Complet list of 1vra hssp fileClick here to see the 3D structure Complete list of 1vra.hssp file
HSSP       HOMOLOGY DERIVED SECONDARY STRUCTURE OF PROTEINS , VERSION 2.0 2011
PDBID      1VRA
THRESHOLD  according to: t(L)=(290.15 * L ** -0.562) + 5
REFERENCE  Sander C., Schneider R. : Database of homology-derived protein structures. Proteins, 9:56-68 (1991).
CONTACT    Maintained at http://www.cmbi.ru.nl/ by Maarten L. Hekkelman 
DATE       file generated on 2014-05-11
HEADER     TRANSFERASE                             17-FEB-05   1VRA
COMPND     MOL_ID: 1; MOLECULE: ARGININE BIOSYNTHESIS BIFUNCTIONAL PROTEIN ARGJ; 
SOURCE     MOL_ID: 1; ORGANISM_SCIENTIFIC: BACILLUS HALODURANS; ORGANISM_TAXID: 8
AUTHOR     JOINT CENTER FOR STRUCTURAL GENOMICS (JCSG)
DBREF      1VRA A    1   196  UNP    Q9K8V3   ARGJ_BACHD       1    196
DBREF      1VRA B  197   411  UNP    Q9K8V3   ARGJ_BACHD     197    411
SEQLENGTH   404
NCHAIN        2 chain(s) in 1VRA data set
NALIGN     4383
NOTATION : ID: EMBL/SWISSPROT identifier of the aligned (homologous) protein
NOTATION : STRID: if the 3-D structure of the aligned protein is known, then STRID is the Protein Data Bank identifier as taken
NOTATION : from the database reference or DR-line of the EMBL/SWISSPROT entry
NOTATION : %IDE: percentage of residue identity of the alignment
NOTATION : %SIM (%WSIM):  (weighted) similarity of the alignment
NOTATION : IFIR/ILAS: first and last residue of the alignment in the test sequence
NOTATION : JFIR/JLAS: first and last residue of the alignment in the alignend protein
NOTATION : LALI: length of the alignment excluding insertions and deletions
NOTATION : NGAP: number of insertions and deletions in the alignment
NOTATION : LGAP: total length of all insertions and deletions
NOTATION : LSEQ2: length of the entire sequence of the aligned protein
NOTATION : ACCNUM: SwissProt accession number
NOTATION : PROTEIN: one-line description of aligned protein
NOTATION : SeqNo,PDBNo,AA,STRUCTURE,BP1,BP2,ACC: sequential and PDB residue numbers, amino acid (lower case = Cys), secondary
NOTATION : structure, bridge partners, solvent exposure as in DSSP (Kabsch and Sander, Biopolymers 22, 2577-2637(1983)
NOTATION : VAR: sequence variability on a scale of 0-100 as derived from the NALIGN alignments
NOTATION : pair of lower case characters (AvaK) in the alignend sequence bracket a point of insertion in this sequence
NOTATION : dots (....) in the alignend sequence indicate points of deletion in this sequence
NOTATION : SEQUENCE PROFILE: relative frequency of an amino acid type at each position. Asx and Glx are in their
NOTATION : acid/amide form in proportion to their database frequencies
NOTATION : NOCC: number of aligned sequences spanning this position (including the test sequence)
NOTATION : NDEL: number of sequences with a deletion in the test protein at this position
NOTATION : NINS: number of sequences with an insertion in the test protein at this position
NOTATION : ENTROPY: entropy measure of sequence variability at this position
NOTATION : RELENT: relative entropy, i.e.  entropy normalized to the range 0-100
NOTATION : WEIGHT: conservation weight

## PROTEINS : identifier and alignment statistics
  NR.    ID         STRID   %IDE %WSIM IFIR ILAS JFIR JLAS LALI NGAP LGAP LSEQ2 ACCNUM     PROTEIN
    1 : ARGJ_BACHD  1VRA    0.97  0.97    1  191    6  196  191    0    0  411  Q9K8V3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125) GN=argJ PE=1 SV=1
    2 : J8T7C3_BACAO        0.77  0.89  193  405  198  409  213    1    1  411  J8T7C3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus alcalophilus ATCC 27647 GN=argJ PE=3 SV=1
    3 : D3FVI8_BACPE        0.75  0.88  193  405  209  421  213    0    0  423  D3FVI8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus pseudofirmus (strain OF4) GN=argJ PE=3 SV=1
    4 : W4QGJ0_9BACI        0.74  0.86  193  405  196  408  213    0    0  410  W4QGJ0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus hemicellulosilyticus JCM 9152 GN=argJ PE=3 SV=1
    5 : ARGJ_GEOKA          0.70  0.84  193  405  197  408  213    1    1  410  Q5L1V4     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus kaustophilus (strain HTA426) GN=argJ PE=3 SV=1
    6 : S7TZ45_9BACI        0.70  0.84  193  405  204  415  213    1    1  417  S7TZ45     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. WSUCF1 GN=argJ PE=3 SV=1
    7 : A4IL47_GEOTN        0.69  0.83  193  405  197  408  213    1    1  410  A4IL47     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus thermodenitrificans (strain NG80-2) GN=argJ PE=3 SV=1
    8 : B4BII6_9BACI        0.69  0.83  193  405  197  408  213    1    1  410  B4BII6     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. G11MC16 GN=argJ PE=3 SV=1
    9 : C5D765_GEOSW        0.69  0.83  193  405  200  411  213    1    1  413  C5D765     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. (strain WCH70) GN=argJ PE=3 SV=1
   10 : C9RY09_GEOSY        0.69  0.84  193  405  197  408  213    1    1  410  C9RY09     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. (strain Y412MC61) GN=argJ PE=3 SV=1
   11 : D7D1T1_GEOSC        0.69  0.84  193  405  197  408  213    1    1  410  D7D1T1     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. (strain C56-T3) GN=argJ PE=3 SV=1
   12 : S6A0G2_9BACI        0.69  0.82  193  405  197  408  213    1    1  410  S6A0G2     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. JF8 GN=argJ PE=3 SV=1
   13 : T0Q945_9BACI        0.69  0.84  193  405  197  408  213    1    1  410  T0Q945     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. A8 GN=argJ PE=3 SV=1
   14 : U2YD56_GEOKU        0.69  0.84  193  405  197  408  213    1    1  410  U2YD56     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus kaustophilus GBlys GN=argJ PE=3 SV=1
   15 : V6VC03_9BACI        0.69  0.84  193  405  197  408  213    1    1  410  V6VC03     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. MAS1 GN=argJ PE=3 SV=1
   16 : E3ID60_GEOS0        0.67  0.83  193  405  200  411  213    1    1  413  E3ID60     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. (strain Y4.1MC1) GN=argJ PE=3 SV=1
   17 : F8CZQ9_GEOTC        0.67  0.83  193  405  200  411  213    1    1  413  F8CZQ9     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus thermoglucosidasius (strain C56-YS93) GN=argJ PE=3 SV=1
   18 : M8D7B7_9BACI        0.67  0.81  193  405  194  405  213    1    1  407  M8D7B7     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus flavithermus AK1 GN=argJ PE=3 SV=1
   19 : T0BDK0_9BACI        0.67  0.81  193  405  195  406  213    1    1  408  T0BDK0     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus sp. SK3-4 GN=argJ PE=3 SV=1
   20 : W7YYE0_9BACI        0.67  0.79  193  405  195  407  213    0    0  409  W7YYE0     Glutamate N-acetyltransferase OS=Bacillus sp. JCM 19045 GN=JCM19045_2819 PE=4 SV=1
   21 : M5JF48_9BACI        0.66  0.81  193  405  195  406  213    1    1  408  M5JF48     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus flavithermus TNO-09.006 GN=argJ PE=3 SV=1
   22 : Q2B923_9BACI        0.66  0.81  193  405  197  408  213    1    1  410  Q2B923     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. NRRL B-14911 GN=argJ PE=3 SV=1
   23 : U5L9X3_9BACI        0.66  0.81  193  405  197  408  213    1    1  410  U5L9X3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus infantis NRRL B-14911 GN=argJ PE=3 SV=1
   24 : W4QVU0_BACA3        0.66  0.85    1  191    6  196  191    0    0  411  W4QVU0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus akibai JCM 9157 GN=argJ PE=3 SV=1
   25 : B7GM07_ANOFW        0.65  0.80  193  405  195  406  213    1    1  408  B7GM07     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus flavithermus (strain DSM 21510 / WK1) GN=argJ PE=3 SV=1
   26 : C2SPT1_BACCE        0.65  0.78  193  405  194  405  213    1    1  407  C2SPT1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BDRD-ST196 GN=argJ PE=3 SV=1
   27 : D3FVI8_BACPE        0.65  0.82    1  191   18  208  191    0    0  423  D3FVI8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus pseudofirmus (strain OF4) GN=argJ PE=3 SV=1
   28 : G2RMG2_BACME        0.65  0.85  193  405   95  306  213    1    1  308  G2RMG2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus megaterium WSH-002 GN=argJ PE=3 SV=1
   29 : J8P0U8_BACCE        0.65  0.78  193  405  194  405  213    1    1  407  J8P0U8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VDM022 GN=argJ PE=3 SV=1
   30 : J9AAR5_BACCE        0.65  0.78  193  405  194  405  213    1    1  407  J9AAR5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BtB2-4 GN=argJ PE=3 SV=1
   31 : R4G5Z7_9BACI        0.65  0.81  193  405  191  402  213    1    1  404  R4G5Z7     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus flavithermus NBRC 109594 GN=argJ PE=3 SV=1
   32 : R8ENA4_BACCE        0.65  0.78  193  405  194  405  213    1    1  407  R8ENA4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VDM019 GN=argJ PE=3 SV=1
   33 : U6SP53_9BACI        0.65  0.82    1  191    6  196  191    0    0  411  U6SP53     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus marmarensis DSM 21297 GN=argJ PE=3 SV=1
   34 : W4Q0J9_9BACI        0.65  0.86    1  191    6  196  191    0    0  411  W4Q0J9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus wakoensis JCM 9140 GN=argJ PE=3 SV=1
   35 : W4QGJ0_9BACI        0.65  0.84    2  191    6  195  190    0    0  410  W4QGJ0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus hemicellulosilyticus JCM 9152 GN=argJ PE=3 SV=1
   36 : W4R5Z7_9BACI        0.65  0.78  193  405  194  405  213    1    1  407  W4R5Z7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus weihenstephanensis NBRC 101238 = DSM 11821 GN=argJ PE=3 SV=1
   37 : C2Q0I2_BACCE        0.64  0.78  193  405  194  405  213    1    1  407  C2Q0I2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AH621 GN=argJ PE=3 SV=1
   38 : C2V057_BACCE        0.64  0.77  193  405  195  406  213    1    1  408  C2V057     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock3-28 GN=argJ PE=3 SV=1
   39 : C2X2M8_BACCE        0.64  0.77  193  405  195  406  213    1    1  408  C2X2M8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock4-18 GN=argJ PE=3 SV=1
   40 : C3AAH5_BACMY        0.64  0.77  193  405  194  405  213    1    1  407  C3AAH5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus mycoides DSM 2048 GN=argJ PE=3 SV=1
   41 : E5WE80_9BACI        0.64  0.80  193  405  196  407  214    2    3  409  E5WE80     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. 2_A_57_CT2 GN=argJ PE=3 SV=1
   42 : J8A1F7_BACCE        0.64  0.77  193  405  194  405  213    1    1  407  J8A1F7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG5O-1 GN=argJ PE=3 SV=1
   43 : J8AD96_BACCE        0.64  0.77  193  405  194  405  213    1    1  407  J8AD96     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuB4-10 GN=argJ PE=3 SV=1
   44 : J8DNL5_BACCE        0.64  0.77  193  405  194  405  213    1    1  407  J8DNL5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuB5-5 GN=argJ PE=3 SV=1
   45 : J8QVP4_BACCE        0.64  0.77  193  405  194  405  213    1    1  407  J8QVP4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1O-2 GN=argJ PE=3 SV=1
   46 : J8SXJ5_BACCE        0.64  0.77  193  405  194  405  213    1    1  407  J8SXJ5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG2X1-3 GN=argJ PE=3 SV=1
   47 : J8YFC2_BACCE        0.64  0.78  193  405  195  406  213    1    1  408  J8YFC2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuA2-1 GN=argJ PE=3 SV=1
   48 : J8ZJ69_BACCE        0.64  0.77  193  405  194  405  213    1    1  407  J8ZJ69     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG4X2-1 GN=argJ PE=3 SV=1
   49 : J9APS7_BACCE        0.64  0.77  193  405  194  405  213    1    1  407  J9APS7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG6O-2 GN=argJ PE=3 SV=1
   50 : J9CWK2_BACCE        0.64  0.77  193  405  194  405  213    1    1  407  J9CWK2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuB2-9 GN=argJ PE=3 SV=1
   51 : K0FY34_BACTU        0.64  0.77  193  405  195  406  213    1    1  408  K0FY34     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis MC28 GN=argJ PE=3 SV=1
   52 : R8LT30_BACCE        0.64  0.77  193  405  194  405  213    1    1  407  R8LT30     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuA2-3 GN=argJ PE=3 SV=1
   53 : R8Q548_BACCE        0.64  0.77  193  405  194  405  213    1    1  407  R8Q548     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD118 GN=argJ PE=3 SV=1
   54 : U5ZQX0_9BACI        0.64  0.77  193  405  194  405  213    1    1  407  U5ZQX0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus toyonensis BCT-7112 GN=argJ PE=3 SV=1
   55 : C2ZU07_BACCE        0.63  0.77  193  405  195  406  213    1    1  408  C2ZU07     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AH1273 GN=argJ PE=3 SV=1
   56 : J8BXE3_BACCE        0.63  0.76  193  405  194  405  213    1    1  407  J8BXE3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus MC67 GN=argJ PE=3 SV=1
   57 : J8E5T1_BACCE        0.63  0.78  193  405  194  405  213    1    1  407  J8E5T1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuA4-10 GN=argJ PE=3 SV=1
   58 : J8GWF8_BACCE        0.63  0.77  193  405  194  405  213    1    1  407  J8GWF8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD014 GN=argJ PE=3 SV=1
   59 : J8MEF6_BACCE        0.63  0.77  193  405  194  405  213    1    1  407  J8MEF6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD156 GN=argJ PE=3 SV=1
   60 : J8REG8_BACCE        0.63  0.77  193  405  194  405  213    1    1  407  J8REG8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1X1-3 GN=argJ PE=3 SV=1
   61 : J8SJD9_BACCE        0.63  0.77  193  405  194  405  213    1    1  407  J8SJD9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG2X1-1 GN=argJ PE=3 SV=1
   62 : K9A6E8_9BACI        0.63  0.78  193  405  197  408  213    1    1  410  K9A6E8     Arginine biosynthesis bifunctional protein ArgJ OS=Lysinibacillus fusiformis ZB2 GN=argJ PE=3 SV=1
   63 : R8HHY8_BACCE        0.63  0.77  193  405  194  405  213    1    1  407  R8HHY8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1O-1 GN=argJ PE=3 SV=1
   64 : R9BY32_9BACI        0.63  0.79  193  405  201  412  213    1    1  414  R9BY32     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus nealsonii AAU1 GN=argJ PE=3 SV=1
   65 : T2LZ23_9BACL        0.63  0.78  193  405  203  414  213    1    1  416  T2LZ23     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. P22 GN=argJ PE=3 SV=1
   66 : W4DT49_9BACI        0.63  0.77  193  405  194  405  213    1    1  407  W4DT49     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus weihenstephanensis FSL H7-687 GN=argJ PE=3 SV=1
   67 : W7S1F8_LYSSH        0.63  0.77  193  405  209  420  213    1    1  422  W7S1F8     N-acetylglutamate synthase OS=Lysinibacillus sphaericus CBAM5 GN=P799_16110 PE=4 SV=1
   68 : A4IL47_GEOTN        0.62  0.77    1  191    6  196  191    0    0  410  A4IL47     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus thermodenitrificans (strain NG80-2) GN=argJ PE=3 SV=1
   69 : ARGJ_BACAN          0.62  0.80    1  191    3  193  191    0    0  407  Q81M96     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis GN=argJ PE=3 SV=1
   70 : ARGJ_BACAN          0.62  0.77  193  405  194  405  213    1    1  407  Q81M96     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis GN=argJ PE=3 SV=1
   71 : ARGJ_BACCZ          0.62  0.80    1  191    4  194  191    0    0  408  Q635F1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain ZK / E33L) GN=argJ PE=3 SV=1
   72 : ARGJ_BACCZ          0.62  0.77  193  405  195  406  213    1    1  408  Q635F1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain ZK / E33L) GN=argJ PE=3 SV=1
   73 : B0ASS4_BACAN        0.62  0.80    1  191    3  193  191    0    0  407  B0ASS4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A0488 GN=argJ PE=3 SV=1
   74 : B0Q344_BACAN        0.62  0.77  193  405  194  405  213    1    1  407  B0Q344     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A0193 GN=argJ PE=3 SV=1
   75 : B0Q344_BACAN        0.62  0.80    1  191    3  193  191    0    0  407  B0Q344     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A0193 GN=argJ PE=3 SV=1
   76 : B0QH43_BACAN        0.62  0.80    1  191    3  193  191    0    0  406  B0QH43     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A0442 GN=argJ PE=3 SV=1
   77 : B1EWQ4_BACAN        0.62  0.80    1  191    3  193  191    0    0  407  B1EWQ4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A0389 GN=argJ PE=3 SV=1
   78 : B1GIN2_BACAN        0.62  0.80    1  191    3  193  191    0    0  407  B1GIN2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A0465 GN=argJ PE=3 SV=1
   79 : B1US01_BACAN        0.62  0.80    1  191    3  193  191    0    0  407  B1US01     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A0174 GN=argJ PE=3 SV=1
   80 : B1US01_BACAN        0.62  0.77  193  405  194  405  213    1    1  407  B1US01     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A0174 GN=argJ PE=3 SV=1
   81 : B3J2X6_BACAN        0.62  0.80    1  191    3  193  191    0    0  407  B3J2X6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. Tsiankovskii-I GN=argJ PE=3 SV=1
   82 : B3YVY7_BACCE        0.62  0.80    1  191    3  193  191    0    0  407  B3YVY7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus W GN=argJ PE=3 SV=1
   83 : B3Z664_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  B3Z664     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus NVH0597-99 GN=argJ PE=3 SV=1
   84 : B5V759_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  B5V759     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus H3081.97 GN=argJ PE=3 SV=1
   85 : B7HB03_BACC4        0.62  0.77  193  405  194  405  213    1    1  407  B7HB03     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain B4264) GN=argJ PE=3 SV=1
   86 : B7IWP5_BACC2        0.62  0.77  193  405  194  405  213    1    1  407  B7IWP5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain G9842) GN=argJ PE=3 SV=1
   87 : B7JLY6_BACC0        0.62  0.77  193  405  194  405  213    1    1  407  B7JLY6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain AH820) GN=argJ PE=3 SV=1
   88 : B7JLY6_BACC0        0.62  0.80    1  191    3  193  191    0    0  407  B7JLY6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain AH820) GN=argJ PE=3 SV=1
   89 : C1ER05_BACC3        0.62  0.77  193  405  194  405  213    1    1  407  C1ER05     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain 03BB102) GN=argJ PE=3 SV=1
   90 : C2N606_BACCE        0.62  0.78  193  405  195  406  213    1    1  408  C2N606     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus ATCC 10876 GN=argJ PE=3 SV=1
   91 : C2P3C9_BACCE        0.62  0.77  193  405  195  406  213    1    1  408  C2P3C9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus 172560W GN=argJ PE=3 SV=1
   92 : C2PJU9_BACCE        0.62  0.77  193  405  195  406  213    1    1  408  C2PJU9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus MM3 GN=argJ PE=3 SV=1
   93 : C2QXV8_BACCE        0.62  0.77  193  405  195  406  213    1    1  408  C2QXV8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus ATCC 4342 GN=argJ PE=3 SV=1
   94 : C2RST5_BACCE        0.62  0.78  193  405  195  406  213    1    1  408  C2RST5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BDRD-ST24 GN=argJ PE=3 SV=1
   95 : C2T5N7_BACCE        0.62  0.77  193  405  195  406  213    1    1  408  C2T5N7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BDRD-Cer4 GN=argJ PE=3 SV=1
   96 : C2TL31_BACCE        0.62  0.80    1  191    4  194  191    0    0  408  C2TL31     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus 95/8201 GN=argJ PE=3 SV=1
   97 : C2U291_BACCE        0.62  0.79    1  191    4  194  191    0    0  408  C2U291     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock1-3 GN=argJ PE=3 SV=1
   98 : C2UIE1_BACCE        0.62  0.77  193  405  195  406  213    1    1  408  C2UIE1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock1-15 GN=argJ PE=3 SV=1
   99 : C2UIE1_BACCE        0.62  0.80    1  191    4  194  191    0    0  408  C2UIE1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock1-15 GN=argJ PE=3 SV=1
  100 : C2V057_BACCE        0.62  0.79    1  191    4  194  191    0    0  408  C2V057     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock3-28 GN=argJ PE=3 SV=1
  101 : C2VGJ7_BACCE        0.62  0.79    1  191    4  194  191    0    0  408  C2VGJ7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock3-29 GN=argJ PE=3 SV=1
  102 : C2VYE7_BACCE        0.62  0.77  193  405  195  406  213    1    1  408  C2VYE7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock3-42 GN=argJ PE=3 SV=1
  103 : C2WSF6_BACCE        0.62  0.78  193  405  195  406  213    1    1  408  C2WSF6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock4-2 GN=argJ PE=3 SV=1
  104 : C2X2M8_BACCE        0.62  0.80    1  191    4  194  191    0    0  408  C2X2M8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock4-18 GN=argJ PE=3 SV=1
  105 : C2YF29_BACCE        0.62  0.77  193  405  195  406  213    1    1  408  C2YF29     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AH676 GN=argJ PE=3 SV=1
  106 : C2YW70_BACCE        0.62  0.79    1  191    4  194  191    0    0  408  C2YW70     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AH1271 GN=argJ PE=3 SV=1
  107 : C3C7Q7_BACTU        0.62  0.77  193  405  195  406  213    1    1  408  C3C7Q7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar tochigiensis BGSC 4Y1 GN=argJ PE=3 SV=1
  108 : C3CNQ6_BACTU        0.62  0.77  193  405  195  406  213    1    1  408  C3CNQ6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis Bt407 GN=argJ PE=3 SV=1
  109 : C3E874_BACTU        0.62  0.80    1  191    4  194  191    0    0  408  C3E874     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar pakistani str. T13001 GN=argJ PE=3 SV=1
  110 : C3EQ99_BACTK        0.62  0.78  193  405  192  403  213    1    1  405  C3EQ99     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar kurstaki str. T03a001 GN=argJ PE=3 SV=1
  111 : C3F6G1_BACTU        0.62  0.80    1  191    4  194  191    0    0  408  C3F6G1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar monterrey BGSC 4AJ1 GN=argJ PE=3 SV=1
  112 : C3FQ32_BACTB        0.62  0.77  193  405  195  406  213    1    1  408  C3FQ32     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar berliner ATCC 10792 GN=argJ PE=3 SV=1
  113 : C3G7U6_BACTU        0.62  0.77  193  405  195  406  213    1    1  408  C3G7U6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar andalousiensis BGSC 4AW1 GN=argJ PE=3 SV=1
  114 : C3G7U6_BACTU        0.62  0.80    1  191    4  194  191    0    0  408  C3G7U6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar andalousiensis BGSC 4AW1 GN=argJ PE=3 SV=1
  115 : C3GNS8_BACTU        0.62  0.80    1  191    4  194  191    0    0  408  C3GNS8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar pondicheriensis BGSC 4BA1 GN=argJ PE=3 SV=1
  116 : C3HN58_BACTU        0.62  0.77  193  405  195  406  213    1    1  408  C3HN58     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar pulsiensis BGSC 4CC1 GN=argJ PE=3 SV=1
  117 : C3I5T1_BACTU        0.62  0.77  193  405  195  406  213    1    1  408  C3I5T1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis IBL 200 GN=argJ PE=3 SV=1
  118 : C3INT3_BACTU        0.62  0.77  193  405  195  406  213    1    1  408  C3INT3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis IBL 4222 GN=argJ PE=3 SV=1
  119 : C3LJQ8_BACAC        0.62  0.80    1  191    3  193  191    0    0  407  C3LJQ8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis (strain CDC 684 / NRRL 3495) GN=argJ PE=3 SV=1
  120 : C3LJQ8_BACAC        0.62  0.77  193  405  194  405  213    1    1  407  C3LJQ8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis (strain CDC 684 / NRRL 3495) GN=argJ PE=3 SV=1
  121 : C3P7R7_BACAA        0.62  0.77  193  405  194  405  213    1    1  407  C3P7R7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis (strain A0248) GN=argJ PE=3 SV=1
  122 : C3P7R7_BACAA        0.62  0.80    1  191    3  193  191    0    0  407  C3P7R7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis (strain A0248) GN=argJ PE=3 SV=1
  123 : C6D4V0_PAESJ        0.62  0.75  193  405  201  412  213    1    1  414  C6D4V0     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. (strain JDR-2) GN=argJ PE=3 SV=1
  124 : D3EMD1_GEOS4        0.62  0.77  193  405  195  406  213    1    1  408  D3EMD1     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. (strain Y412MC10) GN=argJ PE=3 SV=1
  125 : D8H9Q2_BACAI        0.62  0.77  193  405  195  406  213    1    1  408  D8H9Q2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus var. anthracis (strain CI) GN=argJ PE=3 SV=1
  126 : D8H9Q2_BACAI        0.62  0.80    1  191    4  194  191    0    0  408  D8H9Q2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus var. anthracis (strain CI) GN=argJ PE=3 SV=1
  127 : F2F8U4_SOLSS        0.62  0.77  193  405  194  405  213    1    1  407  F2F8U4     Arginine biosynthesis bifunctional protein ArgJ OS=Solibacillus silvestris (strain StLB046) GN=argJ PE=3 SV=1
  128 : G8U941_BACCE        0.62  0.77  193  405  195  406  213    1    1  408  G8U941     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus F837/76 GN=argJ PE=3 SV=1
  129 : G9Q238_9BACI        0.62  0.78  193  405  194  405  213    1    1  407  G9Q238     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. 7_6_55CFAA_CT2 GN=argJ PE=3 SV=1
  130 : H0NTY8_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  H0NTY8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus NC7401 GN=argJ PE=3 SV=1
  131 : H3S9R2_9BACL        0.62  0.76  193  405  204  415  213    1    1  417  H3S9R2     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus dendritiformis C454 GN=argJ PE=3 SV=1
  132 : I0D7F8_BACAN        0.62  0.80    1  191    4  194  191    0    0  408  I0D7F8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. H9401 GN=argJ PE=3 SV=1
  133 : I0UE36_BACLI        0.62  0.78  193  405  193  404  213    1    1  406  I0UE36     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus licheniformis WX-02 GN=argJ PE=3 SV=1
  134 : J3X5C2_BACTU        0.62  0.77  193  405  194  405  213    1    1  407  J3X5C2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis HD-771 GN=argJ PE=3 SV=1
  135 : J4TQY9_BACAN        0.62  0.80    1  191    3  193  191    0    0  407  J4TQY9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. UR-1 GN=argJ PE=3 SV=1
  136 : J7EDC9_BACAN        0.62  0.80    1  191    3  193  191    0    0  407  J7EDC9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. BF1 GN=argJ PE=3 SV=1
  137 : J7EDC9_BACAN        0.62  0.77  193  405  194  405  213    1    1  407  J7EDC9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. BF1 GN=argJ PE=3 SV=1
  138 : J7U7J3_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  J7U7J3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AND1407 GN=argJ PE=3 SV=1
  139 : J8A1F7_BACCE        0.62  0.79    1  191    3  193  191    0    0  407  J8A1F7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG5O-1 GN=argJ PE=3 SV=1
  140 : J8AD96_BACCE        0.62  0.79    1  191    3  193  191    0    0  407  J8AD96     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuB4-10 GN=argJ PE=3 SV=1
  141 : J8BJY2_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  J8BJY2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG5X2-1 GN=argJ PE=3 SV=1
  142 : J8BSD8_BACCE        0.62  0.80    1  191    3  193  191    0    0  407  J8BSD8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus ISP3191 GN=argJ PE=3 SV=1
  143 : J8DLF6_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  J8DLF6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus MSX-D12 GN=argJ PE=3 SV=1
  144 : J8DNL5_BACCE        0.62  0.79    1  191    3  193  191    0    0  407  J8DNL5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuB5-5 GN=argJ PE=3 SV=1
  145 : J8ILA4_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  J8ILA4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD045 GN=argJ PE=3 SV=1
  146 : J8JKX3_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  J8JKX3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD102 GN=argJ PE=3 SV=1
  147 : J8JL07_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  J8JL07     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD107 GN=argJ PE=3 SV=1
  148 : J8KLZ2_BACCE        0.62  0.80    1  191    3  193  191    0    0  407  J8KLZ2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD154 GN=argJ PE=3 SV=1
  149 : J8KSH6_BACCE        0.62  0.80    1  191    3  193  191    0    0  407  J8KSH6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD115 GN=argJ PE=3 SV=1
  150 : J8KSY9_BACCE        0.62  0.79    1  191    3  193  191    0    0  407  J8KSY9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD148 GN=argJ PE=3 SV=1
  151 : J8LWD4_BACCE        0.62  0.80    1  191    3  193  191    0    0  407  J8LWD4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD166 GN=argJ PE=3 SV=1
  152 : J8MG26_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  J8MG26     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1X1-2 GN=argJ PE=3 SV=1
  153 : J8MM98_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  J8MM98     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD169 GN=argJ PE=3 SV=1
  154 : J8NXQ1_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  J8NXQ1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG2X1-2 GN=argJ PE=3 SV=1
  155 : J8QVP4_BACCE        0.62  0.79    1  191    3  193  191    0    0  407  J8QVP4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1O-2 GN=argJ PE=3 SV=1
  156 : J8SJD9_BACCE        0.62  0.80    1  191    3  193  191    0    0  407  J8SJD9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG2X1-1 GN=argJ PE=3 SV=1
  157 : J8T7C3_BACAO        0.62  0.80    1  191    7  197  191    0    0  411  J8T7C3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus alcalophilus ATCC 27647 GN=argJ PE=3 SV=1
  158 : J8ZD62_BACCE        0.62  0.79    1  191    3  193  191    0    0  407  J8ZD62     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG6O-1 GN=argJ PE=3 SV=1
  159 : J8ZJ69_BACCE        0.62  0.79    1  191    3  193  191    0    0  407  J8ZJ69     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG4X2-1 GN=argJ PE=3 SV=1
  160 : J9BXN4_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  J9BXN4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuB1-1 GN=argJ PE=3 SV=1
  161 : J9CI49_BACCE        0.62  0.78  193  405  191  402  213    1    1  404  J9CI49     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HD73 GN=argJ PE=3 SV=1
  162 : J9CWK2_BACCE        0.62  0.79    1  191    3  193  191    0    0  407  J9CWK2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuB2-9 GN=argJ PE=3 SV=1
  163 : K0FY34_BACTU        0.62  0.79    1  191    4  194  191    0    0  408  K0FY34     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis MC28 GN=argJ PE=3 SV=1
  164 : K1KVH5_9BACI        0.62  0.78  193  405  194  405  213    1    1  407  K1KVH5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus isronensis B3W22 GN=argJ PE=3 SV=1
  165 : K4MDR6_BACTU        0.62  0.77  193  405  194  405  213    1    1  407  K4MDR6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis Bt407 GN=argJ PE=3 SV=1
  166 : M1QKJ2_BACTU        0.62  0.77  193  405  194  405  213    1    1  407  M1QKJ2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar thuringiensis str. IS5056 GN=argJ PE=3 SV=1
  167 : M4LAN1_BACTK        0.62  0.78  193  405  191  402  213    1    1  404  M4LAN1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar kurstaki str. HD73 GN=argJ PE=3 SV=1
  168 : Q4MMY3_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  Q4MMY3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus G9241 GN=argJ PE=3 SV=1
  169 : R8CE85_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  R8CE85     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus str. Schrouff GN=argJ PE=3 SV=1
  170 : R8DZW8_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  R8DZW8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD133 GN=argJ PE=3 SV=1
  171 : R8IX60_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  R8IX60     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus K-5975c GN=argJ PE=3 SV=1
  172 : R8JP97_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  R8JP97     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus IS195 GN=argJ PE=3 SV=1
  173 : R8LDY7_BACCE        0.62  0.78  193  405  191  402  213    1    1  404  R8LDY7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuB13-1 GN=argJ PE=3 SV=1
  174 : R8LK65_BACCE        0.62  0.80    1  191    3  193  191    0    0  407  R8LK65     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD131 GN=argJ PE=3 SV=1
  175 : R8LT30_BACCE        0.62  0.79    1  191    3  193  191    0    0  407  R8LT30     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuA2-3 GN=argJ PE=3 SV=1
  176 : R8MXG4_BACCE        0.62  0.79    1  191    3  193  191    0    0  407  R8MXG4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD214 GN=argJ PE=3 SV=1
  177 : R8SD36_BACCE        0.62  0.78  193  405  194  405  213    1    1  407  R8SD36     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD140 GN=argJ PE=3 SV=1
  178 : R8SR11_BACCE        0.62  0.78  193  405  191  402  213    1    1  404  R8SR11     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BMG1.7 GN=argJ PE=3 SV=1
  179 : R8YL60_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  R8YL60     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus TIAC219 GN=argJ PE=3 SV=1
  180 : R9TS15_BACLI        0.62  0.78  193  405  193  404  213    1    1  406  R9TS15     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus licheniformis 9945A GN=argJ PE=3 SV=1
  181 : S3IP60_BACCE        0.62  0.77  193  405  194  405  213    1    1  407  S3IP60     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1O-3 GN=argJ PE=3 SV=1
  182 : S3IVE0_BACCE        0.62  0.79    1  191    3  193  191    0    0  407  S3IVE0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG2O-2 GN=argJ PE=3 SV=1
  183 : S9SQB5_PAEAL        0.62  0.77  193  405  202  413  213    1    1  415  S9SQB5     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus alvei TS-15 GN=argJ PE=3 SV=1
  184 : U5ZQX0_9BACI        0.62  0.79    1  191    3  193  191    0    0  407  U5ZQX0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus toyonensis BCT-7112 GN=argJ PE=3 SV=1
  185 : V5MHM9_BACTU        0.62  0.77  193  405  194  405  213    1    1  407  V5MHM9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis YBT-1518 GN=argJ PE=3 SV=1
  186 : V6T2F6_9BACI        0.62  0.77  193  405  198  409  213    1    1  411  V6T2F6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. 17376 GN=argJ PE=3 SV=1
  187 : V6VC03_9BACI        0.62  0.78    1  191    6  196  191    0    0  410  V6VC03     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. MAS1 GN=argJ PE=3 SV=1
  188 : V8PY27_BACTA        0.62  0.78  193  405  191  402  213    1    1  404  V8PY27     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar aizawai str. Hu4-2 GN=argJ PE=3 SV=1
  189 : V9GGK8_9BACL        0.62  0.76  193  405  195  406  213    1    1  408  V9GGK8     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. JCM 10914 GN=argJ PE=3 SV=1
  190 : W0CLD7_BACAN        0.62  0.80    1  191    3  193  191    0    0  407  W0CLD7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A16R GN=argJ PE=3 SV=1
  191 : W0CLD7_BACAN        0.62  0.77  193  405  194  405  213    1    1  407  W0CLD7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A16R GN=argJ PE=3 SV=1
  192 : W0CZ54_BACAN        0.62  0.77  193  405  194  405  213    1    1  407  W0CZ54     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A16 GN=argJ PE=3 SV=1
  193 : W0CZ54_BACAN        0.62  0.80    1  191    3  193  191    0    0  407  W0CZ54     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A16 GN=argJ PE=3 SV=1
  194 : W4DHI4_9BACL        0.62  0.77  193  405  195  406  213    1    1  408  W4DHI4     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. FSL H8-457 GN=argJ PE=3 SV=1
  195 : W4RNN4_9BACI        0.62  0.77  193  405  169  380  213    1    1  382  W4RNN4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus boroniphilus JCM 21738 GN=argJ PE=3 SV=1
  196 : W7GHW0_BACAN        0.62  0.77  193  405  195  406  213    1    1  408  W7GHW0     N-acetylglutamate synthase OS=Bacillus anthracis 8903-G GN=U368_21235 PE=4 SV=1
  197 : W7GHW0_BACAN        0.62  0.80    1  191    4  194  191    0    0  408  W7GHW0     N-acetylglutamate synthase OS=Bacillus anthracis 8903-G GN=U368_21235 PE=4 SV=1
  198 : W7HAT3_BACAN        0.62  0.80    1  191    4  194  191    0    0  408  W7HAT3     N-acetylglutamate synthase OS=Bacillus anthracis 9080-G GN=U365_19200 PE=4 SV=1
  199 : W7HAT3_BACAN        0.62  0.77  193  405  195  406  213    1    1  408  W7HAT3     N-acetylglutamate synthase OS=Bacillus anthracis 9080-G GN=U365_19200 PE=4 SV=1
  200 : W7HHH3_BACAN        0.62  0.77  193  405  195  406  213    1    1  408  W7HHH3     N-acetylglutamate synthase OS=Bacillus anthracis 52-G GN=U369_21420 PE=4 SV=1
  201 : W7HHH3_BACAN        0.62  0.80    1  191    4  194  191    0    0  408  W7HHH3     N-acetylglutamate synthase OS=Bacillus anthracis 52-G GN=U369_21420 PE=4 SV=1
  202 : W7LBL6_BACFI        0.62  0.79  193  405  196  407  214    2    3  409  W7LBL6     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Bacillus firmus DS1 GN=argJ PE=4 SV=1
  203 : W7XXA6_BACAN        0.62  0.80    1  191    3  193  191    0    0  407  W7XXA6     Glutamate N-acetyltransferase OS=Bacillus anthracis CZC5 GN=BAZ_4207 PE=4 SV=1
  204 : W7ZQY9_9BACI        0.62  0.78  193  405  195  407  213    0    0  409  W7ZQY9     Glutamate N-acetyltransferase OS=Bacillus sp. JCM 19047 GN=JCM19047_2168 PE=4 SV=1
  205 : A0RID1_BACAH        0.61  0.79    1  191    4  194  191    0    0  408  A0RID1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis (strain Al Hakam) GN=argJ PE=3 SV=1
  206 : ARGJ_BACC1          0.61  0.78    1  191    3  193  191    0    0  407  P62057     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain ATCC 10987) GN=argJ PE=3 SV=1
  207 : ARGJ_BACLD          0.61  0.77  193  405  193  404  213    1    1  406  Q65LE9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus licheniformis (strain DSM 13 / ATCC 14580) GN=argJ PE=3 SV=1
  208 : ARGJ_GEOKA          0.61  0.78    1  191    6  196  191    0    0  410  Q5L1V4     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus kaustophilus (strain HTA426) GN=argJ PE=3 SV=1
  209 : B3Z664_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  B3Z664     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus NVH0597-99 GN=argJ PE=3 SV=1
  210 : B3ZVK9_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  B3ZVK9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus 03BB108 GN=argJ PE=3 SV=1
  211 : B4BII6_9BACI        0.61  0.76    1  191    6  196  191    0    0  410  B4BII6     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. G11MC16 GN=argJ PE=3 SV=1
  212 : B5UST1_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  B5UST1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AH1134 GN=argJ PE=3 SV=1
  213 : B5V759_BACCE        0.61  0.80    1  191    3  193  191    0    0  407  B5V759     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus H3081.97 GN=argJ PE=3 SV=1
  214 : B7HB03_BACC4        0.61  0.79    1  191    3  193  191    0    0  407  B7HB03     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain B4264) GN=argJ PE=3 SV=1
  215 : B7IWP5_BACC2        0.61  0.79    1  191    3  193  191    0    0  407  B7IWP5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain G9842) GN=argJ PE=3 SV=1
  216 : C1ER05_BACC3        0.61  0.79    1  191    3  193  191    0    0  407  C1ER05     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain 03BB102) GN=argJ PE=3 SV=1
  217 : C2MQC3_BACCE        0.61  0.80    1  191    4  194  191    0    0  408  C2MQC3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus m1293 GN=argJ PE=3 SV=1
  218 : C2N606_BACCE        0.61  0.79    1  191    4  194  191    0    0  408  C2N606     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus ATCC 10876 GN=argJ PE=3 SV=1
  219 : C2NMI8_BACCE        0.61  0.78    1  191    4  194  191    0    0  408  C2NMI8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BGSC 6E1 GN=argJ PE=3 SV=1
  220 : C2P3C9_BACCE        0.61  0.79    1  191    4  194  191    0    0  408  C2P3C9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus 172560W GN=argJ PE=3 SV=1
  221 : C2QGR8_BACCE        0.61  0.74  193  405  195  406  213    1    1  408  C2QGR8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus R309803 GN=argJ PE=3 SV=1
  222 : C2QGR8_BACCE        0.61  0.80    1  191    4  194  191    0    0  408  C2QGR8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus R309803 GN=argJ PE=3 SV=1
  223 : C2RST5_BACCE        0.61  0.79    1  191    4  194  191    0    0  408  C2RST5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BDRD-ST24 GN=argJ PE=3 SV=1
  224 : C2VYE7_BACCE        0.61  0.79    1  191    4  194  191    0    0  408  C2VYE7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock3-42 GN=argJ PE=3 SV=1
  225 : C2WSF6_BACCE        0.61  0.79    1  191    4  194  191    0    0  408  C2WSF6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock4-2 GN=argJ PE=3 SV=1
  226 : C2XGE3_BACCE        0.61  0.79    1  191    4  194  191    0    0  408  C2XGE3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus F65185 GN=argJ PE=3 SV=1
  227 : C2YF29_BACCE        0.61  0.79    1  191    4  194  191    0    0  408  C2YF29     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AH676 GN=argJ PE=3 SV=1
  228 : C2ZCH8_BACCE        0.61  0.79    1  191    4  194  191    0    0  408  C2ZCH8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AH1272 GN=argJ PE=3 SV=1
  229 : C2ZU07_BACCE        0.61  0.79    1  191    4  194  191    0    0  408  C2ZU07     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AH1273 GN=argJ PE=3 SV=1
  230 : C3CNQ6_BACTU        0.61  0.79    1  191    4  194  191    0    0  408  C3CNQ6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis Bt407 GN=argJ PE=3 SV=1
  231 : C3D6Q1_BACTU        0.61  0.79    1  191    4  194  191    0    0  408  C3D6Q1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar thuringiensis str. T01001 GN=argJ PE=3 SV=1
  232 : C3DPR7_BACTS        0.61  0.79    1  191    4  194  191    0    0  408  C3DPR7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar sotto str. T04001 GN=argJ PE=3 SV=1
  233 : C3FQ32_BACTB        0.61  0.79    1  191    4  194  191    0    0  408  C3FQ32     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar berliner ATCC 10792 GN=argJ PE=3 SV=1
  234 : C3HN58_BACTU        0.61  0.79    1  191    4  194  191    0    0  408  C3HN58     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar pulsiensis BGSC 4CC1 GN=argJ PE=3 SV=1
  235 : C3I5T1_BACTU        0.61  0.79    1  191    4  194  191    0    0  408  C3I5T1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis IBL 200 GN=argJ PE=3 SV=1
  236 : C3INT3_BACTU        0.61  0.79    1  191    4  194  191    0    0  408  C3INT3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis IBL 4222 GN=argJ PE=3 SV=1
  237 : C9RY09_GEOSY        0.61  0.78    1  191    6  196  191    0    0  410  C9RY09     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. (strain Y412MC61) GN=argJ PE=3 SV=1
  238 : D5TWX2_BACT1        0.61  0.79    1  191    3  193  191    0    0  407  D5TWX2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis (strain BMB171) GN=argJ PE=3 SV=1
  239 : D7D1T1_GEOSC        0.61  0.78    1  191    6  196  191    0    0  410  D7D1T1     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. (strain C56-T3) GN=argJ PE=3 SV=1
  240 : E0IEB0_9BACL        0.61  0.77  193  405  201  412  213    1    1  414  E0IEB0     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus curdlanolyticus YK9 GN=argJ PE=3 SV=1
  241 : E3ID60_GEOS0        0.61  0.76    5  191   13  199  187    0    0  413  E3ID60     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. (strain Y4.1MC1) GN=argJ PE=3 SV=1
  242 : E5W4Y4_9BACI        0.61  0.77  193  405  146  357  213    1    1  359  E5W4Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. BT1B_CT2 GN=argJ PE=3 SV=1
  243 : E8SWC4_GEOS2        0.61  0.78    1  191    6  196  191    0    0  410  E8SWC4     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. (strain Y412MC52) GN=argJ PE=3 SV=1
  244 : F2H4P3_BACTU        0.61  0.79    1  191    3  193  191    0    0  407  F2H4P3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar chinensis CT-43 GN=argJ PE=3 SV=1
  245 : F5LSQ8_9BACL        0.61  0.78  193  405  195  406  213    1    1  408  F5LSQ8     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. HGF7 GN=argJ PE=3 SV=1
  246 : F8CZQ9_GEOTC        0.61  0.76    5  191   13  199  187    0    0  413  F8CZQ9     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus thermoglucosidasius (strain C56-YS93) GN=argJ PE=3 SV=1
  247 : G8MX95_GEOTH        0.61  0.78    1  191    6  196  191    0    0  410  G8MX95     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus thermoleovorans CCB_US3_UF5 GN=argJ PE=3 SV=1
  248 : G8U941_BACCE        0.61  0.79    1  191    4  194  191    0    0  408  G8U941     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus F837/76 GN=argJ PE=3 SV=1
  249 : G9Q238_9BACI        0.61  0.79    1  191    3  193  191    0    0  407  G9Q238     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. 7_6_55CFAA_CT2 GN=argJ PE=3 SV=1
  250 : I0U6R4_GEOTM        0.61  0.76    5  191   12  198  187    0    0  412  I0U6R4     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus thermoglucosidans TNO-09.020 GN=argJ PE=3 SV=1
  251 : J3VA79_BACTU        0.61  0.79    1  191    3  193  191    0    0  407  J3VA79     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis HD-789 GN=argJ PE=3 SV=1
  252 : J3X5C2_BACTU        0.61  0.79    1  191    3  193  191    0    0  407  J3X5C2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis HD-771 GN=argJ PE=3 SV=1
  253 : J7UY89_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J7UY89     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG3O-2 GN=argJ PE=3 SV=1
  254 : J7WCV4_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J7WCV4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD022 GN=argJ PE=3 SV=1
  255 : J7XSP2_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J7XSP2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG3X2-1 GN=argJ PE=3 SV=1
  256 : J7XWP7_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J7XWP7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG6X1-2 GN=argJ PE=3 SV=1
  257 : J7YKK7_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J7YKK7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG4O-1 GN=argJ PE=3 SV=1
  258 : J7YZ11_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J7YZ11     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG3X2-2 GN=argJ PE=3 SV=1
  259 : J7ZBY7_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J7ZBY7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG4X12-1 GN=argJ PE=3 SV=1
  260 : J8B9K9_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J8B9K9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG5X1-1 GN=argJ PE=3 SV=1
  261 : J8BJY2_BACCE        0.61  0.80    1  191    3  193  191    0    0  407  J8BJY2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG5X2-1 GN=argJ PE=3 SV=1
  262 : J8BXE3_BACCE        0.61  0.78    1  191    3  193  191    0    0  407  J8BXE3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus MC67 GN=argJ PE=3 SV=1
  263 : J8CQJ0_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J8CQJ0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus MSX-A1 GN=argJ PE=3 SV=1
  264 : J8DLF6_BACCE        0.61  0.80    1  191    3  193  191    0    0  407  J8DLF6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus MSX-D12 GN=argJ PE=3 SV=1
  265 : J8E5T1_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J8E5T1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuA4-10 GN=argJ PE=3 SV=1
  266 : J8ILA4_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J8ILA4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD045 GN=argJ PE=3 SV=1
  267 : J8JKX3_BACCE        0.61  0.80    1  191    3  193  191    0    0  407  J8JKX3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD102 GN=argJ PE=3 SV=1
  268 : J8MG26_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J8MG26     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1X1-2 GN=argJ PE=3 SV=1
  269 : J8MM98_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J8MM98     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD169 GN=argJ PE=3 SV=1
  270 : J8N692_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J8N692     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD200 GN=argJ PE=3 SV=1
  271 : J8REG8_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J8REG8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1X1-3 GN=argJ PE=3 SV=1
  272 : J8SXJ5_BACCE        0.61  0.80    1  191    3  193  191    0    0  407  J8SXJ5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG2X1-3 GN=argJ PE=3 SV=1
  273 : J9APS7_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J9APS7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG6O-2 GN=argJ PE=3 SV=1
  274 : J9BXN4_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  J9BXN4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuB1-1 GN=argJ PE=3 SV=1
  275 : K4MDR6_BACTU        0.61  0.79    1  191    3  193  191    0    0  407  K4MDR6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis Bt407 GN=argJ PE=3 SV=1
  276 : K4ZPW2_PAEAL        0.61  0.78  193  405  204  415  213    1    1  417  K4ZPW2     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus alvei DSM 29 GN=argJ PE=3 SV=1
  277 : K6BWP5_BACAZ        0.61  0.77    7  191   15  200  186    1    1  414  K6BWP5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus azotoformans LMG 9581 GN=argJ PE=3 SV=1
  278 : L0E808_THECK        0.61  0.77  193  405  197  408  213    1    1  410  L0E808     Arginine biosynthesis bifunctional protein ArgJ OS=Thermobacillus composti (strain DSM 18247 / JCM 13945 / KWC4) GN=argJ PE=3 SV=1
  279 : L7ZW45_9BACI        0.61  0.78    1  191    6  196  191    0    0  410  L7ZW45     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. GHH01 GN=argJ PE=3 SV=1
  280 : M1QKJ2_BACTU        0.61  0.79    1  191    3  193  191    0    0  407  M1QKJ2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar thuringiensis str. IS5056 GN=argJ PE=3 SV=1
  281 : M4HF70_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  M4HF70     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus FRI-35 GN=argJ PE=3 SV=1
  282 : Q3EYI2_BACTI        0.61  0.79    1  191    9  199  191    0    0  413  Q3EYI2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar israelensis ATCC 35646 GN=argJ PE=3 SV=1
  283 : R8CE85_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8CE85     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus str. Schrouff GN=argJ PE=3 SV=1
  284 : R8DZW8_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8DZW8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD133 GN=argJ PE=3 SV=1
  285 : R8E1X1_BACCE        0.61  0.77  193  405  194  405  213    1    1  407  R8E1X1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1X1-1 GN=argJ PE=3 SV=1
  286 : R8E1X1_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8E1X1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1X1-1 GN=argJ PE=3 SV=1
  287 : R8FE74_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8FE74     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1X2-1 GN=argJ PE=3 SV=1
  288 : R8G1X6_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8G1X6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1X2-2 GN=argJ PE=3 SV=1
  289 : R8GC71_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8GC71     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1X2-3 GN=argJ PE=3 SV=1
  290 : R8GTY5_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8GTY5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD196 GN=argJ PE=3 SV=1
  291 : R8HHY8_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8HHY8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1O-1 GN=argJ PE=3 SV=1
  292 : R8IX60_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8IX60     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus K-5975c GN=argJ PE=3 SV=1
  293 : R8K1V2_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8K1V2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG2O-1 GN=argJ PE=3 SV=1
  294 : R8K1V2_BACCE        0.61  0.77  193  405  194  405  213    1    1  407  R8K1V2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG2O-1 GN=argJ PE=3 SV=1
  295 : R8LCB4_BACCE        0.61  0.78    1  191    3  193  191    0    0  407  R8LCB4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus MC118 GN=argJ PE=3 SV=1
  296 : R8NYK2_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8NYK2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VDM053 GN=argJ PE=3 SV=1
  297 : R8RNG0_BACCE        0.61  0.79    3  191    5  193  189    0    0  305  R8RNG0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuB4-4 GN=argJ PE=3 SV=1
  298 : R8RQV6_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8RQV6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG5X12-1 GN=argJ PE=3 SV=1
  299 : R8SD36_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8SD36     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD140 GN=argJ PE=3 SV=1
  300 : R8V6M0_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8V6M0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG3O-1 GN=argJ PE=3 SV=1
  301 : R8YL60_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  R8YL60     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus TIAC219 GN=argJ PE=3 SV=1
  302 : S3IP60_BACCE        0.61  0.79    1  191    3  193  191    0    0  407  S3IP60     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG1O-3 GN=argJ PE=3 SV=1
  303 : S6A0G2_9BACI        0.61  0.79    1  191    6  196  191    0    0  410  S6A0G2     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. JF8 GN=argJ PE=3 SV=1
  304 : S7TZ45_9BACI        0.61  0.78    1  191   13  203  191    0    0  417  S7TZ45     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. WSUCF1 GN=argJ PE=3 SV=1
  305 : T0Q945_9BACI        0.61  0.78    1  191    6  196  191    0    0  410  T0Q945     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. A8 GN=argJ PE=3 SV=1
  306 : T5HWE8_BACLI        0.61  0.77  193  405  193  404  213    1    1  406  T5HWE8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus licheniformis CG-B52 GN=argJ PE=3 SV=1
  307 : U1W4Z1_BACTU        0.61  0.79    1  191    3  193  191    0    0  407  U1W4Z1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis T01-328 GN=argJ PE=3 SV=1
  308 : U2YD56_GEOKU        0.61  0.78    1  191    6  196  191    0    0  410  U2YD56     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus kaustophilus GBlys GN=argJ PE=3 SV=1
  309 : V5MHM9_BACTU        0.61  0.79    1  191    3  193  191    0    0  407  V5MHM9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis YBT-1518 GN=argJ PE=3 SV=1
  310 : ARGJ_BACCR          0.60  0.78    1  191    4  194  191    0    0  408  Q818W0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain ATCC 14579 / DSM 31) GN=argJ PE=3 SV=1
  311 : ARGJ_BACHK          0.60  0.78    1  191    4  194  191    0    0  408  Q6HE29     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis subsp. konkukian (strain 97-27) GN=argJ PE=3 SV=1
  312 : B0QH43_BACAN        0.60  0.75  193  405  194  404  213    2    2  406  B0QH43     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus anthracis str. A0442 GN=argJ PE=3 SV=1
  313 : C2PJU9_BACCE        0.60  0.79    1  191    4  194  191    0    0  408  C2PJU9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus MM3 GN=argJ PE=3 SV=1
  314 : C2QXV8_BACCE        0.60  0.80    1  191    4  194  191    0    0  408  C2QXV8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus ATCC 4342 GN=argJ PE=3 SV=1
  315 : C2RCS2_BACCE        0.60  0.78    1  191    4  194  191    0    0  408  C2RCS2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus m1550 GN=argJ PE=3 SV=1
  316 : C2S8L9_BACCE        0.60  0.79    3  191    6  194  189    0    0  306  C2S8L9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BDRD-ST26 GN=argJ PE=3 SV=1
  317 : C2T5N7_BACCE        0.60  0.78    1  191    4  194  191    0    0  408  C2T5N7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BDRD-Cer4 GN=argJ PE=3 SV=1
  318 : C3BPP1_9BACI        0.60  0.77  193  405  195  406  213    1    1  408  C3BPP1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus pseudomycoides DSM 12442 GN=argJ PE=3 SV=1
  319 : C3C7Q7_BACTU        0.60  0.80    1  191    4  194  191    0    0  408  C3C7Q7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar tochigiensis BGSC 4Y1 GN=argJ PE=3 SV=1
  320 : C3EQ99_BACTK        0.60  0.77    1  191    4  191  191    1    3  405  C3EQ99     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar kurstaki str. T03a001 GN=argJ PE=3 SV=1
  321 : C3H5X5_BACTU        0.60  0.79    1  191    4  194  191    0    0  408  C3H5X5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar huazhongensis BGSC 4BD1 GN=argJ PE=3 SV=1
  322 : C5D765_GEOSW        0.60  0.77    3  191   11  199  189    0    0  413  C5D765     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. (strain WCH70) GN=argJ PE=3 SV=1
  323 : G4HMB3_9BACL        0.60  0.74  193  405  195  406  213    1    1  408  G4HMB3     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus lactis 154 GN=argJ PE=3 SV=1
  324 : J8GWF8_BACCE        0.60  0.79    1  191    3  193  191    0    0  407  J8GWF8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD014 GN=argJ PE=3 SV=1
  325 : J8MEF6_BACCE        0.60  0.79    1  191    3  193  191    0    0  407  J8MEF6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD156 GN=argJ PE=3 SV=1
  326 : J9CI49_BACCE        0.60  0.77    1  191    3  190  191    1    3  404  J9CI49     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HD73 GN=argJ PE=3 SV=1
  327 : M4LAN1_BACTK        0.60  0.77    1  191    3  190  191    1    3  404  M4LAN1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar kurstaki str. HD73 GN=argJ PE=3 SV=1
  328 : M5P9H3_9BACI        0.60  0.77  193  405  193  404  213    1    1  406  M5P9H3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sonorensis L12 GN=argJ PE=3 SV=1
  329 : M5R4H3_9BACI        0.60  0.77    8  191   11  194  184    0    0  408  M5R4H3     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus sp. DT3-1 GN=argJ PE=3 SV=1
  330 : M8D7B7_9BACI        0.60  0.75    8  191   10  193  184    0    0  407  M8D7B7     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus flavithermus AK1 GN=argJ PE=3 SV=1
  331 : N1LKH4_9BACI        0.60  0.78    1  191    3  193  191    0    0  407  N1LKH4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. GeD10 GN=argJ PE=3 SV=1
  332 : Q4MMY3_BACCE        0.60  0.79    1  191    3  193  191    0    0  407  Q4MMY3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus G9241 GN=argJ PE=3 SV=1
  333 : R8KUQ6_BACCE        0.60  0.79    1  191    3  193  191    0    0  407  R8KUQ6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG2O-3 GN=argJ PE=3 SV=1
  334 : R8LDY7_BACCE        0.60  0.77    1  191    3  190  191    1    3  404  R8LDY7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuB13-1 GN=argJ PE=3 SV=1
  335 : R8PJW2_BACCE        0.60  0.77    1  191    3  190  191    1    3  404  R8PJW2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus ISP2954 GN=argJ PE=3 SV=1
  336 : R8SR11_BACCE        0.60  0.77    1  191    3  190  191    1    3  404  R8SR11     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BMG1.7 GN=argJ PE=3 SV=1
  337 : R8TG13_BACCE        0.60  0.78    1  191    3  193  191    0    0  407  R8TG13     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD184 GN=argJ PE=3 SV=1
  338 : R8TNQ7_BACCE        0.60  0.79    1  191    3  193  191    0    0  407  R8TNQ7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus B5-2 GN=argJ PE=3 SV=1
  339 : T0BDK0_9BACI        0.60  0.78    8  191   11  194  184    0    0  408  T0BDK0     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus sp. SK3-4 GN=argJ PE=3 SV=1
  340 : V8PY27_BACTA        0.60  0.77    1  191    3  190  191    1    3  404  V8PY27     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar aizawai str. Hu4-2 GN=argJ PE=3 SV=1
  341 : V8Q5Z8_BACTA        0.60  0.77    1  191    4  191  191    1    3  405  V8Q5Z8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis serovar aizawai str. Leapi01 GN=argJ PE=3 SV=1
  342 : W4E1E5_9BACI        0.60  0.78    1  191    3  193  191    0    0  407  W4E1E5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus weihenstephanensis FSL R5-860 GN=argJ PE=3 SV=1
  343 : A9VG71_BACWK        0.59  0.77    1  191    3  193  191    0    0  407  A9VG71     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus weihenstephanensis (strain KBAB4) GN=argJ PE=3 SV=1
  344 : ARGJ_BACSU          0.59  0.77  193  405  193  404  213    1    1  406  P36843     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis (strain 168) GN=argJ PE=3 SV=2
  345 : B7HNP8_BACC7        0.59  0.79    1  191    3  193  191    0    0  407  B7HNP8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain AH187) GN=argJ PE=3 SV=1
  346 : B9IXC8_BACCQ        0.59  0.78    1  191    3  193  191    0    0  407  B9IXC8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus (strain Q1) GN=argJ PE=3 SV=1
  347 : C2SPT1_BACCE        0.59  0.77    1  191    3  193  191    0    0  407  C2SPT1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BDRD-ST196 GN=argJ PE=3 SV=1
  348 : C2WBR9_BACCE        0.59  0.75  193  405  144  355  213    1    1  357  C2WBR9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus Rock3-44 GN=argJ PE=3 SV=1
  349 : C3AAH5_BACMY        0.59  0.77    1  191    3  193  191    0    0  407  C3AAH5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus mycoides DSM 2048 GN=argJ PE=3 SV=1
  350 : F0PV02_BACT0        0.59  0.77    1  191    3  193  191    0    0  407  F0PV02     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus thuringiensis subsp. finitimus (strain YBT-020) GN=argJ PE=3 SV=1
  351 : F8FJ64_PAEMK        0.59  0.76  193  405  196  407  213    1    1  409  F8FJ64     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus mucilaginosus (strain KNP414) GN=argJ PE=3 SV=1
  352 : G4EXX3_BACIU        0.59  0.77  193  405  193  404  213    1    1  406  G4EXX3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. subtilis str. SC-8 GN=argJ PE=3 SV=1
  353 : G4PAC4_BACIU        0.59  0.78  193  405  193  404  213    1    1  406  G4PAC4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. subtilis str. RO-NN-1 GN=argJ PE=3 SV=1
  354 : H0NTY8_BACCE        0.59  0.79    1  191    3  193  191    0    0  407  H0NTY8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus NC7401 GN=argJ PE=3 SV=1
  355 : H6NT92_9BACL        0.59  0.76  193  405  196  407  213    1    1  409  H6NT92     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus mucilaginosus 3016 GN=argJ PE=3 SV=1
  356 : I0F2Q4_9BACI        0.59  0.78  193  405  193  404  213    1    1  406  I0F2Q4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. JS GN=argJ PE=3 SV=1
  357 : J7U7J3_BACCE        0.59  0.79    1  191    3  193  191    0    0  407  J7U7J3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AND1407 GN=argJ PE=3 SV=1
  358 : J7WVP7_BACCE        0.59  0.79    1  191    3  193  191    0    0  407  J7WVP7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus IS075 GN=argJ PE=3 SV=1
  359 : J8CTX1_BACCE        0.59  0.77    1  191    3  193  191    0    0  407  J8CTX1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuA2-4 GN=argJ PE=3 SV=1
  360 : J8GM86_BACCE        0.59  0.79    1  191    3  193  191    0    0  407  J8GM86     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus MSX-A12 GN=argJ PE=3 SV=1
  361 : J8JL07_BACCE        0.59  0.79    1  191    3  193  191    0    0  407  J8JL07     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD107 GN=argJ PE=3 SV=1
  362 : J8NFD8_BACCE        0.59  0.77    1  191    3  193  191    0    0  407  J8NFD8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VDM034 GN=argJ PE=3 SV=1
  363 : J8NXQ1_BACCE        0.59  0.77    1  191    3  193  191    0    0  407  J8NXQ1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG2X1-2 GN=argJ PE=3 SV=1
  364 : J8PPJ0_BACCE        0.59  0.77    1  191    3  193  191    0    0  407  J8PPJ0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VDM062 GN=argJ PE=3 SV=1
  365 : J9A0Y8_BACCE        0.59  0.77    1  191    3  193  191    0    0  407  J9A0Y8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BAG6X1-1 GN=argJ PE=3 SV=1
  366 : L8ADJ4_BACIU        0.59  0.77  193  405  193  404  213    1    1  406  L8ADJ4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis BEST7613 GN=argJ PE=3 SV=1
  367 : L8PYA1_BACIU        0.59  0.77  193  405  193  404  213    1    1  406  L8PYA1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. inaquosorum KCTC 13429 GN=argJ PE=3 SV=1
  368 : M4X7F6_BACIU        0.59  0.78  193  405  193  404  213    1    1  406  M4X7F6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. subtilis str. BAB-1 GN=argJ PE=3 SV=1
  369 : R8I3X7_BACCE        0.59  0.77    1  191    3  193  191    0    0  407  R8I3X7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD021 GN=argJ PE=3 SV=1
  370 : R8J9M6_BACCE        0.59  0.79    1  191    3  193  191    0    0  407  R8J9M6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus IS845/00 GN=argJ PE=3 SV=1
  371 : R8JP97_BACCE        0.59  0.79    1  191    3  193  191    0    0  407  R8JP97     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus IS195 GN=argJ PE=3 SV=1
  372 : R8NW33_BACCE        0.59  0.76  193  405  194  405  213    1    1  407  R8NW33     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD136 GN=argJ PE=3 SV=1
  373 : R8Q548_BACCE        0.59  0.77    1  191    3  193  191    0    0  407  R8Q548     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD118 GN=argJ PE=3 SV=1
  374 : S9SQB5_PAEAL        0.59  0.73   10  191   17  201  185    2    3  415  S9SQB5     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus alvei TS-15 GN=argJ PE=3 SV=1
  375 : S9SXW1_PAEAL        0.59  0.73   10  191   17  201  185    2    3  415  S9SXW1     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus alvei A6-6i-x GN=argJ PE=3 SV=1
  376 : U1ZFW5_9BACI        0.59  0.78  193  405  193  404  213    1    1  406  U1ZFW5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. EGD-AK10 GN=argJ PE=3 SV=1
  377 : V5X2A6_PAEPO        0.59  0.74  193  405  195  406  213    1    1  408  V5X2A6     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus polymyxa CR1 GN=argJ PE=3 SV=1
  378 : V7I9H6_9CLOT        0.59  0.76    5  191    5  191  187    0    0  405  V7I9H6     Arginine biosynthesis bifunctional protein ArgJ OS=Youngiibacter fragilis 232.1 GN=argJ PE=3 SV=1
  379 : W2EBX9_9BACL        0.59  0.73  193  405  195  406  213    1    1  408  W2EBX9     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus larvae subsp. larvae DSM 25719 GN=argJ PE=3 SV=1
  380 : W4DT49_9BACI        0.59  0.77    1  191    3  193  191    0    0  407  W4DT49     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus weihenstephanensis FSL H7-687 GN=argJ PE=3 SV=1
  381 : W4R5Z7_9BACI        0.59  0.77    1  191    3  193  191    0    0  407  W4R5Z7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus weihenstephanensis NBRC 101238 = DSM 11821 GN=argJ PE=3 SV=1
  382 : A7GSF3_BACCN        0.58  0.76    1  191    3  193  191    0    0  407  A7GSF3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus subsp. cytotoxis (strain NVH 391-98) GN=argJ PE=3 SV=1
  383 : ARGJ_GEOSE          0.58  0.76    1  191    6  196  191    0    0  410  Q07908     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus stearothermophilus GN=argJ PE=1 SV=1
  384 : B7GM07_ANOFW        0.58  0.76    1  191    4  194  191    0    0  408  B7GM07     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus flavithermus (strain DSM 21510 / WK1) GN=argJ PE=3 SV=1
  385 : C2Q0I2_BACCE        0.58  0.77    1  191    3  193  191    0    0  407  C2Q0I2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AH621 GN=argJ PE=3 SV=1
  386 : C2XYV1_BACCE        0.58  0.77    1  191    3  193  191    0    0  407  C2XYV1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus AH603 GN=argJ PE=3 SV=1
  387 : D4FUY8_BACNB        0.58  0.78  193  405  193  404  213    1    1  406  D4FUY8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. natto (strain BEST195) GN=argJ PE=3 SV=1
  388 : D5DZZ2_BACMQ        0.58  0.75    5  191   11  197  187    0    0  411  D5DZZ2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus megaterium (strain ATCC 12872 / QMB1551) GN=argJ PE=3 SV=1
  389 : D5N365_BACPN        0.58  0.78  193  405  193  404  213    1    1  406  D5N365     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. spizizenii ATCC 6633 GN=argJ PE=3 SV=1
  390 : E0U120_BACPZ        0.58  0.78  193  405  193  404  213    1    1  406  E0U120     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. spizizenii (strain ATCC 23059 / NRRL B-14472 / W23) GN=argJ PE=3 SV=1
  391 : E1UR09_BACAS        0.58  0.77  193  405  192  403  213    1    1  405  E1UR09     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens (strain ATCC 23350 / DSM 7 / BCRC 11601 / NBRC 15535 / NRRL B-14393) GN=argJ PE=3 SV=1
  392 : E3DVG3_BACA1        0.58  0.74  193  405  193  404  213    1    1  406  E3DVG3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus atrophaeus (strain 1942) GN=argJ PE=3 SV=1
  393 : F4E6K3_BACAM        0.58  0.77  193  405  192  403  213    1    1  405  F4E6K3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens TA208 GN=argJ PE=3 SV=1
  394 : F4EPN0_BACAM        0.58  0.77  193  405  192  403  213    1    1  405  F4EPN0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens LL3 GN=argJ PE=3 SV=1
  395 : G2TNP1_BACCO        0.58  0.77  193  405  198  410  213    0    0  412  G2TNP1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus coagulans 36D1 GN=argJ PE=3 SV=1
  396 : G4NUZ8_BACPT        0.58  0.77  193  405  193  404  213    1    1  406  G4NUZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. spizizenii (strain TU-B-10) GN=argJ PE=3 SV=1
  397 : G7VUP7_PAETH        0.58  0.75  193  405  195  406  213    1    1  408  G7VUP7     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus terrae (strain HPL-003) GN=argJ PE=3 SV=1
  398 : I4XEI3_BACAT        0.58  0.74  193  405  193  404  213    1    1  406  I4XEI3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus atrophaeus C89 GN=argJ PE=3 SV=1
  399 : J0X667_9BACI        0.58  0.77  193  405  192  403  213    1    1  405  J0X667     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. 916 GN=argJ PE=3 SV=1
  400 : J7VND6_BACCE        0.58  0.77    1  191    3  193  191    0    0  407  J7VND6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD142 GN=argJ PE=3 SV=1
  401 : J7ZDT8_BACCE        0.58  0.76    1  191    3  193  191    0    0  407  J7ZDT8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus CER074 GN=argJ PE=3 SV=1
  402 : J8BTR6_BACCE        0.58  0.76    1  191    3  193  191    0    0  407  J8BTR6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus CER057 GN=argJ PE=3 SV=1
  403 : J8F515_BACCE        0.58  0.77    1  191    3  193  191    0    0  407  J8F515     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD048 GN=argJ PE=3 SV=1
  404 : J8IUE8_BACCE        0.58  0.76    1  191    3  193  191    0    0  407  J8IUE8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD078 GN=argJ PE=3 SV=1
  405 : J8P0U8_BACCE        0.58  0.76    1  191    3  193  191    0    0  407  J8P0U8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VDM022 GN=argJ PE=3 SV=1
  406 : J9AAR5_BACCE        0.58  0.76    1  191    3  193  191    0    0  407  J9AAR5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus BtB2-4 GN=argJ PE=3 SV=1
  407 : M5JF48_9BACI        0.58  0.76    1  191    4  194  191    0    0  408  M5JF48     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus flavithermus TNO-09.006 GN=argJ PE=3 SV=1
  408 : R4G5Z7_9BACI        0.58  0.76    2  191    1  190  190    0    0  404  R4G5Z7     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus flavithermus NBRC 109594 GN=argJ PE=3 SV=1
  409 : R8CZJ5_BACCE        0.58  0.77    1  191    3  193  191    0    0  407  R8CZJ5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuA3-9 GN=argJ PE=3 SV=1
  410 : R8ENA4_BACCE        0.58  0.76    1  191    3  193  191    0    0  407  R8ENA4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VDM019 GN=argJ PE=3 SV=1
  411 : R8MPC4_BACCE        0.58  0.76    1  191    3  193  191    0    0  407  R8MPC4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD146 GN=argJ PE=3 SV=1
  412 : U1U7B7_BACAM        0.58  0.77  193  405  192  403  213    1    1  405  U1U7B7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens EGD-AQ14 GN=argJ PE=3 SV=1
  413 : U5X6K4_BACAM        0.58  0.77  193  405  192  403  213    1    1  405  U5X6K4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens CC178 GN=argJ PE=3 SV=1
  414 : V9W1M4_9BACL        0.58  0.73  193  405  195  406  213    1    1  408  V9W1M4     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus larvae subsp. larvae DSM 25430 GN=argJ PE=3 SV=1
  415 : W4C3A4_9BACL        0.58  0.73  193  405  212  424  213    0    0  426  W4C3A4     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. FSL R7-269 GN=argJ PE=3 SV=1
  416 : ARGJ_BACSK          0.57  0.75   11  191   16  194  182    2    4  408  Q5WEW8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus clausii (strain KSM-K16) GN=argJ PE=3 SV=1
  417 : ARGJ_LISIN          0.57  0.75    8  191    3  184  184    1    2  398  Q92BB8     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria innocua serovar 6a (strain CLIP 11262) GN=argJ PE=3 SV=1
  418 : B8DHF1_LISMH        0.57  0.77    8  191    3  184  184    1    2  398  B8DHF1     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4a (strain HCC23) GN=argJ PE=3 SV=1
  419 : C4L125_EXISA        0.57  0.70  193  405  192  403  213    1    1  405  C4L125     Arginine biosynthesis bifunctional protein ArgJ OS=Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b) GN=argJ PE=3 SV=1
  420 : C6J2M6_9BACL        0.57  0.75   11  191   13  197  185    3    4  411  C6J2M6     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. oral taxon 786 str. D14 GN=argJ PE=3 SV=1
  421 : D3UNH4_LISSS        0.57  0.76   11  191    6  184  181    1    2  398  D3UNH4     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria seeligeri serovar 1/2b (strain ATCC 35967 / DSM 20751 / CIP 100100 / SLCC 3954) GN=argJ PE=3 SV=1
  422 : D5DAG4_BACMD        0.57  0.74    5  191   11  197  187    0    0  411  D5DAG4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus megaterium (strain DSM 319) GN=argJ PE=3 SV=1
  423 : E1UGV3_LISML        0.57  0.77    8  191    3  184  184    1    2  398  E1UGV3     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4a (strain L99) GN=argJ PE=3 SV=1
  424 : E3EBK6_PAEPS        0.57  0.74  193  405  195  406  213    1    1  408  E3EBK6     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus polymyxa (strain SC2) GN=argJ PE=3 SV=1
  425 : E3YZG3_LISIO        0.57  0.75    8  191    3  184  184    1    2  398  E3YZG3     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria innocua FSL S4-378 GN=argJ PE=3 SV=1
  426 : E3Z816_LISIO        0.57  0.75    8  191    3  184  184    1    2  398  E3Z816     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria innocua FSL J1-023 GN=argJ PE=3 SV=1
  427 : E3ZGX8_LISIV        0.57  0.77   11  191    7  185  181    1    2  399  E3ZGX8     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria ivanovii FSL F6-596 GN=argJ PE=3 SV=1
  428 : F5L4S2_9BACI        0.57  0.70    1  191    3  192  191    1    1  406  F5L4S2     Arginine biosynthesis bifunctional protein ArgJ OS=Caldalkalibacillus thermarum TA2.A1 GN=argJ PE=3 SV=1
  429 : F8BBQ5_LISMM        0.57  0.77    8  191    3  184  184    1    2  398  F8BBQ5     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4a (strain M7) GN=argJ PE=3 SV=1
  430 : G2Z9T1_LISIP        0.57  0.77   11  191    6  184  181    1    2  398  G2Z9T1     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria ivanovii (strain ATCC BAA-678 / PAM 55) GN=argJ PE=3 SV=1
  431 : G4HMB3_9BACL        0.57  0.72    8  191    9  194  187    3    4  408  G4HMB3     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus lactis 154 GN=argJ PE=3 SV=1
  432 : G9QL94_9BACI        0.57  0.74    1  191    6  196  191    0    0  410  G9QL94     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus smithii 7_3_47FAA GN=argJ PE=3 SV=1
  433 : H1GE18_LISIO        0.57  0.76    8  191    3  184  184    1    2  398  H1GE18     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria innocua ATCC 33091 GN=argJ PE=3 SV=1
  434 : H2AGQ9_BACAM        0.57  0.71   11  191   13  191  185    3   10  405  H2AGQ9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens subsp. plantarum CAU B946 GN=argJ PE=3 SV=1
  435 : H6CQF5_9BACL        0.57  0.75  193  405   76  287  213    1    1  289  H6CQF5     N-acetylglutamate synthase protein (Fragment) OS=Paenibacillus sp. Aloe-11 GN=WG8_4698 PE=3 SV=1
  436 : H7CM05_LISMN        0.57  0.77    8  191    3  184  184    1    2  398  H7CM05     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL J1-208 GN=argJ PE=3 SV=1
  437 : I0BA46_9BACL        0.57  0.74   10  191   13  195  183    1    1  409  I0BA46     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus mucilaginosus K02 GN=argJ PE=3 SV=1
  438 : I0JSV5_HALH3        0.57  0.77  193  405  196  407  213    1    1  409  I0JSV5     Arginine biosynthesis bifunctional protein ArgJ OS=Halobacillus halophilus (strain ATCC 35676 / DSM 2266 / JCM 20832 / NBRC 102448/ NCIMB 2269) GN=argJ PE=3 SV=1
  439 : I0JSV5_HALH3        0.57  0.74    5  191   11  195  187    1    2  409  I0JSV5     Arginine biosynthesis bifunctional protein ArgJ OS=Halobacillus halophilus (strain ATCC 35676 / DSM 2266 / JCM 20832 / NBRC 102448/ NCIMB 2269) GN=argJ PE=3 SV=1
  440 : I2HPJ8_9BACI        0.57  0.77  193  405  192  403  213    1    1  405  I2HPJ8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. 5B6 GN=argJ PE=3 SV=1
  441 : J8YFC2_BACCE        0.57  0.76    1  191    3  194  192    1    1  408  J8YFC2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuA2-1 GN=argJ PE=3 SV=1
  442 : K4ZPW2_PAEAL        0.57  0.73    1  191   10  203  194    2    3  417  K4ZPW2     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus alvei DSM 29 GN=argJ PE=3 SV=1
  443 : K6DTW5_9BACI        0.57  0.78  193  405  196  407  213    1    1  409  K6DTW5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus bataviensis LMG 21833 GN=argJ PE=3 SV=1
  444 : L0CWG9_BACIU        0.57  0.70   10  191   13  192  182    1    2  249  L0CWG9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. subtilis str. BSP1 GN=argJ PE=3 SV=1
  445 : M1KSS7_BACAM        0.57  0.77  193  405  192  403  213    1    1  405  M1KSS7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens IT-45 GN=argJ PE=3 SV=1
  446 : M1KSS7_BACAM        0.57  0.71   11  191   13  191  185    3   10  405  M1KSS7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens IT-45 GN=argJ PE=3 SV=1
  447 : R8D4W1_BACCE        0.57  0.76    1  191    3  194  192    1    1  408  R8D4W1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus HuA2-9 GN=argJ PE=3 SV=1
  448 : R9BY32_9BACI        0.57  0.77    3  191   12  200  189    0    0  414  R9BY32     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus nealsonii AAU1 GN=argJ PE=3 SV=1
  449 : R9L5M6_9BACL        0.57  0.75   11  191   13  197  185    3    4  411  R9L5M6     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus barengoltzii G22 GN=argJ PE=3 SV=1
  450 : U2TJE8_BACAM        0.57  0.71   11  191   13  191  185    3   10  405  U2TJE8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens UASWS BA1 GN=argJ PE=3 SV=1
  451 : V6J6D0_9BACL        0.57  0.76  193  405  195  406  213    1    1  408  V6J6D0     Arginine biosynthesis bifunctional protein ArgJ OS=Sporolactobacillus laevolacticus DSM 442 GN=argJ PE=3 SV=1
  452 : V9RED6_BACAM        0.57  0.77  193  405  192  403  213    1    1  405  V9RED6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens LFB112 GN=argJ PE=3 SV=1
  453 : W4VFE4_9BACI        0.57  0.75   11  191   14  193  181    1    1  234  W4VFE4     Arginine biosynthesis bifunctional protein ArgJ OS=Gracilibacillus boraciitolerans JCM 21714 GN=argJ PE=3 SV=1
  454 : W6AG48_LISIV        0.57  0.77   11  191    6  184  181    1    2  398  W6AG48     N-acetylglutamate synthase OS=Listeria ivanovii WSLC3009 GN=AX25_08245 PE=4 SV=1
  455 : W7LBL6_BACFI        0.57  0.74    5  191    9  195  187    0    0  409  W7LBL6     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Bacillus firmus DS1 GN=argJ PE=4 SV=1
  456 : A7Z3A8_BACA2        0.56  0.71   11  191   13  191  185    3   10  405  A7Z3A8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens subsp. plantarum (strain DSM 23117 / BGSC 10A6 / FZB42) GN=argJ PE=3 SV=1
  457 : A8FBW0_BACP2        0.56  0.72   11  191   14  192  181    1    2  406  A8FBW0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus pumilus (strain SAFR-032) GN=argJ PE=3 SV=1
  458 : ARGJ_BACAM          0.56  0.70   13  191   16  192  183    3   10  406  Q9ZJ14     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens GN=argJ PE=3 SV=1
  459 : ARGJ_BACSU          0.56  0.70   13  191   16  192  183    3   10  406  P36843     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis (strain 168) GN=argJ PE=3 SV=2
  460 : B4AFD3_BACPU        0.56  0.72   11  191   14  192  181    1    2  406  B4AFD3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus pumilus ATCC 7061 GN=argJ PE=3 SV=1
  461 : C3AQ91_BACMY        0.56  0.78    2  191    5  194  190    0    0  408  C3AQ91     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus mycoides Rock1-4 GN=argJ PE=3 SV=1
  462 : C3B7M5_BACMY        0.56  0.78    2  191    5  194  190    0    0  408  C3B7M5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus mycoides Rock3-17 GN=argJ PE=3 SV=1
  463 : C3BPP1_9BACI        0.56  0.78    2  191    5  194  190    0    0  408  C3BPP1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus pseudomycoides DSM 12442 GN=argJ PE=3 SV=1
  464 : D3KR26_LISMN        0.56  0.71  193  405  185  396  213    1    1  398  D3KR26     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL J2-071 GN=argJ PE=3 SV=1
  465 : D3KR26_LISMN        0.56  0.76    8  191    3  184  184    1    2  398  D3KR26     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL J2-071 GN=argJ PE=3 SV=1
  466 : E1UR09_BACAS        0.56  0.72   11  191   13  191  185    3   10  405  E1UR09     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens (strain ATCC 23350 / DSM 7 / BCRC 11601 / NBRC 15535 / NRRL B-14393) GN=argJ PE=3 SV=1
  467 : E3YGQ0_LISMN        0.56  0.71  193  405  191  402  213    1    1  404  E3YGQ0     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL F2-208 GN=argJ PE=3 SV=1
  468 : E5WE80_9BACI        0.56  0.74    5  191    9  195  187    0    0  409  E5WE80     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. 2_A_57_CT2 GN=argJ PE=3 SV=1
  469 : E8VGZ4_BACST        0.56  0.70   13  191   16  192  183    3   10  406  E8VGZ4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis (strain BSn5) GN=argJ PE=3 SV=1
  470 : F4E6K3_BACAM        0.56  0.72   11  191   13  191  185    3   10  405  F4E6K3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens TA208 GN=argJ PE=3 SV=1
  471 : F4EPN0_BACAM        0.56  0.72   11  191   13  191  185    3   10  405  F4EPN0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens LL3 GN=argJ PE=3 SV=1
  472 : F7Z4Z8_BACC6        0.56  0.76  193  405  199  411  213    0    0  413  F7Z4Z8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus coagulans (strain 2-6) GN=argJ PE=3 SV=1
  473 : F8FJ64_PAEMK        0.56  0.74    8  191   11  195  185    1    1  409  F8FJ64     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus mucilaginosus (strain KNP414) GN=argJ PE=3 SV=1
  474 : G0IJL0_BACAM        0.56  0.72   11  191   13  191  185    3   10  405  G0IJL0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens XH7 GN=argJ PE=3 SV=1
  475 : G4EXX3_BACIU        0.56  0.70   13  191   16  192  183    3   10  406  G4EXX3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. subtilis str. SC-8 GN=argJ PE=3 SV=1
  476 : G4PAC4_BACIU        0.56  0.70   13  191   16  192  183    3   10  406  G4PAC4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. subtilis str. RO-NN-1 GN=argJ PE=3 SV=1
  477 : H6NT92_9BACL        0.56  0.74    8  191   11  195  185    1    1  409  H6NT92     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus mucilaginosus 3016 GN=argJ PE=3 SV=1
  478 : H8XIP6_BACAM        0.56  0.71   11  191   13  191  185    3   10  405  H8XIP6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens subsp. plantarum YAU B9601-Y2 GN=argJ PE=3 SV=1
  479 : I0F2Q4_9BACI        0.56  0.70   13  191   16  192  183    3   10  406  I0F2Q4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. JS GN=argJ PE=3 SV=1
  480 : I2C3G5_BACAM        0.56  0.71   11  191   13  191  185    3   10  405  I2C3G5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens Y2 GN=argJ PE=3 SV=1
  481 : I2HPJ8_9BACI        0.56  0.71   11  191   13  191  185    3   10  405  I2HPJ8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. 5B6 GN=argJ PE=3 SV=1
  482 : J0X667_9BACI        0.56  0.71   11  191   13  191  185    3   10  405  J0X667     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. 916 GN=argJ PE=3 SV=1
  483 : J7JT50_BACIU        0.56  0.70   13  191   39  215  183    3   10  429  J7JT50     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis QB928 GN=argJ PE=3 SV=1
  484 : J7NR56_LISMN        0.56  0.71  193  405  185  396  213    1    1  398  J7NR56     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC2376 GN=argJ PE=3 SV=1
  485 : J7NR56_LISMN        0.56  0.76    8  191    3  184  184    1    2  398  J7NR56     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC2376 GN=argJ PE=3 SV=1
  486 : K2HJ50_BACAM        0.56  0.71   11  191   13  191  185    3   10  405  K2HJ50     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens subsp. plantarum M27 GN=argJ PE=3 SV=1
  487 : L0BJR3_BACAM        0.56  0.71   11  191   13  191  185    3   10  405  L0BJR3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens subsp. plantarum AS43.3 GN=argJ PE=3 SV=1
  488 : L5N6C4_9BACI        0.56  0.76  193  405  195  406  213    1    1  408  L5N6C4     Arginine biosynthesis bifunctional protein ArgJ OS=Halobacillus sp. BAB-2008 GN=argJ PE=3 SV=1
  489 : L8ADJ4_BACIU        0.56  0.70   13  191   16  192  183    3   10  406  L8ADJ4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis BEST7613 GN=argJ PE=3 SV=1
  490 : M1UEA9_BACIU        0.56  0.70   13  191   16  192  183    3   10  406  M1UEA9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. subtilis 6051-HGW GN=argJ PE=3 SV=1
  491 : M1X659_BACAM        0.56  0.71   11  191   13  191  185    3   10  405  M1X659     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens subsp. plantarum UCMB5036 GN=argJ PE=3 SV=1
  492 : M2U9Y5_BACIU        0.56  0.70   13  191   16  192  183    3   10  406  M2U9Y5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis MB73/2 GN=argJ PE=3 SV=1
  493 : M3IFZ4_9LIST        0.56  0.76  193  405  185  397  213    0    0  399  M3IFZ4     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria fleischmannii LU2006-1 GN=argJ PE=3 SV=1
  494 : M4KX61_BACIU        0.56  0.70   13  191   16  192  183    3   10  406  M4KX61     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis XF-1 GN=argJ PE=3 SV=1
  495 : M4X7F6_BACIU        0.56  0.70   13  191   16  192  183    3   10  406  M4X7F6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. subtilis str. BAB-1 GN=argJ PE=3 SV=1
  496 : N0DA66_BACIU        0.56  0.70   13  191   16  192  183    3   10  406  N0DA66     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis BEST7003 GN=argJ PE=3 SV=1
  497 : R8Q8X1_BACCE        0.56  0.78    2  191    4  193  190    0    0  407  R8Q8X1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VDM006 GN=argJ PE=3 SV=1
  498 : S6FQK5_BACAM        0.56  0.71   11  191   13  191  185    3   10  405  S6FQK5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens subsp. plantarum UCMB5113 GN=argJ PE=3 SV=1
  499 : S6G1F9_BACAM        0.56  0.71   11  191   13  191  185    3   10  405  S6G1F9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens subsp. plantarum UCMB5033 GN=argJ PE=3 SV=1
  500 : U1U7B7_BACAM        0.56  0.71   11  191   13  191  185    3   10  405  U1U7B7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens EGD-AQ14 GN=argJ PE=3 SV=1
  501 : U1ZFW5_9BACI        0.56  0.70   13  191   16  192  183    3   10  406  U1ZFW5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. EGD-AK10 GN=argJ PE=3 SV=1
  502 : U4PZI7_BACAM        0.56  0.71   11  191   13  191  185    3   10  405  U4PZI7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens subsp. plantarum NAU-B3 GN=argJ PE=3 SV=1
  503 : U5X6K4_BACAM        0.56  0.71   11  191   13  191  185    3   10  405  U5X6K4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens CC178 GN=argJ PE=3 SV=1
  504 : V5MSE9_BACIU        0.56  0.70   13  191   16  192  183    3   10  406  V5MSE9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis PY79 GN=argJ PE=3 SV=1
  505 : V9RED6_BACAM        0.56  0.72   11  191   13  191  185    3   10  405  V9RED6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus amyloliquefaciens LFB112 GN=argJ PE=3 SV=1
  506 : A0AJ39_LISW6        0.55  0.70  193  405  185  396  213    1    1  398  A0AJ39     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / SLCC5334) GN=argJ PE=3 SV=1
  507 : ARGJ_LISMF          0.55  0.76    7  191    2  184  185    1    2  398  Q71Z77     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4b (strain F2365) GN=argJ PE=3 SV=1
  508 : ARGJ_LISMO          0.55  0.76    7  191    2  184  185    1    2  398  Q8Y6U2     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e) GN=argJ PE=3 SV=1
  509 : B1YJM0_EXIS2        0.55  0.71  193  405  194  405  213    1    1  407  B1YJM0     Arginine biosynthesis bifunctional protein ArgJ OS=Exiguobacterium sibiricum (strain DSM 17290 / JCM 13490 / 255-15) GN=argJ PE=3 SV=1
  510 : C1KVN7_LISMC        0.55  0.76    7  191    2  184  185    1    2  398  C1KVN7     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4b (strain CLIP80459) GN=argJ PE=3 SV=1
  511 : C8JUQ7_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  C8JUQ7     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL N3-165 GN=argJ PE=3 SV=1
  512 : C8K0B5_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  C8K0B5     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL R2-503 GN=argJ PE=3 SV=1
  513 : C8K0B5_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  C8K0B5     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL R2-503 GN=argJ PE=3 SV=1
  514 : C8K974_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  C8K974     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes F6900 GN=argJ PE=3 SV=1
  515 : D2P2M1_LISM1        0.55  0.71  193  405  185  396  213    1    1  398  D2P2M1     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 1/2a (strain 08-5578) GN=argJ PE=3 SV=1
  516 : D2P2M1_LISM1        0.55  0.76    7  191    2  184  185    1    2  398  D2P2M1     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 1/2a (strain 08-5578) GN=argJ PE=3 SV=1
  517 : D2P5F7_LISM2        0.55  0.71  193  405  185  396  213    1    1  398  D2P5F7     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 1/2a (strain 08-5923) GN=argJ PE=3 SV=1
  518 : D2P5F7_LISM2        0.55  0.76    7  191    2  184  185    1    2  398  D2P5F7     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 1/2a (strain 08-5923) GN=argJ PE=3 SV=1
  519 : D4FUY8_BACNB        0.55  0.69   13  191   16  192  183    3   10  406  D4FUY8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. natto (strain BEST195) GN=argJ PE=3 SV=1
  520 : D4PJS4_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  D4PJS4     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL J1-194 GN=argJ PE=3 SV=1
  521 : D4PU99_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  D4PU99     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes J2818 GN=argJ PE=3 SV=1
  522 : D4Q1X5_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  D4Q1X5     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes HPB2262 GN=argJ PE=3 SV=1
  523 : D5N365_BACPN        0.55  0.70   13  191   16  192  183    3   10  406  D5N365     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. spizizenii ATCC 6633 GN=argJ PE=3 SV=1
  524 : D7UM72_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  D7UM72     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL N1-017 GN=argJ PE=3 SV=1
  525 : D7UYU4_LISGR        0.55  0.74    7  191    2  184  185    1    2  398  D7UYU4     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria grayi DSM 20601 GN=argJ PE=3 SV=1
  526 : D7WPP0_9BACI        0.55  0.75    5  191   10  196  187    0    0  410  D7WPP0     Arginine biosynthesis bifunctional protein ArgJ OS=Lysinibacillus fusiformis ZC1 GN=argJ PE=3 SV=1
  527 : E0U120_BACPZ        0.55  0.70   13  191   16  192  183    3   10  406  E0U120     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. spizizenii (strain ATCC 23059 / NRRL B-14472 / W23) GN=argJ PE=3 SV=1
  528 : E3DVG3_BACA1        0.55  0.73   11  191   14  192  181    1    2  406  E3DVG3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus atrophaeus (strain 1942) GN=argJ PE=3 SV=1
  529 : E3YQN9_9LIST        0.55  0.75    7  191    2  184  185    1    2  398  E3YQN9     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria marthii FSL S4-120 GN=argJ PE=3 SV=1
  530 : E3ZZ28_LISSE        0.55  0.71  193  405  120  331  213    1    1  333  E3ZZ28     Glutamate N-acetyltransferase/amino-acid acetyltransferase (Fragment) OS=Listeria seeligeri FSL S4-171 GN=NT04LS_1555 PE=3 SV=1
  531 : E5Z5B9_9BACL        0.55  0.74    8  191    9  194  187    3    4  408  E5Z5B9     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus vortex V453 GN=argJ PE=3 SV=1
  532 : F3MFA9_9BACL        0.55  0.73    8  191    9  194  187    3    4  408  F3MFA9     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. HGF5 GN=argJ PE=3 SV=1
  533 : F3RK81_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  F3RK81     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes J1-220 GN=argJ PE=3 SV=1
  534 : F3YQ86_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  F3YQ86     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes str. Scott A GN=argJ PE=3 SV=1
  535 : F3YQ86_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  F3YQ86     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes str. Scott A GN=argJ PE=3 SV=1
  536 : F5SGS4_9BACL        0.55  0.72    8  191   17  200  184    0    0  414  F5SGS4     Arginine biosynthesis bifunctional protein ArgJ OS=Desmospora sp. 8437 GN=argJ PE=3 SV=1
  537 : F8BBQ5_LISMM        0.55  0.71  193  405  185  396  213    1    1  398  F8BBQ5     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4a (strain M7) GN=argJ PE=3 SV=1
  538 : G2JU32_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  G2JU32     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes J0161 GN=argJ PE=3 SV=1
  539 : G2KC81_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  G2KC81     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL R2-561 GN=argJ PE=3 SV=1
  540 : G2KGA1_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  G2KGA1     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes Finland 1998 GN=argJ PE=3 SV=1
  541 : H3S9R2_9BACL        0.55  0.69   11  191   20  203  188    4   11  417  H3S9R2     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus dendritiformis C454 GN=argJ PE=3 SV=1
  542 : H7CM05_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  H7CM05     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL J1-208 GN=argJ PE=3 SV=1
  543 : I0CS25_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  I0CS25     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes 07PF0776 GN=argJ PE=3 SV=1
  544 : I0CS25_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  I0CS25     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes 07PF0776 GN=argJ PE=3 SV=1
  545 : I3E5V4_BACMT        0.55  0.73    8  191   13  196  184    0    0  410  I3E5V4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus methanolicus PB1 GN=argJ PE=3 SV=1
  546 : I3E7N0_BACMT        0.55  0.72    5  191   10  196  187    0    0  410  I3E7N0     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus methanolicus MGA3 GN=argJ PE=3 SV=1
  547 : I4V724_9BACI        0.55  0.71   11  191   14  192  181    1    2  406  I4V724     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. M 2-6 GN=argJ PE=3 SV=1
  548 : I4XEI3_BACAT        0.55  0.73   11  191   14  192  181    1    2  406  I4XEI3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus atrophaeus C89 GN=argJ PE=3 SV=1
  549 : J7MHN8_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  J7MHN8     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 7 str. SLCC2482 GN=argJ PE=3 SV=1
  550 : J7MHN8_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  J7MHN8     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 7 str. SLCC2482 GN=argJ PE=3 SV=1
  551 : J7MMP7_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  J7MMP7     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC2755 GN=argJ PE=3 SV=1
  552 : J7MMP7_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  J7MMP7     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC2755 GN=argJ PE=3 SV=1
  553 : J7N8N4_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  J7N8N4     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC2372 GN=argJ PE=3 SV=1
  554 : J7N8N4_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  J7N8N4     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC2372 GN=argJ PE=3 SV=1
  555 : J7NHU5_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  J7NHU5     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC7179 GN=argJ PE=3 SV=1
  556 : J7NHU5_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  J7NHU5     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC7179 GN=argJ PE=3 SV=1
  557 : J7NUC9_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  J7NUC9     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC2479 GN=argJ PE=3 SV=1
  558 : J7NUC9_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  J7NUC9     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC2479 GN=argJ PE=3 SV=1
  559 : J7NZF0_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  J7NZF0     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes L312 GN=argJ PE=3 SV=1
  560 : J7P1Q9_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  J7P1Q9     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes ATCC 19117 GN=argJ PE=3 SV=1
  561 : J7P1Q9_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  J7P1Q9     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes ATCC 19117 GN=argJ PE=3 SV=1
  562 : J7P9T4_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  J7P9T4     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC2378 GN=argJ PE=3 SV=1
  563 : J7PZM2_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  J7PZM2     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC2540 GN=argJ PE=3 SV=1
  564 : J7PZM2_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  J7PZM2     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC2540 GN=argJ PE=3 SV=1
  565 : K8EXQ2_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  K8EXQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4b str. LL195 GN=argJ PE=3 SV=1
  566 : K9A6E8_9BACI        0.55  0.75    5  191   10  196  187    0    0  410  K9A6E8     Arginine biosynthesis bifunctional protein ArgJ OS=Lysinibacillus fusiformis ZB2 GN=argJ PE=3 SV=1
  567 : L8E0J8_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  L8E0J8     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes GN=argJ PE=3 SV=1
  568 : L8E0J8_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  L8E0J8     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes GN=argJ PE=3 SV=1
  569 : L8E3N9_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  L8E3N9     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes N53-1 GN=argJ PE=3 SV=1
  570 : L8E3N9_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  L8E3N9     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes N53-1 GN=argJ PE=3 SV=1
  571 : M5R2U5_9BACI        0.55  0.71   11  191   14  192  181    1    2  406  M5R2U5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus stratosphericus LAMA 585 GN=argJ PE=3 SV=1
  572 : Q4EPY5_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  Q4EPY5     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 1/2a str. F6854 GN=argJ PE=3 SV=1
  573 : R0PJ61_BACAT        0.55  0.73   11  191   14  192  181    1    2  406  R0PJ61     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus atrophaeus UCMB-5137 GN=argJ PE=3 SV=1
  574 : R8NW33_BACCE        0.55  0.78    2  191    4  193  190    0    0  407  R8NW33     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VD136 GN=argJ PE=3 SV=1
  575 : R8T5J7_BACCE        0.55  0.78    2  191    4  193  190    0    0  407  R8T5J7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cereus VDM021 GN=argJ PE=3 SV=1
  576 : S5JW90_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  S5JW90     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes GN=argJ PE=3 SV=1
  577 : S5JXA5_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  S5JXA5     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes GN=argJ PE=3 SV=1
  578 : S5K6V6_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  S5K6V6     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes GN=argJ PE=3 SV=1
  579 : S5KG68_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  S5KG68     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes GN=argJ PE=3 SV=1
  580 : S5KG68_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  S5KG68     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes GN=argJ PE=3 SV=1
  581 : S5L5L3_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  S5L5L3     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes GN=argJ PE=3 SV=1
  582 : S5L5L3_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  S5L5L3     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes GN=argJ PE=3 SV=1
  583 : S5LGC6_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  S5LGC6     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes GN=argJ PE=3 SV=1
  584 : S5M2Z3_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  S5M2Z3     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes J1816 GN=argJ PE=3 SV=1
  585 : U1V5R7_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  U1V5R7     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4bV str. LS644 GN=argJ PE=3 SV=1
  586 : U1V5R7_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  U1V5R7     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4bV str. LS644 GN=argJ PE=3 SV=1
  587 : U1VIP7_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  U1VIP7     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4bV str. LS643 GN=argJ PE=3 SV=1
  588 : U1VIP7_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  U1VIP7     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4bV str. LS643 GN=argJ PE=3 SV=1
  589 : U1WH10_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  U1WH10     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4bV str. LS642 GN=argJ PE=3 SV=1
  590 : U1WH10_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  U1WH10     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4bV str. LS642 GN=argJ PE=3 SV=1
  591 : U1WJZ1_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  U1WJZ1     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4bV str. LS645 GN=argJ PE=3 SV=1
  592 : U1WV00_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  U1WV00     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4bV str. LS542 GN=argJ PE=3 SV=1
  593 : V9GGK8_9BACL        0.55  0.73    8  191    9  194  187    3    4  408  V9GGK8     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. JCM 10914 GN=argJ PE=3 SV=1
  594 : W1SBZ5_9BACI        0.55  0.69    2  191    7  195  194    3    9  409  W1SBZ5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus vireti LMG 21834 GN=argJ PE=3 SV=1
  595 : W4B5F9_9BACL        0.55  0.74    8  191    9  194  187    3    4  408  W4B5F9     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. FSL R5-808 GN=argJ PE=3 SV=1
  596 : W4DHI4_9BACL        0.55  0.73    8  191    9  194  187    3    4  408  W4DHI4     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. FSL H8-457 GN=argJ PE=3 SV=1
  597 : W4EJB8_9BACL        0.55  0.72   11  191   13  195  184    3    4  410  W4EJB8     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. FSL R7-277 GN=argJ PE=3 SV=1
  598 : W4RNN4_9BACI        0.55  0.71   24  191    1  168  168    0    0  382  W4RNN4     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus boroniphilus JCM 21738 GN=argJ PE=3 SV=1
  599 : W6GN62_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  W6GN62     Ornithine acetyltransferase OS=Listeria monocytogenes WSLC1042 GN=AX24_05480 PE=4 SV=1
  600 : W6GN62_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  W6GN62     Ornithine acetyltransferase OS=Listeria monocytogenes WSLC1042 GN=AX24_05480 PE=4 SV=1
  601 : W6PRS1_LISMN        0.55  0.71  193  405  185  396  213    1    1  398  W6PRS1     Ornithine acetyltransferase amino-acid acetyltransferase OS=Listeria monocytogenes 6179 GN=argJ PE=4 SV=1
  602 : W6PRS1_LISMN        0.55  0.76    7  191    2  184  185    1    2  398  W6PRS1     Ornithine acetyltransferase amino-acid acetyltransferase OS=Listeria monocytogenes 6179 GN=argJ PE=4 SV=1
  603 : W7C2A9_LISGR        0.55  0.74    7  191    2  184  185    1    2  398  W7C2A9     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Listeria grayi FSL F6-1183 GN=argJ PE=4 SV=1
  604 : W7YYE0_9BACI        0.55  0.77    2  191    7  194  191    2    4  409  W7YYE0     Glutamate N-acetyltransferase OS=Bacillus sp. JCM 19045 GN=JCM19045_2819 PE=4 SV=1
  605 : W7ZZ03_9BACI        0.55  0.77    2  191    1  188  191    2    4  403  W7ZZ03     Glutamate N-acetyltransferase OS=Bacillus sp. JCM 19046 GN=JCM19046_4053 PE=4 SV=1
  606 : A0AJ39_LISW6        0.54  0.74    7  191    2  184  185    1    2  398  A0AJ39     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / SLCC5334) GN=argJ PE=3 SV=1
  607 : A3I901_9BACI        0.54  0.73    2  191    7  196  190    0    0  410  A3I901     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. B14905 GN=argJ PE=3 SV=1
  608 : ARGJ_BACLD          0.54  0.70   10  191   13  192  182    1    2  406  Q65LE9     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus licheniformis (strain DSM 13 / ATCC 14580) GN=argJ PE=3 SV=1
  609 : ARGJ_LISIN          0.54  0.70  193  405  185  396  213    1    1  398  Q92BB8     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria innocua serovar 6a (strain CLIP 11262) GN=argJ PE=3 SV=1
  610 : ARGJ_OCEIH          0.54  0.77  193  405  194  405  213    1    1  407  Q8CUN1     Arginine biosynthesis bifunctional protein ArgJ OS=Oceanobacillus iheyensis (strain DSM 14371 / JCM 11309 / KCTC 3954 / HTE831) GN=argJ PE=3 SV=1
  611 : B1HX79_LYSSC        0.54  0.73    2  191   19  208  190    0    0  422  B1HX79     Arginine biosynthesis bifunctional protein ArgJ OS=Lysinibacillus sphaericus (strain C3-41) GN=argJ PE=3 SV=1
  612 : C0WS42_LACBU        0.54  0.75  193  405  189  400  214    2    3  402  C0WS42     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus buchneri ATCC 11577 GN=argJ PE=3 SV=1
  613 : D3EMD1_GEOS4        0.54  0.73    8  191    9  194  187    3    4  408  D3EMD1     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacillus sp. (strain Y412MC10) GN=argJ PE=3 SV=1
  614 : D3UNH4_LISSS        0.54  0.70  193  405  185  396  213    1    1  398  D3UNH4     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria seeligeri serovar 1/2b (strain ATCC 35967 / DSM 20751 / CIP 100100 / SLCC 3954) GN=argJ PE=3 SV=1
  615 : D5XAD4_THEPJ        0.54  0.73  193  405  187  398  213    1    1  400  D5XAD4     Arginine biosynthesis bifunctional protein ArgJ OS=Thermincola potens (strain JR) GN=argJ PE=3 SV=1
  616 : E3YGQ0_LISMN        0.54  0.75    1  191    2  190  191    1    2  404  E3YGQ0     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes FSL F2-208 GN=argJ PE=3 SV=1
  617 : E3YQN9_9LIST        0.54  0.71  193  405  185  396  213    1    1  398  E3YQN9     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria marthii FSL S4-120 GN=argJ PE=3 SV=1
  618 : E3Z816_LISIO        0.54  0.70  193  405  185  396  213    1    1  398  E3Z816     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria innocua FSL J1-023 GN=argJ PE=3 SV=1
  619 : E6TYY8_BACCJ        0.54  0.75  193  405  195  406  213    1    1  408  E6TYY8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cellulosilyticus (strain ATCC 21833 / DSM 2522 / FERM P-1141 / JCM 9156 / N-4) GN=argJ PE=3 SV=1
  620 : G2JXZ1_LISM4        0.54  0.70  193  405  185  396  213    1    1  398  G2JXZ1     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 1/2a (strain 10403S) GN=argJ PE=3 SV=1
  621 : G2JXZ1_LISM4        0.54  0.76    7  191    2  184  185    1    2  398  G2JXZ1     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 1/2a (strain 10403S) GN=argJ PE=3 SV=1
  622 : G2KGA1_LISMN        0.54  0.70  193  405  185  396  213    1    1  398  G2KGA1     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes Finland 1998 GN=argJ PE=3 SV=1
  623 : G2Z9T1_LISIP        0.54  0.70  193  405  185  396  213    1    1  398  G2Z9T1     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria ivanovii (strain ATCC BAA-678 / PAM 55) GN=argJ PE=3 SV=1
  624 : G4NUZ8_BACPT        0.54  0.70   13  191   16  192  183    3   10  406  G4NUZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. spizizenii (strain TU-B-10) GN=argJ PE=3 SV=1
  625 : I0UE36_BACLI        0.54  0.70   10  191   13  192  182    1    2  406  I0UE36     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus licheniformis WX-02 GN=argJ PE=3 SV=1
  626 : J7ND61_LISMN        0.54  0.76    7  191    2  184  185    1    2  398  J7ND61     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes SLCC5850 GN=argJ PE=3 SV=1
  627 : K0J4N2_AMPXN        0.54  0.71    7  191   13  195  185    1    2  409  K0J4N2     Arginine biosynthesis bifunctional protein ArgJ OS=Amphibacillus xylanus (strain ATCC 51415 / DSM 6626 / JCM 7361 / LMG 17667 / NBRC 15112 / Ep01) GN=argJ PE=3 SV=1
  628 : K2MPC8_9BACI        0.54  0.71   12  191   15  192  180    1    2  406  K2MPC8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. HYC-10 GN=argJ PE=3 SV=1
  629 : K6DTW5_9BACI        0.54  0.68    2  191    7  195  194    3    9  409  K6DTW5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus bataviensis LMG 21833 GN=argJ PE=3 SV=1
  630 : L0E808_THECK        0.54  0.71    8  191   10  196  191    4   11  410  L0E808     Arginine biosynthesis bifunctional protein ArgJ OS=Thermobacillus composti (strain DSM 18247 / JCM 13945 / KWC4) GN=argJ PE=3 SV=1
  631 : L5N6C4_9BACI        0.54  0.74    1  191    6  194  191    1    2  408  L5N6C4     Arginine biosynthesis bifunctional protein ArgJ OS=Halobacillus sp. BAB-2008 GN=argJ PE=3 SV=1
  632 : L8PYA1_BACIU        0.54  0.69   13  191   16  192  183    3   10  406  L8PYA1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus subtilis subsp. inaquosorum KCTC 13429 GN=argJ PE=3 SV=1
  633 : Q4EGM7_LISMN        0.54  0.75    7  191    2  184  185    1    2  398  Q4EGM7     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes serotype 4b str. H7858 GN=argJ PE=3 SV=1
  634 : R9TS15_BACLI        0.54  0.70   10  191   13  192  182    1    2  406  R9TS15     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus licheniformis 9945A GN=argJ PE=3 SV=1
  635 : S0KWN6_ENTAV        0.54  0.72  193  405  184  395  213    1    1  397  S0KWN6     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus avium ATCC 14025 GN=argJ PE=3 SV=1
  636 : S5JXA5_LISMN        0.54  0.70  193  405  185  396  213    1    1  398  S5JXA5     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes GN=argJ PE=3 SV=1
  637 : T2KY95_LISMN        0.54  0.76    7  191    2  184  185    1    2  398  T2KY95     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria monocytogenes EGD GN=argJ PE=3 SV=1
  638 : T5HWE8_BACLI        0.54  0.70   10  191   13  192  182    1    2  406  T5HWE8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus licheniformis CG-B52 GN=argJ PE=3 SV=1
  639 : U1MZR8_9BACL        0.54  0.67  193  405  192  403  213    1    1  405  U1MZR8     Arginine biosynthesis bifunctional protein ArgJ OS=Exiguobacterium pavilionensis RW-2 GN=argJ PE=3 SV=1
  640 : U1MZR8_9BACL        0.54  0.74   14  191   13  191  179    1    1  405  U1MZR8     Arginine biosynthesis bifunctional protein ArgJ OS=Exiguobacterium pavilionensis RW-2 GN=argJ PE=3 SV=1
  641 : V7Q3K2_9BACI        0.54  0.70   10  191   13  192  182    1    2  406  V7Q3K2     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. CPSM8 GN=argJ PE=3 SV=1
  642 : W4C3A4_9BACL        0.54  0.71    9  191   27  211  186    3    4  426  W4C3A4     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. FSL R7-269 GN=argJ PE=3 SV=1
  643 : W6DQD0_LISMN        0.54  0.70  193  405  185  396  213    1    1  398  W6DQD0     N-acetylglutamate synthase OS=Listeria monocytogenes WSLC1001 GN=AX10_02035 PE=4 SV=1
  644 : W6DQD0_LISMN        0.54  0.76    7  191    2  184  185    1    2  398  W6DQD0     N-acetylglutamate synthase OS=Listeria monocytogenes WSLC1001 GN=AX10_02035 PE=4 SV=1
  645 : W7AWE7_LISMN        0.54  0.76    7  191    2  184  185    1    2  398  W7AWE7     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Listeria monocytogenes FSL F6-684 GN=argJ PE=4 SV=1
  646 : W7BDW4_9LIST        0.54  0.78   10  191   15  194  182    1    2  408  W7BDW4     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Listeriaceae bacterium FSL F6-971 GN=argJ PE=4 SV=1
  647 : W7CND1_9LIST        0.54  0.70  193  405  195  406  213    1    1  408  W7CND1     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Listeria weihenstephanensis FSL R9-0317 GN=argJ PE=4 SV=1
  648 : W7D4C7_9LIST        0.54  0.79   11  191   16  194  181    1    2  408  W7D4C7     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Listeriaceae bacterium FSL S10-1204 GN=argJ PE=4 SV=1
  649 : W7D7G7_9LIST        0.54  0.70  193  405  195  406  213    1    1  408  W7D7G7     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Listeria rocourtiae FSL F6-920 GN=argJ PE=4 SV=1
  650 : W7S1F8_LYSSH        0.54  0.73    2  191   19  208  190    0    0  422  W7S1F8     N-acetylglutamate synthase OS=Lysinibacillus sphaericus CBAM5 GN=P799_16110 PE=4 SV=1
  651 : C2D3D1_LACBR        0.53  0.75  193  405  189  400  214    2    3  402  C2D3D1     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus brevis subsp. gravesensis ATCC 27305 GN=argJ PE=3 SV=1
  652 : C4L125_EXISA        0.53  0.72    2  191    1  191  191    1    1  405  C4L125     Arginine biosynthesis bifunctional protein ArgJ OS=Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b) GN=argJ PE=3 SV=1
  653 : C6D4V0_PAESJ        0.53  0.69   11  191   17  200  188    4   11  414  C6D4V0     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. (strain JDR-2) GN=argJ PE=3 SV=1
  654 : C8MFY8_STAAU        0.53  0.71    8  191   16  199  185    2    2  413  C8MFY8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9635 GN=argJ PE=3 SV=1
  655 : E3YZG3_LISIO        0.53  0.69  193  405  185  396  213    1    1  398  E3YZG3     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria innocua FSL S4-378 GN=argJ PE=3 SV=1
  656 : F4BLU5_CARS1        0.53  0.70  193  405  200  411  213    1    1  413  F4BLU5     Arginine biosynthesis bifunctional protein ArgJ OS=Carnobacterium sp. (strain 17-4) GN=argJ PE=3 SV=1
  657 : F6DPH2_DESRL        0.53  0.70  193  405  193  404  213    1    1  406  F6DPH2     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotomaculum ruminis (strain ATCC 23193 / DSM 2154 / NCIB 8452 / DL) GN=argJ PE=3 SV=1
  658 : F9JXM6_STAAU        0.53  0.71    8  191   16  199  185    2    2  413  F9JXM6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21200 GN=argJ PE=3 SV=1
  659 : G5KZR7_STRSU        0.53  0.72  193  405  184  395  213    1    1  397  G5KZR7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus suis R61 GN=argJ PE=3 SV=1
  660 : H0CAC9_STAAU        0.53  0.71    8  191   16  199  185    2    2  413  H0CAC9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21194 GN=argJ PE=3 SV=1
  661 : H3RQ44_9LACO        0.53  0.70  193  405  193  406  215    2    3  408  H3RQ44     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus mucosae LM1 GN=argJ PE=3 SV=1
  662 : H4B6H5_STAAU        0.53  0.71    8  191   16  199  185    2    2  413  H4B6H5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1524 GN=argJ PE=3 SV=1
  663 : K2H486_9BACI        0.53  0.71  193  405  192  403  213    1    1  405  K2H486     Arginine biosynthesis bifunctional protein ArgJ OS=Salimicrobium sp. MJ3 GN=argJ PE=3 SV=1
  664 : M2JZM6_STRMG        0.53  0.72  193  405  184  395  213    1    1  397  M2JZM6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans ST1 GN=argJ PE=3 SV=1
  665 : M3IFZ4_9LIST        0.53  0.74    7  191    2  184  185    1    2  399  M3IFZ4     Arginine biosynthesis bifunctional protein ArgJ OS=Listeria fleischmannii LU2006-1 GN=argJ PE=3 SV=1
  666 : N5ZX49_STAAU        0.53  0.71    8  191   16  199  185    2    2  413  N5ZX49     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0877 GN=argJ PE=3 SV=1
  667 : N6L9I9_STAAU        0.53  0.71    8  191   16  199  185    2    2  413  N6L9I9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1311 GN=argJ PE=3 SV=1
  668 : R2S861_9ENTE        0.53  0.70  193  405  183  394  213    1    1  396  R2S861     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus asini ATCC 700915 GN=argJ PE=3 SV=1
  669 : R2SBP8_9ENTE        0.53  0.72  193  405  184  395  213    1    1  397  R2SBP8     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus pallens ATCC BAA-351 GN=argJ PE=3 SV=1
  670 : R9YLS5_STAAU        0.53  0.71    8  191   16  199  185    2    2  413  R9YLS5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus CA-347 GN=argJ PE=3 SV=1
  671 : S0JIY3_9ENTE        0.53  0.69  193  405  185  396  213    1    1  398  S0JIY3     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus saccharolyticus ATCC 43076 GN=argJ PE=3 SV=1
  672 : S0KIP3_9ENTE        0.53  0.68  193  405  182  393  214    2    3  395  S0KIP3     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus dispar ATCC 51266 GN=argJ PE=3 SV=1
  673 : T2LZ23_9BACL        0.53  0.70    5  191   13  202  194    4   11  416  T2LZ23     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. P22 GN=argJ PE=3 SV=1
  674 : U6B778_9BACL        0.53  0.68  193  405  192  403  213    1    1  405  U6B778     Arginine biosynthesis bifunctional protein ArgJ OS=Exiguobacterium sp. MH3 GN=argJ PE=3 SV=1
  675 : V6T2F6_9BACI        0.53  0.71    8  191   14  197  184    0    0  411  V6T2F6     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. 17376 GN=argJ PE=3 SV=1
  676 : W4BC81_9BACL        0.53  0.75    5  191   10  198  190    3    4  412  W4BC81     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. FSL R5-192 GN=argJ PE=3 SV=1
  677 : W7RY51_BACLI        0.53  0.70   10  191   13  192  182    1    2  406  W7RY51     N-acetylglutamate synthase OS=Bacillus licheniformis S 16 GN=M769_0103530 PE=4 SV=1
  678 : W7YPE4_9BACL        0.53  0.70    9  191   10  194  186    3    4  408  W7YPE4     Glutamate N-acetyltransferase OS=Paenibacillus pini JCM 16418 GN=JCM16418_4476 PE=4 SV=1
  679 : A8U6G3_9LACT        0.52  0.69  193  405  198  409  213    1    1  411  A8U6G3     Arginine biosynthesis bifunctional protein ArgJ OS=Carnobacterium sp. AT7 GN=argJ PE=3 SV=1
  680 : ARGJ_STRMU          0.52  0.72  193  405  184  395  213    1    1  397  Q8DV45     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans serotype c (strain ATCC 700610 / UA159) GN=argJ PE=3 SV=1
  681 : C9A292_ENTGA        0.52  0.70   11  191    6  182  181    2    4  396  C9A292     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus gallinarum EG2 GN=argJ PE=3 SV=1
  682 : C9A9U1_ENTCA        0.52  0.69  193  405  183  394  213    1    1  396  C9A9U1     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus casseliflavus EC20 GN=argJ PE=3 SV=2
  683 : C9AYD8_ENTCA        0.52  0.69  193  405  190  401  213    1    1  403  C9AYD8     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus casseliflavus EC30 GN=argJ PE=3 SV=1
  684 : D5WRZ0_KYRT2        0.52  0.69  193  405  201  412  213    1    1  414  D5WRZ0     Arginine biosynthesis bifunctional protein ArgJ OS=Kyrpidia tusciae (strain DSM 2912 / NBRC 15312 / T2) GN=argJ PE=3 SV=1
  685 : E0PIT5_STRGY        0.52  0.72  193  405  184  395  213    1    1  397  E0PIT5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus gallolyticus subsp. gallolyticus TX20005 GN=argJ PE=3 SV=1
  686 : E6TYY8_BACCJ        0.52  0.71    8  191   12  194  185    3    3  408  E6TYY8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus cellulosilyticus (strain ATCC 21833 / DSM 2522 / FERM P-1141 / JCM 9156 / N-4) GN=argJ PE=3 SV=1
  687 : F0VWG0_STRG2        0.52  0.72  193  405  184  395  213    1    1  397  F0VWG0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus gallolyticus (strain ATCC BAA-2069) GN=argJ PE=3 SV=1
  688 : F2F8U4_SOLSS        0.52  0.76    5  191    7  193  187    0    0  407  F2F8U4     Arginine biosynthesis bifunctional protein ArgJ OS=Solibacillus silvestris (strain StLB046) GN=argJ PE=3 SV=1
  689 : F5WZU1_STRG1        0.52  0.72  193  405  184  395  213    1    1  397  F5WZU1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus gallolyticus (strain ATCC 43143 / F-1867) GN=argJ PE=3 SV=1
  690 : G5IPX0_9ENTE        0.52  0.67  193  405  183  394  213    1    1  396  G5IPX0     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus saccharolyticus 30_1 GN=argJ PE=3 SV=1
  691 : G5IPX0_9ENTE        0.52  0.70   11  191    6  182  181    2    4  396  G5IPX0     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus saccharolyticus 30_1 GN=argJ PE=3 SV=1
  692 : I6SUF2_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  I6SUF2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans GS-5 GN=argJ PE=3 SV=1
  693 : I7L7H9_9LACT        0.52  0.68  193  405  187  397  214    3    4  399  I7L7H9     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus raffinolactis 4877 GN=argJ PE=3 SV=1
  694 : J0XQV1_9ENTE        0.52  0.69  193  405  183  394  213    1    1  396  J0XQV1     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus sp. C1 GN=argJ PE=3 SV=1
  695 : J9W9Q4_LACBU        0.52  0.73  193  405  189  400  213    1    1  402  J9W9Q4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus buchneri CD034 GN=argJ PE=3 SV=1
  696 : K1KVH5_9BACI        0.52  0.76    5  191    7  193  187    0    0  407  K1KVH5     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus isronensis B3W22 GN=argJ PE=3 SV=1
  697 : K8DYJ1_9FIRM        0.52  0.69  193  405  193  404  213    1    1  406  K8DYJ1     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotomaculum hydrothermale Lam5 = DSM 18033 GN=argJ PE=3 SV=1
  698 : M2CQK4_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2CQK4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 11A1 GN=argJ PE=3 SV=1
  699 : M2DVD6_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2DVD6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 2ST1 GN=argJ PE=3 SV=1
  700 : M2EGK9_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2EGK9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 1SM1 GN=argJ PE=3 SV=1
  701 : M2EQV3_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2EQV3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 4SM1 GN=argJ PE=3 SV=1
  702 : M2EV68_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2EV68     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NFSM2 GN=argJ PE=3 SV=1
  703 : M2FUR2_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2FUR2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans A9 GN=argJ PE=3 SV=1
  704 : M2FX77_STRMG        0.52  0.71  193  405  184  395  213    1    1  397  M2FX77     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans G123 GN=argJ PE=3 SV=1
  705 : M2FZI8_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2FZI8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans N29 GN=argJ PE=3 SV=1
  706 : M2G1B6_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2G1B6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NVAB GN=argJ PE=3 SV=1
  707 : M2GEM6_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2GEM6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans U138 GN=argJ PE=3 SV=1
  708 : M2GTI3_STRMG        0.52  0.71  193  405  184  395  213    1    1  397  M2GTI3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans M21 GN=argJ PE=3 SV=1
  709 : M2GTV2_STRMG        0.52  0.71  193  405  184  395  213    1    1  397  M2GTV2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NLML4 GN=argJ PE=3 SV=1
  710 : M2GWT8_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2GWT8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NLML5 GN=argJ PE=3 SV=1
  711 : M2HHI1_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2HHI1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans N66 GN=argJ PE=3 SV=1
  712 : M2HS78_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2HS78     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans T4 GN=argJ PE=3 SV=1
  713 : M2IK10_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2IK10     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NLML9 GN=argJ PE=3 SV=1
  714 : M2J2W0_STRMG        0.52  0.71  193  405  184  395  213    1    1  397  M2J2W0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 14D GN=argJ PE=3 SV=1
  715 : M2JDH3_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2JDH3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SF1 GN=argJ PE=3 SV=1
  716 : M2JLT0_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2JLT0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SF14 GN=argJ PE=3 SV=1
  717 : M2K197_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2K197     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NLML1 GN=argJ PE=3 SV=1
  718 : M2KDE9_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2KDE9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SA41 GN=argJ PE=3 SV=1
  719 : M2KHL3_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2KHL3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SM4 GN=argJ PE=3 SV=1
  720 : M2KHT4_STRMG        0.52  0.71  193  405  184  395  213    1    1  397  M2KHT4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans B GN=argJ PE=3 SV=1
  721 : M2KKE0_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2KKE0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 66-2A GN=argJ PE=3 SV=1
  722 : M2KVG0_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2KVG0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SM1 GN=argJ PE=3 SV=1
  723 : M2KYG2_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2KYG2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans OMZ175 GN=argJ PE=3 SV=1
  724 : M2LXZ8_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2LXZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SA38 GN=argJ PE=3 SV=1
  725 : M2M6Q6_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2M6Q6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SF12 GN=argJ PE=3 SV=1
  726 : M2MD61_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2MD61     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans M230 GN=argJ PE=3 SV=1
  727 : M2MHK4_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M2MHK4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans U2B GN=argJ PE=3 SV=1
  728 : M5P9H3_9BACI        0.52  0.68    9  191   12  192  183    1    2  406  M5P9H3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sonorensis L12 GN=argJ PE=3 SV=1
  729 : M7D0V6_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M7D0V6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans KK21 GN=argJ PE=3 SV=1
  730 : M7DG35_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M7DG35     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans KK23 GN=argJ PE=3 SV=1
  731 : M7DS39_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M7DS39     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NCTC 11060 GN=argJ PE=3 SV=1
  732 : M7DVP2_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  M7DVP2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans ATCC 25175 GN=argJ PE=3 SV=1
  733 : N0APP8_9BACI        0.52  0.73    1  191    6  196  191    0    0  410  N0APP8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. 1NLA3E GN=argJ PE=3 SV=1
  734 : Q030G4_LACLS        0.52  0.69  193  405  183  393  213    2    2  395  Q030G4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris (strain SK11) GN=argJ PE=3 SV=1
  735 : Q2B923_9BACI        0.52  0.70    3  191    8  196  189    0    0  410  Q2B923     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus sp. NRRL B-14911 GN=argJ PE=3 SV=1
  736 : Q2RG63_MOOTA        0.52  0.69  193  405  190  403  217    3    7  405  Q2RG63     Arginine biosynthesis bifunctional protein ArgJ OS=Moorella thermoacetica (strain ATCC 39073) GN=argJ PE=3 SV=1
  737 : S1RNL8_9ENTE        0.52  0.71  193  405  185  396  213    1    1  398  S1RNL8     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus cecorum DSM 20682 = ATCC 43198 GN=argJ PE=3 SV=1
  738 : S4AWS0_ENTCA        0.52  0.69  193  405  190  401  213    1    1  403  S4AWS0     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus casseliflavus 14-MB-W-14 GN=argJ PE=3 SV=1
  739 : T0S4Z2_LACLC        0.52  0.69  193  405   19  229  213    2    2  231  T0S4Z2     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris TIFN6 GN=argJ PE=3 SV=1
  740 : T0T8T4_LACLC        0.52  0.69  193  405  183  393  213    2    2  395  T0T8T4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris TIFN5 GN=argJ PE=3 SV=1
  741 : T0U1C4_9ENTE        0.52  0.70   11  191    6  182  181    2    4  396  T0U1C4     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus sp. HSIEG1 GN=argJ PE=3 SV=1
  742 : T0UT44_LACLC        0.52  0.69  193  405  183  393  213    2    2  395  T0UT44     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris TIFN1 GN=argJ PE=3 SV=1
  743 : T0VEQ3_LACLC        0.52  0.69  193  405  183  393  213    2    2  395  T0VEQ3     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris TIFN3 GN=argJ PE=3 SV=1
  744 : U5L9X3_9BACI        0.52  0.70    3  191    8  196  189    0    0  410  U5L9X3     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus infantis NRRL B-14911 GN=argJ PE=3 SV=1
  745 : U5SB53_9LACT        0.52  0.74  193  405  198  409  213    1    1  411  U5SB53     Arginine biosynthesis bifunctional protein ArgJ OS=Carnobacterium sp. WN1359 GN=argJ PE=3 SV=1
  746 : V5AQD8_STRMG        0.52  0.72  193  405  184  395  213    1    1  397  V5AQD8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans PKUSS-LG01 GN=argJ PE=3 SV=1
  747 : V7HW31_9LACO        0.52  0.71  193  405   88  299  213    1    1  301  V7HW31     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus equi DPC 6820 GN=argJ PE=3 SV=1
  748 : W4BYH7_9BACL        0.52  0.74    5  191   10  198  190    3    4  412  W4BYH7     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. FSL H7-689 GN=argJ PE=3 SV=1
  749 : W4DB48_9BACL        0.52  0.69    1  191    3  195  194    3    4  410  W4DB48     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. FSL H8-237 GN=argJ PE=3 SV=1
  750 : W7CND1_9LIST        0.52  0.77   11  191   16  194  181    1    2  408  W7CND1     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Listeria weihenstephanensis FSL R9-0317 GN=argJ PE=4 SV=1
  751 : W7CYG9_9LIST        0.52  0.75  193  405  186  398  214    2    2  400  W7CYG9     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Brochothrix campestris FSL F6-1037 GN=argJ PE=4 SV=1
  752 : W7D7G7_9LIST        0.52  0.76   10  191   15  194  182    1    2  408  W7D7G7     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Listeria rocourtiae FSL F6-920 GN=argJ PE=4 SV=1
  753 : A2RM02_LACLM        0.51  0.68  193  405  184  394  213    2    2  396  A2RM02     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris (strain MG1363) GN=argJ PE=3 SV=1
  754 : A5IP52_STAA9        0.51  0.72   10  191   18  199  183    2    2  413  A5IP52     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain JH9) GN=argJ PE=3 SV=1
  755 : A6TXW7_STAA2        0.51  0.72   10  191   18  199  183    2    2  413  A6TXW7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain JH1) GN=argJ PE=3 SV=1
  756 : A7WXH4_STAA1        0.51  0.72   10  191   18  199  183    2    2  413  A7WXH4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain Mu3 / ATCC 700698) GN=argJ PE=3 SV=1
  757 : A8AYI6_STRGC        0.51  0.69    7  191    2  183  185    1    3  397  A8AYI6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus gordonii (strain Challis / ATCC 35105 / CH1 / DL1 / V288) GN=argJ PE=3 SV=1
  758 : ARGJ_STAAM          0.51  0.72   10  191   18  199  183    2    2  413  P63575     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain Mu50 / ATCC 700699) GN=argJ PE=3 SV=1
  759 : ARGJ_STAAN          0.51  0.72   10  191   18  199  183    2    2  413  P63576     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain N315) GN=argJ PE=3 SV=1
  760 : ARGJ_STAS1          0.51  0.73   11  191   19  198  181    1    1  412  Q4A0N0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229) GN=argJ PE=3 SV=1
  761 : B1YJM0_EXIS2        0.51  0.74   13  191   14  193  180    1    1  407  B1YJM0     Arginine biosynthesis bifunctional protein ArgJ OS=Exiguobacterium sibiricum (strain DSM 17290 / JCM 13490 / 255-15) GN=argJ PE=3 SV=1
  762 : C3XGK7_9HELI        0.51  0.69  193  405  260  475  217    2    5  477  C3XGK7     Arginine biosynthesis bifunctional protein ArgJ OS=Helicobacter bilis ATCC 43879 GN=argJ PE=3 SV=1
  763 : C8L754_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  C8L754     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A5937 GN=argJ PE=3 SV=1
  764 : C8LHV4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  C8LHV4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A6224 GN=argJ PE=3 SV=1
  765 : C8LUB2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  C8LUB2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A6300 GN=argJ PE=3 SV=1
  766 : C8M1I0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  C8M1I0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A8115 GN=argJ PE=3 SV=1
  767 : C8M966_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  C8M966     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9299 GN=argJ PE=3 SV=1
  768 : C8MMH1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  C8MMH1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9719 GN=argJ PE=3 SV=1
  769 : C8MTK4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  C8MTK4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9763 GN=argJ PE=3 SV=1
  770 : C8N124_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  C8N124     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9781 GN=argJ PE=3 SV=1
  771 : C8W632_DESAS        0.51  0.70  193  405  192  403  213    1    1  405  C8W632     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotomaculum acetoxidans (strain ATCC 49208 / DSM 771 / VKM B-1644) GN=argJ PE=3 SV=1
  772 : C9AYD8_ENTCA        0.51  0.71   11  191   13  189  181    2    4  403  C9AYD8     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus casseliflavus EC30 GN=argJ PE=3 SV=1
  773 : C9CKV4_ENTCA        0.51  0.71   11  191   13  189  181    2    4  403  C9CKV4     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus casseliflavus EC10 GN=argJ PE=3 SV=1
  774 : D0K7U0_STAAD        0.51  0.72   10  191   18  199  183    2    2  413  D0K7U0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain ED98) GN=argJ PE=3 SV=1
  775 : D0RW44_9STRE        0.51  0.69    7  191    2  183  185    1    3  397  D0RW44     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sp. 2_1_36FAA GN=argJ PE=3 SV=1
  776 : D1QEC1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  D1QEC1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A10102 GN=argJ PE=3 SV=1
  777 : D1QYH6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  D1QYH6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A8117 GN=argJ PE=3 SV=1
  778 : D3ES11_STAA4        0.51  0.72   10  191   18  199  183    2    2  413  D3ES11     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain 04-02981) GN=argJ PE=3 SV=1
  779 : D4UCC7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  D4UCC7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A8819 GN=argJ PE=3 SV=1
  780 : D6T5F5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  D6T5F5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A8796 GN=argJ PE=3 SV=1
  781 : D8KCT5_LACLN        0.51  0.68  193  405  184  394  213    2    2  396  D8KCT5     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris (strain NZ9000) GN=argJ PE=3 SV=1
  782 : E0RHL1_PAEP6        0.51  0.72    8  191    9  194  187    3    4  408  E0RHL1     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus polymyxa (strain E681) GN=argJ PE=3 SV=1
  783 : E5R651_STAAG        0.51  0.72   10  191   18  199  183    2    2  413  E5R651     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain ECT-R 2) GN=argJ PE=3 SV=1
  784 : E5TUD5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  E5TUD5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CGS03 GN=argJ PE=3 SV=1
  785 : E8KQL9_STRSA        0.51  0.73  193  405  184  395  213    1    1  397  E8KQL9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis VMC66 GN=argJ PE=3 SV=1
  786 : F0EG92_ENTCA        0.51  0.71   11  191   13  189  181    2    4  403  F0EG92     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus casseliflavus ATCC 12755 GN=argJ PE=3 SV=1
  787 : F0FKQ1_STRSA        0.51  0.73  193  405  184  395  213    1    1  397  F0FKQ1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK405 GN=argJ PE=3 SV=1
  788 : F0FSJ6_STRSA        0.51  0.72  193  405  184  395  213    1    1  397  F0FSJ6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK678 GN=argJ PE=3 SV=1
  789 : F0FSJ6_STRSA        0.51  0.69    7  191    2  183  185    1    3  397  F0FSJ6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK678 GN=argJ PE=3 SV=1
  790 : F0INL5_STRSA        0.51  0.73  193  405  184  395  213    1    1  397  F0INL5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK150 GN=argJ PE=3 SV=1
  791 : F0ITB6_STRSA        0.51  0.69    7  191    2  183  185    1    3  397  F0ITB6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK160 GN=argJ PE=3 SV=1
  792 : F2BJJ0_STRSA        0.51  0.73  193  405  184  395  213    1    1  397  F2BJJ0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK1 GN=argJ PE=3 SV=1
  793 : F2BTS7_STRSA        0.51  0.73  193  405  184  395  213    1    1  397  F2BTS7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK1057 GN=argJ PE=3 SV=1
  794 : F2CEY2_STRSA        0.51  0.73  193  405  184  395  213    1    1  397  F2CEY2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK408 GN=argJ PE=3 SV=1
  795 : F2CMQ2_STRSA        0.51  0.73  193  405  184  395  213    1    1  397  F2CMQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK1058 GN=argJ PE=3 SV=1
  796 : F3TD54_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  F3TD54     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21172 GN=argJ PE=3 SV=1
  797 : F3UBT9_STRSA        0.51  0.69    7  191    2  183  185    1    3  397  F3UBT9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK1056 GN=argJ PE=3 SV=1
  798 : F3UIP5_STRSA        0.51  0.72  193  405  184  395  213    1    1  397  F3UIP5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK1059 GN=argJ PE=3 SV=1
  799 : F3UIP5_STRSA        0.51  0.69    7  191    2  183  185    1    3  397  F3UIP5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK1059 GN=argJ PE=3 SV=1
  800 : F3UR51_STRSA        0.51  0.69    7  191    2  183  185    1    3  397  F3UR51     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK355 GN=argJ PE=3 SV=1
  801 : F3UWC8_STRSA        0.51  0.73  193  405  184  395  213    1    1  397  F3UWC8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK49 GN=argJ PE=3 SV=1
  802 : F3UWC8_STRSA        0.51  0.68    7  191    2  183  185    1    3  397  F3UWC8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK49 GN=argJ PE=3 SV=1
  803 : F5LSQ8_9BACL        0.51  0.69    2  191    4  194  195    3    9  408  F5LSQ8     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. HGF7 GN=argJ PE=3 SV=1
  804 : F5SGS4_9BACL        0.51  0.72  193  405  201  412  214    2    3  414  F5SGS4     Arginine biosynthesis bifunctional protein ArgJ OS=Desmospora sp. 8437 GN=argJ PE=3 SV=1
  805 : F5WBL3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  F5WBL3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21310 GN=argJ PE=3 SV=1
  806 : F5WPZ1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  F5WPZ1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21318 GN=argJ PE=3 SV=1
  807 : F6B5T7_DESCC        0.51  0.69  193  405  194  405  213    1    1  407  F6B5T7     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotomaculum carboxydivorans (strain DSM 14880 / VKM B-2319 / CO-1-SRB) GN=argJ PE=3 SV=1
  808 : F7Z4Z8_BACC6        0.51  0.67   11  191   18  198  185    2    8  413  F7Z4Z8     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus coagulans (strain 2-6) GN=argJ PE=3 SV=1
  809 : F9E1K6_STRSA        0.51  0.69    7  191    2  183  185    1    3  397  F9E1K6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis ATCC 29667 GN=argJ PE=3 SV=1
  810 : F9EAI2_STRSA        0.51  0.69    7  191    2  183  185    1    3  397  F9EAI2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK340 GN=argJ PE=3 SV=1
  811 : F9K543_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  F9K543     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21201 GN=argJ PE=3 SV=1
  812 : G0M3B7_LACPE        0.51  0.75  193  405  201  412  213    1    1  414  G0M3B7     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus pentosus IG1 GN=argJ PE=3 SV=1
  813 : G2TNP1_BACCO        0.51  0.70   11  191   18  197  185    3    9  412  G2TNP1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus coagulans 36D1 GN=argJ PE=3 SV=1
  814 : G6FFQ4_LACLL        0.51  0.68  193  405  184  394  213    2    2  396  G6FFQ4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis CNCM I-1631 GN=argJ PE=3 SV=1
  815 : H1LEC7_9LACO        0.51  0.74  193  405  189  400  213    1    1  402  H1LEC7     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus kisonensis F0435 GN=argJ PE=3 SV=1
  816 : H1SJV2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H1SJV2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21252 GN=argJ PE=3 SV=1
  817 : H1T9E0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H1T9E0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21272 GN=argJ PE=3 SV=1
  818 : H3X7J5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H3X7J5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-3 GN=argJ PE=3 SV=1
  819 : H3Y816_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H3Y816     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-99 GN=argJ PE=3 SV=1
  820 : H3YII2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H3YII2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-105 GN=argJ PE=3 SV=1
  821 : H3Z1G0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H3Z1G0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-122 GN=argJ PE=3 SV=1
  822 : H4A9K8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H4A9K8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1165 GN=argJ PE=3 SV=1
  823 : H4AH95_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H4AH95     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1213 GN=argJ PE=3 SV=1
  824 : H4AQW7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H4AQW7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1769 GN=argJ PE=3 SV=1
  825 : H4AY21_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H4AY21     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1150 GN=argJ PE=3 SV=1
  826 : H4BLJ4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H4BLJ4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1057 GN=argJ PE=3 SV=1
  827 : H4D7A2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H4D7A2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIGC340D GN=argJ PE=3 SV=1
  828 : H4DND5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H4DND5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIGC348 GN=argJ PE=3 SV=1
  829 : H4EKP4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H4EKP4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1750 GN=argJ PE=3 SV=1
  830 : H4HCR3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H4HCR3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1096 GN=argJ PE=3 SV=1
  831 : H4HJB7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  H4HJB7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG290 GN=argJ PE=3 SV=1
  832 : H5SY24_LACLL        0.51  0.68  193  405  184  394  213    2    2  396  H5SY24     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis IO-1 GN=argJ PE=3 SV=1
  833 : H7FEX8_STASA        0.51  0.73   11  191   19  198  181    1    1  412  H7FEX8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus saprophyticus subsp. saprophyticus KACC 16562 GN=argJ PE=3 SV=1
  834 : I0J9U5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I0J9U5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus HO 5096 0412 GN=argJ PE=3 SV=1
  835 : I0QJQ9_STRSL        0.51  0.71  193  405  184  395  213    1    1  397  I0QJQ9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius PS4 GN=argJ PE=3 SV=1
  836 : I0U155_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I0U155     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-M GN=argJ PE=3 SV=1
  837 : I3FE34_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I3FE34     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS3a GN=argJ PE=3 SV=1
  838 : I3FES4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I3FES4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS2 GN=argJ PE=3 SV=1
  839 : I3FI22_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I3FI22     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS1 GN=argJ PE=3 SV=1
  840 : I3FY22_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I3FY22     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS4 GN=argJ PE=3 SV=1
  841 : I3G1B3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I3G1B3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS5 GN=argJ PE=3 SV=1
  842 : I3G6H0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I3G6H0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS6 GN=argJ PE=3 SV=1
  843 : I3GSG2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I3GSG2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS8 GN=argJ PE=3 SV=1
  844 : I3GVQ2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I3GVQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS7 GN=argJ PE=3 SV=1
  845 : I3HI79_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I3HI79     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS11a GN=argJ PE=3 SV=1
  846 : I3HJL6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  I3HJL6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS11b GN=argJ PE=3 SV=1
  847 : I9APS3_LACPE        0.51  0.74  193  405  189  400  213    1    1  402  I9APS3     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus pentosus KCA1 GN=argJ PE=3 SV=1
  848 : J5ACI3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  J5ACI3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CM05 GN=argJ PE=3 SV=1
  849 : J7T6D2_STRSL        0.51  0.71  193  405  184  395  213    1    1  397  J7T6D2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius K12 GN=argJ PE=3 SV=1
  850 : K0AAI0_EXIAB        0.51  0.74   14  191   13  191  179    1    1  405  K0AAI0     Arginine biosynthesis bifunctional protein ArgJ OS=Exiguobacterium antarcticum (strain B7) GN=argJ PE=3 SV=1
  851 : K0L574_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  K0L574     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus ST228 GN=argJ PE=3 SV=1
  852 : K0U3L1_9STAP        0.51  0.69   11  191   19  198  181    1    1  412  K0U3L1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus arlettae CVD059 GN=argJ PE=3 SV=1
  853 : K7WM21_LACLC        0.51  0.68  193  405  183  393  213    2    2  395  K7WM21     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris UC509.9 GN=argJ PE=3 SV=1
  854 : L8QI58_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  L8QI58     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21236 GN=argJ PE=3 SV=1
  855 : N1XM63_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N1XM63     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0075 GN=argJ PE=3 SV=1
  856 : N1Y3B0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N1Y3B0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0294 GN=argJ PE=3 SV=1
  857 : N1Y8H0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N1Y8H0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1060 GN=argJ PE=3 SV=1
  858 : N1YI95_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N1YI95     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1078 GN=argJ PE=3 SV=1
  859 : N1YL41_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N1YL41     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1193 GN=argJ PE=3 SV=1
  860 : N1Z540_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N1Z540     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1228 GN=argJ PE=3 SV=1
  861 : N1Z7Z2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N1Z7Z2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1407 GN=argJ PE=3 SV=1
  862 : N1ZLI8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N1ZLI8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1466 GN=argJ PE=3 SV=1
  863 : N4WPE1_9BACI        0.51  0.67    2  191    9  197  194    3    9  411  N4WPE1     Arginine biosynthesis bifunctional protein ArgJ OS=Gracilibacillus halophilus YIM-C55.5 GN=argJ PE=3 SV=1
  864 : N4Y6E6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N4Y6E6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus B40723 GN=argJ PE=3 SV=1
  865 : N4YB89_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N4YB89     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus B147830 GN=argJ PE=3 SV=1
  866 : N4YNH4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N4YNH4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus B40950 GN=argJ PE=3 SV=1
  867 : N4YX28_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N4YX28     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus B53639 GN=argJ PE=3 SV=1
  868 : N5AXC6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5AXC6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0029 GN=argJ PE=3 SV=1
  869 : N5B4H6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5B4H6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0001 GN=argJ PE=3 SV=1
  870 : N5BWC2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5BWC2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0035 GN=argJ PE=3 SV=1
  871 : N5BYW4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5BYW4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0006 GN=argJ PE=3 SV=1
  872 : N5CA92_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5CA92     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0045 GN=argJ PE=3 SV=1
  873 : N5CIW8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5CIW8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0060 GN=argJ PE=3 SV=1
  874 : N5CJA2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5CJA2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0066 GN=argJ PE=3 SV=1
  875 : N5D4V3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5D4V3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0103 GN=argJ PE=3 SV=1
  876 : N5DBZ7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5DBZ7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0077 GN=argJ PE=3 SV=1
  877 : N5DHC0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5DHC0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0102 GN=argJ PE=3 SV=1
  878 : N5DY30_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5DY30     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0144 GN=argJ PE=3 SV=1
  879 : N5E8B5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5E8B5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0104 GN=argJ PE=3 SV=1
  880 : N5ECX4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5ECX4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0171 GN=argJ PE=3 SV=1
  881 : N5EDW1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5EDW1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0108 GN=argJ PE=3 SV=1
  882 : N5EQT5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5EQT5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0177 GN=argJ PE=3 SV=1
  883 : N5EVS7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5EVS7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0150 GN=argJ PE=3 SV=1
  884 : N5EZM2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5EZM2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0154 GN=argJ PE=3 SV=1
  885 : N5F7J4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5F7J4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0192 GN=argJ PE=3 SV=1
  886 : N5FE49_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5FE49     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0173 GN=argJ PE=3 SV=1
  887 : N5FF60_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5FF60     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0200 GN=argJ PE=3 SV=1
  888 : N5FHE5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5FHE5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0210 GN=argJ PE=3 SV=1
  889 : N5G1K7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5G1K7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0197 GN=argJ PE=3 SV=1
  890 : N5G5F2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5G5F2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0216 GN=argJ PE=3 SV=1
  891 : N5GFY6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5GFY6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0212 GN=argJ PE=3 SV=1
  892 : N5GVM8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5GVM8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0213 GN=argJ PE=3 SV=1
  893 : N5GXV5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5GXV5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0235 GN=argJ PE=3 SV=1
  894 : N5H725_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5H725     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0250 GN=argJ PE=3 SV=1
  895 : N5HS89_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5HS89     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0237 GN=argJ PE=3 SV=1
  896 : N5HVY0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5HVY0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0252 GN=argJ PE=3 SV=1
  897 : N5IKW4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5IKW4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0240 GN=argJ PE=3 SV=1
  898 : N5IPC0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5IPC0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0279 GN=argJ PE=3 SV=1
  899 : N5IUL6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5IUL6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0280 GN=argJ PE=3 SV=1
  900 : N5IWD8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5IWD8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0273 GN=argJ PE=3 SV=1
  901 : N5IZP4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5IZP4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0288 GN=argJ PE=3 SV=1
  902 : N5J2X8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5J2X8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0306 GN=argJ PE=3 SV=1
  903 : N5J8Q6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5J8Q6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0270 GN=argJ PE=3 SV=1
  904 : N5JHS3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5JHS3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0326 GN=argJ PE=3 SV=1
  905 : N5K4E8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5K4E8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0328 GN=argJ PE=3 SV=1
  906 : N5KHK2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5KHK2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0329 GN=argJ PE=3 SV=1
  907 : N5KY00_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5KY00     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0330 GN=argJ PE=3 SV=1
  908 : N5KYD3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5KYD3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0334 GN=argJ PE=3 SV=1
  909 : N5LLG6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5LLG6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0347 GN=argJ PE=3 SV=1
  910 : N5LRF5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5LRF5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0363 GN=argJ PE=3 SV=1
  911 : N5M0Z5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5M0Z5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0351 GN=argJ PE=3 SV=1
  912 : N5M4J7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5M4J7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0367 GN=argJ PE=3 SV=1
  913 : N5MCU7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5MCU7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0350 GN=argJ PE=3 SV=1
  914 : N5MMJ2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5MMJ2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0374 GN=argJ PE=3 SV=1
  915 : N5MNS0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5MNS0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0375 GN=argJ PE=3 SV=1
  916 : N5MS45_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5MS45     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0364 GN=argJ PE=3 SV=1
  917 : N5MY10_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5MY10     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0391 GN=argJ PE=3 SV=1
  918 : N5N5S6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5N5S6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0404 GN=argJ PE=3 SV=1
  919 : N5NPB7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5NPB7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0415 GN=argJ PE=3 SV=1
  920 : N5PKJ6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5PKJ6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0460 GN=argJ PE=3 SV=1
  921 : N5PLW8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5PLW8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0455 GN=argJ PE=3 SV=1
  922 : N5PQD9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5PQD9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0467 GN=argJ PE=3 SV=1
  923 : N5PRW1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5PRW1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0438 GN=argJ PE=3 SV=1
  924 : N5PSQ5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5PSQ5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0427 GN=argJ PE=3 SV=1
  925 : N5QH54_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5QH54     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0478 GN=argJ PE=3 SV=1
  926 : N5QQR4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5QQR4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0450 GN=argJ PE=3 SV=1
  927 : N5QT09_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5QT09     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0493 GN=argJ PE=3 SV=1
  928 : N5RLM4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5RLM4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0494 GN=argJ PE=3 SV=1
  929 : N5RYR0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5RYR0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0510 GN=argJ PE=3 SV=1
  930 : N5S0S1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5S0S1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0528 GN=argJ PE=3 SV=1
  931 : N5S4K5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5S4K5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0489 GN=argJ PE=3 SV=1
  932 : N5S5Q7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5S5Q7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0529 GN=argJ PE=3 SV=1
  933 : N5SLT6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5SLT6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0536 GN=argJ PE=3 SV=1
  934 : N5TE57_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5TE57     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0539 GN=argJ PE=3 SV=1
  935 : N5TK81_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5TK81     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0547 GN=argJ PE=3 SV=1
  936 : N5TR49_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5TR49     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0562 GN=argJ PE=3 SV=1
  937 : N5TVY7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5TVY7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0580 GN=argJ PE=3 SV=1
  938 : N5U4V3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5U4V3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0565 GN=argJ PE=3 SV=1
  939 : N5UA53_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5UA53     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0584 GN=argJ PE=3 SV=1
  940 : N5UBN4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5UBN4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0602 GN=argJ PE=3 SV=1
  941 : N5UIA5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5UIA5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0586 GN=argJ PE=3 SV=1
  942 : N5V4K9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5V4K9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0622 GN=argJ PE=3 SV=1
  943 : N5VIF2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5VIF2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0628 GN=argJ PE=3 SV=1
  944 : N5VLI1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5VLI1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0648 GN=argJ PE=3 SV=1
  945 : N5WIY5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5WIY5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0687 GN=argJ PE=3 SV=1
  946 : N5WNK3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5WNK3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0673 GN=argJ PE=3 SV=1
  947 : N5WT36_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5WT36     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0660 GN=argJ PE=3 SV=1
  948 : N5X1D9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5X1D9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0663 GN=argJ PE=3 SV=1
  949 : N5X7D8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5X7D8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0676 GN=argJ PE=3 SV=1
  950 : N5X7U1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5X7U1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0695 GN=argJ PE=3 SV=1
  951 : N5XHR8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5XHR8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0769 GN=argJ PE=3 SV=1
  952 : N5XXK2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5XXK2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0719 GN=argJ PE=3 SV=1
  953 : N5Y092_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5Y092     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0770 GN=argJ PE=3 SV=1
  954 : N5YJ08_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5YJ08     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0792 GN=argJ PE=3 SV=1
  955 : N5YNA3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5YNA3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0799 GN=argJ PE=3 SV=1
  956 : N5YSM7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5YSM7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0780 GN=argJ PE=3 SV=1
  957 : N5ZI28_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5ZI28     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0822 GN=argJ PE=3 SV=1
  958 : N5ZTH4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N5ZTH4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0844 GN=argJ PE=3 SV=1
  959 : N6A664_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6A664     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0823 GN=argJ PE=3 SV=1
  960 : N6AEU9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6AEU9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0900 GN=argJ PE=3 SV=1
  961 : N6AN71_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6AN71     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0892 GN=argJ PE=3 SV=1
  962 : N6AVA8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6AVA8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0871 GN=argJ PE=3 SV=1
  963 : N6B6A9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6B6A9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0953 GN=argJ PE=3 SV=1
  964 : N6B9T3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6B9T3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0978 GN=argJ PE=3 SV=1
  965 : N6BBA3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6BBA3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0994 GN=argJ PE=3 SV=1
  966 : N6BD46_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6BD46     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0927 GN=argJ PE=3 SV=1
  967 : N6BNM0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6BNM0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0934 GN=argJ PE=3 SV=1
  968 : N6BY40_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6BY40     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0964 GN=argJ PE=3 SV=1
  969 : N6C853_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6C853     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0998 GN=argJ PE=3 SV=1
  970 : N6CSN5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6CSN5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1010 GN=argJ PE=3 SV=1
  971 : N6D5E8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6D5E8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1015 GN=argJ PE=3 SV=1
  972 : N6D626_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6D626     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0999 GN=argJ PE=3 SV=1
  973 : N6DHS9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6DHS9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1016 GN=argJ PE=3 SV=1
  974 : N6DPI9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6DPI9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1036 GN=argJ PE=3 SV=1
  975 : N6E8P8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6E8P8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1037 GN=argJ PE=3 SV=1
  976 : N6E9X8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6E9X8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1062 GN=argJ PE=3 SV=1
  977 : N6ECS5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6ECS5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1044 GN=argJ PE=3 SV=1
  978 : N6EQN1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6EQN1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1063 GN=argJ PE=3 SV=1
  979 : N6F705_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6F705     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1061 GN=argJ PE=3 SV=1
  980 : N6FEX8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6FEX8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1093 GN=argJ PE=3 SV=1
  981 : N6FKL1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6FKL1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1076 GN=argJ PE=3 SV=1
  982 : N6FLL0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6FLL0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1068 GN=argJ PE=3 SV=1
  983 : N6G8E1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6G8E1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1083 GN=argJ PE=3 SV=1
  984 : N6GCX4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6GCX4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1103 GN=argJ PE=3 SV=1
  985 : N6GEJ1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6GEJ1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1109 GN=argJ PE=3 SV=1
  986 : N6GFM9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6GFM9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1092 GN=argJ PE=3 SV=1
  987 : N6H3T1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6H3T1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1119 GN=argJ PE=3 SV=1
  988 : N6H4P3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6H4P3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1095 GN=argJ PE=3 SV=1
  989 : N6HER5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6HER5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1142 GN=argJ PE=3 SV=1
  990 : N6HPG1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6HPG1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1170 GN=argJ PE=3 SV=1
  991 : N6HR82_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6HR82     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1126 GN=argJ PE=3 SV=1
  992 : N6I4S1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6I4S1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1188 GN=argJ PE=3 SV=1
  993 : N6IGR0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6IGR0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1167 GN=argJ PE=3 SV=1
  994 : N6J182_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6J182     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1229 GN=argJ PE=3 SV=1
  995 : N6J9A3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6J9A3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1224 GN=argJ PE=3 SV=1
  996 : N6JFX5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6JFX5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1275 GN=argJ PE=3 SV=1
  997 : N6JUC2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6JUC2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1277 GN=argJ PE=3 SV=1
  998 : N6JV64_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6JV64     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1244 GN=argJ PE=3 SV=1
  999 : N6K0E8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6K0E8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1257 GN=argJ PE=3 SV=1
 1000 : N6K9R7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6K9R7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1291 GN=argJ PE=3 SV=1
 1001 : N6KIM2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6KIM2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1286 GN=argJ PE=3 SV=1
 1002 : N6L706_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6L706     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1309 GN=argJ PE=3 SV=1
 1003 : N6L9P9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6L9P9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1320 GN=argJ PE=3 SV=1
 1004 : N6L9R5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6L9R5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1321 GN=argJ PE=3 SV=1
 1005 : N6LMM5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6LMM5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1322 GN=argJ PE=3 SV=1
 1006 : N6LWF3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6LWF3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1367 GN=argJ PE=3 SV=1
 1007 : N6MCJ4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6MCJ4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1359 GN=argJ PE=3 SV=1
 1008 : N6MQQ2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6MQQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1374 GN=argJ PE=3 SV=1
 1009 : N6MRT7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6MRT7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1373 GN=argJ PE=3 SV=1
 1010 : N6MS74_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6MS74     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1394 GN=argJ PE=3 SV=1
 1011 : N6N6N9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6N6N9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1450 GN=argJ PE=3 SV=1
 1012 : N6NKK9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6NKK9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1451 GN=argJ PE=3 SV=1
 1013 : N6NN76_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6NN76     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1521 GN=argJ PE=3 SV=1
 1014 : N6NNM5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6NNM5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1481 GN=argJ PE=3 SV=1
 1015 : N6NNN0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6NNN0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1463 GN=argJ PE=3 SV=1
 1016 : N6NPD0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6NPD0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1405 GN=argJ PE=3 SV=1
 1017 : N6P2A5_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6P2A5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1510 GN=argJ PE=3 SV=1
 1018 : N6PSX0_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6PSX0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1520 GN=argJ PE=3 SV=1
 1019 : N6PWW9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6PWW9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1544 GN=argJ PE=3 SV=1
 1020 : N6Q189_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6Q189     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1533 GN=argJ PE=3 SV=1
 1021 : N6QBR9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6QBR9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1531 GN=argJ PE=3 SV=1
 1022 : N6QHS8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6QHS8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1565 GN=argJ PE=3 SV=1
 1023 : N6R4R6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6R4R6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1556 GN=argJ PE=3 SV=1
 1024 : N6R5L4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6R5L4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1563 GN=argJ PE=3 SV=1
 1025 : N6R8V2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6R8V2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0944 GN=argJ PE=3 SV=1
 1026 : N6RAL3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6RAL3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0943 GN=argJ PE=3 SV=1
 1027 : N6RCI4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6RCI4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1578 GN=argJ PE=3 SV=1
 1028 : N6RHR4_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6RHR4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1198 GN=argJ PE=3 SV=1
 1029 : N6RPC7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6RPC7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1215 GN=argJ PE=3 SV=1
 1030 : N6SDL7_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6SDL7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1199 GN=argJ PE=3 SV=1
 1031 : N6SV92_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6SV92     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1216 GN=argJ PE=3 SV=1
 1032 : N6T8U3_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6T8U3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1253 GN=argJ PE=3 SV=1
 1033 : N6TEP6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6TEP6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1248 GN=argJ PE=3 SV=1
 1034 : N6TUV1_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  N6TUV1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1255 GN=argJ PE=3 SV=1
 1035 : R7MNY0_9STRE        0.51  0.71  193  405  184  395  213    1    1  397  R7MNY0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius CAG:79 GN=argJ PE=3 SV=1
 1036 : R9D2W6_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  R9D2W6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 091751 GN=argJ PE=3 SV=1
 1037 : R9GGM8_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  R9GGM8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CBD-635 GN=argJ PE=3 SV=1
 1038 : S0KWN6_ENTAV        0.51  0.74    7  191    2  183  185    2    3  397  S0KWN6     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus avium ATCC 14025 GN=argJ PE=3 SV=1
 1039 : S1RNL8_9ENTE        0.51  0.69    7  191    2  184  185    2    2  398  S1RNL8     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus cecorum DSM 20682 = ATCC 43198 GN=argJ PE=3 SV=1
 1040 : S3AAY6_9BACL        0.51  0.69    2  191    4  194  195    3    9  408  S3AAY6     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus sp. HGH0039 GN=argJ PE=3 SV=1
 1041 : S4AWS0_ENTCA        0.51  0.71   11  191   13  189  181    2    4  403  S4AWS0     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus casseliflavus 14-MB-W-14 GN=argJ PE=3 SV=1
 1042 : S4D2I9_ENTFL        0.51  0.71   11  191   13  189  181    2    4  403  S4D2I9     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus faecalis 06-MB-DW-09 GN=argJ PE=3 SV=1
 1043 : S6FIU2_LACLL        0.51  0.68  193  405  184  394  213    2    2  396  S6FIU2     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis A12 GN=argJ PE=3 SV=1
 1044 : S9RPE2_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  S9RPE2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus SA16 GN=argJ PE=3 SV=1
 1045 : T0UQ81_LACLC        0.51  0.69  193  405  183  393  213    2    2  395  T0UQ81     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris TIFN7 GN=argJ PE=3 SV=1
 1046 : T0WF65_LACLL        0.51  0.68  193  405  197  407  213    2    2  409  T0WF65     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis bv. diacetylactis str. TIFN2 GN=argJ PE=3 SV=1
 1047 : T2NS50_ENTFC        0.51  0.71   11  191   13  189  181    2    4  403  T2NS50     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus faecium 13.SD.W.09 GN=argJ PE=3 SV=1
 1048 : T2R2Q9_STAAU        0.51  0.72   10  191   18  199  183    2    2  413  T2R2Q9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus SA_ST125_MupR GN=argJ PE=3 SV=1
 1049 : U1EMV3_9STAP        0.51  0.67   11  191   19  198  181    1    1  412  U1EMV3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus sp. EGD-HP3 GN=argJ PE=3 SV=1
 1050 : U2WJ57_LACPN        0.51  0.74  193  405  189  400  213    1    1  402  U2WJ57     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum AY01 GN=argJ PE=3 SV=1
 1051 : V5X2A6_PAEPO        0.51  0.72    8  191    9  194  187    3    4  408  V5X2A6     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus polymyxa CR1 GN=argJ PE=3 SV=1
 1052 : V6J6D0_9BACL        0.51  0.68    4  191   10  194  188    1    3  408  V6J6D0     Arginine biosynthesis bifunctional protein ArgJ OS=Sporolactobacillus laevolacticus DSM 442 GN=argJ PE=3 SV=1
 1053 : V8B4V8_STRSA        0.51  0.73  193  405  184  395  213    1    1  397  V8B4V8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis CC94A GN=argJ PE=3 SV=1
 1054 : V9W1M4_9BACL        0.51  0.72    1  191    4  194  192    2    2  408  V9W1M4     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus larvae subsp. larvae DSM 25430 GN=argJ PE=3 SV=1
 1055 : W2EBX9_9BACL        0.51  0.72    1  191    4  194  192    2    2  408  W2EBX9     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus larvae subsp. larvae DSM 25719 GN=argJ PE=3 SV=1
 1056 : W6T9Y9_9LACO        0.51  0.70  193  405  189  400  215    2    5  402  W6T9Y9     N-acetylglutamate synthase OS=Lactobacillus fabifermentans T30PCM01 GN=LFAB_02405 PE=4 SV=1
 1057 : A3CLY5_STRSV        0.50  0.69    7  191    2  183  185    1    3  397  A3CLY5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis (strain SK36) GN=argJ PE=3 SV=1
 1058 : ARGJ_LACPL          0.50  0.73  193  405  189  400  213    1    1  402  O08319     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1) GN=argJ PE=3 SV=2
 1059 : ARGJ_OCEIH          0.50  0.68    2  191    6  193  190    1    2  407  Q8CUN1     Arginine biosynthesis bifunctional protein ArgJ OS=Oceanobacillus iheyensis (strain DSM 14371 / JCM 11309 / KCTC 3954 / HTE831) GN=argJ PE=3 SV=1
 1060 : ARGJ_STAEQ          0.50  0.66  193  405  184  395  213    1    1  397  Q5HP22     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis (strain ATCC 35984 / RP62A) GN=argJ PE=3 SV=1
 1061 : ARGJ_STRT1          0.50  0.71  193  405  184  395  213    1    1  397  Q5M122     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus (strain CNRZ 1066) GN=argJ PE=3 SV=1
 1062 : C0FYU9_9FIRM        0.50  0.71  193  405  190  405  218    3    7  407  C0FYU9     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia inulinivorans DSM 16841 GN=argJ PE=3 SV=1
 1063 : C4WCG0_STAWA        0.50  0.68  193  405  184  395  213    1    1  397  C4WCG0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus warneri L37603 GN=argJ PE=3 SV=1
 1064 : C5N159_STAA3        0.50  0.72   10  191   18  199  183    2    2  413  C5N159     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus USA300_TCH959 GN=argJ PE=3 SV=1
 1065 : C5Q441_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  C5Q441     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus TCH130 GN=argJ PE=3 SV=1
 1066 : C5Q9F0_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  C5Q9F0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis BCM-HMP0060 GN=argJ PE=3 SV=1
 1067 : C5QSR6_9STAP        0.50  0.69    7  191    2  183  185    1    3  397  C5QSR6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus caprae M23864:W1 GN=argJ PE=3 SV=1
 1068 : C9A9U1_ENTCA        0.50  0.70    7  191    2  182  185    2    4  396  C9A9U1     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus casseliflavus EC20 GN=argJ PE=3 SV=2
 1069 : D1WNA5_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  D1WNA5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis SK135 GN=argJ PE=3 SV=1
 1070 : D2GMZ8_STAAU        0.50  0.71    8  191   16  199  185    2    2  413  D2GMZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus C160 GN=argJ PE=3 SV=1
 1071 : D2N3N8_STAA5        0.50  0.72   10  191   18  199  183    2    2  351  D2N3N8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain MRSA ST398 / isolate S0385) GN=argJ PE=3 SV=1
 1072 : D4FJ58_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  D4FJ58     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis M23864:W2(grey) GN=argJ PE=3 SV=1
 1073 : D6XUI7_BACIE        0.50  0.74  193  405  196  407  213    1    1  409  D6XUI7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus selenitireducens (strain ATCC 700615 / DSM 15326 / MLS10) GN=argJ PE=3 SV=1
 1074 : E3EBK6_PAEPS        0.50  0.72    6  191    7  194  189    3    4  408  E3EBK6     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus polymyxa (strain SC2) GN=argJ PE=3 SV=1
 1075 : E4SSF3_STRTN        0.50  0.71  193  405  184  395  213    1    1  397  E4SSF3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus (strain ND03) GN=argJ PE=3 SV=1
 1076 : E6LHX8_9ENTE        0.50  0.71  193  405  185  396  213    1    1  398  E6LHX8     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus italicus DSM 15952 GN=argJ PE=3 SV=1
 1077 : E6SH25_THEM7        0.50  0.70  193  405  225  436  213    1    1  438  E6SH25     Arginine biosynthesis bifunctional protein ArgJ OS=Thermaerobacter marianensis (strain ATCC 700841 / DSM 12885 / JCM 10246 / 7p75a) GN=argJ PE=3 SV=1
 1078 : E8KQL9_STRSA        0.50  0.69    7  191    2  183  185    1    3  397  E8KQL9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis VMC66 GN=argJ PE=3 SV=1
 1079 : E8KWG6_STRVE        0.50  0.71  193  405  184  395  213    1    1  397  E8KWG6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus vestibularis ATCC 49124 GN=argJ PE=3 SV=1
 1080 : F0FEJ5_STRSA        0.50  0.73  193  405  184  395  213    1    1  397  F0FEJ5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK353 GN=argJ PE=3 SV=1
 1081 : F0FEJ5_STRSA        0.50  0.68    7  191    2  183  185    1    3  397  F0FEJ5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK353 GN=argJ PE=3 SV=1
 1082 : F0FKQ1_STRSA        0.50  0.68    7  191    2  183  185    1    3  397  F0FKQ1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK405 GN=argJ PE=3 SV=1
 1083 : F0I0B8_STRSA        0.50  0.69    7  191    2  183  185    1    3  397  F0I0B8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK72 GN=argJ PE=3 SV=1
 1084 : F0I8Q8_STRSA        0.50  0.68    7  191    2  183  185    1    3  397  F0I8Q8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK115 GN=argJ PE=3 SV=1
 1085 : F0INL5_STRSA        0.50  0.69    7  191    2  183  185    1    3  397  F0INL5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK150 GN=argJ PE=3 SV=1
 1086 : F2BJJ0_STRSA        0.50  0.68    7  191    2  183  185    1    3  397  F2BJJ0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK1 GN=argJ PE=3 SV=1
 1087 : F2BTS7_STRSA        0.50  0.68    7  191    2  183  185    1    3  397  F2BTS7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK1057 GN=argJ PE=3 SV=1
 1088 : F2C7T0_STRSA        0.50  0.68    7  191    2  183  185    1    3  397  F2C7T0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK330 GN=argJ PE=3 SV=1
 1089 : F2CEY2_STRSA        0.50  0.68    7  191    2  183  185    1    3  397  F2CEY2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK408 GN=argJ PE=3 SV=1
 1090 : F2CMQ2_STRSA        0.50  0.68    7  191    2  183  185    1    3  397  F2CMQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK1058 GN=argJ PE=3 SV=1
 1091 : F2HJ93_LACLV        0.50  0.67  193  405  184  394  213    2    2  396  F2HJ93     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis (strain CV56) GN=argJ PE=3 SV=1
 1092 : F3SIU2_STRSA        0.50  0.67    7  191    2  183  185    1    3  397  F3SIU2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis SK1087 GN=argJ PE=3 SV=1
 1093 : F3TZB5_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  F3TZB5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU045 GN=argJ PE=3 SV=1
 1094 : F7QZT5_9LACO        0.50  0.69  193  405  181  393  215    3    4  395  F7QZT5     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus ruminis SPM0211 GN=argJ PE=3 SV=1
 1095 : F8HFK8_STRE5        0.50  0.72  193  405  184  395  213    1    1  397  F8HFK8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius (strain 57.I) GN=argJ PE=3 SV=1
 1096 : F8LVL8_STRTR        0.50  0.71  193  405  184  395  213    1    1  397  F8LVL8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus JIM 8232 GN=argJ PE=3 SV=1
 1097 : F9K874_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  F9K874     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21235 GN=argJ PE=3 SV=1
 1098 : F9KHH7_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  F9KHH7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21259 GN=argJ PE=3 SV=1
 1099 : F9KVE2_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  F9KVE2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21266 GN=argJ PE=3 SV=1
 1100 : F9LM49_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  F9LM49     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU105 GN=argJ PE=3 SV=1
 1101 : G2GRJ1_STRSL        0.50  0.72  193  405  184  395  213    1    1  397  G2GRJ1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius M18 GN=argJ PE=3 SV=1
 1102 : G2SM34_LACRR        0.50  0.69  193  405  181  393  215    3    4  395  G2SM34     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus ruminis (strain ATCC 27782 / RF3) GN=argJ PE=3 SV=1
 1103 : G5KZR7_STRSU        0.50  0.71    7  191    2  183  185    1    3  397  G5KZR7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus suis R61 GN=argJ PE=3 SV=1
 1104 : G7VIN7_LEUME        0.50  0.67  193  405  191  402  213    1    1  404  G7VIN7     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc mesenteroides subsp. mesenteroides J18 GN=argJ PE=3 SV=1
 1105 : G8V5B2_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  G8V5B2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 11819-97 GN=argJ PE=3 SV=1
 1106 : H0CRY3_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H0CRY3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21334 GN=argJ PE=3 SV=1
 1107 : H0CSL4_STAAU        0.50  0.71    8  191   16  199  185    2    2  413  H0CSL4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21340 GN=argJ PE=3 SV=1
 1108 : H0D9G4_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H0D9G4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VCU006 GN=argJ PE=3 SV=1
 1109 : H0DMR5_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  H0DMR5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU071 GN=argJ PE=3 SV=1
 1110 : H1TT04_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H1TT04     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21333 GN=argJ PE=3 SV=1
 1111 : H3P2E1_LACPN        0.50  0.72  193  405  191  402  213    1    1  404  H3P2E1     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum subsp. plantarum NC8 GN=argJ PE=3 SV=1
 1112 : H3RU41_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H3RU41     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1114 GN=argJ PE=3 SV=1
 1113 : H3UTV7_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  H3UTV7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU065 GN=argJ PE=3 SV=1
 1114 : H3WCZ1_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  H3WCZ1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU127 GN=argJ PE=3 SV=1
 1115 : H3XCE8_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H3XCE8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-24 GN=argJ PE=3 SV=1
 1116 : H3XNT5_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H3XNT5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-55 GN=argJ PE=3 SV=1
 1117 : H3XQQ2_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H3XQQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-88 GN=argJ PE=3 SV=1
 1118 : H3YII2_STAAU        0.50  0.70  193  405  200  411  213    1    1  413  H3YII2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-105 GN=argJ PE=3 SV=1
 1119 : H3YUK4_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H3YUK4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-111 GN=argJ PE=3 SV=1
 1120 : H3Z5V5_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  H3Z5V5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU081 GN=argJ PE=3 SV=1
 1121 : H4A179_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H4A179     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIGC93 GN=argJ PE=3 SV=1
 1122 : H4C9U4_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H4C9U4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1770 GN=argJ PE=3 SV=1
 1123 : H4CM81_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H4CM81     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIGC345D GN=argJ PE=3 SV=1
 1124 : H4D044_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H4D044     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG547 GN=argJ PE=3 SV=1
 1125 : H4E4E7_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H4E4E7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG2018 GN=argJ PE=3 SV=1
 1126 : H4ES05_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  H4ES05     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIGC128 GN=argJ PE=3 SV=1
 1127 : H4H466_STAAU        0.50  0.71  193  405  200  411  213    1    1  413  H4H466     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1835 GN=argJ PE=3 SV=1
 1128 : I7KPE7_9STAP        0.50  0.72   11  191   19  198  181    1    1  412  I7KPE7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus equorum subsp. equorum Mu2 GN=argJ PE=3 SV=1
 1129 : I7L495_PAEPO        0.50  0.72    6  191    7  194  189    3    4  408  I7L495     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus polymyxa M1 GN=argJ PE=3 SV=1
 1130 : J0HPT1_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  J0HPT1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM008 GN=argJ PE=3 SV=1
 1131 : J0I7P3_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  J0I7P3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH05005 GN=argJ PE=3 SV=1
 1132 : J0J083_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  J0J083     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH06004 GN=argJ PE=3 SV=1
 1133 : J0MMS2_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  J0MMS2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM088 GN=argJ PE=3 SV=1
 1134 : J0XQV1_9ENTE        0.50  0.70    7  191    2  182  185    2    4  396  J0XQV1     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus sp. C1 GN=argJ PE=3 SV=1
 1135 : J0Y9R2_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  J0Y9R2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM087 GN=argJ PE=3 SV=1
 1136 : J0YI10_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  J0YI10     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM070 GN=argJ PE=3 SV=1
 1137 : J0YLF2_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  J0YLF2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM067 GN=argJ PE=3 SV=1
 1138 : J0ZZ17_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  J0ZZ17     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM040 GN=argJ PE=3 SV=1
 1139 : J1BX22_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  J1BX22     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM003 GN=argJ PE=3 SV=1
 1140 : J1DNE1_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  J1DNE1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH04003 GN=argJ PE=3 SV=1
 1141 : J1EY03_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  J1EY03     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus str. Newbould 305 GN=argJ PE=3 SV=1
 1142 : J9HE42_9STAP        0.50  0.72   11  191   19  198  181    1    1  412  J9HE42     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus sp. OJ82 GN=argJ PE=3 SV=1
 1143 : K0J4N2_AMPXN        0.50  0.71  193  405  196  407  213    1    1  409  K0J4N2     Arginine biosynthesis bifunctional protein ArgJ OS=Amphibacillus xylanus (strain ATCC 51415 / DSM 6626 / JCM 7361 / LMG 17667 / NBRC 15112 / Ep01) GN=argJ PE=3 SV=1
 1144 : K2H486_9BACI        0.50  0.70    5  191    8  191  187    2    3  405  K2H486     Arginine biosynthesis bifunctional protein ArgJ OS=Salimicrobium sp. MJ3 GN=argJ PE=3 SV=1
 1145 : L8QE19_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  L8QE19     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21196 GN=argJ PE=3 SV=1
 1146 : L9LM43_STRTR        0.50  0.71  193  405  184  395  213    1    1  397  L9LM43     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus MTCC 5460 GN=argJ PE=3 SV=1
 1147 : L9TU50_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  L9TU50     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus KT/314250 GN=argJ PE=3 SV=1
 1148 : M7C091_LACPN        0.50  0.73  193  405  189  400  213    1    1  402  M7C091     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum UCMA 3037 GN=argJ PE=3 SV=1
 1149 : M7YQ37_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  M7YQ37     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus KLT6 GN=argJ PE=3 SV=1
 1150 : N2BC55_9HELI        0.50  0.70  193  405  261  476  217    2    5  478  N2BC55     Arginine biosynthesis bifunctional protein ArgJ OS=Helicobacter bilis WiWa GN=argJ PE=3 SV=1
 1151 : N5HRT1_STAAU        0.50  0.71    8  191   16  199  185    2    2  413  N5HRT1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0239 GN=argJ PE=3 SV=1
 1152 : N5NBL6_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  N5NBL6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0396 GN=argJ PE=3 SV=1
 1153 : N5U7A1_STAAU        0.50  0.71   10  191   18  199  183    2    2  413  N5U7A1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0571 GN=argJ PE=3 SV=1
 1154 : N5VWU2_STAAU        0.50  0.71   10  191   18  199  183    2    2  413  N5VWU2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0646 GN=argJ PE=3 SV=1
 1155 : N5WY54_STAAU        0.50  0.71   10  191   18  199  183    2    2  413  N5WY54     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0692 GN=argJ PE=3 SV=1
 1156 : N6AT50_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  N6AT50     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis M0881 GN=argJ PE=3 SV=1
 1157 : Q040B1_LEUMM        0.50  0.67  193  405  191  402  213    1    1  404  Q040B1     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / NCDO 523) GN=argJ PE=3 SV=1
 1158 : R2P7W5_9ENTE        0.50  0.75    7  191    2  183  185    2    3  397  R2P7W5     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus raffinosus ATCC 49464 GN=argJ PE=3 SV=1
 1159 : R2PIK7_ENTCA        0.50  0.70    7  191    2  182  185    2    4  396  R2PIK7     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus flavescens ATCC 49996 GN=argJ PE=3 SV=1
 1160 : R4PQ50_LACPN        0.50  0.73  193  405  191  402  213    1    1  404  R4PQ50     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum subsp. plantarum P-8 GN=argJ PE=3 SV=1
 1161 : R5GBV1_9FIRM        0.50  0.69  193  405  191  406  217    2    5  408  R5GBV1     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:146 GN=argJ PE=3 SV=1
 1162 : R6SNY3_9LACO        0.50  0.69  193  405  181  393  215    3    4  395  R6SNY3     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus ruminis CAG:367 GN=argJ PE=3 SV=1
 1163 : R8A7P0_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  R8A7P0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis 528m GN=argJ PE=3 SV=1
 1164 : R8AAT4_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  R8AAT4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis 41tr GN=argJ PE=3 SV=1
 1165 : R8AG95_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  R8AG95     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis 36-1 GN=argJ PE=3 SV=1
 1166 : R9D5V2_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  R9D5V2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 103564 GN=argJ PE=3 SV=1
 1167 : S4NL43_9LACO        0.50  0.71  193  405  189  400  214    2    3  402  S4NL43     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus otakiensis JCM 15040 GN=argJ PE=3 SV=1
 1168 : T0B8J3_STAEP        0.50  0.66  193  405  184  395  213    1    1  397  T0B8J3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis E13A GN=argJ PE=3 SV=1
 1169 : T1Y721_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  T1Y721     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CN1 GN=argJ PE=3 SV=1
 1170 : T5JV41_LACPN        0.50  0.74  193  405  189  400  213    1    1  402  T5JV41     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum EGD-AQ4 GN=argJ PE=3 SV=1
 1171 : U1SUN7_9STAP        0.50  0.72   11  191   19  198  181    1    1  412  U1SUN7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus equorum UMC-CNS-924 GN=argJ PE=3 SV=1
 1172 : U6B778_9BACL        0.50  0.69   15  191   14  191  182    3    9  405  U6B778     Arginine biosynthesis bifunctional protein ArgJ OS=Exiguobacterium sp. MH3 GN=argJ PE=3 SV=1
 1173 : U6Z4U1_LACPN        0.50  0.73  193  405  189  400  213    1    1  402  U6Z4U1     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum WJL GN=argJ PE=3 SV=1
 1174 : V8B4V8_STRSA        0.50  0.68    7  191    2  183  185    1    3  397  V8B4V8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sanguinis CC94A GN=argJ PE=3 SV=1
 1175 : V8BES0_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  V8BES0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus KPL1828 GN=argJ PE=3 SV=1
 1176 : V8LYZ4_STRTR        0.50  0.71  193  405  184  395  213    1    1  397  V8LYZ4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus TH1435 GN=argJ PE=3 SV=1
 1177 : W1W0H6_9STAP        0.50  0.66  193  405  184  395  213    1    1  397  W1W0H6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus sp. DORA_6_22 GN=argJ PE=3 SV=1
 1178 : W4KYX7_STRTR        0.50  0.71  193  405  184  395  213    1    1  397  W4KYX7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus MTH17CL396 GN=argJ PE=3 SV=1
 1179 : W7N331_STAAU        0.50  0.72   10  191   18  199  183    2    2  413  W7N331     N-acetylglutamate synthase OS=Staphylococcus aureus MUF168 GN=Y000_13055 PE=4 SV=1
 1180 : W7UXH0_STRTR        0.50  0.71  193  405  184  395  213    1    1  397  W7UXH0     N-acetylglutamate synthase OS=Streptococcus thermophilus TH982 GN=Y018_02430 PE=4 SV=1
 1181 : W7VIH0_STRTR        0.50  0.71  193  405  184  395  213    1    1  397  W7VIH0     N-acetylglutamate synthase OS=Streptococcus thermophilus TH985 GN=Y016_02435 PE=4 SV=1
 1182 : W7VPI2_STRTR        0.50  0.71  193  405  184  395  213    1    1  397  W7VPI2     N-acetylglutamate synthase OS=Streptococcus thermophilus TH1477 GN=Y022_02560 PE=4 SV=1
 1183 : A5IP52_STAA9        0.49  0.71  193  405  200  411  213    1    1  413  A5IP52     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain JH9) GN=argJ PE=3 SV=1
 1184 : A6BGS3_9FIRM        0.49  0.66  193  405  200  415  217    2    5  417  A6BGS3     Arginine biosynthesis bifunctional protein ArgJ OS=Dorea longicatena DSM 13814 GN=argJ PE=3 SV=1
 1185 : A6QDG7_STAAE        0.49  0.71  193  405  200  411  213    1    1  413  A6QDG7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain Newman) GN=argJ PE=3 SV=1
 1186 : A6QDG7_STAAE        0.49  0.71    8  191   16  199  185    2    2  413  A6QDG7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain Newman) GN=argJ PE=3 SV=1
 1187 : A7WXH4_STAA1        0.49  0.71  193  405  200  411  213    1    1  413  A7WXH4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain Mu3 / ATCC 700698) GN=argJ PE=3 SV=1
 1188 : A8YZA4_STAAT        0.49  0.71    8  191   16  199  185    2    2  413  A8YZA4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain USA300 / TCH1516) GN=argJ PE=3 SV=1
 1189 : ARGJ_STAAC          0.49  0.71    8  191   16  199  185    2    2  413  Q5HJJ0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain COL) GN=argJ PE=3 SV=1
 1190 : ARGJ_STAAM          0.49  0.71  193  405  200  411  213    1    1  413  P63575     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain Mu50 / ATCC 700699) GN=argJ PE=3 SV=1
 1191 : ARGJ_STAAN          0.49  0.71  193  405  200  411  213    1    1  413  P63576     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain N315) GN=argJ PE=3 SV=1
 1192 : ARGJ_STAAR          0.49  0.71  193  405  200  411  213    1    1  413  Q6GKC3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain MRSA252) GN=argJ PE=3 SV=1
 1193 : ARGJ_STAAR          0.49  0.71    8  191   16  199  185    2    2  413  Q6GKC3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain MRSA252) GN=argJ PE=3 SV=1
 1194 : ARGJ_STAAS          0.49  0.71  193  405  200  411  213    1    1  413  Q6GCU3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain MSSA476) GN=argJ PE=3 SV=1
 1195 : ARGJ_STAAS          0.49  0.71    8  191   16  199  185    2    2  413  Q6GCU3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain MSSA476) GN=argJ PE=3 SV=1
 1196 : ARGJ_STAAW          0.49  0.71    8  191   16  199  185    2    2  413  Q8NYM7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain MW2) GN=argJ PE=3 SV=1
 1197 : ARGJ_STAEQ          0.49  0.72    7  191    2  183  185    1    3  397  Q5HP22     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis (strain ATCC 35984 / RP62A) GN=argJ PE=3 SV=1
 1198 : ARGJ_STAES          0.49  0.72    7  191    2  183  185    1    3  397  Q8CSF9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis (strain ATCC 12228) GN=argJ PE=3 SV=1
 1199 : ARGJ_STRMU          0.49  0.70    7  191    2  183  185    1    3  397  Q8DV45     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans serotype c (strain ATCC 700610 / UA159) GN=argJ PE=3 SV=1
 1200 : B0TCA7_HELMI        0.49  0.69   11  191   10  190  182    2    2  404  B0TCA7     Arginine biosynthesis bifunctional protein ArgJ OS=Heliobacterium modesticaldum (strain ATCC 51547 / Ice1) GN=argJ PE=3 SV=1
 1201 : B1BZS7_9FIRM        0.49  0.69  193  405  190  405  217    2    5  407  B1BZS7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium spiroforme DSM 1552 GN=argJ PE=3 SV=1
 1202 : C0EWN8_9FIRM        0.49  0.68  193  405  191  406  219    3    9  408  C0EWN8     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium hallii DSM 3353 GN=argJ PE=3 SV=1
 1203 : C0GH78_9FIRM        0.49  0.70   10  191    7  187  182    1    1  401  C0GH78     Arginine biosynthesis bifunctional protein ArgJ OS=Dethiobacter alkaliphilus AHT 1 GN=argJ PE=3 SV=1
 1204 : C2LVA0_STRSL        0.49  0.69    7  191    2  183  185    1    3  397  C2LVA0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius SK126 GN=argJ PE=3 SV=1
 1205 : C5N159_STAA3        0.49  0.71  193  405  200  411  213    1    1  413  C5N159     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus USA300_TCH959 GN=argJ PE=3 SV=1
 1206 : C5Q441_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  C5Q441     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus TCH130 GN=argJ PE=3 SV=1
 1207 : C5Q9F0_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  C5Q9F0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis BCM-HMP0060 GN=argJ PE=3 SV=1
 1208 : C5QXD2_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  C5QXD2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis W23144 GN=argJ PE=3 SV=1
 1209 : C6SRL1_STRMN        0.49  0.70    7  191    2  183  185    1    3  397  C6SRL1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans serotype c (strain NN2025) GN=argJ PE=3 SV=1
 1210 : C7GEI1_9FIRM        0.49  0.69  193  405  208  423  218    3    7  425  C7GEI1     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia intestinalis L1-82 GN=argJ PE=3 SV=1
 1211 : C7ZTI7_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  C7ZTI7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 55/2053 GN=argJ PE=3 SV=1
 1212 : C8A168_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  C8A168     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 65-1322 GN=argJ PE=3 SV=1
 1213 : C8A168_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  C8A168     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 65-1322 GN=argJ PE=3 SV=1
 1214 : C8A7K1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  C8A7K1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 68-397 GN=argJ PE=3 SV=1
 1215 : C8AG32_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  C8AG32     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus E1410 GN=argJ PE=3 SV=1
 1216 : C8ALT0_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  C8ALT0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus M876 GN=argJ PE=3 SV=1
 1217 : C8KIW1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  C8KIW1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus 930918-3 GN=argJ PE=3 SV=1
 1218 : C8KIW1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  C8KIW1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus 930918-3 GN=argJ PE=3 SV=1
 1219 : C8KQE2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  C8KQE2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus D30 GN=argJ PE=3 SV=1
 1220 : C8L754_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  C8L754     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A5937 GN=argJ PE=3 SV=1
 1221 : C8LAZ9_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  C8LAZ9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A5948 GN=argJ PE=3 SV=1
 1222 : C8M966_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  C8M966     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9299 GN=argJ PE=3 SV=1
 1223 : C8MMH1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  C8MMH1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9719 GN=argJ PE=3 SV=1
 1224 : C8N124_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  C8N124     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9781 GN=argJ PE=3 SV=1
 1225 : D1GM09_STAA0        0.49  0.71  193  405  200  411  213    1    1  413  D1GM09     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain TW20 / 0582) GN=argJ PE=3 SV=1
 1226 : D1GM09_STAA0        0.49  0.71    8  191   16  199  185    2    2  413  D1GM09     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain TW20 / 0582) GN=argJ PE=3 SV=1
 1227 : D1Q8E1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D1Q8E1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9765 GN=argJ PE=3 SV=1
 1228 : D1Q8E1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D1Q8E1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9765 GN=argJ PE=3 SV=1
 1229 : D1QYH6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D1QYH6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A8117 GN=argJ PE=3 SV=1
 1230 : D1WNA5_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  D1WNA5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis SK135 GN=argJ PE=3 SV=1
 1231 : D2F3K2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D2F3K2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus C101 GN=argJ PE=3 SV=1
 1232 : D2F3K2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D2F3K2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus C101 GN=argJ PE=3 SV=1
 1233 : D2FHM6_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D2FHM6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus C427 GN=argJ PE=3 SV=1
 1234 : D2FIM8_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D2FIM8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus D139 GN=argJ PE=3 SV=1
 1235 : D2FRZ5_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D2FRZ5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus M899 GN=argJ PE=3 SV=1
 1236 : D2FRZ5_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D2FRZ5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus M899 GN=argJ PE=3 SV=1
 1237 : D2G593_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D2G593     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus WBG10049 GN=argJ PE=3 SV=1
 1238 : D2G689_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D2G689     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus WW2703/97 GN=argJ PE=3 SV=1
 1239 : D2G689_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D2G689     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus WW2703/97 GN=argJ PE=3 SV=1
 1240 : D2GIL2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D2GIL2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus Btn1260 GN=argJ PE=3 SV=1
 1241 : D2GMZ8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D2GMZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus C160 GN=argJ PE=3 SV=1
 1242 : D2UIW0_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D2UIW0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus H19 GN=argJ PE=3 SV=1
 1243 : D2UW76_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D2UW76     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus A017934/97 GN=argJ PE=3 SV=1
 1244 : D4FJ58_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  D4FJ58     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis M23864:W2(grey) GN=argJ PE=3 SV=1
 1245 : D4U5T8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D4U5T8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9754 GN=argJ PE=3 SV=1
 1246 : D4U5T8_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D4U5T8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A9754 GN=argJ PE=3 SV=1
 1247 : D4UCC7_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D4UCC7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A8819 GN=argJ PE=3 SV=1
 1248 : D6H2X6_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D6H2X6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus M1015 GN=argJ PE=3 SV=1
 1249 : D6HDI1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D6HDI1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 58-424 GN=argJ PE=3 SV=1
 1250 : D6HDI1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D6HDI1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 58-424 GN=argJ PE=3 SV=1
 1251 : D6J401_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D6J401     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus M809 GN=argJ PE=3 SV=1
 1252 : D6J401_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D6J401     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus M809 GN=argJ PE=3 SV=1
 1253 : D6LUB6_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D6LUB6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus EMRSA16 GN=argJ PE=3 SV=1
 1254 : D6SE11_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D6SE11     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus MN8 GN=argJ PE=3 SV=1
 1255 : D6SE11_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D6SE11     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus MN8 GN=argJ PE=3 SV=1
 1256 : D6T5F5_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  D6T5F5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus A8796 GN=argJ PE=3 SV=1
 1257 : D6UEF2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  D6UEF2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus ATCC 51811 GN=argJ PE=3 SV=1
 1258 : D8HDP2_STAAF        0.49  0.71    8  191   16  199  185    2    2  413  D8HDP2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus (strain ED133) GN=argJ PE=3 SV=1
 1259 : D9RCV1_STAAJ        0.49  0.71    8  191   16  199  185    2    2  413  D9RCV1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain JKD6159) GN=argJ PE=3 SV=1
 1260 : D9RIH6_STAAK        0.49  0.71  193  405  200  411  213    1    1  413  D9RIH6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain JKD6008) GN=argJ PE=3 SV=1
 1261 : D9RIH6_STAAK        0.49  0.71    8  191   16  199  185    2    2  413  D9RIH6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain JKD6008) GN=argJ PE=3 SV=1
 1262 : E0P6J1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  E0P6J1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus ATCC BAA-39 GN=argJ PE=3 SV=1
 1263 : E0P6J1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  E0P6J1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus ATCC BAA-39 GN=argJ PE=3 SV=1
 1264 : E1E4G3_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  E1E4G3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus TCH70 GN=argJ PE=3 SV=1
 1265 : E1E4G3_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  E1E4G3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus TCH70 GN=argJ PE=3 SV=1
 1266 : E3CT95_STRVE        0.49  0.69    7  191    2  183  185    1    3  397  E3CT95     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus vestibularis F0396 GN=argJ PE=3 SV=1
 1267 : E5QUC6_STAAH        0.49  0.71  193  405  200  411  213    1    1  413  E5QUC6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain TCH60) GN=argJ PE=3 SV=1
 1268 : E5QUC6_STAAH        0.49  0.71    8  191   16  199  185    2    2  413  E5QUC6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain TCH60) GN=argJ PE=3 SV=1
 1269 : E5TD50_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  E5TD50     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CGS00 GN=argJ PE=3 SV=1
 1270 : E5TJ71_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  E5TJ71     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CGS01 GN=argJ PE=3 SV=1
 1271 : E5TJ71_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  E5TJ71     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CGS01 GN=argJ PE=3 SV=1
 1272 : E6JMF1_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  E6JMF1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis FRI909 GN=argJ PE=3 SV=1
 1273 : E6U655_ETHHY        0.49  0.71  193  405  189  404  217    2    5  406  E6U655     Arginine biosynthesis bifunctional protein ArgJ OS=Ethanoligenens harbinense (strain DSM 18485 / JCM 12961 / CGMCC 1.5033 / YUAN-3) GN=argJ PE=3 SV=1
 1274 : E7MIW2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  E7MIW2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus MRSA177 GN=argJ PE=3 SV=1
 1275 : E7MIW2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  E7MIW2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus MRSA177 GN=argJ PE=3 SV=1
 1276 : E7MRV9_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  E7MRV9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus MRSA131 GN=argJ PE=3 SV=1
 1277 : E8KWG6_STRVE        0.49  0.69    7  191    2  183  185    1    3  397  E8KWG6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus vestibularis ATCC 49124 GN=argJ PE=3 SV=1
 1278 : F0D3W8_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  F0D3W8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus O11 GN=argJ PE=3 SV=1
 1279 : F0DAJ9_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  F0DAJ9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus O46 GN=argJ PE=3 SV=1
 1280 : F0DAJ9_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  F0DAJ9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus O46 GN=argJ PE=3 SV=1
 1281 : F3AL45_9FIRM        0.49  0.66  193  405  190  405  217    2    5  407  F3AL45     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 9_1_43BFAA GN=argJ PE=3 SV=1
 1282 : F3T1R3_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  F3T1R3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21189 GN=argJ PE=3 SV=1
 1283 : F3TD54_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  F3TD54     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21172 GN=argJ PE=3 SV=1
 1284 : F3TIA6_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  F3TIA6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21193 GN=argJ PE=3 SV=1
 1285 : F3TNY7_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  F3TNY7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU028 GN=argJ PE=3 SV=1
 1286 : F3TZB5_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  F3TZB5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU045 GN=argJ PE=3 SV=1
 1287 : F4FMA3_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  F4FMA3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus T0131 GN=argJ PE=3 SV=1
 1288 : F5W4Q1_STAAU        0.49  0.71  194  405  201  411  212    1    1  413  F5W4Q1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21305 GN=argJ PE=3 SV=1
 1289 : F5W4Q1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  F5W4Q1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21305 GN=argJ PE=3 SV=1
 1290 : F9JMB9_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  F9JMB9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21195 GN=argJ PE=3 SV=1
 1291 : F9JMB9_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  F9JMB9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21195 GN=argJ PE=3 SV=1
 1292 : F9K543_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  F9K543     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21201 GN=argJ PE=3 SV=1
 1293 : F9L214_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  F9L214     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21269 GN=argJ PE=3 SV=1
 1294 : F9L214_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  F9L214     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21269 GN=argJ PE=3 SV=1
 1295 : F9LBK0_STAEP        0.49  0.72    7  191    2  183  185    1    3  366  F9LBK0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU037 GN=argJ PE=3 SV=1
 1296 : F9LR22_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  F9LR22     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU109 GN=argJ PE=3 SV=1
 1297 : G0LQF8_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  G0LQF8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus LGA251 GN=argJ PE=3 SV=1
 1298 : G7VUP7_PAETH        0.49  0.69    4  191    5  194  191    3    4  408  G7VUP7     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus terrae (strain HPL-003) GN=argJ PE=3 SV=1
 1299 : G7ZQG4_STAAU        0.49  0.72    8  191   16  199  185    2    2  413  G7ZQG4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus MSHR1132 GN=argJ PE=3 SV=1
 1300 : G8RG77_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  G8RG77     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus M013 GN=argJ PE=3 SV=1
 1301 : G8RG77_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  G8RG77     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus M013 GN=argJ PE=3 SV=1
 1302 : G8V5B2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  G8V5B2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 11819-97 GN=argJ PE=3 SV=1
 1303 : H0ALW9_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H0ALW9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21178 GN=argJ PE=3 SV=1
 1304 : H0ARJ1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H0ARJ1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21202 GN=argJ PE=3 SV=1
 1305 : H0AZH0_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H0AZH0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21209 GN=argJ PE=3 SV=1
 1306 : H0AZH0_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H0AZH0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21209 GN=argJ PE=3 SV=1
 1307 : H0CH43_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H0CH43     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21331 GN=argJ PE=3 SV=1
 1308 : H0CH43_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H0CH43     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21331 GN=argJ PE=3 SV=1
 1309 : H0CRY3_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H0CRY3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21334 GN=argJ PE=3 SV=1
 1310 : H0CSL4_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H0CSL4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21340 GN=argJ PE=3 SV=1
 1311 : H0D6F6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H0D6F6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21232 GN=argJ PE=3 SV=1
 1312 : H0D6F6_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H0D6F6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21232 GN=argJ PE=3 SV=1
 1313 : H0DU95_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  H0DU95     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis 14.1.R1.SE GN=argJ PE=3 SV=1
 1314 : H1SXR8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H1SXR8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21262 GN=argJ PE=3 SV=1
 1315 : H1SXR8_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H1SXR8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21262 GN=argJ PE=3 SV=1
 1316 : H1T4R0_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H1T4R0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21264 GN=argJ PE=3 SV=1
 1317 : H1T9E0_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H1T9E0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21272 GN=argJ PE=3 SV=1
 1318 : H1TKG6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H1TKG6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21283 GN=argJ PE=3 SV=1
 1319 : H1TKG6_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H1TKG6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21283 GN=argJ PE=3 SV=1
 1320 : H3RU41_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H3RU41     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1114 GN=argJ PE=3 SV=1
 1321 : H3S314_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H3S314     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1605 GN=argJ PE=3 SV=1
 1322 : H3S314_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H3S314     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1605 GN=argJ PE=3 SV=1
 1323 : H3TUJ3_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H3TUJ3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21342 GN=argJ PE=3 SV=1
 1324 : H3U1U5_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H3U1U5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21343 GN=argJ PE=3 SV=1
 1325 : H3U1U5_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H3U1U5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21343 GN=argJ PE=3 SV=1
 1326 : H3U9W0_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H3U9W0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21345 GN=argJ PE=3 SV=1
 1327 : H3UI61_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  H3UI61     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU041 GN=argJ PE=3 SV=1
 1328 : H3UKM5_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  H3UKM5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU057 GN=argJ PE=3 SV=1
 1329 : H3UTV7_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  H3UTV7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU065 GN=argJ PE=3 SV=1
 1330 : H3V3V6_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  H3V3V6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU117 GN=argJ PE=3 SV=1
 1331 : H3VCK0_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  H3VCK0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU120 GN=argJ PE=3 SV=1
 1332 : H3W1Y3_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  H3W1Y3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU125 GN=argJ PE=3 SV=1
 1333 : H3W8Z2_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  H3W8Z2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU126 GN=argJ PE=3 SV=1
 1334 : H3WCZ1_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  H3WCZ1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU127 GN=argJ PE=3 SV=1
 1335 : H3WGM6_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  H3WGM6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU128 GN=argJ PE=3 SV=1
 1336 : H3WNT2_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  H3WNT2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU129 GN=argJ PE=3 SV=1
 1337 : H3XCE8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H3XCE8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-24 GN=argJ PE=3 SV=1
 1338 : H3XNT5_STAAU        0.49  0.70  193  405  200  411  213    1    1  413  H3XNT5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-55 GN=argJ PE=3 SV=1
 1339 : H3Y0T4_STAAU        0.49  0.71    8  191   16  199  185    2    2  418  H3Y0T4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-91 GN=argJ PE=3 SV=1
 1340 : H3YUK4_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H3YUK4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-111 GN=argJ PE=3 SV=1
 1341 : H3Z1G0_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H3Z1G0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-122 GN=argJ PE=3 SV=1
 1342 : H3Z5V5_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  H3Z5V5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU081 GN=argJ PE=3 SV=1
 1343 : H3ZUB3_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H3ZUB3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-125 GN=argJ PE=3 SV=1
 1344 : H4AH95_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H4AH95     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1213 GN=argJ PE=3 SV=1
 1345 : H4AQW7_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H4AQW7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1769 GN=argJ PE=3 SV=1
 1346 : H4BD57_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4BD57     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1176 GN=argJ PE=3 SV=1
 1347 : H4BUS5_STAAU        0.49  0.71    8  191   16  199  185    2    2  373  H4BUS5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIGC341D GN=argJ PE=3 SV=1
 1348 : H4C330_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4C330     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1214 GN=argJ PE=3 SV=1
 1349 : H4CRW2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H4CRW2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG149 GN=argJ PE=3 SV=1
 1350 : H4CRW2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4CRW2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG149 GN=argJ PE=3 SV=1
 1351 : H4D044_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H4D044     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG547 GN=argJ PE=3 SV=1
 1352 : H4D7A2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H4D7A2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIGC340D GN=argJ PE=3 SV=1
 1353 : H4DFI4_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4DFI4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1267 GN=argJ PE=3 SV=1
 1354 : H4DWG4_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4DWG4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1233 GN=argJ PE=3 SV=1
 1355 : H4E4E7_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H4E4E7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG2018 GN=argJ PE=3 SV=1
 1356 : H4ECL5_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4ECL5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1612 GN=argJ PE=3 SV=1
 1357 : H4FYH2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4FYH2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-157 GN=argJ PE=3 SV=1
 1358 : H4G4N9_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4G4N9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-160 GN=argJ PE=3 SV=1
 1359 : H4GDL5_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H4GDL5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-189 GN=argJ PE=3 SV=1
 1360 : H4GDL5_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4GDL5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-189 GN=argJ PE=3 SV=1
 1361 : H4GIY6_9LACO        0.49  0.68  193  405  181  392  213    1    1  394  H4GIY6     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus gastricus PS3 GN=argJ PE=3 SV=1
 1362 : H4GMF3_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H4GMF3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1242 GN=argJ PE=3 SV=1
 1363 : H4GMF3_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4GMF3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1242 GN=argJ PE=3 SV=1
 1364 : H4GXH8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H4GXH8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1500 GN=argJ PE=3 SV=1
 1365 : H4GXH8_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4GXH8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1500 GN=argJ PE=3 SV=1
 1366 : H4H466_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H4H466     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1835 GN=argJ PE=3 SV=1
 1367 : H4HCR3_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  H4HCR3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CIG1096 GN=argJ PE=3 SV=1
 1368 : H6LNK0_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  H6LNK0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VC40 GN=argJ PE=3 SV=1
 1369 : H7G604_STAA5        0.49  0.71  193  405  200  411  213    1    1  413  H7G604     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus DR10 GN=argJ PE=3 SV=1
 1370 : H7G604_STAA5        0.49  0.71    8  191   16  199  185    2    2  413  H7G604     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus DR10 GN=argJ PE=3 SV=1
 1371 : I0C121_STAA5        0.49  0.71    8  191   16  199  185    2    2  413  I0C121     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 71193 GN=argJ PE=3 SV=1
 1372 : I0TIV5_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  I0TIV5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis IS-250 GN=argJ PE=3 SV=1
 1373 : I0U155_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  I0U155     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus IS-M GN=argJ PE=3 SV=1
 1374 : I0XKG3_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  I0XKG3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CO-23 GN=argJ PE=3 SV=1
 1375 : I3FE34_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  I3FE34     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS3a GN=argJ PE=3 SV=1
 1376 : I3FI22_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  I3FI22     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS1 GN=argJ PE=3 SV=1
 1377 : I3GSG2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  I3GSG2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS8 GN=argJ PE=3 SV=1
 1378 : I3GU31_STAAU        0.49  0.71  193  405   65  276  213    1    1  278  I3GU31     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS9 GN=argJ PE=3 SV=1
 1379 : I3GVQ2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  I3GVQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS7 GN=argJ PE=3 SV=1
 1380 : I3HI79_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  I3HI79     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS11a GN=argJ PE=3 SV=1
 1381 : I3HJL6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  I3HJL6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus VRS11b GN=argJ PE=3 SV=1
 1382 : I4A555_DESDJ        0.49  0.68  193  405  212  420  213    2    4  422  I4A555     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfitobacterium dehalogenans (strain ATCC 51507 / DSM 9161 / JW/IU-DC1) GN=argJ PE=3 SV=1
 1383 : I6SUF2_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  I6SUF2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans GS-5 GN=argJ PE=3 SV=1
 1384 : I7JC23_LEUPS        0.49  0.71    4  191    7  190  188    2    4  241  I7JC23     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc pseudomesenteroides 4882 GN=argJ PE=3 SV=1
 1385 : J0G9R5_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  J0G9R5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM023 GN=argJ PE=3 SV=1
 1386 : J0GGR3_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J0GGR3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM021 GN=argJ PE=3 SV=1
 1387 : J0HPT1_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J0HPT1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM008 GN=argJ PE=3 SV=1
 1388 : J0I7P3_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J0I7P3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH05005 GN=argJ PE=3 SV=1
 1389 : J0IW33_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J0IW33     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH05001 GN=argJ PE=3 SV=1
 1390 : J0J083_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J0J083     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH06004 GN=argJ PE=3 SV=1
 1391 : J0MMS2_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J0MMS2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM088 GN=argJ PE=3 SV=1
 1392 : J0QYQ8_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  J0QYQ8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM031 GN=argJ PE=3 SV=1
 1393 : J0SKI0_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J0SKI0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH08001 GN=argJ PE=3 SV=1
 1394 : J0Y9R2_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J0Y9R2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM087 GN=argJ PE=3 SV=1
 1395 : J0YI10_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J0YI10     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM070 GN=argJ PE=3 SV=1
 1396 : J1B9B2_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J1B9B2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM018 GN=argJ PE=3 SV=1
 1397 : J1BX22_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J1BX22     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM003 GN=argJ PE=3 SV=1
 1398 : J1CYC3_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J1CYC3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH04008 GN=argJ PE=3 SV=1
 1399 : J1DNE1_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J1DNE1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH04003 GN=argJ PE=3 SV=1
 1400 : J1DXJ4_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  J1DXJ4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH051668 GN=argJ PE=3 SV=1
 1401 : J2ZU25_9LACO        0.49  0.67  193  405  185  396  219    3   13  398  J2ZU25     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus coryniformis subsp. coryniformis CECT 5711 GN=argJ PE=3 SV=1
 1402 : J4X9T7_9STRE        0.49  0.68    7  191    2  183  185    1    3  397  J4X9T7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sp. AS14 GN=argJ PE=3 SV=1
 1403 : J7T6D2_STRSL        0.49  0.69    7  191    2  183  185    1    3  397  J7T6D2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius K12 GN=argJ PE=3 SV=1
 1404 : J9UND7_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  J9UND7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus 08BA02176 GN=argJ PE=3 SV=1
 1405 : K0L574_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  K0L574     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus ST228 GN=argJ PE=3 SV=1
 1406 : K1UE48_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  K1UE48     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis AU12-03 GN=argJ PE=3 SV=1
 1407 : K8ER21_CARML        0.49  0.68    7  191    2  184  185    1    2  398  K8ER21     Arginine biosynthesis bifunctional protein ArgJ OS=Carnobacterium maltaromaticum LMA28 GN=argJ PE=3 SV=2
 1408 : K8PLS9_STAEP        0.49  0.66  193  405  117  328  213    1    1  330  K8PLS9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis BVS058A4 GN=argJ PE=3 SV=1
 1409 : K8YHB6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  K8YHB6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus CN79 GN=argJ PE=3 SV=1
 1410 : K8YHB6_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  K8YHB6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus CN79 GN=argJ PE=3 SV=1
 1411 : L7BZG5_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  L7BZG5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus DSM 20231 GN=argJ PE=3 SV=1
 1412 : L7D5P1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  L7D5P1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21282 GN=argJ PE=3 SV=1
 1413 : L8QI58_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  L8QI58     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 21236 GN=argJ PE=3 SV=1
 1414 : L9U2V5_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  L9U2V5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus KT/Y21 GN=argJ PE=3 SV=1
 1415 : M2CQK4_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2CQK4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 11A1 GN=argJ PE=3 SV=1
 1416 : M2DVD6_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2DVD6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 2ST1 GN=argJ PE=3 SV=1
 1417 : M2DYX7_STRMG        0.49  0.71    7  191    2  183  185    1    3  397  M2DYX7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 11SSST2 GN=argJ PE=3 SV=1
 1418 : M2E3W6_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2E3W6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NLML8 GN=argJ PE=3 SV=1
 1419 : M2E8J3_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2E8J3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 8ID3 GN=argJ PE=3 SV=1
 1420 : M2EGK9_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2EGK9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 1SM1 GN=argJ PE=3 SV=1
 1421 : M2EIK3_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2EIK3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 15JP3 GN=argJ PE=3 SV=1
 1422 : M2ENR5_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2ENR5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 3SN1 GN=argJ PE=3 SV=1
 1423 : M2EQV3_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2EQV3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 4SM1 GN=argJ PE=3 SV=1
 1424 : M2ET50_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2ET50     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 11VS1 GN=argJ PE=3 SV=1
 1425 : M2FAY2_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2FAY2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 5SM3 GN=argJ PE=3 SV=1
 1426 : M2FBR0_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2FBR0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 2VS1 GN=argJ PE=3 SV=1
 1427 : M2FCI9_STRMG        0.49  0.71    7  191    2  183  185    1    3  397  M2FCI9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NMT4863 GN=argJ PE=3 SV=1
 1428 : M2FQX2_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2FQX2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 15VF2 GN=argJ PE=3 SV=1
 1429 : M2FUR2_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2FUR2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans A9 GN=argJ PE=3 SV=1
 1430 : M2FX77_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2FX77     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans G123 GN=argJ PE=3 SV=1
 1431 : M2FZI8_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2FZI8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans N29 GN=argJ PE=3 SV=1
 1432 : M2G1B6_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2G1B6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NVAB GN=argJ PE=3 SV=1
 1433 : M2GEM6_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2GEM6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans U138 GN=argJ PE=3 SV=1
 1434 : M2GTI3_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2GTI3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans M21 GN=argJ PE=3 SV=1
 1435 : M2GTV2_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2GTV2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NLML4 GN=argJ PE=3 SV=1
 1436 : M2GWA7_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2GWA7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans N34 GN=argJ PE=3 SV=1
 1437 : M2GXR4_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2GXR4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans A19 GN=argJ PE=3 SV=1
 1438 : M2HHI1_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2HHI1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans N66 GN=argJ PE=3 SV=1
 1439 : M2HS78_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2HS78     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans T4 GN=argJ PE=3 SV=1
 1440 : M2HXC3_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2HXC3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NFSM1 GN=argJ PE=3 SV=1
 1441 : M2HY82_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2HY82     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans N3209 GN=argJ PE=3 SV=1
 1442 : M2IK10_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2IK10     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NLML9 GN=argJ PE=3 SV=1
 1443 : M2IK97_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2IK97     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans M2A GN=argJ PE=3 SV=1
 1444 : M2J725_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2J725     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 21 GN=argJ PE=3 SV=1
 1445 : M2JD36_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2JD36     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans ST6 GN=argJ PE=3 SV=1
 1446 : M2JDA4_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2JDA4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NV1996 GN=argJ PE=3 SV=1
 1447 : M2JDH3_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2JDH3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SF1 GN=argJ PE=3 SV=1
 1448 : M2JNB5_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2JNB5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SM6 GN=argJ PE=3 SV=1
 1449 : M2JZM6_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2JZM6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans ST1 GN=argJ PE=3 SV=1
 1450 : M2KDE9_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2KDE9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SA41 GN=argJ PE=3 SV=1
 1451 : M2KHL3_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2KHL3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SM4 GN=argJ PE=3 SV=1
 1452 : M2KHT4_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2KHT4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans B GN=argJ PE=3 SV=1
 1453 : M2KQT6_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2KQT6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 24 GN=argJ PE=3 SV=1
 1454 : M2KVG0_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2KVG0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SM1 GN=argJ PE=3 SV=1
 1455 : M2KYG2_STRMG        0.49  0.71    7  191    2  183  185    1    3  397  M2KYG2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans OMZ175 GN=argJ PE=3 SV=1
 1456 : M2LN47_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2LN47     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans R221 GN=argJ PE=3 SV=1
 1457 : M2LXZ8_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2LXZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SA38 GN=argJ PE=3 SV=1
 1458 : M2M005_STRMG        0.49  0.71    7  191    2  183  185    1    3  397  M2M005     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans S1B GN=argJ PE=3 SV=1
 1459 : M2M6Q6_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2M6Q6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SF12 GN=argJ PE=3 SV=1
 1460 : M2MD61_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2MD61     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans M230 GN=argJ PE=3 SV=1
 1461 : M2MHK4_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M2MHK4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans U2B GN=argJ PE=3 SV=1
 1462 : M7D0V6_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M7D0V6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans KK21 GN=argJ PE=3 SV=1
 1463 : M7DG35_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M7DG35     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans KK23 GN=argJ PE=3 SV=1
 1464 : M7DNS9_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M7DNS9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans AC4446 GN=argJ PE=3 SV=1
 1465 : M7DS39_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M7DS39     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NCTC 11060 GN=argJ PE=3 SV=1
 1466 : M7DV36_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M7DV36     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 5DC8 GN=argJ PE=3 SV=1
 1467 : M7DVP2_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  M7DVP2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans ATCC 25175 GN=argJ PE=3 SV=1
 1468 : M7YQ37_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  M7YQ37     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus KLT6 GN=argJ PE=3 SV=1
 1469 : N1MYE3_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N1MYE3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1 GN=argJ PE=3 SV=1
 1470 : N1MYE3_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N1MYE3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1 GN=argJ PE=3 SV=1
 1471 : N1Y3B0_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N1Y3B0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0294 GN=argJ PE=3 SV=1
 1472 : N4Z1H8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N4Z1H8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI010B GN=argJ PE=3 SV=1
 1473 : N4Z1H8_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N4Z1H8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI010B GN=argJ PE=3 SV=1
 1474 : N4Z1Y4_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N4Z1Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI010 GN=argJ PE=3 SV=1
 1475 : N4Z1Y4_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N4Z1Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI010 GN=argJ PE=3 SV=1
 1476 : N4ZCQ8_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N4ZCQ8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI049B GN=argJ PE=3 SV=1
 1477 : N4ZFD5_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N4ZFD5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI013 GN=argJ PE=3 SV=1
 1478 : N4ZSR7_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N4ZSR7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI049 GN=argJ PE=3 SV=1
 1479 : N4ZSR7_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N4ZSR7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI049 GN=argJ PE=3 SV=1
 1480 : N4ZX76_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N4ZX76     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI022 GN=argJ PE=3 SV=1
 1481 : N4ZX76_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N4ZX76     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI022 GN=argJ PE=3 SV=1
 1482 : N5A6J4_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5A6J4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI111 GN=argJ PE=3 SV=1
 1483 : N5A7Z0_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5A7Z0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI049C GN=argJ PE=3 SV=1
 1484 : N5ARY5_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5ARY5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI168 GN=argJ PE=3 SV=1
 1485 : N5ARY5_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5ARY5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HI168 GN=argJ PE=3 SV=1
 1486 : N5AX22_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5AX22     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus HIF003_B2N-C GN=argJ PE=3 SV=1
 1487 : N5AXC6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5AXC6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0029 GN=argJ PE=3 SV=1
 1488 : N5BWC2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5BWC2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0035 GN=argJ PE=3 SV=1
 1489 : N5BYW4_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5BYW4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0006 GN=argJ PE=3 SV=1
 1490 : N5CEM9_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5CEM9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0055 GN=argJ PE=3 SV=1
 1491 : N5CEM9_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5CEM9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0055 GN=argJ PE=3 SV=1
 1492 : N5DHC0_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5DHC0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0102 GN=argJ PE=3 SV=1
 1493 : N5ECX4_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5ECX4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0171 GN=argJ PE=3 SV=1
 1494 : N5EVS7_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5EVS7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0150 GN=argJ PE=3 SV=1
 1495 : N5GTI1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5GTI1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0221 GN=argJ PE=3 SV=1
 1496 : N5GVM8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5GVM8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0213 GN=argJ PE=3 SV=1
 1497 : N5H725_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5H725     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0250 GN=argJ PE=3 SV=1
 1498 : N5HRT1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5HRT1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0239 GN=argJ PE=3 SV=1
 1499 : N5IPC0_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5IPC0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0279 GN=argJ PE=3 SV=1
 1500 : N5IUL6_STAAU        0.49  0.70  193  405  200  411  213    1    1  413  N5IUL6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0280 GN=argJ PE=3 SV=1
 1501 : N5IWD8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5IWD8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0273 GN=argJ PE=3 SV=1
 1502 : N5J8Q6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5J8Q6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0270 GN=argJ PE=3 SV=1
 1503 : N5JVZ8_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5JVZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0312 GN=argJ PE=3 SV=1
 1504 : N5K4E8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5K4E8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0328 GN=argJ PE=3 SV=1
 1505 : N5KHK2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5KHK2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0329 GN=argJ PE=3 SV=1
 1506 : N5KYD3_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5KYD3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0334 GN=argJ PE=3 SV=1
 1507 : N5LGM6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5LGM6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0340 GN=argJ PE=3 SV=1
 1508 : N5LGM6_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5LGM6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0340 GN=argJ PE=3 SV=1
 1509 : N5LLG6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5LLG6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0347 GN=argJ PE=3 SV=1
 1510 : N5MMJ2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5MMJ2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0374 GN=argJ PE=3 SV=1
 1511 : N5MY10_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5MY10     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0391 GN=argJ PE=3 SV=1
 1512 : N5NBL6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5NBL6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0396 GN=argJ PE=3 SV=1
 1513 : N5NPB7_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5NPB7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0415 GN=argJ PE=3 SV=1
 1514 : N5NS36_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5NS36     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0408 GN=argJ PE=3 SV=1
 1515 : N5PJQ1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5PJQ1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0424 GN=argJ PE=3 SV=1
 1516 : N5PQD9_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5PQD9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0467 GN=argJ PE=3 SV=1
 1517 : N5QJS9_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5QJS9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0468 GN=argJ PE=3 SV=1
 1518 : N5QJS9_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5QJS9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0468 GN=argJ PE=3 SV=1
 1519 : N5QT09_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5QT09     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0493 GN=argJ PE=3 SV=1
 1520 : N5RZB6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5RZB6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0513 GN=argJ PE=3 SV=1
 1521 : N5RZB6_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5RZB6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0513 GN=argJ PE=3 SV=1
 1522 : N5S4K5_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5S4K5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0489 GN=argJ PE=3 SV=1
 1523 : N5T183_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5T183     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0531 GN=argJ PE=3 SV=1
 1524 : N5TK81_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5TK81     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0547 GN=argJ PE=3 SV=1
 1525 : N5TR49_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5TR49     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0562 GN=argJ PE=3 SV=1
 1526 : N5U7A1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5U7A1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0571 GN=argJ PE=3 SV=1
 1527 : N5UA53_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5UA53     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0584 GN=argJ PE=3 SV=1
 1528 : N5UBN4_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5UBN4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0602 GN=argJ PE=3 SV=1
 1529 : N5V4K9_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5V4K9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0622 GN=argJ PE=3 SV=1
 1530 : N5VDF8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5VDF8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0633 GN=argJ PE=3 SV=1
 1531 : N5VDF8_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5VDF8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0633 GN=argJ PE=3 SV=1
 1532 : N5VIF2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5VIF2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0628 GN=argJ PE=3 SV=1
 1533 : N5VWU2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5VWU2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0646 GN=argJ PE=3 SV=1
 1534 : N5WY54_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5WY54     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0692 GN=argJ PE=3 SV=1
 1535 : N5X7U1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5X7U1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0695 GN=argJ PE=3 SV=1
 1536 : N5XHR8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5XHR8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0769 GN=argJ PE=3 SV=1
 1537 : N5XXK2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5XXK2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0719 GN=argJ PE=3 SV=1
 1538 : N5Y092_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5Y092     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0770 GN=argJ PE=3 SV=1
 1539 : N5YSM7_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5YSM7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0780 GN=argJ PE=3 SV=1
 1540 : N5Z0E0_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N5Z0E0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0831 GN=argJ PE=3 SV=1
 1541 : N5Z0E0_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N5Z0E0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0831 GN=argJ PE=3 SV=1
 1542 : N6A664_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6A664     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0823 GN=argJ PE=3 SV=1
 1543 : N6AEU9_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6AEU9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0900 GN=argJ PE=3 SV=1
 1544 : N6AN71_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6AN71     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0892 GN=argJ PE=3 SV=1
 1545 : N6AT50_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  N6AT50     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis M0881 GN=argJ PE=3 SV=1
 1546 : N6AVA8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6AVA8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0871 GN=argJ PE=3 SV=1
 1547 : N6CJB2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6CJB2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1007 GN=argJ PE=3 SV=1
 1548 : N6CJB2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N6CJB2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1007 GN=argJ PE=3 SV=1
 1549 : N6CSN5_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6CSN5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1010 GN=argJ PE=3 SV=1
 1550 : N6D626_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6D626     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0999 GN=argJ PE=3 SV=1
 1551 : N6DHS9_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6DHS9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1016 GN=argJ PE=3 SV=1
 1552 : N6DKC1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6DKC1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1034 GN=argJ PE=3 SV=1
 1553 : N6DKC1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N6DKC1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1034 GN=argJ PE=3 SV=1
 1554 : N6EQN1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6EQN1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1063 GN=argJ PE=3 SV=1
 1555 : N6FKL1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6FKL1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1076 GN=argJ PE=3 SV=1
 1556 : N6FLL0_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6FLL0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1068 GN=argJ PE=3 SV=1
 1557 : N6FQV9_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N6FQV9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1064 GN=argJ PE=3 SV=1
 1558 : N6G8E1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6G8E1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1083 GN=argJ PE=3 SV=1
 1559 : N6GEJ1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6GEJ1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1109 GN=argJ PE=3 SV=1
 1560 : N6H3T1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6H3T1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1119 GN=argJ PE=3 SV=1
 1561 : N6H4P3_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6H4P3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1095 GN=argJ PE=3 SV=1
 1562 : N6IGR0_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6IGR0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1167 GN=argJ PE=3 SV=1
 1563 : N6IU02_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6IU02     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1223 GN=argJ PE=3 SV=1
 1564 : N6IU02_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N6IU02     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1223 GN=argJ PE=3 SV=1
 1565 : N6J182_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6J182     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1229 GN=argJ PE=3 SV=1
 1566 : N6JFX5_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6JFX5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1275 GN=argJ PE=3 SV=1
 1567 : N6JNS6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6JNS6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1256 GN=argJ PE=3 SV=1
 1568 : N6JNS6_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N6JNS6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1256 GN=argJ PE=3 SV=1
 1569 : N6K0E8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6K0E8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1257 GN=argJ PE=3 SV=1
 1570 : N6LMM5_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6LMM5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1322 GN=argJ PE=3 SV=1
 1571 : N6LWF3_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6LWF3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1367 GN=argJ PE=3 SV=1
 1572 : N6MS74_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6MS74     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1394 GN=argJ PE=3 SV=1
 1573 : N6N6N9_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6N6N9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1450 GN=argJ PE=3 SV=1
 1574 : N6NPD0_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6NPD0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1405 GN=argJ PE=3 SV=1
 1575 : N6P775_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6P775     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1462 GN=argJ PE=3 SV=1
 1576 : N6P775_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N6P775     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1462 GN=argJ PE=3 SV=1
 1577 : N6PWW9_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6PWW9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1544 GN=argJ PE=3 SV=1
 1578 : N6Q189_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6Q189     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1533 GN=argJ PE=3 SV=1
 1579 : N6QHS8_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6QHS8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1565 GN=argJ PE=3 SV=1
 1580 : N6R4R6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6R4R6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1556 GN=argJ PE=3 SV=1
 1581 : N6RAB7_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6RAB7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0946 GN=argJ PE=3 SV=1
 1582 : N6RAB7_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  N6RAB7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M0946 GN=argJ PE=3 SV=1
 1583 : N6RCI4_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6RCI4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1578 GN=argJ PE=3 SV=1
 1584 : N6RHR4_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6RHR4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1198 GN=argJ PE=3 SV=1
 1585 : N6T8U3_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6T8U3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1253 GN=argJ PE=3 SV=1
 1586 : N6TEP6_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6TEP6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1248 GN=argJ PE=3 SV=1
 1587 : N6TUV1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  N6TUV1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus M1255 GN=argJ PE=3 SV=1
 1588 : N9W5D9_9CLOT        0.49  0.66    7  190    2  188  187    2    3  407  N9W5D9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium hathewayi 12489931 GN=argJ PE=3 SV=1
 1589 : Q0AUM3_SYNWW        0.49  0.66  193  405  187  399  214    2    2  401  Q0AUM3     Arginine biosynthesis bifunctional protein ArgJ OS=Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen) GN=argJ PE=3 SV=1
 1590 : Q2FK79_STAA3        0.49  0.71  193  405  200  411  213    1    1  413  Q2FK79     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain USA300) GN=argJ PE=3 SV=1
 1591 : Q2FK79_STAA3        0.49  0.71    8  191   16  199  185    2    2  413  Q2FK79     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain USA300) GN=argJ PE=3 SV=1
 1592 : Q2G1H5_STAA8        0.49  0.71  193  405  200  411  213    1    1  413  Q2G1H5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain NCTC 8325) GN=argJ PE=3 SV=1
 1593 : Q2G1H5_STAA8        0.49  0.71    8  191   16  199  185    2    2  413  Q2G1H5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain NCTC 8325) GN=argJ PE=3 SV=1
 1594 : Q2YUZ6_STAAB        0.49  0.71    8  191   16  199  185    2    2  413  Q2YUZ6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus (strain bovine RF122 / ET3-1) GN=argJ PE=3 SV=1
 1595 : R5AXZ6_9FIRM        0.49  0.68  193  405  186  401  217    2    5  403  R5AXZ6     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:103 GN=argJ PE=3 SV=1
 1596 : R5DBK2_9FIRM        0.49  0.66  193  405  190  405  217    2    5  407  R5DBK2     Arginine biosynthesis bifunctional protein ArgJ OS=Dorea sp. CAG:105 GN=argJ PE=3 SV=1
 1597 : R5GZU3_9FIRM        0.49  0.70  193  405  190  405  217    2    5  407  R5GZU3     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:24 GN=argJ PE=3 SV=1
 1598 : R5NN87_9FIRM        0.49  0.69  193  405  190  405  217    2    5  407  R5NN87     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:17 GN=argJ PE=3 SV=1
 1599 : R5NNH6_9FIRM        0.49  0.68  193  405  196  411  217    2    5  413  R5NNH6     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:603 GN=argJ PE=3 SV=1
 1600 : R6BV33_9FIRM        0.49  0.69  193  405  190  405  218    3    7  407  R6BV33     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia intestinalis CAG:13 GN=argJ PE=3 SV=1
 1601 : R6G4P3_9FIRM        0.49  0.68  193  405  191  406  219    3    9  408  R6G4P3     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium hallii CAG:12 GN=argJ PE=3 SV=1
 1602 : R6LB01_9FIRM        0.49  0.66  193  405  190  405  217    2    5  407  R6LB01     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus comes CAG:19 GN=argJ PE=3 SV=1
 1603 : R6NNH3_9FIRM        0.49  0.68  193  405  190  405  217    2    5  407  R6NNH3     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:45 GN=argJ PE=3 SV=1
 1604 : R6SXZ0_9CLOT        0.49  0.67  193  405  186  401  217    2    5  403  R6SXZ0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:448 GN=argJ PE=3 SV=1
 1605 : R7G210_9FIRM        0.49  0.66  193  405  190  405  217    2    5  407  R7G210     Arginine biosynthesis bifunctional protein ArgJ OS=Dorea longicatena CAG:42 GN=argJ PE=3 SV=1
 1606 : R7HDN2_9FIRM        0.49  0.68  193  405  190  405  217    2    5  407  R7HDN2     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:38 GN=argJ PE=3 SV=1
 1607 : R7MNY0_9STRE        0.49  0.69    7  191    2  183  185    1    3  397  R7MNY0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius CAG:79 GN=argJ PE=3 SV=1
 1608 : R8A7P0_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  R8A7P0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis 528m GN=argJ PE=3 SV=1
 1609 : R8AAT4_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  R8AAT4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis 41tr GN=argJ PE=3 SV=1
 1610 : R8AG95_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  R8AG95     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis 36-1 GN=argJ PE=3 SV=1
 1611 : R9D911_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  R9D911     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus MRGR3 GN=argJ PE=3 SV=1
 1612 : R9DUU8_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  R9DUU8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 122051 GN=argJ PE=3 SV=1
 1613 : R9EBX4_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  R9EBX4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 112808A GN=argJ PE=3 SV=1
 1614 : R9EBX4_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  R9EBX4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 112808A GN=argJ PE=3 SV=1
 1615 : S4X6K2_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  S4X6K2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus Bmb9393 GN=argJ PE=3 SV=1
 1616 : S4X6K2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  S4X6K2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus Bmb9393 GN=argJ PE=3 SV=1
 1617 : S5RK18_9STRE        0.49  0.70    7  191    2  183  185    1    3  397  S5RK18     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus lutetiensis 033 GN=argJ PE=3 SV=1
 1618 : S9YSC0_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  S9YSC0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus S100 GN=argJ PE=3 SV=1
 1619 : S9YSC0_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  S9YSC0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus S100 GN=argJ PE=3 SV=1
 1620 : S9YY60_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  S9YY60     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus S123 GN=argJ PE=3 SV=1
 1621 : S9ZF77_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  S9ZF77     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus S94 GN=argJ PE=3 SV=1
 1622 : S9ZF77_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  S9ZF77     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus S94 GN=argJ PE=3 SV=1
 1623 : T0A811_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  T0A811     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus S130 GN=argJ PE=3 SV=1
 1624 : T1XN26_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  T1XN26     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 6850 GN=argJ PE=3 SV=1
 1625 : T1XN26_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  T1XN26     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus 6850 GN=argJ PE=3 SV=1
 1626 : T1Y721_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  T1Y721     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CN1 GN=argJ PE=3 SV=1
 1627 : T5LN62_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  T5LN62     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus S1 GN=argJ PE=3 SV=1
 1628 : U1F419_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  U1F419     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CO-08 GN=argJ PE=3 SV=1
 1629 : U1F419_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  U1F419     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus CO-08 GN=argJ PE=3 SV=1
 1630 : U2CDF7_9CLOT        0.49  0.68  193  405  190  405  219    3    9  407  U2CDF7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. KLE 1755 GN=argJ PE=3 SV=1
 1631 : U3NFW2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  U3NFW2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus SA957 GN=argJ PE=3 SV=1
 1632 : U3NNB2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  U3NNB2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus SA40 GN=argJ PE=3 SV=1
 1633 : U5SW13_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  U5SW13     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus Z172 GN=argJ PE=3 SV=1
 1634 : U5SW13_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  U5SW13     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus Z172 GN=argJ PE=3 SV=1
 1635 : V4RUZ1_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  V4RUZ1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus PSP1996 GN=argJ PE=3 SV=1
 1636 : V4RUZ1_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  V4RUZ1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus PSP1996 GN=argJ PE=3 SV=1
 1637 : V4Z0Q1_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  V4Z0Q1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans PKUSS-HG01 GN=argJ PE=3 SV=1
 1638 : V5AQD8_STRMG        0.49  0.70    7  191    2  183  185    1    3  397  V5AQD8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans PKUSS-LG01 GN=argJ PE=3 SV=1
 1639 : V6Q9V5_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  V6Q9V5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis Scl31 GN=argJ PE=3 SV=1
 1640 : V6QH99_STAEP        0.49  0.72    7  191    2  183  185    1    3  397  V6QH99     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis Scl25 GN=argJ PE=3 SV=1
 1641 : V6X2L8_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  V6X2L8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis MC28 GN=argJ PE=3 SV=1
 1642 : V6XAU6_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  V6XAU6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis WI09 GN=argJ PE=3 SV=1
 1643 : V6XLC5_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  V6XLC5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis CIM40 GN=argJ PE=3 SV=1
 1644 : V6Y2C7_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  V6Y2C7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis MC16 GN=argJ PE=3 SV=1
 1645 : V6Y9V5_STAEP        0.49  0.67  193  405  184  395  213    1    1  397  V6Y9V5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis MC19 GN=argJ PE=3 SV=1
 1646 : V8B4Y7_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  V8B4Y7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus KPL1845 GN=argJ PE=3 SV=1
 1647 : V8B4Y7_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  V8B4Y7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus KPL1845 GN=argJ PE=3 SV=1
 1648 : W1W0H6_9STAP        0.49  0.72    7  191    2  183  185    1    3  397  W1W0H6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus sp. DORA_6_22 GN=argJ PE=3 SV=1
 1649 : W3XU03_9STRE        0.49  0.69    7  191    2  183  185    1    3  397  W3XU03     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sp. SR4 GN=argJ PE=3 SV=1
 1650 : W4F0A9_9BACL        0.49  0.76    4  191    7  194  188    0    0  408  W4F0A9     Arginine biosynthesis bifunctional protein ArgJ OS=Viridibacillus arenosi FSL R5-213 GN=argJ PE=3 SV=1
 1651 : W6E9F2_STAAU        0.49  0.71    8  191   16  199  185    2    2  413  W6E9F2     N-acetylglutamate synthase OS=Staphylococcus aureus USA300-ISMMS1 GN=AZ30_00950 PE=4 SV=1
 1652 : W7CYG9_9LIST        0.49  0.69   11  191    7  185  183    5    6  400  W7CYG9     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Brochothrix campestris FSL F6-1037 GN=argJ PE=4 SV=1
 1653 : W7J314_STAAU        0.49  0.71   10  191   18  199  183    2    2  257  W7J314     N-acetylglutamate synthase OS=Staphylococcus aureus subsp. aureus ST 1413 GN=W893_00810 PE=4 SV=1
 1654 : W7N331_STAAU        0.49  0.71  193  405  200  411  213    1    1  413  W7N331     N-acetylglutamate synthase OS=Staphylococcus aureus MUF168 GN=Y000_13055 PE=4 SV=1
 1655 : A0YXY3_LYNSP        0.48  0.66  193  405  191  411  221    2    8  413  A0YXY3     Arginine biosynthesis bifunctional protein ArgJ OS=Lyngbya sp. (strain PCC 8106) GN=argJ PE=3 SV=1
 1656 : A5ZVL6_9FIRM        0.48  0.68  193  405  190  405  217    2    5  407  A5ZVL6     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus obeum ATCC 29174 GN=argJ PE=3 SV=1
 1657 : A8RJD4_9CLOT        0.48  0.69  193  405  206  421  217    2    5  423  A8RJD4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium bolteae ATCC BAA-613 GN=argJ PE=3 SV=1
 1658 : ARGJ1_NOSS1         0.48  0.67  193  405  191  411  221    1    8  413  Q8YVA8     Arginine biosynthesis bifunctional protein ArgJ 1 OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) GN=argJ1 PE=3 SV=1
 1659 : ARGJ_STRT1          0.48  0.69    7  191    2  183  185    1    3  397  Q5M122     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus (strain CNRZ 1066) GN=argJ PE=3 SV=1
 1660 : ARGJ_STRT2          0.48  0.69    7  191    2  183  185    1    3  397  Q5M5L0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311) GN=argJ PE=3 SV=1
 1661 : B0A996_9FIRM        0.48  0.70  193  405  188  403  217    2    5  405  B0A996     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium bartlettii DSM 16795 GN=argJ PE=3 SV=1
 1662 : B1MWD0_LEUCK        0.48  0.66  193  405  191  402  213    1    1  404  B1MWD0     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc citreum (strain KM20) GN=argJ PE=3 SV=1
 1663 : B1SFF8_9STRE        0.48  0.70    7  191    2  183  185    1    3  397  B1SFF8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus infantarius subsp. infantarius ATCC BAA-102 GN=argJ PE=3 SV=1
 1664 : B2GBM9_LACF3        0.48  0.73  193  405  174  385  213    1    1  387  B2GBM9     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus fermentum (strain NBRC 3956 / LMG 18251) GN=argJ PE=3 SV=1
 1665 : B2J8E9_NOSP7        0.48  0.66  193  405  191  411  221    1    8  413  B2J8E9     Arginine biosynthesis bifunctional protein ArgJ OS=Nostoc punctiforme (strain ATCC 29133 / PCC 73102) GN=argJ PE=3 SV=1
 1666 : B6FJL6_9CLOT        0.48  0.66  193  405  206  421  218    3    7  423  B6FJL6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium nexile DSM 1787 GN=argJ PE=3 SV=1
 1667 : C4WCG0_STAWA        0.48  0.69    7  191    2  183  185    1    3  397  C4WCG0     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus warneri L37603 GN=argJ PE=3 SV=1
 1668 : C5QXD2_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  C5QXD2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis W23144 GN=argJ PE=3 SV=1
 1669 : C9R9D9_AMMDK        0.48  0.70   11  191    6  185  184    4    7  399  C9R9D9     Arginine biosynthesis bifunctional protein ArgJ OS=Ammonifex degensii (strain DSM 10501 / KC4) GN=argJ PE=3 SV=1
 1670 : D3HCB8_STRG3        0.48  0.70    7  191    2  183  185    1    3  397  D3HCB8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus gallolyticus (strain UCN34) GN=argJ PE=3 SV=1
 1671 : D6XUI7_BACIE        0.48  0.70    5  191   10  195  187    1    1  409  D6XUI7     Arginine biosynthesis bifunctional protein ArgJ OS=Bacillus selenitireducens (strain ATCC 700615 / DSM 15326 / MLS10) GN=argJ PE=3 SV=1
 1672 : E0IEB0_9BACL        0.48  0.67    1  191    7  200  198    4   11  414  E0IEB0     Arginine biosynthesis bifunctional protein ArgJ OS=Paenibacillus curdlanolyticus YK9 GN=argJ PE=3 SV=1
 1673 : E0PCG3_STREI        0.48  0.69    9  191   43  222  183    1    3  436  E0PCG3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus equinus ATCC 700338 GN=argJ PE=3 SV=1
 1674 : E0PIT5_STRGY        0.48  0.69    7  191    2  183  185    1    3  397  E0PIT5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus gallolyticus subsp. gallolyticus TX20005 GN=argJ PE=3 SV=1
 1675 : E4SSF3_STRTN        0.48  0.69    7  191    2  183  185    1    3  397  E4SSF3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus (strain ND03) GN=argJ PE=3 SV=1
 1676 : E6JMF1_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  E6JMF1     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis FRI909 GN=argJ PE=3 SV=1
 1677 : E8JMB2_STREI        0.48  0.70    7  191    2  183  185    1    3  397  E8JMB2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus equinus ATCC 9812 GN=argJ PE=3 SV=1
 1678 : E9DLW6_9STRE        0.48  0.69    7  191    2  183  185    1    3  397  E9DLW6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sp. C150 GN=argJ PE=3 SV=1
 1679 : F0VWG0_STRG2        0.48  0.69    7  191    2  183  185    1    3  397  F0VWG0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus gallolyticus (strain ATCC BAA-2069) GN=argJ PE=3 SV=1
 1680 : F3SNR3_STAWA        0.48  0.70   11  191    6  183  181    1    3  397  F3SNR3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus warneri VCU121 GN=argJ PE=3 SV=1
 1681 : F5WZU1_STRG1        0.48  0.70    7  191    2  183  185    1    3  397  F5WZU1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus gallolyticus (strain ATCC 43143 / F-1867) GN=argJ PE=3 SV=1
 1682 : F5X5I1_STRPX        0.48  0.70    7  191    2  183  185    1    3  397  F5X5I1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus pasteurianus (strain ATCC 43144 / JCM 5346 / CDC 1723-81) GN=argJ PE=3 SV=1
 1683 : F7K512_9FIRM        0.48  0.67  193  405  190  405  219    3    9  407  F7K512     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 3_1_57FAA_CT1 GN=argJ PE=3 SV=1
 1684 : F7K512_9FIRM        0.48  0.66   10  190    5  188  184    2    3  407  F7K512     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 3_1_57FAA_CT1 GN=argJ PE=3 SV=1
 1685 : F7UQG9_SYNYG        0.48  0.65  193  405  197  417  221    1    8  419  F7UQG9     Arginine biosynthesis bifunctional protein ArgJ OS=Synechocystis sp. (strain PCC 6803 / GT-S) GN=argJ PE=3 SV=1
 1686 : F8HFK8_STRE5        0.48  0.69    7  191    2  183  185    1    3  397  F8HFK8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius (strain 57.I) GN=argJ PE=3 SV=1
 1687 : F8LHH3_STREH        0.48  0.69    7  191    2  183  185    1    3  397  F8LHH3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius (strain CCHSS3) GN=argJ PE=3 SV=1
 1688 : F8LN61_STRE8        0.48  0.69    7  191    2  183  185    1    3  397  F8LN61     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius (strain JIM8777) GN=argJ PE=3 SV=1
 1689 : F8LVL8_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  F8LVL8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus JIM 8232 GN=argJ PE=3 SV=1
 1690 : F9DWM5_9BACL        0.48  0.73    2  191    4  193  190    0    0  407  F9DWM5     Arginine biosynthesis bifunctional protein ArgJ OS=Sporosarcina newyorkensis 2681 GN=argJ PE=3 SV=1
 1691 : F9LM49_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  F9LM49     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU105 GN=argJ PE=3 SV=1
 1692 : G2GRJ1_STRSL        0.48  0.69    7  191    2  183  185    1    3  397  G2GRJ1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius M18 GN=argJ PE=3 SV=1
 1693 : G7ZQG4_STAAU        0.48  0.71  193  405  200  411  213    1    1  413  G7ZQG4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus aureus subsp. aureus MSHR1132 GN=argJ PE=3 SV=1
 1694 : H0DMR5_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  H0DMR5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU071 GN=argJ PE=3 SV=1
 1695 : H0DU95_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  H0DU95     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis 14.1.R1.SE GN=argJ PE=3 SV=1
 1696 : H0P5Y5_9SYNC        0.48  0.65  193  405  197  417  221    1    8  419  H0P5Y5     Arginine biosynthesis bifunctional protein ArgJ OS=Synechocystis sp. PCC 6803 substr. GT-I GN=argJ PE=3 SV=1
 1697 : H0P9B7_9SYNC        0.48  0.65  193  405  197  417  221    1    8  419  H0P9B7     Arginine biosynthesis bifunctional protein ArgJ OS=Synechocystis sp. PCC 6803 substr. PCC-N GN=argJ PE=3 SV=1
 1698 : H0PNB9_9SYNC        0.48  0.65  193  405  197  417  221    1    8  419  H0PNB9     Arginine biosynthesis bifunctional protein ArgJ OS=Synechocystis sp. PCC 6803 substr. PCC-P GN=argJ PE=3 SV=1
 1699 : H1X455_LEUCI        0.48  0.66  193  405  199  410  213    1    1  412  H1X455     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc citreum LBAE E16 GN=argJ PE=3 SV=1
 1700 : H3V7V6_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  H3V7V6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU118 GN=argJ PE=3 SV=1
 1701 : H3VS97_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  H3VS97     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU123 GN=argJ PE=3 SV=1
 1702 : H3WGM6_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  H3WGM6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU128 GN=argJ PE=3 SV=1
 1703 : H3WNT2_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  H3WNT2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis VCU129 GN=argJ PE=3 SV=1
 1704 : H6LEN7_ACEWD        0.48  0.66  193  405  190  405  217    2    5  407  H6LEN7     Arginine biosynthesis bifunctional protein ArgJ OS=Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655) GN=argJ PE=3 SV=1
 1705 : H6P9H8_STRIC        0.48  0.70    7  191    2  183  185    1    3  397  H6P9H8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus infantarius (strain CJ18) GN=argJ PE=3 SV=1
 1706 : I0QJQ9_STRSL        0.48  0.69    7  191    2  183  185    1    3  397  I0QJQ9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus salivarius PS4 GN=argJ PE=3 SV=1
 1707 : I0TQU7_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  I0TQU7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis IS-K GN=argJ PE=3 SV=1
 1708 : I6Q1H3_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  I6Q1H3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus MN-ZLW-002 GN=argJ PE=3 SV=1
 1709 : J0EXB2_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J0EXB2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM061 GN=argJ PE=3 SV=1
 1710 : J0G9R5_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J0G9R5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM023 GN=argJ PE=3 SV=1
 1711 : J0HBG9_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J0HBG9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM015 GN=argJ PE=3 SV=1
 1712 : J0I0U6_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J0I0U6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM001 GN=argJ PE=3 SV=1
 1713 : J0JN09_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J0JN09     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH05003 GN=argJ PE=3 SV=1
 1714 : J0QYQ8_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J0QYQ8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM031 GN=argJ PE=3 SV=1
 1715 : J0YLF2_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J0YLF2     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM067 GN=argJ PE=3 SV=1
 1716 : J0Z2G6_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J0Z2G6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM057 GN=argJ PE=3 SV=1
 1717 : J0ZW39_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J0ZW39     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM039 GN=argJ PE=3 SV=1
 1718 : J0ZZ17_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J0ZZ17     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM040 GN=argJ PE=3 SV=1
 1719 : J1A4T7_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J1A4T7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIHLM037 GN=argJ PE=3 SV=1
 1720 : J1E469_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  J1E469     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis NIH051475 GN=argJ PE=3 SV=1
 1721 : J3A2F2_STRRT        0.48  0.70    7  191    2  183  185    1    3  397  J3A2F2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus ratti FA-1 = DSM 20564 GN=argJ PE=3 SV=1
 1722 : J9YI72_LEUGJ        0.48  0.69  193  405  191  402  213    1    1  404  J9YI72     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc gelidum (strain JB7) GN=argJ PE=3 SV=1
 1723 : K0DEF1_LEUCJ        0.48  0.71    2  191    5  190  190    2    4  404  K0DEF1     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc carnosum (strain JB16) GN=argJ PE=3 SV=1
 1724 : K1JW90_9BURK        0.48  0.68  193  405  195  410  217    2    5  412  K1JW90     Arginine biosynthesis bifunctional protein ArgJ OS=Sutterella wadsworthensis 2_1_59BFAA GN=argJ PE=3 SV=1
 1725 : K4KXE2_9FIRM        0.48  0.69  193  405  205  413  213    2    4  415  K4KXE2     Arginine biosynthesis bifunctional protein ArgJ OS=Dehalobacter sp. DCA GN=argJ PE=3 SV=1
 1726 : K4L5H4_9FIRM        0.48  0.69  193  405  205  413  213    2    4  415  K4L5H4     Arginine biosynthesis bifunctional protein ArgJ OS=Dehalobacter sp. CF GN=argJ PE=3 SV=1
 1727 : K4LI93_THEPS        0.48  0.72   11  191   11  193  183    2    2  407  K4LI93     Arginine biosynthesis bifunctional protein ArgJ OS=Thermacetogenium phaeum (strain ATCC BAA-254 / DSM 12270 / PB) GN=argJ PE=3 SV=1
 1728 : K6DTB2_ARTPT        0.48  0.67  193  405  191  411  221    1    8  413  K6DTB2     Arginine biosynthesis bifunctional protein ArgJ OS=Arthrospira platensis str. Paraca GN=argJ PE=3 SV=1
 1729 : L1QKG8_9CLOT        0.48  0.70  193  405  196  411  218    4    7  413  L1QKG8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium celatum DSM 1785 GN=argJ PE=3 SV=1
 1730 : L7WWU5_STAWS        0.48  0.70   11  191    6  183  181    1    3  397  L7WWU5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus warneri (strain SG1) GN=argJ PE=3 SV=1
 1731 : L8LI64_9CHRO        0.48  0.67  193  405  191  411  221    1    8  413  L8LI64     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Gloeocapsa sp. PCC 73106 GN=argJ PE=3 SV=1
 1732 : L9LKT4_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  L9LKT4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus MTCC 5461 GN=argJ PE=3 SV=1
 1733 : L9LM43_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  L9LM43     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus MTCC 5460 GN=argJ PE=3 SV=1
 1734 : M1MA51_9SYNC        0.48  0.65  193  405  197  417  221    1    8  419  M1MA51     Arginine biosynthesis bifunctional protein ArgJ OS=Synechocystis sp. PCC 6803 GN=argJ PE=3 SV=1
 1735 : M2CMY1_STRMG        0.48  0.70    7  191    2  183  185    1    3  397  M2CMY1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 1ID3 GN=argJ PE=3 SV=1
 1736 : M2EV68_STRMG        0.48  0.70    7  191    2  183  185    1    3  397  M2EV68     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NFSM2 GN=argJ PE=3 SV=1
 1737 : M2F647_STRMG        0.48  0.70    7  191    2  183  185    1    3  397  M2F647     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 4VF1 GN=argJ PE=3 SV=1
 1738 : M2GWT8_STRMG        0.48  0.70    7  191    2  183  185    1    3  397  M2GWT8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NLML5 GN=argJ PE=3 SV=1
 1739 : M2J2W0_STRMG        0.48  0.70    7  191    2  183  185    1    3  397  M2J2W0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 14D GN=argJ PE=3 SV=1
 1740 : M2JAI4_STRMG        0.48  0.70    7  191    2  183  185    1    3  397  M2JAI4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans W6 GN=argJ PE=3 SV=1
 1741 : M2JC31_STRMG        0.48  0.70    7  191    2  183  185    1    3  397  M2JC31     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans U2A GN=argJ PE=3 SV=1
 1742 : M2JLT0_STRMG        0.48  0.70    7  191    2  183  185    1    3  397  M2JLT0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans SF14 GN=argJ PE=3 SV=1
 1743 : M2K197_STRMG        0.48  0.70    7  191    2  183  185    1    3  397  M2K197     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans NLML1 GN=argJ PE=3 SV=1
 1744 : M2KKE0_STRMG        0.48  0.70    7  191    2  183  185    1    3  397  M2KKE0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans 66-2A GN=argJ PE=3 SV=1
 1745 : N9ZWV5_9CLOT        0.48  0.69  193  405  197  412  217    2    5  414  N9ZWV5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium bolteae 90B3 GN=argJ PE=3 SV=1
 1746 : Q03LZ3_STRTD        0.48  0.69    7  191    2  183  185    1    3  397  Q03LZ3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9) GN=argJ PE=3 SV=1
 1747 : Q24ZJ2_DESHY        0.48  0.68  193  405  198  406  213    2    4  408  Q24ZJ2     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfitobacterium hafniense (strain Y51) GN=argJ PE=3 SV=1
 1748 : Q3M8G0_ANAVT        0.48  0.67  193  405  191  411  221    1    8  413  Q3M8G0     Arginine biosynthesis bifunctional protein ArgJ OS=Anabaena variabilis (strain ATCC 29413 / PCC 7937) GN=argJ PE=3 SV=1
 1749 : R0ACG3_9CLOT        0.48  0.69  193  405  197  412  217    2    5  414  R0ACG3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium bolteae 90A9 GN=argJ PE=3 SV=1
 1750 : R0BV78_9CLOT        0.48  0.69  193  405  197  412  217    2    5  414  R0BV78     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium bolteae 90B7 GN=argJ PE=3 SV=1
 1751 : R2RM85_9ENTE        0.48  0.75    7  191    2  183  185    2    3  397  R2RM85     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus malodoratus ATCC 43197 GN=argJ PE=3 SV=1
 1752 : R2VG02_9ENTE        0.48  0.74    7  191    2  183  185    2    3  397  R2VG02     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus gilvus ATCC BAA-350 GN=argJ PE=3 SV=1
 1753 : R5DTZ4_9FIRM        0.48  0.69  193  405  190  405  218    3    7  407  R5DTZ4     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:86 GN=argJ PE=3 SV=1
 1754 : R5FAH8_9CLOT        0.48  0.69  193  405  197  412  217    2    5  414  R5FAH8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium bolteae CAG:59 GN=argJ PE=3 SV=1
 1755 : R5IUE4_9FIRM        0.48  0.67  193  405  186  401  217    2    5  403  R5IUE4     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:124 GN=argJ PE=3 SV=1
 1756 : R5XLM6_9CLOT        0.48  0.71  193  405  188  403  217    2    5  405  R5XLM6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium bartlettii CAG:1329 GN=argJ PE=3 SV=1
 1757 : R5ZL30_9STRE        0.48  0.69    7  191    2  183  185    1    3  397  R5ZL30     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus CAG:236 GN=argJ PE=3 SV=1
 1758 : R6GH83_9FIRM        0.48  0.70  193  405  190  405  217    2    5  407  R6GH83     Arginine biosynthesis bifunctional protein ArgJ OS=Blautia sp. CAG:52 GN=argJ PE=3 SV=1
 1759 : R6I555_9FIRM        0.48  0.67  193  405  186  401  217    2    5  403  R6I555     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:177 GN=argJ PE=3 SV=1
 1760 : R6RFM0_9FIRM        0.48  0.67  193  405  190  405  218    3    7  407  R6RFM0     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:424 GN=argJ PE=3 SV=1
 1761 : R7ABB1_9BACE        0.48  0.70  193  405  190  406  219    4    8  408  R7ABB1     Arginine biosynthesis bifunctional protein ArgJ OS=Bacteroides pectinophilus CAG:437 GN=argJ PE=3 SV=1
 1762 : R7BYD1_9FIRM        0.48  0.69  193  405  191  406  217    2    5  408  R7BYD1     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:270 GN=argJ PE=3 SV=1
 1763 : R7CR83_9FIRM        0.48  0.68  193  405  190  405  217    2    5  407  R7CR83     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:9 GN=argJ PE=3 SV=1
 1764 : R7D799_9FIRM        0.48  0.68  193  405  190  405  217    2    5  407  R7D799     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus obeum CAG:39 GN=argJ PE=3 SV=1
 1765 : R7GXC7_9FIRM        0.48  0.69  193  405  190  405  217    2    5  407  R7GXC7     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:90 GN=argJ PE=3 SV=1
 1766 : S0JIY3_9ENTE        0.48  0.67   11  191    6  184  181    2    2  398  S0JIY3     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus saccharolyticus ATCC 43076 GN=argJ PE=3 SV=1
 1767 : S0KWC8_9ENTE        0.48  0.69    7  191    2  184  185    2    2  398  S0KWC8     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus columbae DSM 7374 = ATCC 51263 GN=argJ PE=3 SV=1
 1768 : S0L2Q0_9ENTE        0.48  0.64  193  405  185  396  213    1    1  398  S0L2Q0     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus sulfureus ATCC 49903 GN=argJ PE=3 SV=1
 1769 : S7LUP8_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  S7LUP8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis Scl22 GN=argJ PE=3 SV=1
 1770 : T0B8J3_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  T0B8J3     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis E13A GN=argJ PE=3 SV=1
 1771 : T0I0N0_9FIRM        0.48  0.69  193  405  205  413  213    2    4  415  T0I0N0     Arginine biosynthesis bifunctional protein ArgJ OS=Dehalobacter sp. UNSWDHB GN=argJ PE=3 SV=1
 1772 : T0SZ19_9STRE        0.48  0.69    7  191    2  183  185    1    3  397  T0SZ19     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sp. HSISS1 GN=argJ PE=3 SV=1
 1773 : T0TFM1_9STRE        0.48  0.70    7  191    2  183  185    1    3  397  T0TFM1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sp. HSISB1 GN=argJ PE=3 SV=1
 1774 : T0UH08_9STRE        0.48  0.69    7  191    2  183  185    1    3  397  T0UH08     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sp. HSISS4 GN=argJ PE=3 SV=1
 1775 : T0V314_9STRE        0.48  0.69    7  191    2  183  185    1    3  397  T0V314     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sp. HSISS3 GN=argJ PE=3 SV=1
 1776 : U3SSS1_STRMG        0.48  0.70    7  191    2  183  185    1    3  397  U3SSS1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus mutans LJ23 GN=argJ PE=3 SV=1
 1777 : U5UI38_9STAP        0.48  0.68  193  405  184  395  213    1    1  397  U5UI38     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus pasteuri SP1 GN=argJ PE=3 SV=1
 1778 : U5UI38_9STAP        0.48  0.69   11  191    6  183  181    1    3  397  U5UI38     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus pasteuri SP1 GN=argJ PE=3 SV=1
 1779 : V4QRB9_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  V4QRB9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis CIM28 GN=argJ PE=3 SV=1
 1780 : V4QZ68_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  V4QZ68     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis APO35 GN=argJ PE=3 SV=1
 1781 : V6QZ73_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  V6QZ73     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis CIM37 GN=argJ PE=3 SV=1
 1782 : V6X0X9_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  V6X0X9     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis WI05 GN=argJ PE=3 SV=1
 1783 : V6X2L8_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  V6X2L8     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis MC28 GN=argJ PE=3 SV=1
 1784 : V6XAU6_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  V6XAU6     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis WI09 GN=argJ PE=3 SV=1
 1785 : V6XLC5_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  V6XLC5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis CIM40 GN=argJ PE=3 SV=1
 1786 : V6XN75_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  V6XN75     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis APO27 GN=argJ PE=3 SV=1
 1787 : V6Y2C7_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  V6Y2C7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis MC16 GN=argJ PE=3 SV=1
 1788 : V6Y9V5_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  V6Y9V5     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis MC19 GN=argJ PE=3 SV=1
 1789 : V6YH64_STAEP        0.48  0.72    7  191    2  183  185    1    3  397  V6YH64     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus epidermidis Scl19 GN=argJ PE=3 SV=1
 1790 : V8LYB2_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  V8LYB2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus TH1436 GN=argJ PE=3 SV=1
 1791 : V8LYZ4_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  V8LYZ4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus TH1435 GN=argJ PE=3 SV=1
 1792 : W1WKT8_9ZZZZ        0.48  0.66  193  405  191  402  213    1    1  404  W1WKT8     Uncharacterized protein OS=human gut metagenome GN=Q604_UNBC18623G0004 PE=3 SV=1
 1793 : W4KYX7_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  W4KYX7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus MTH17CL396 GN=argJ PE=3 SV=1
 1794 : W4KZH4_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  W4KZH4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus thermophilus M17PTZA496 GN=argJ PE=3 SV=1
 1795 : W7UWZ9_RUMFL        0.48  0.65  193  405  214  429  217    2    5  431  W7UWZ9     Ornithine acetyltransferase OS=Ruminococcus flavefaciens 007c GN=RF007C_16420 PE=4 SV=1
 1796 : W7UXH0_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  W7UXH0     N-acetylglutamate synthase OS=Streptococcus thermophilus TH982 GN=Y018_02430 PE=4 SV=1
 1797 : W7V934_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  W7V934     N-acetylglutamate synthase OS=Streptococcus thermophilus 1F8CT GN=Y021_02425 PE=4 SV=1
 1798 : W7VIH0_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  W7VIH0     N-acetylglutamate synthase OS=Streptococcus thermophilus TH985 GN=Y016_02435 PE=4 SV=1
 1799 : W7VPI2_STRTR        0.48  0.69    7  191    2  183  185    1    3  397  W7VPI2     N-acetylglutamate synthase OS=Streptococcus thermophilus TH1477 GN=Y022_02560 PE=4 SV=1
 1800 : A3DBJ3_CLOTH        0.47  0.69  193  405  188  399  213    1    1  401  A3DBJ3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium thermocellum (strain ATCC 27405 / DSM 1237) GN=argJ PE=3 SV=1
 1801 : A8YHI9_MICAE        0.47  0.65  193  405  191  411  221    1    8  413  A8YHI9     Arginine biosynthesis bifunctional protein ArgJ OS=Microcystis aeruginosa PCC 7806 GN=argJ PE=3 SV=1
 1802 : ARGJ_CARHZ          0.47  0.65    7  191    2  185  186    2    3  399  Q3A9W1     Arginine biosynthesis bifunctional protein ArgJ OS=Carboxydothermus hydrogenoformans (strain Z-2901 / DSM 6008) GN=argJ PE=3 SV=1
 1803 : ARGJ_DEHE1          0.47  0.72  193  405  192  403  213    1    1  405  Q3Z731     Arginine biosynthesis bifunctional protein ArgJ OS=Dehalococcoides ethenogenes (strain 195) GN=argJ PE=3 SV=1
 1804 : B0N3G6_9FIRM        0.47  0.67  193  405  201  416  217    2    5  418  B0N3G6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium ramosum DSM 1402 GN=argJ PE=3 SV=1
 1805 : B0NE91_CLOSV        0.47  0.65  193  405  203  418  217    2    5  420  B0NE91     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium scindens ATCC 35704 GN=argJ PE=3 SV=1
 1806 : B1C854_9FIRM        0.47  0.69  193  405  189  404  217    2    5  406  B1C854     Arginine biosynthesis bifunctional protein ArgJ OS=Anaerofustis stercorihominis DSM 17244 GN=argJ PE=3 SV=1
 1807 : B1MWD0_LEUCK        0.47  0.71    2  191    5  190  190    2    4  404  B1MWD0     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc citreum (strain KM20) GN=argJ PE=3 SV=1
 1808 : B1WTE7_CYAA5        0.47  0.65  193  405  194  415  222    2    9  417  B1WTE7     Arginine biosynthesis bifunctional protein ArgJ OS=Cyanothece sp. (strain ATCC 51142) GN=argJ PE=3 SV=1
 1809 : C0BVS7_9CLOT        0.47  0.67  193  405  208  423  217    2    5  425  C0BVS7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium hylemonae DSM 15053 GN=argJ PE=3 SV=1
 1810 : C0QYU8_BRAHW        0.47  0.67  193  405  192  407  217    2    5  409  C0QYU8     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira hyodysenteriae (strain ATCC 49526 / WA1) GN=argJ PE=3 SV=1
 1811 : C4Z4C3_EUBE2        0.47  0.67  193  405  191  406  218    3    7  408  C4Z4C3     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium eligens (strain ATCC 27750 / VPI C15-48) GN=argJ PE=3 SV=1
 1812 : C7HFR9_CLOTM        0.47  0.69  193  405  188  399  213    1    1  401  C7HFR9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium thermocellum DSM 2360 GN=argJ PE=3 SV=1
 1813 : C8W632_DESAS        0.47  0.69   11  191   12  191  183    2    5  405  C8W632     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotomaculum acetoxidans (strain ATCC 49208 / DSM 771 / VKM B-1644) GN=argJ PE=3 SV=1
 1814 : D3AQ77_9CLOT        0.47  0.64    7  190    2  188  187    2    3  407  D3AQ77     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium hathewayi DSM 13479 GN=argJ PE=3 SV=1
 1815 : D4J9G8_9FIRM        0.47  0.68  193  405  190  405  217    2    5  407  D4J9G8     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus catus GD/7 GN=argJ PE=3 SV=1
 1816 : D4L5Y9_9FIRM        0.47  0.65  193  405  191  406  217    2    5  408  D4L5Y9     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus bromii L2-63 GN=argJ PE=3 SV=1
 1817 : D4LUR5_9FIRM        0.47  0.67  193  405  190  405  217    2    5  407  D4LUR5     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus obeum A2-162 GN=argJ PE=3 SV=1
 1818 : D4MXX6_9FIRM        0.47  0.68  193  405  191  406  217    2    5  408  D4MXX6     Arginine biosynthesis bifunctional protein ArgJ OS=butyrate-producing bacterium SSC/2 GN=argJ PE=3 SV=1
 1819 : D5T372_LEUKI        0.47  0.67  193  405  191  402  214    3    3  404  D5T372     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc kimchii (strain IMSNU 11154 / KCTC 2386 / IH25) GN=argJ PE=3 SV=1
 1820 : D5XAD4_THEPJ        0.47  0.67    5  191    1  186  187    1    1  400  D5XAD4     Arginine biosynthesis bifunctional protein ArgJ OS=Thermincola potens (strain JR) GN=argJ PE=3 SV=1
 1821 : D8IHH4_LACFC        0.47  0.72  193  405  187  398  213    1    1  400  D8IHH4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus fermentum (strain CECT 5716) GN=argJ PE=3 SV=1
 1822 : E0XSC4_9ACTN        0.47  0.67  193  405  198  411  215    3    3  413  E0XSC4     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured actinobacterium HF0070_17F14 GN=argJ PE=3 SV=1
 1823 : E0XSL2_9BACT        0.47  0.67  193  405  198  411  215    3    3  413  E0XSL2     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured Verrucomicrobiales bacterium HF0070_30L02 GN=argJ PE=3 SV=1
 1824 : E3GMV0_EUBLK        0.47  0.65  193  405  190  408  220    4    8  410  E3GMV0     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium limosum (strain KIST612) GN=argJ PE=3 SV=1
 1825 : E7FT72_9LACO        0.47  0.65   16  191    9  180  176    1    4  395  E7FT72     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus ruminis ATCC 25644 GN=argJ PE=3 SV=1
 1826 : F0YXQ0_9CLOT        0.47  0.68  193  405  190  405  217    2    5  407  F0YXQ0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. D5 GN=argJ PE=3 SV=1
 1827 : F2JI89_CELLD        0.47  0.65  193  405  189  404  217    2    5  406  F2JI89     Arginine biosynthesis bifunctional protein ArgJ OS=Cellulosilyticum lentocellum (strain ATCC 49066 / DSM 5427 / NCIMB 11756 / RHM5) GN=argJ PE=3 SV=1
 1828 : F4BLU5_CARS1        0.47  0.66    2  191   11  199  190    1    1  413  F4BLU5     Arginine biosynthesis bifunctional protein ArgJ OS=Carnobacterium sp. (strain 17-4) GN=argJ PE=3 SV=1
 1829 : F4XIA4_9CYAN        0.47  0.67  193  405  200  420  221    1    8  422  F4XIA4     Arginine biosynthesis bifunctional protein ArgJ OS=Moorea producens 3L GN=argJ PE=3 SV=1
 1830 : F5Y8H2_TREAZ        0.47  0.67  193  405  190  405  217    2    5  407  F5Y8H2     Arginine biosynthesis bifunctional protein ArgJ OS=Treponema azotonutricium (strain ATCC BAA-888 / DSM 13862 / ZAS-9) GN=argJ PE=3 SV=1
 1831 : F6B5T7_DESCC        0.47  0.67   12  191   14  193  183    3    6  407  F6B5T7     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotomaculum carboxydivorans (strain DSM 14880 / VKM B-2319 / CO-1-SRB) GN=argJ PE=3 SV=1
 1832 : F6CP37_DESK7        0.47  0.66   11  191   10  190  184    3    6  404  F6CP37     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotomaculum kuznetsovii (strain DSM 6115 / VKM B-1805 / 17) GN=argJ PE=3 SV=1
 1833 : F7QZT5_9LACO        0.47  0.65   16  191    9  180  176    1    4  395  F7QZT5     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus ruminis SPM0211 GN=argJ PE=3 SV=1
 1834 : F8HXS5_LEUS2        0.47  0.67  193  405  191  402  214    3    3  404  F8HXS5     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc sp. (strain C2) GN=argJ PE=3 SV=1
 1835 : F9Q709_9PAST        0.47  0.66   19  191   17  185  173    1    4  303  F9Q709     Arginine biosynthesis bifunctional protein ArgJ OS=Haemophilus pittmaniae HK 85 GN=argJ PE=3 SV=1
 1836 : G2FR56_9FIRM        0.47  0.69  193  405  209  417  213    2    4  419  G2FR56     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfosporosinus sp. OT GN=argJ PE=3 SV=1
 1837 : G2SM34_LACRR        0.47  0.65   16  191    9  180  176    1    4  395  G2SM34     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus ruminis (strain ATCC 27782 / RF3) GN=argJ PE=3 SV=1
 1838 : G5FFS8_9CLOT        0.47  0.65  193  405  185  400  217    2    5  402  G5FFS8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. 7_3_54FAA GN=argJ PE=3 SV=1
 1839 : G5HG67_9CLOT        0.47  0.68  193  405  197  412  217    2    5  414  G5HG67     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium citroniae WAL-17108 GN=argJ PE=3 SV=1
 1840 : G5IC63_9CLOT        0.47  0.69  193  405  190  405  217    2    5  407  G5IC63     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium hathewayi WAL-18680 GN=argJ PE=3 SV=1
 1841 : G6BRN6_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  G6BRN6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 70-100-2010 GN=argJ PE=3 SV=1
 1842 : H1WJQ6_9CYAN        0.47  0.67  193  405  191  411  221    1    8  413  H1WJQ6     Arginine biosynthesis bifunctional protein ArgJ OS=Arthrospira sp. PCC 8005 GN=argJ PE=3 SV=1
 1843 : H1WRF5_LEUCI        0.47  0.71    2  191   13  198  190    2    4  412  H1WRF5     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc citreum LBAE C10 GN=argJ PE=3 SV=1
 1844 : H1WWA6_LEUCI        0.47  0.71    2  191    5  190  190    2    4  404  H1WWA6     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc citreum LBAE C11 GN=argJ PE=3 SV=1
 1845 : H1X455_LEUCI        0.47  0.71    2  191   13  198  190    2    4  412  H1X455     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc citreum LBAE E16 GN=argJ PE=3 SV=1
 1846 : H2A5F2_STRMD        0.47  0.69    7  191    2  183  185    1    3  397  H2A5F2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus macedonicus (strain ACA-DC 198) GN=argJ PE=3 SV=1
 1847 : H8EC40_CLOTM        0.47  0.69  193  405  188  399  213    1    1  401  H8EC40     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium thermocellum AD2 GN=argJ PE=3 SV=1
 1848 : H8EML6_CLOTM        0.47  0.69  193  405  188  399  213    1    1  401  H8EML6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium thermocellum YS GN=argJ PE=3 SV=1
 1849 : I4FNG2_MICAE        0.47  0.65  193  405  191  411  221    1    8  413  I4FNG2     Arginine biosynthesis bifunctional protein ArgJ OS=Microcystis aeruginosa PCC 9717 GN=argJ PE=3 SV=1
 1850 : I4GNL1_MICAE        0.47  0.65  193  405  191  411  221    1    8  413  I4GNL1     Arginine biosynthesis bifunctional protein ArgJ OS=Microcystis aeruginosa PCC 7941 GN=argJ PE=3 SV=1
 1851 : I4H3X9_MICAE        0.47  0.65  193  405  191  411  221    1    8  413  I4H3X9     Arginine biosynthesis bifunctional protein ArgJ OS=Microcystis aeruginosa PCC 9807 GN=argJ PE=3 SV=1
 1852 : I4HYI8_MICAE        0.47  0.65  193  405  191  411  221    1    8  413  I4HYI8     Arginine biosynthesis bifunctional protein ArgJ OS=Microcystis aeruginosa PCC 9808 GN=argJ PE=3 SV=1
 1853 : I7A2K2_MELRP        0.47  0.70   13  191   19  197  180    2    2  408  I7A2K2     Arginine biosynthesis bifunctional protein ArgJ OS=Melioribacter roseus (strain JCM 17771 / P3M-2) GN=argJ PE=3 SV=1
 1854 : I7L7H9_9LACT        0.47  0.67   11  191    9  186  182    3    5  399  I7L7H9     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus raffinolactis 4877 GN=argJ PE=3 SV=1
 1855 : K9W2X8_9CYAN        0.47  0.67  193  405  191  411  221    1    8  413  K9W2X8     Arginine biosynthesis bifunctional protein ArgJ OS=Crinalium epipsammum PCC 9333 GN=argJ PE=3 SV=1
 1856 : K9YZ05_DACSA        0.47  0.65  193  405  191  411  221    1    8  413  K9YZ05     Arginine biosynthesis bifunctional protein ArgJ OS=Dactylococcopsis salina PCC 8305 GN=argJ PE=3 SV=1
 1857 : L0WZ68_9SPIR        0.47  0.67  193  405  192  408  218    3    6  410  L0WZ68     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira hampsonii 30446 GN=argJ PE=3 SV=1
 1858 : L8NMP5_MICAE        0.47  0.65  193  405  191  411  221    1    8  413  L8NMP5     Arginine biosynthesis bifunctional protein ArgJ OS=Microcystis aeruginosa DIANCHI905 GN=argJ PE=3 SV=1
 1859 : M7E755_9STRE        0.47  0.68    7  191    2  183  185    1    3  397  M7E755     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sobrinus DSM 20742 = ATCC 33478 GN=argJ PE=3 SV=1
 1860 : N9XEA2_9CLOT        0.47  0.67  193  405  197  412  218    3    7  414  N9XEA2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium clostridioforme 90A8 GN=argJ PE=3 SV=1
 1861 : N9ZGX9_9CLOT        0.47  0.67  193  405  197  412  218    3    7  414  N9ZGX9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium clostridioforme 90A1 GN=argJ PE=3 SV=1
 1862 : Q188A1_CLOD6        0.47  0.71  193  405  188  403  217    2    5  405  Q188A1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile (strain 630) GN=argJ PE=3 SV=1
 1863 : Q2RG63_MOOTA        0.47  0.65   11  191   10  189  182    2    3  405  Q2RG63     Arginine biosynthesis bifunctional protein ArgJ OS=Moorella thermoacetica (strain ATCC 39073) GN=argJ PE=3 SV=1
 1864 : R0CG15_9CLOT        0.47  0.67  193  405  197  412  218    3    7  414  R0CG15     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium clostridioforme 90A6 GN=argJ PE=3 SV=1
 1865 : R0D897_9CLOT        0.47  0.67  193  405  197  412  218    3    7  414  R0D897     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium clostridioforme 90A4 GN=argJ PE=3 SV=1
 1866 : R4RH46_LACFE        0.47  0.67   18  191   17  186  174    1    4  400  R4RH46     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus fermentum F-6 GN=argJ PE=3 SV=1
 1867 : R5CNE0_9FIRM        0.47  0.68  193  405  191  406  219    3    9  408  R5CNE0     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:791 GN=argJ PE=3 SV=1
 1868 : R5E5X1_9FIRM        0.47  0.65  193  405  191  406  217    2    5  408  R5E5X1     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:108 GN=argJ PE=3 SV=1
 1869 : R5HT10_9FIRM        0.47  0.63  193  405  194  409  217    2    5  411  R5HT10     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:114 GN=argJ PE=3 SV=1
 1870 : R5T8X7_9CLOT        0.47  0.64    7  190    2  188  187    2    3  407  R5T8X7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium hathewayi CAG:224 GN=argJ PE=3 SV=1
 1871 : R5ZI00_9FIRM        0.47  0.67  193  405  191  406  218    3    7  408  R5ZI00     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium eligens CAG:72 GN=argJ PE=3 SV=1
 1872 : R6JRG9_9CLOT        0.47  0.68  193  405  197  412  218    3    7  414  R6JRG9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium clostridioforme CAG:132 GN=argJ PE=3 SV=1
 1873 : R6SNY3_9LACO        0.47  0.65   16  191    9  180  176    1    4  395  R6SNY3     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus ruminis CAG:367 GN=argJ PE=3 SV=1
 1874 : R6VZ56_9CLOT        0.47  0.69  193  405  190  405  217    2    5  407  R6VZ56     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:91 GN=argJ PE=3 SV=1
 1875 : R6YHI4_9FIRM        0.47  0.67  193  405  187  402  217    2    5  404  R6YHI4     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:94 GN=argJ PE=3 SV=1
 1876 : R7I7D7_9FIRM        0.47  0.68  193  405  187  402  217    2    5  404  R7I7D7     Arginine biosynthesis bifunctional protein ArgJ OS=Faecalibacterium sp. CAG:74 GN=argJ PE=3 SV=1
 1877 : R7QZ28_9FIRM        0.47  0.68  193  405  190  405  217    2    5  407  R7QZ28     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:182 GN=argJ PE=3 SV=1
 1878 : R7R7I1_9FIRM        0.47  0.67  193  405  190  405  217    2    5  407  R7R7I1     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:100 GN=argJ PE=3 SV=1
 1879 : R9ISQ7_9FIRM        0.47  0.68  193  405  190  405  218    4    7  407  R9ISQ7     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium A4 GN=argJ PE=3 SV=1
 1880 : R9MA83_9FIRM        0.47  0.67  193  405  190  405  218    3    7  407  R9MA83     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 3-2 GN=argJ PE=3 SV=1
 1881 : R9MWB7_9FIRM        0.47  0.66  193  405  190  405  217    2    5  407  R9MWB7     Arginine biosynthesis bifunctional protein ArgJ OS=Dorea sp. 5-2 GN=argJ PE=3 SV=1
 1882 : S0JG15_9FIRM        0.47  0.67  193  405  190  405  217    2    5  407  S0JG15     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. 14-2 GN=argJ PE=3 SV=1
 1883 : S3JEE9_MICAE        0.47  0.65  193  405  191  411  221    1    8  413  S3JEE9     Arginine biosynthesis bifunctional protein ArgJ OS=Microcystis aeruginosa SPC777 GN=argJ PE=3 SV=1
 1884 : T2TJX6_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T2TJX6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD9 GN=argJ PE=3 SV=1
 1885 : T2TY71_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T2TY71     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD13 GN=argJ PE=3 SV=1
 1886 : T2TYG6_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T2TYG6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD8 GN=argJ PE=3 SV=1
 1887 : T2UKW9_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T2UKW9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD17 GN=argJ PE=3 SV=1
 1888 : T2US57_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T2US57     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD18 GN=argJ PE=3 SV=1
 1889 : T2V4L2_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T2V4L2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD21 GN=argJ PE=3 SV=1
 1890 : T2VPF8_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T2VPF8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD34 GN=argJ PE=3 SV=1
 1891 : T2X6G4_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T2X6G4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD39 GN=argJ PE=3 SV=1
 1892 : T2XLF1_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T2XLF1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD43 GN=argJ PE=3 SV=1
 1893 : T2YEE5_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T2YEE5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD45 GN=argJ PE=3 SV=1
 1894 : T2YV27_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T2YV27     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD47 GN=argJ PE=3 SV=1
 1895 : T2ZDA3_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T2ZDA3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD49 GN=argJ PE=3 SV=1
 1896 : T2ZQW9_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T2ZQW9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD68 GN=argJ PE=3 SV=1
 1897 : T3A3U1_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3A3U1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD69 GN=argJ PE=3 SV=1
 1898 : T3AUW3_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3AUW3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD70 GN=argJ PE=3 SV=1
 1899 : T3BW80_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3BW80     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD132 GN=argJ PE=3 SV=1
 1900 : T3CV10_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3CV10     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD129 GN=argJ PE=3 SV=1
 1901 : T3DK30_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3DK30     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD159 GN=argJ PE=3 SV=1
 1902 : T3EZ01_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3EZ01     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD170 GN=argJ PE=3 SV=1
 1903 : T3FHK2_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3FHK2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD178 GN=argJ PE=3 SV=1
 1904 : T3GXY9_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3GXY9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD206 GN=argJ PE=3 SV=1
 1905 : T3HJX6_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3HJX6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD212 GN=argJ PE=3 SV=1
 1906 : T3HU63_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3HU63     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD211 GN=argJ PE=3 SV=1
 1907 : T3I0J2_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3I0J2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 342 GN=argJ PE=3 SV=1
 1908 : T3J779_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3J779     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 842 GN=argJ PE=3 SV=1
 1909 : T3JE33_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3JE33     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 840 GN=argJ PE=3 SV=1
 1910 : T3JN76_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3JN76     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 6042 GN=argJ PE=3 SV=1
 1911 : T3JTA1_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3JTA1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 6041 GN=argJ PE=3 SV=1
 1912 : T3L1R1_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3L1R1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00065 GN=argJ PE=3 SV=1
 1913 : T3LKN9_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3LKN9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00114 GN=argJ PE=3 SV=1
 1914 : T3MFS5_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3MFS5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00128 GN=argJ PE=3 SV=1
 1915 : T3N1L0_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3N1L0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00132 GN=argJ PE=3 SV=1
 1916 : T3NAC5_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3NAC5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00134 GN=argJ PE=3 SV=1
 1917 : T3PAD9_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3PAD9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00145 GN=argJ PE=3 SV=1
 1918 : T3PHC6_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3PHC6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00149 GN=argJ PE=3 SV=1
 1919 : T3PUU8_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3PUU8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00154 GN=argJ PE=3 SV=1
 1920 : T3Q8Y6_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3Q8Y6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00160 GN=argJ PE=3 SV=1
 1921 : T3R968_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3R968     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00183 GN=argJ PE=3 SV=1
 1922 : T3RFE9_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3RFE9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00174 GN=argJ PE=3 SV=1
 1923 : T3SAB5_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3SAB5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00189 GN=argJ PE=3 SV=1
 1924 : T3SBI1_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3SBI1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00193 GN=argJ PE=3 SV=1
 1925 : T3SVK4_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3SVK4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00196 GN=argJ PE=3 SV=1
 1926 : T3TBV4_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3TBV4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00197 GN=argJ PE=3 SV=1
 1927 : T3U578_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3U578     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00210 GN=argJ PE=3 SV=1
 1928 : T3UIT4_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3UIT4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00211 GN=argJ PE=3 SV=1
 1929 : T3V331_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3V331     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00215 GN=argJ PE=3 SV=1
 1930 : T3VIH8_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3VIH8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00232 GN=argJ PE=3 SV=1
 1931 : T3VV24_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3VV24     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00238 GN=argJ PE=3 SV=1
 1932 : T3YVQ2_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T3YVQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00305 GN=argJ PE=3 SV=1
 1933 : T3ZD24_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T3ZD24     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00310 GN=argJ PE=3 SV=1
 1934 : T4BBI8_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4BBI8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F253 GN=argJ PE=3 SV=1
 1935 : T4BUD5_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4BUD5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y21 GN=argJ PE=3 SV=1
 1936 : T4CD32_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4CD32     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y41 GN=argJ PE=3 SV=1
 1937 : T4DTI7_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4DTI7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y184 GN=argJ PE=3 SV=1
 1938 : T4E1M8_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4E1M8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y202 GN=argJ PE=3 SV=1
 1939 : T4F0D3_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4F0D3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y270 GN=argJ PE=3 SV=1
 1940 : T4FFK2_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4FFK2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y312 GN=argJ PE=3 SV=1
 1941 : T4FUU6_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4FUU6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y307 GN=argJ PE=3 SV=1
 1942 : T4GHN1_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4GHN1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y358 GN=argJ PE=3 SV=1
 1943 : T4HEF4_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4HEF4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P1 GN=argJ PE=3 SV=1
 1944 : T4HGI1_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4HGI1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y401 GN=argJ PE=3 SV=1
 1945 : T4HN11_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4HN11     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y384 GN=argJ PE=3 SV=1
 1946 : T4ICA6_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4ICA6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P3 GN=argJ PE=3 SV=1
 1947 : T4IRV0_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4IRV0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P5 GN=argJ PE=3 SV=1
 1948 : T4J3W9_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4J3W9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P6 GN=argJ PE=3 SV=1
 1949 : T4KBI9_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4KBI9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P13 GN=argJ PE=3 SV=1
 1950 : T4KKG3_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4KKG3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P11 GN=argJ PE=3 SV=1
 1951 : T4M7L4_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4M7L4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P23 GN=argJ PE=3 SV=1
 1952 : T4MB23_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4MB23     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P21 GN=argJ PE=3 SV=1
 1953 : T4MYV7_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4MYV7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P24 GN=argJ PE=3 SV=1
 1954 : T4NRG1_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4NRG1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P32 GN=argJ PE=3 SV=1
 1955 : T4PIY0_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4PIY0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P38 GN=argJ PE=3 SV=1
 1956 : T4PL38_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4PL38     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P42 GN=argJ PE=3 SV=1
 1957 : T4QJT5_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4QJT5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P46 GN=argJ PE=3 SV=1
 1958 : T4QUV2_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4QUV2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P48 GN=argJ PE=3 SV=1
 1959 : T4REW0_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4REW0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P50 GN=argJ PE=3 SV=1
 1960 : T4RYL8_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4RYL8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P51 GN=argJ PE=3 SV=1
 1961 : T4S8X7_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4S8X7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P61 GN=argJ PE=3 SV=1
 1962 : T4T5Y6_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4T5Y6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P69 GN=argJ PE=3 SV=1
 1963 : T4U137_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4U137     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P71 GN=argJ PE=3 SV=1
 1964 : T4UDN3_CLODI        0.47  0.71  193  405   95  310  217    2    5  312  T4UDN3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P75 GN=argJ PE=3 SV=1
 1965 : T4UHF5_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4UHF5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P73 GN=argJ PE=3 SV=1
 1966 : T4USJ9_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4USJ9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P74 GN=argJ PE=3 SV=1
 1967 : T4VZ71_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4VZ71     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P77 GN=argJ PE=3 SV=1
 1968 : T4WAU8_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4WAU8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F480 GN=argJ PE=3 SV=1
 1969 : T4XLV3_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4XLV3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD90 GN=argJ PE=3 SV=1
 1970 : T4Y836_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4Y836     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD92 GN=argJ PE=3 SV=1
 1971 : T4YAM8_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4YAM8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD111 GN=argJ PE=3 SV=1
 1972 : T4YBH5_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4YBH5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD113 GN=argJ PE=3 SV=1
 1973 : T4ZE98_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T4ZE98     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P30 GN=argJ PE=3 SV=1
 1974 : T4ZNW8_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  T4ZNW8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD127 GN=argJ PE=3 SV=1
 1975 : T5B1G7_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  T5B1G7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD86 GN=argJ PE=3 SV=1
 1976 : U2C3U6_CLOSY        0.47  0.65  193  405  185  400  217    2    5  402  U2C3U6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium symbiosum ATCC 14940 GN=argJ PE=3 SV=1
 1977 : U2KP81_9STRE        0.47  0.68    5  191   35  218  187    1    3  432  U2KP81     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus sobrinus W1703 GN=argJ PE=3 SV=1
 1978 : U3UQ04_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  U3UQ04     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T20 GN=argJ PE=3 SV=1
 1979 : U3VKV3_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  U3VKV3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E13 GN=argJ PE=3 SV=1
 1980 : U3W392_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  U3W392     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD002 GN=argJ PE=3 SV=1
 1981 : U3WD17_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  U3WD17     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E16 GN=argJ PE=3 SV=1
 1982 : U3WJT9_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  U3WJT9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T22 GN=argJ PE=3 SV=1
 1983 : U3XJK0_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  U3XJK0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T11 GN=argJ PE=3 SV=1
 1984 : U3YAI5_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  U3YAI5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T23 GN=argJ PE=3 SV=1
 1985 : U3Z6T6_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  U3Z6T6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T42 GN=argJ PE=3 SV=1
 1986 : U3ZRA9_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  U3ZRA9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E14 GN=argJ PE=3 SV=1
 1987 : U4A4Z2_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  U4A4Z2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T17 GN=argJ PE=3 SV=1
 1988 : U4BAY7_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  U4BAY7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E28 GN=argJ PE=3 SV=1
 1989 : U4BT32_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  U4BT32     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E23 GN=argJ PE=3 SV=1
 1990 : U4BTC2_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  U4BTC2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E12 GN=argJ PE=3 SV=1
 1991 : U4CH91_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  U4CH91     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T10 GN=argJ PE=3 SV=1
 1992 : U4MLS2_CLOTM        0.47  0.69  193  405  188  399  213    1    1  401  U4MLS2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium thermocellum BC1 GN=argJ PE=3 SV=1
 1993 : U4X5X5_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  U4X5X5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P33 GN=argJ PE=3 SV=1
 1994 : U4XQF3_CLODI        0.47  0.70  193  405  188  403  217    2    5  405  U4XQF3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00130 GN=argJ PE=3 SV=1
 1995 : U4Y7W4_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  U4Y7W4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P37 GN=argJ PE=3 SV=1
 1996 : U4Z0F9_CLODI        0.47  0.71  193  405  188  403  217    2    5  405  U4Z0F9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F665 GN=argJ PE=3 SV=1
 1997 : W1WKT8_9ZZZZ        0.47  0.70    2  191    5  190  190    2    4  404  W1WKT8     Uncharacterized protein OS=human gut metagenome GN=Q604_UNBC18623G0004 PE=3 SV=1
 1998 : A1B590_PARDP        0.46  0.66  193  405  250  463  215    3    3  465  A1B590     Arginine biosynthesis bifunctional protein ArgJ OS=Paracoccus denitrificans (strain Pd 1222) GN=argJ PE=3 SV=1
 1999 : A1BG25_CHLPD        0.46  0.66  193  405  217  426  213    2    3  428  A1BG25     Arginine biosynthesis bifunctional protein ArgJ OS=Chlorobium phaeobacteroides (strain DSM 266) GN=argJ PE=3 SV=1
 2000 : A5D505_PELTS        0.46  0.69   11  191    8  188  182    2    2  402  A5D505     Arginine biosynthesis bifunctional protein ArgJ OS=Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI) GN=ArgJ PE=3 SV=1
 2001 : A5FQ83_DEHSB        0.46  0.70  193  405  198  409  213    1    1  411  A5FQ83     Arginine biosynthesis bifunctional protein ArgJ OS=Dehalococcoides sp. (strain BAV1) GN=argJ PE=3 SV=1
 2002 : A5N8G5_CLOK5        0.46  0.68  193  405  189  404  218    3    7  406  A5N8G5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680) GN=argJ PE=3 SV=1
 2003 : A5Z3G6_9FIRM        0.46  0.66  193  405  212  427  217    2    5  429  A5Z3G6     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium ventriosum ATCC 27560 GN=argJ PE=3 SV=1
 2004 : ARGJ_DEHSC          0.46  0.70  193  405  192  403  213    1    1  405  Q3ZYG4     Arginine biosynthesis bifunctional protein ArgJ OS=Dehalococcoides sp. (strain CBDB1) GN=argJ PE=3 SV=1
 2005 : ARGJ_SYNP6          0.46  0.63  193  405  193  413  221    1    8  415  Q5MZY1     Arginine biosynthesis bifunctional protein ArgJ OS=Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1) GN=argJ PE=3 SV=1
 2006 : ARGJ_THETN          0.46  0.66  193  405  186  401  217    2    5  403  Q8R7B9     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4) GN=argJ PE=3 SV=1
 2007 : B0JYC7_MICAN        0.46  0.65  193  405  191  411  221    1    8  413  B0JYC7     Arginine biosynthesis bifunctional protein ArgJ OS=Microcystis aeruginosa (strain NIES-843) GN=argJ PE=3 SV=1
 2008 : B2TQ26_CLOBB        0.46  0.68  193  405  190  405  217    2    5  407  B2TQ26     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium botulinum (strain Eklund 17B / Type B) GN=argJ PE=3 SV=1
 2009 : B2UYI3_CLOBA        0.46  0.68  193  405  190  405  217    2    5  407  B2UYI3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium botulinum (strain Alaska E43 / Type E3) GN=argJ PE=3 SV=1
 2010 : C0WXH8_LACFE        0.46  0.67   17  191   16  186  175    1    4  315  C0WXH8     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus fermentum ATCC 14931 GN=argJ PE=3 SV=1
 2011 : C6LGL4_9FIRM        0.46  0.68  193  405  190  405  217    2    5  407  C6LGL4     Arginine biosynthesis bifunctional protein ArgJ OS=Marvinbryantia formatexigens DSM 14469 GN=argJ PE=3 SV=1
 2012 : D0DQV7_LACFE        0.46  0.67   18  191   17  186  174    1    4  400  D0DQV7     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus fermentum 28-3-CHN GN=argJ PE=3 SV=1
 2013 : D2C833_THENR        0.46  0.65   15  191    3  179  178    2    2  397  D2C833     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga naphthophila (strain ATCC BAA-489 / DSM 13996 / JCM 10882 / RKU-10) GN=argJ PE=3 SV=1
 2014 : D4IVS5_BUTFI        0.46  0.71  193  405  190  405  217    2    5  407  D4IVS5     Arginine biosynthesis bifunctional protein ArgJ OS=Butyrivibrio fibrisolvens 16/4 GN=argJ PE=3 SV=1
 2015 : D4LFE2_RUMC1        0.46  0.68  193  405  207  422  217    2    5  424  D4LFE2     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus champanellensis (strain DSM 18848 / JCM 17042 / 18P13) GN=argJ PE=3 SV=1
 2016 : D5T372_LEUKI        0.46  0.70    2  191    5  190  190    2    4  404  D5T372     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc kimchii (strain IMSNU 11154 / KCTC 2386 / IH25) GN=argJ PE=3 SV=1
 2017 : D7DWN5_NOSA0        0.46  0.65  193  405  191  411  221    1    8  413  D7DWN5     Arginine biosynthesis bifunctional protein ArgJ OS=Nostoc azollae (strain 0708) GN=argJ PE=3 SV=1
 2018 : D8G171_9CYAN        0.46  0.66  193  405  191  411  221    2    8  413  D8G171     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillatoria sp. PCC 6506 GN=argJ PE=3 SV=1
 2019 : D8IHH4_LACFC        0.46  0.66   18  191   17  186  174    1    4  400  D8IHH4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus fermentum (strain CECT 5716) GN=argJ PE=3 SV=1
 2020 : E3CHD9_STRDO        0.46  0.69    7  191    2  183  185    1    3  397  E3CHD9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus downei F0415 GN=argJ PE=3 SV=1
 2021 : E6MFH8_9FIRM        0.46  0.68  193  405  198  414  218    3    6  416  E6MFH8     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudoramibacter alactolyticus ATCC 23263 GN=argJ PE=3 SV=1
 2022 : F7JAV6_9FIRM        0.46  0.66  193  405  190  405  218    3    7  407  F7JAV6     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 1_1_57FAA GN=argJ PE=3 SV=1
 2023 : F8HXS5_LEUS2        0.46  0.70    2  191    5  190  190    2    4  404  F8HXS5     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc sp. (strain C2) GN=argJ PE=3 SV=1
 2024 : F9Y649_KETVW        0.46  0.67  193  405  195  402  217    5   13  404  F9Y649     Arginine biosynthesis bifunctional protein ArgJ OS=Ketogulonicigenium vulgare (strain WSH-001) GN=argJ PE=3 SV=1
 2025 : G4KUS7_OSCVS        0.46  0.66  193  405  191  404  217    3    7  406  G4KUS7     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillibacter valericigenes (strain DSM 18026 / NBRC 101213 / Sjm18-20) GN=argJ PE=3 SV=1
 2026 : G5JGU4_9STAP        0.46  0.71    2  191    7  196  191    2    2  410  G5JGU4     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus simiae CCM 7213 GN=argJ PE=3 SV=1
 2027 : G5JRK5_STRCG        0.46  0.69    7  191    2  183  185    1    3  397  G5JRK5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus criceti HS-6 GN=argJ PE=3 SV=1
 2028 : G5JUS1_9STRE        0.46  0.69    7  191    2  183  185    1    3  397  G5JUS1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptococcus macacae NCTC 11558 GN=argJ PE=3 SV=1
 2029 : G8QXM1_SPHPG        0.46  0.70  193  405  191  406  217    2    5  408  G8QXM1     Arginine biosynthesis bifunctional protein ArgJ OS=Sphaerochaeta pleomorpha (strain ATCC BAA-1885 / DSM 22778 / Grapes) GN=argJ PE=3 SV=1
 2030 : I1H6V6_BRADI        0.46  0.69  193  405  245  462  218    3    5  464  I1H6V6     Uncharacterized protein OS=Brachypodium distachyon GN=BRADI1G66350 PE=3 SV=1
 2031 : I3VTI0_THESW        0.46  0.68  193  405  189  404  217    2    5  406  I3VTI0     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacterium saccharolyticum (strain DSM 8691 / JW/SL-YS485) GN=argJ PE=3 SV=1
 2032 : I4HKQ6_MICAE        0.46  0.65  193  405  191  411  221    1    8  413  I4HKQ6     Arginine biosynthesis bifunctional protein ArgJ OS=Microcystis aeruginosa PCC 9809 GN=argJ PE=3 SV=1
 2033 : I9AU68_9FIRM        0.46  0.65  193  405  188  399  213    1    1  401  I9AU68     Arginine biosynthesis bifunctional protein ArgJ OS=Pelosinus fermentans B4 GN=argJ PE=3 SV=1
 2034 : I9BBR2_9FIRM        0.46  0.65  193  405  188  399  213    1    1  401  I9BBR2     Arginine biosynthesis bifunctional protein ArgJ OS=Pelosinus fermentans A11 GN=argJ PE=3 SV=1
 2035 : I9MQS3_9FIRM        0.46  0.65  193  405  149  360  213    1    1  362  I9MQS3     Arginine biosynthesis bifunctional protein ArgJ (Fragment) OS=Pelosinus fermentans B3 GN=FB3_2238 PE=3 SV=1
 2036 : J7IQB2_DESMD        0.46  0.69  193  405  209  417  213    2    4  419  J7IQB2     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfosporosinus meridiei (strain ATCC BAA-275 / DSM 13257 / NCIMB 13706 / S10) GN=argJ PE=3 SV=1
 2037 : K0DEF1_LEUCJ        0.46  0.67  193  405  191  402  214    3    3  404  K0DEF1     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc carnosum (strain JB16) GN=argJ PE=3 SV=1
 2038 : K2DWC8_9BACT        0.46  0.71  193  405  189  404  217    2    5  406  K2DWC8     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured bacterium GN=argJ PE=3 SV=1
 2039 : K2DWC8_9BACT        0.46  0.64    7  191    2  188  191    3   10  406  K2DWC8     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured bacterium GN=argJ PE=3 SV=1
 2040 : K2LXJ1_9PROT        0.46  0.67  193  405  194  407  215    3    3  409  K2LXJ1     Arginine biosynthesis bifunctional protein ArgJ OS=Thalassospira profundimaris WP0211 GN=argJ PE=3 SV=1
 2041 : K2M1S1_9PROT        0.46  0.68  193  405  194  407  215    3    3  409  K2M1S1     Arginine biosynthesis bifunctional protein ArgJ OS=Thalassospira xiamenensis M-5 = DSM 17429 GN=argJ PE=3 SV=1
 2042 : K9TJM2_9CYAN        0.46  0.66  193  405  191  411  221    1    8  413  K9TJM2     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillatoria acuminata PCC 6304 GN=argJ PE=3 SV=1
 2043 : K9XRH6_STAC7        0.46  0.65  193  405  191  411  221    1    8  413  K9XRH6     Arginine biosynthesis bifunctional protein ArgJ OS=Stanieria cyanosphaera (strain ATCC 29371 / PCC 7437) GN=argJ PE=3 SV=1
 2044 : K9YEU2_HALP7        0.46  0.65  193  405  191  411  221    1    8  413  K9YEU2     Arginine biosynthesis bifunctional protein ArgJ OS=Halothece sp. (strain PCC 7418) GN=argJ PE=3 SV=1
 2045 : K9YNX2_CYASC        0.46  0.66  193  405  191  411  221    1    8  413  K9YNX2     Arginine biosynthesis bifunctional protein ArgJ OS=Cyanobacterium stanieri (strain ATCC 29140 / PCC 7202) GN=argJ PE=3 SV=1
 2046 : L8XQC8_9SPIR        0.46  0.67  193  405  192  408  218    3    6  410  L8XQC8     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira hampsonii 30599 GN=argJ PE=3 SV=1
 2047 : M1RAY0_9CHLR        0.46  0.70  193  405  192  403  213    1    1  405  M1RAY0     Arginine biosynthesis bifunctional protein ArgJ OS=Dehalococcoides mccartyi DCMB5 GN=argJ PE=3 SV=1
 2048 : Q040B1_LEUMM        0.46  0.67    2  191    5  190  190    2    4  404  Q040B1     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / NCDO 523) GN=argJ PE=3 SV=1
 2049 : Q1AS31_RUBXD        0.46  0.67  193  405  194  405  213    1    1  407  Q1AS31     Arginine biosynthesis bifunctional protein ArgJ OS=Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129) GN=argJ PE=3 SV=1
 2050 : Q31LZ3_SYNE7        0.46  0.63  193  405  192  412  221    1    8  414  Q31LZ3     Arginine biosynthesis bifunctional protein ArgJ OS=Synechococcus elongatus (strain PCC 7942) GN=argJ PE=3 SV=1
 2051 : R5KIL9_9CLOT        0.46  0.68  193  405   39  254  217    2    5  256  R5KIL9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:264 GN=argJ PE=3 SV=1
 2052 : R5TKX4_9FIRM        0.46  0.66  193  405  190  405  217    2    5  407  R5TKX4     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus gnavus CAG:126 GN=argJ PE=3 SV=1
 2053 : R6HGR9_9ACTN        0.46  0.64  193  405  202  416  216    3    4  418  R6HGR9     Arginine biosynthesis bifunctional protein ArgJ OS=Eggerthella sp. CAG:209 GN=argJ PE=3 SV=1
 2054 : R6S0C7_9FIRM        0.46  0.68  193  405  190  405  217    2    5  407  R6S0C7     Arginine biosynthesis bifunctional protein ArgJ OS=Dorea formicigenerans CAG:28 GN=argJ PE=3 SV=1
 2055 : R6T4L2_9FIRM        0.46  0.66  193  405  191  406  217    2    5  408  R6T4L2     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillibacter sp. CAG:155 GN=argJ PE=3 SV=1
 2056 : R6ZKJ4_9FIRM        0.46  0.68  193  405  190  405  218    3    7  407  R6ZKJ4     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:534 GN=argJ PE=3 SV=1
 2057 : R7AYC0_9FIRM        0.46  0.67  193  405  207  422  217    2    5  424  R7AYC0     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:379 GN=argJ PE=3 SV=1
 2058 : R7HVX5_9CLOT        0.46  0.65  193  405  198  413  217    2    5  415  R7HVX5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:411 GN=argJ PE=3 SV=1
 2059 : R9J847_9FIRM        0.46  0.67  193  405  190  405  218    4    7  407  R9J847     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 28-4 GN=argJ PE=3 SV=1
 2060 : R9LXV8_9FIRM        0.46  0.68  193  405  189  404  217    2    5  406  R9LXV8     Arginine biosynthesis bifunctional protein ArgJ OS=Anaerotruncus sp. G3(2012) GN=argJ PE=3 SV=1
 2061 : R9M9N8_9FIRM        0.46  0.64  193  405  191  406  217    2    5  408  R9M9N8     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillibacter sp. 1-3 GN=argJ PE=3 SV=1
 2062 : S0KIP3_9ENTE        0.46  0.66   10  191    5  181  182    2    5  395  S0KIP3     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus dispar ATCC 51266 GN=argJ PE=3 SV=1
 2063 : S7V301_DESML        0.46  0.65   18  191    8  181  175    2    2  394  S7V301     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfococcus multivorans DSM 2059 GN=argJ PE=3 SV=1
 2064 : T1CR97_9HELI        0.46  0.66  193  405  194  410  218    3    6  412  T1CR97     Arginine biosynthesis bifunctional protein ArgJ OS=Helicobacter fennelliae MRY12-0050 GN=argJ PE=3 SV=1
 2065 : T2IEA9_CROWT        0.46  0.66  193  405  193  414  222    2    9  416  T2IEA9     Arginine biosynthesis bifunctional protein ArgJ OS=Crocosphaera watsonii WH 8502 GN=argJ PE=3 SV=1
 2066 : T2ILN0_CROWT        0.46  0.66  193  405  193  414  222    2    9  416  T2ILN0     Arginine biosynthesis bifunctional protein ArgJ OS=Crocosphaera watsonii WH 0005 GN=argJ PE=3 SV=1
 2067 : T2J6U6_CROWT        0.46  0.66  193  405  193  414  222    2    9  416  T2J6U6     Arginine biosynthesis bifunctional protein ArgJ OS=Crocosphaera watsonii WH 0401 GN=argJ PE=3 SV=1
 2068 : T2JZH3_CROWT        0.46  0.66  193  405  194  415  222    2    9  417  T2JZH3     Arginine biosynthesis bifunctional protein ArgJ OS=Crocosphaera watsonii WH 0402 GN=argJ PE=3 SV=1
 2069 : U2CDF7_9CLOT        0.46  0.64   10  190    5  188  184    2    3  407  U2CDF7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. KLE 1755 GN=argJ PE=3 SV=1
 2070 : U5RSZ9_9CLOT        0.46  0.67  193  405  189  404  217    2    5  406  U5RSZ9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium autoethanogenum DSM 10061 GN=argJ PE=3 SV=1
 2071 : U5SB53_9LACT        0.46  0.63    2  191    9  197  190    1    1  411  U5SB53     Arginine biosynthesis bifunctional protein ArgJ OS=Carnobacterium sp. WN1359 GN=argJ PE=3 SV=1
 2072 : V4WYN8_LACFE        0.46  0.67   18  191   17  186  174    1    4  400  V4WYN8     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus fermentum NB-22 GN=argJ PE=3 SV=1
 2073 : V5QC42_9CHLR        0.46  0.72  193  405  192  403  213    1    1  405  V5QC42     Arginine biosynthesis bifunctional protein ArgJ OS=Dehalococcoides mccartyi GY50 GN=argJ PE=3 SV=1
 2074 : A0ZN84_NODSP        0.45  0.64  193  405   28  258  231    2   18  260  A0ZN84     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein (Fragment) OS=Nodularia spumigena CCY9414 GN=argJ PE=3 SV=1
 2075 : A5ILL4_THEP1        0.45  0.65  193  405  180  395  218    3    7  397  A5ILL4     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga petrophila (strain RKU-1 / ATCC BAA-488 / DSM 13995) GN=argJ PE=3 SV=1
 2076 : A6TTJ2_ALKMQ        0.45  0.69   11  191    9  188  181    1    1  406  A6TTJ2     Arginine biosynthesis bifunctional protein ArgJ OS=Alkaliphilus metalliredigens (strain QYMF) GN=argJ PE=3 SV=1
 2077 : A7VYH1_9CLOT        0.45  0.65  193  405  189  404  217    2    5  406  A7VYH1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium leptum DSM 753 GN=argJ PE=3 SV=1
 2078 : A7VYH1_9CLOT        0.45  0.65   11  191    8  188  183    4    4  406  A7VYH1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium leptum DSM 753 GN=argJ PE=3 SV=1
 2079 : A9AWL2_HERA2        0.45  0.67  193  405  185  393  213    2    4  395  A9AWL2     Arginine biosynthesis bifunctional protein ArgJ OS=Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785) GN=argJ PE=3 SV=1
 2080 : ARGJ1_CLOAB         0.45  0.68  193  405  191  406  217    2    5  408  Q97GH6     Arginine biosynthesis bifunctional protein ArgJ 1 OS=Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / LMG 5710 / VKM B-1787) GN=argJ1 PE=3 SV=1
 2081 : ARGJ_GLOVI          0.45  0.62   12  191   10  190  185    3    9  406  Q7NE46     Arginine biosynthesis bifunctional protein ArgJ OS=Gloeobacter violaceus (strain PCC 7421) GN=argJ PE=3 SV=1
 2082 : ARGJ_ORYSJ          0.45  0.69  193  405  244  461  218    3    5  463  Q10N79     Arginine biosynthesis bifunctional protein ArgJ, chloroplastic OS=Oryza sativa subsp. japonica GN=Os03g0279400 PE=2 SV=1
 2083 : ARGJ_THEMA          0.45  0.66  193  405  180  395  218    3    7  397  Q9X2A3     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099) GN=argJ PE=3 SV=1
 2084 : B0MCF9_9FIRM        0.45  0.65  193  405  191  406  217    2    5  408  B0MCF9     Arginine biosynthesis bifunctional protein ArgJ OS=Anaerostipes caccae DSM 14662 GN=argJ PE=3 SV=1
 2085 : B0PD04_9FIRM        0.45  0.69  193  405  189  404  217    2    5  406  B0PD04     Arginine biosynthesis bifunctional protein ArgJ OS=Anaerotruncus colihominis DSM 17241 GN=argJ PE=3 SV=1
 2086 : B1LAP1_THESQ        0.45  0.65  193  405  180  395  218    3    7  397  B1LAP1     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga sp. (strain RQ2) GN=argJ PE=3 SV=1
 2087 : B3QWG9_CHLT3        0.45  0.62   17  191   25  200  176    1    1  414  B3QWG9     Arginine biosynthesis bifunctional protein ArgJ OS=Chloroherpeton thalassium (strain ATCC 35110 / GB-78) GN=argJ PE=3 SV=1
 2088 : C0GH78_9FIRM        0.45  0.67  193  405  188  399  213    1    1  401  C0GH78     Arginine biosynthesis bifunctional protein ArgJ OS=Dethiobacter alkaliphilus AHT 1 GN=argJ PE=3 SV=1
 2089 : C0QEH5_DESAH        0.45  0.63   17  191    2  176  176    2    2  389  C0QEH5     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfobacterium autotrophicum (strain ATCC 43914 / DSM 3382 / HRM2) GN=argJ PE=3 SV=1
 2090 : C2KLY0_LEUMC        0.45  0.68    2  191    5  190  190    2    4  307  C2KLY0     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc mesenteroides subsp. cremoris ATCC 19254 GN=argJ PE=3 SV=1
 2091 : C4G8S5_9FIRM        0.45  0.63  193  405  191  406  219    3    9  408  C4G8S5     Arginine biosynthesis bifunctional protein ArgJ OS=Shuttleworthia satelles DSM 14600 GN=argJ PE=3 SV=1
 2092 : C5UXM6_CLOBO        0.45  0.68  193  405  190  405  217    2    5  407  C5UXM6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium botulinum E1 str. 'BoNT E Beluga' GN=argJ PE=3 SV=1
 2093 : D1AJ74_SEBTE        0.45  0.65  193  405  188  404  218    3    6  406  D1AJ74     Arginine biosynthesis bifunctional protein ArgJ OS=Sebaldella termitidis (strain ATCC 33386 / NCTC 11300) GN=argJ PE=3 SV=1
 2094 : D4TL27_9NOST        0.45  0.64  193  405  191  411  221    1    8  413  D4TL27     Arginine biosynthesis bifunctional protein ArgJ OS=Cylindrospermopsis raciborskii CS-505 GN=argJ PE=3 SV=1
 2095 : D4TNI8_9NOST        0.45  0.63  193  405  220  440  223    3   12  442  D4TNI8     Arginine biosynthesis bifunctional protein ArgJ OS=Raphidiopsis brookii D9 GN=argJ PE=3 SV=1
 2096 : D9SLS1_CLOC7        0.45  0.67  193  405  188  403  217    2    5  405  D9SLS1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium cellulovorans (strain ATCC 35296 / DSM 3052 / OCM 3 / 743B) GN=argJ PE=3 SV=1
 2097 : D9TQ29_THETC        0.45  0.68  193  405  189  404  217    2    5  406  D9TQ29     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacterium thermosaccharolyticum (strain ATCC 7956 / DSM 571 / NCIB 9385 / NCA 3814) GN=argJ PE=3 SV=1
 2098 : E0UC35_CYAP2        0.45  0.65  193  405  191  411  221    1    8  413  E0UC35     Arginine biosynthesis bifunctional protein ArgJ OS=Cyanothece sp. (strain PCC 7822) GN=argJ PE=3 SV=1
 2099 : E3HC23_ILYPC        0.45  0.63    5  191    1  187  188    2    2  405  E3HC23     Arginine biosynthesis bifunctional protein ArgJ OS=Ilyobacter polytropus (strain DSM 2926 / CuHBu1) GN=argJ PE=3 SV=1
 2100 : E5VST9_9FIRM        0.45  0.65  193  405  191  406  217    2    5  408  E5VST9     Arginine biosynthesis bifunctional protein ArgJ OS=Anaerostipes sp. 3_2_56FAA GN=argJ PE=3 SV=1
 2101 : E8LCV0_9FIRM        0.45  0.62    7  191    2  186  186    2    2  401  E8LCV0     Arginine biosynthesis bifunctional protein ArgJ OS=Phascolarctobacterium succinatutens YIT 12067 GN=argJ PE=3 SV=1
 2102 : F0KBE5_CLOAE        0.45  0.68  193  405  191  406  217    2    5  408  F0KBE5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium acetobutylicum (strain EA 2018) GN=argJ PE=3 SV=1
 2103 : F2JI89_CELLD        0.45  0.64    7  191    2  188  187    1    2  406  F2JI89     Arginine biosynthesis bifunctional protein ArgJ OS=Cellulosilyticum lentocellum (strain ATCC 49066 / DSM 5427 / NCIMB 11756 / RHM5) GN=argJ PE=3 SV=1
 2104 : F2LXK2_HIPMA        0.45  0.64  193  405  187  398  213    1    1  400  F2LXK2     Arginine biosynthesis bifunctional protein ArgJ OS=Hippea maritima (strain ATCC 700847 / DSM 10411 / MH2) GN=argJ PE=3 SV=1
 2105 : F4GLD9_SPICD        0.45  0.65  193  405  212  426  217    3    6  428  F4GLD9     Arginine biosynthesis bifunctional protein ArgJ OS=Spirochaeta coccoides (strain ATCC BAA-1237 / DSM 17374 / SPN1) GN=argJ PE=3 SV=1
 2106 : F5UDN0_9CYAN        0.45  0.66  193  405  191  411  221    2    8  413  F5UDN0     Arginine biosynthesis bifunctional protein ArgJ OS=Microcoleus vaginatus FGP-2 GN=argJ PE=3 SV=1
 2107 : F6DPH2_DESRL        0.45  0.69   11  191   12  192  182    2    2  406  F6DPH2     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotomaculum ruminis (strain ATCC 23193 / DSM 2154 / NCIB 8452 / DL) GN=argJ PE=3 SV=1
 2108 : G7VIN7_LEUME        0.45  0.68    2  191    5  190  190    2    4  404  G7VIN7     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc mesenteroides subsp. mesenteroides J18 GN=argJ PE=3 SV=1
 2109 : G9YMG0_9FIRM        0.45  0.65  193  405  190  405  217    2    5  407  G9YMG0     Arginine biosynthesis bifunctional protein ArgJ OS=Flavonifractor plautii ATCC 29863 GN=argJ PE=3 SV=1
 2110 : I4D1C1_DESAJ        0.45  0.66  193  405  209  417  213    2    4  419  I4D1C1     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfosporosinus acidiphilus (strain DSM 22704 / JCM 16185 / SJ4) GN=argJ PE=3 SV=1
 2111 : I8TR98_9FIRM        0.45  0.65  193  405  188  399  213    1    1  401  I8TR98     Arginine biosynthesis bifunctional protein ArgJ OS=Pelosinus fermentans JBW45 GN=argJ PE=3 SV=1
 2112 : J1H8M0_9CLOT        0.45  0.66  193  405  189  404  217    2    5  406  J1H8M0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. MSTE9 GN=argJ PE=3 SV=1
 2113 : J9H2J2_9THEM        0.45  0.66  193  405  180  395  218    3    7  397  J9H2J2     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga sp. EMP GN=argJ PE=3 SV=1
 2114 : J9YI72_LEUGJ        0.45  0.68    2  191    5  190  190    2    4  404  J9YI72     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc gelidum (strain JB7) GN=argJ PE=3 SV=1
 2115 : K9V8P8_9CYAN        0.45  0.63  193  405  191  421  231    2   18  423  K9V8P8     Arginine biosynthesis bifunctional protein ArgJ OS=Calothrix sp. PCC 6303 GN=argJ PE=3 SV=1
 2116 : K9Z3Y5_CYAAP        0.45  0.65  193  405  191  411  221    1    8  413  K9Z3Y5     Arginine biosynthesis bifunctional protein ArgJ OS=Cyanobacterium aponinum (strain PCC 10605) GN=argJ PE=3 SV=1
 2117 : K9ZR92_ANACC        0.45  0.65  193  405  191  411  221    1    8  413  K9ZR92     Arginine biosynthesis bifunctional protein ArgJ OS=Anabaena cylindrica (strain ATCC 27899 / PCC 7122) GN=argJ PE=3 SV=1
 2118 : L0IIB0_THETR        0.45  0.68  193  405  189  404  217    2    5  406  L0IIB0     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacterium thermosaccharolyticum M0795 GN=argJ PE=3 SV=1
 2119 : L1QKG8_9CLOT        0.45  0.65   13  191   14  195  183    3    5  413  L1QKG8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium celatum DSM 1785 GN=argJ PE=3 SV=1
 2120 : M0RHY2_MUSAM        0.45  0.70  193  405  251  468  218    3    5  470  M0RHY2     Uncharacterized protein OS=Musa acuminata subsp. malaccensis PE=3 SV=1
 2121 : M1AHA1_SOLTU        0.45  0.67  193  405  251  468  220    5    9  470  M1AHA1     Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400008852 PE=3 SV=1
 2122 : M1LP05_9CLOT        0.45  0.69  193  405  190  405  217    2    5  407  M1LP05     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium saccharoperbutylacetonicum N1-4(HMT) GN=argJ PE=3 SV=1
 2123 : M1WYT1_9NOST        0.45  0.64  193  405  191  411  222    2   10  413  M1WYT1     Arginine biosynthesis bifunctional protein ArgJ OS=Richelia intracellularis HH01 GN=argJ PE=3 SV=1
 2124 : M7Z6Z1_TRIUA        0.45  0.69  193  405  244  461  218    3    5  463  M7Z6Z1     Arginine biosynthesis bifunctional protein ArgJ, chloroplastic OS=Triticum urartu GN=TRIUR3_35174 PE=3 SV=1
 2125 : R2SBP8_9ENTE        0.45  0.69    7  191    2  183  185    2    3  397  R2SBP8     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus pallens ATCC BAA-351 GN=argJ PE=3 SV=1
 2126 : R5A929_9FIRM        0.45  0.66  193  405  188  403  217    2    5  405  R5A929     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:102 GN=argJ PE=3 SV=1
 2127 : R5KWM8_9FIRM        0.45  0.65  193  405  193  408  218    4    7  410  R5KWM8     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:161 GN=argJ PE=3 SV=1
 2128 : R5R2H0_9FIRM        0.45  0.64  193  405  197  412  217    2    5  414  R5R2H0     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:194 GN=argJ PE=3 SV=1
 2129 : R5XTV8_9FIRM        0.45  0.67  193  405  192  407  217    2    5  409  R5XTV8     Arginine biosynthesis bifunctional protein ArgJ OS=Anaerotruncus sp. CAG:528 GN=argJ PE=3 SV=1
 2130 : R6ND23_9CLOT        0.45  0.65  193  405  189  404  217    2    5  406  R6ND23     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium leptum CAG:27 GN=argJ PE=3 SV=1
 2131 : R6ND23_9CLOT        0.45  0.65   11  191    8  188  183    4    4  406  R6ND23     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium leptum CAG:27 GN=argJ PE=3 SV=1
 2132 : R6RKZ6_9FIRM        0.45  0.65  193  405  191  406  217    2    5  408  R6RKZ6     Arginine biosynthesis bifunctional protein ArgJ OS=Anaerostipes sp. CAG:276 GN=argJ PE=3 SV=1
 2133 : R6XTE3_9FIRM        0.45  0.63   13  191    8  186  180    2    2  401  R6XTE3     Arginine biosynthesis bifunctional protein ArgJ OS=Phascolarctobacterium succinatutens CAG:287 GN=argJ PE=3 SV=1
 2134 : R6Z9N0_9CLOT        0.45  0.64  193  405  185  400  217    2    5  402  R6Z9N0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:299 GN=argJ PE=3 SV=1
 2135 : R7B7Y4_9CLOT        0.45  0.65  193  405  187  402  217    2    5  404  R7B7Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:505 GN=argJ PE=3 SV=1
 2136 : R7C612_9CLOT        0.45  0.66  193  405  191  405  218    4    8  407  R7C612     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:62 GN=argJ PE=3 SV=1
 2137 : R9CEU6_9CLOT        0.45  0.67  193  405  189  404  217    2    5  406  R9CEU6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sartagoforme AAU1 GN=argJ PE=3 SV=1
 2138 : R9J847_9FIRM        0.45  0.64    7  190    2  188  187    2    3  407  R9J847     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 28-4 GN=argJ PE=3 SV=1
 2139 : R9KEB6_9FIRM        0.45  0.69  193  405  190  405  217    2    5  407  R9KEB6     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium A2 GN=argJ PE=3 SV=1
 2140 : U2CQ15_9CLOT        0.45  0.65  193  405   55  270  217    2    5  272  U2CQ15     ArgJ family protein (Fragment) OS=Clostridium sp. ATCC BAA-442 GN=HMPREF0239_03485 PE=3 SV=1
 2141 : U2MAL4_9FIRM        0.45  0.69  193  405  201  416  217    2    5  418  U2MAL4     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus callidus ATCC 27760 GN=argJ PE=3 SV=1
 2142 : U2NL18_9CLOT        0.45  0.67    8  191    5  189  188    5    7  407  U2NL18     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium intestinale URNW GN=argJ PE=3 SV=1
 2143 : V8C3C7_9FIRM        0.45  0.65  193  405  190  405  217    2    5  407  V8C3C7     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus lactaris CC59_002D GN=argJ PE=3 SV=1
 2144 : W0F903_LEUME        0.45  0.67    2  191    5  190  190    2    4  404  W0F903     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc mesenteroides KFRI-MG GN=argJ PE=3 SV=1
 2145 : W0U7H4_9FIRM        0.45  0.65  193  405  201  416  217    2    5  418  W0U7H4     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. 80/3 GN=argJ PE=3 SV=1
 2146 : W4M2H7_9DELT        0.45  0.64  193  405  182  388  215    3   10  390  W4M2H7     Arginine biosynthesis bifunctional protein ArgJ OS=Candidatus Entotheonella sp. TSY2 GN=argJ PE=3 SV=1
 2147 : W5DXQ2_WHEAT        0.45  0.69  193  405  244  461  218    3    5  463  W5DXQ2     Uncharacterized protein OS=Triticum aestivum PE=3 SV=1
 2148 : W5E8A1_WHEAT        0.45  0.69  193  405  213  430  218    3    5  432  W5E8A1     Uncharacterized protein (Fragment) OS=Triticum aestivum PE=3 SV=1
 2149 : W7ZQY9_9BACI        0.45  0.65    5  191   11  194  187    1    3  409  W7ZQY9     Glutamate N-acetyltransferase OS=Bacillus sp. JCM 19047 GN=JCM19047_2168 PE=4 SV=1
 2150 : A1HQQ5_9FIRM        0.44  0.64  193  405  188  400  214    2    2  402  A1HQQ5     Arginine biosynthesis bifunctional protein ArgJ OS=Thermosinus carboxydivorans Nor1 GN=argJ PE=3 SV=1
 2151 : A3W450_9RHOB        0.44  0.64  193  405  199  407  218    7   14  409  A3W450     Arginine biosynthesis bifunctional protein ArgJ OS=Roseovarius sp. 217 GN=argJ PE=3 SV=1
 2152 : A4J168_DESRM        0.44  0.66    8  191    8  191  186    3    4  405  A4J168     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotomaculum reducens (strain MI-1) GN=argJ PE=3 SV=1
 2153 : A4SEI4_PROVI        0.44  0.64  193  405  191  400  214    3    5  402  A4SEI4     Arginine biosynthesis bifunctional protein ArgJ OS=Prosthecochloris vibrioformis (strain DSM 265) GN=argJ PE=3 SV=1
 2154 : A5ILL4_THEP1        0.44  0.63   15  191    3  179  181    4    8  397  A5ILL4     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga petrophila (strain RKU-1 / ATCC BAA-488 / DSM 13995) GN=argJ PE=3 SV=1
 2155 : A8TK72_9PROT        0.44  0.65  193  405  180  393  215    3    3  395  A8TK72     Arginine biosynthesis bifunctional protein ArgJ OS=alpha proteobacterium BAL199 GN=argJ PE=3 SV=1
 2156 : A8U6G3_9LACT        0.44  0.63    2  191    9  197  195    3   11  411  A8U6G3     Arginine biosynthesis bifunctional protein ArgJ OS=Carnobacterium sp. AT7 GN=argJ PE=3 SV=1
 2157 : A9KHN2_CLOPH        0.44  0.64    7  191    2  188  187    1    2  406  A9KHN2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg) GN=argJ PE=3 SV=1
 2158 : ARGJ_SORBI          0.44  0.68  193  405  245  462  220    5    9  464  C5WPC2     Arginine biosynthesis bifunctional protein ArgJ, chloroplastic OS=Sorghum bicolor GN=Sb01g039230 PE=3 SV=1
 2159 : ARGJ_THEMA          0.44  0.65   15  191    3  179  178    2    2  397  Q9X2A3     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099) GN=argJ PE=3 SV=1
 2160 : ARGJ_THENN          0.44  0.65  193  405  180  395  218    3    7  397  Q9Z4S1     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NS-E) GN=argJ PE=1 SV=2
 2161 : B0C1W7_ACAM1        0.44  0.66  193  405  192  403  213    1    1  405  B0C1W7     Arginine biosynthesis bifunctional protein ArgJ OS=Acaryochloris marina (strain MBIC 11017) GN=argJ PE=3 SV=1
 2162 : B0K4D3_THEPX        0.44  0.64  193  405  189  404  217    2    5  406  B0K4D3     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter sp. (strain X514) GN=argJ PE=3 SV=1
 2163 : B0K4D3_THEPX        0.44  0.62   10  191    8  188  183    2    3  406  B0K4D3     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter sp. (strain X514) GN=argJ PE=3 SV=1
 2164 : B1GYR1_UNCTG        0.44  0.67  193  405  189  398  213    2    3  400  B1GYR1     Arginine biosynthesis bifunctional protein ArgJ OS=Uncultured termite group 1 bacterium phylotype Rs-D17 GN=argJ PE=3 SV=1
 2165 : B1I1C6_DESAP        0.44  0.69   12  191   13  193  182    2    3  407  B1I1C6     Arginine biosynthesis bifunctional protein ArgJ OS=Desulforudis audaxviator (strain MP104C) GN=argJ PE=3 SV=1
 2166 : B1LAP1_THESQ        0.44  0.63   15  191    3  179  181    4    8  397  B1LAP1     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga sp. (strain RQ2) GN=argJ PE=3 SV=1
 2167 : B6R5B0_9RHOB        0.44  0.63  193  405  195  408  218    5    9  410  B6R5B0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudovibrio sp. JE062 GN=argJ PE=3 SV=1
 2168 : B8D1G7_HALOH        0.44  0.64    8  191    6  190  189    4    9  401  B8D1G7     Arginine biosynthesis bifunctional protein ArgJ OS=Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562) GN=argJ PE=3 SV=1
 2169 : C4ZHC6_EUBR3        0.44  0.68  193  405  191  406  217    2    5  408  C4ZHC6     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium rectale (strain ATCC 33656 / VPI 0990) GN=argJ PE=3 SV=1
 2170 : C5CHW8_KOSOT        0.44  0.63   13  191    1  179  182    3    6  397  C5CHW8     Arginine biosynthesis bifunctional protein ArgJ OS=Kosmotoga olearia (strain TBF 19.5.1) GN=argJ PE=3 SV=1
 2171 : C7DEC6_9RHOB        0.44  0.68  193  405  195  402  214    3    7  404  C7DEC6     Arginine biosynthesis bifunctional protein ArgJ OS=Thalassiobium sp. R2A62 GN=argJ PE=3 SV=1
 2172 : C7GEI1_9FIRM        0.44  0.63    7  190   20  206  187    2    3  425  C7GEI1     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia intestinalis L1-82 GN=argJ PE=3 SV=1
 2173 : C7N8R1_LEPBD        0.44  0.64  193  405  188  408  222    4   10  410  C7N8R1     Arginine biosynthesis bifunctional protein ArgJ OS=Leptotrichia buccalis (strain ATCC 14201 / DSM 1135 / JCM 12969 / NCTC 10249) GN=argJ PE=3 SV=1
 2174 : D1AJ74_SEBTE        0.44  0.64    5  191    1  187  188    2    2  406  D1AJ74     Arginine biosynthesis bifunctional protein ArgJ OS=Sebaldella termitidis (strain ATCC 33386 / NCTC 11300) GN=argJ PE=3 SV=1
 2175 : D3T5L3_THEIA        0.44  0.62   10  191    8  188  183    2    3  406  D3T5L3     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter italicus (strain DSM 9252 / Ab9) GN=argJ PE=3 SV=1
 2176 : D4KPT2_9FIRM        0.44  0.63    9  190   20  204  185    2    3  423  D4KPT2     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia intestinalis M50/1 GN=argJ PE=3 SV=1
 2177 : D4KVI5_9FIRM        0.44  0.63    9  190   20  204  185    2    3  423  D4KVI5     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia intestinalis XB6B4 GN=argJ PE=3 SV=1
 2178 : D7ASW7_THEM3        0.44  0.63   10  191    8  188  183    2    3  406  D7ASW7     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter mathranii (strain DSM 11426 / CIP 108742 / A3) GN=argJ PE=3 SV=1
 2179 : D7CJG4_SYNLT        0.44  0.66    7  191    2  186  188    3    6  401  D7CJG4     Arginine biosynthesis bifunctional protein ArgJ OS=Syntrophothermus lipocalidus (strain DSM 12680 / TGB-C1) GN=argJ PE=3 SV=1
 2180 : D8MI53_LEUGT        0.44  0.68    2  191    5  190  190    2    4  404  D8MI53     Arginine biosynthesis bifunctional protein ArgJ OS=Leuconostoc gasicomitatum (strain DSM 15947 / CECT 5767 / JCM 12535 / LMG 18811 / TB1-10) GN=argJ PE=3 SV=1
 2181 : E0XS86_9PROT        0.44  0.67  193  405  192  405  215    3    3  407  E0XS86     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured alpha proteobacterium HF0070_17D04 GN=argJ PE=3 SV=1
 2182 : E1FA79_9THEO        0.44  0.62   10  191    8  188  183    2    3  406  E1FA79     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter sp. X561 GN=argJ PE=3 SV=1
 2183 : E1R722_SPISS        0.44  0.63  193  405  193  412  221    5    9  414  E1R722     Arginine biosynthesis bifunctional protein ArgJ OS=Spirochaeta smaragdinae (strain DSM 11293 / JCM 15392 / SEBR 4228) GN=argJ PE=3 SV=1
 2184 : E1T0R1_THESX        0.44  0.62   10  191    8  188  183    2    3  406  E1T0R1     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter sp. (strain X513) GN=argJ PE=3 SV=1
 2185 : E6LKU6_9FIRM        0.44  0.64  193  405  190  406  218    3    6  408  E6LKU6     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnoanaerobaculum saburreum DSM 3986 GN=argJ PE=3 SV=1
 2186 : E6U655_ETHHY        0.44  0.69   11  191    8  188  183    4    4  406  E6U655     Arginine biosynthesis bifunctional protein ArgJ OS=Ethanoligenens harbinense (strain DSM 18485 / JCM 12961 / CGMCC 1.5033 / YUAN-3) GN=argJ PE=3 SV=1
 2187 : E7GBD0_9FIRM        0.44  0.63  193  405  187  402  218    4    7  404  E7GBD0     Arginine biosynthesis bifunctional protein ArgJ OS=Coprobacillus sp. 29_1 GN=argJ PE=3 SV=1
 2188 : E8T563_THEA1        0.44  0.64  193  405  180  388  214    4    6  390  E8T563     Arginine biosynthesis bifunctional protein ArgJ OS=Thermovibrio ammonificans (strain DSM 15698 / JCM 12110 / HB-1) GN=argJ PE=3 SV=1
 2189 : E8UU47_THEBF        0.44  0.64  193  405  189  404  217    2    5  406  E8UU47     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter brockii subsp. finnii (strain ATCC 43586 / DSM 3389 / AKO-1) GN=argJ PE=3 SV=1
 2190 : F6BFX2_THEXL        0.44  0.63   10  191    8  188  185    4    7  406  F6BFX2     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacterium xylanolyticum (strain ATCC 49914 / DSM 7097 / LX-11) GN=argJ PE=3 SV=1
 2191 : F7V5T9_CLOSS        0.44  0.63   11  190    6  188  187    4   11  407  F7V5T9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. (strain SY8519) GN=ArgJ (BS) PE=3 SV=1
 2192 : G1Y4L2_9PROT        0.44  0.63  193  405  195  408  218    5    9  410  G1Y4L2     Arginine biosynthesis bifunctional protein ArgJ OS=Azospirillum amazonense Y2 GN=argJ PE=3 SV=1
 2193 : G4FGH0_THEMA        0.44  0.65   15  191    3  179  178    2    2  397  G4FGH0     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099) GN=argJ PE=3 SV=1
 2194 : G4KXE9_OSCVS        0.44  0.64  193  405  190  405  217    2    5  407  G4KXE9     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillibacter valericigenes (strain DSM 18026 / NBRC 101213 / Sjm18-20) GN=argJ PE=3 SV=1
 2195 : H2JFH3_9CLOT        0.44  0.69  193  405  187  398  213    1    1  400  H2JFH3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. BNL1100 GN=argJ PE=3 SV=1
 2196 : I3ST60_LOTJA        0.44  0.68  193  405   14  231  218    2    5  233  I3ST60     Uncharacterized protein OS=Lotus japonicus PE=2 SV=1
 2197 : I5B8L6_9SPHN        0.44  0.61  193  405  193  406  218    5    9  408  I5B8L6     Arginine biosynthesis bifunctional protein ArgJ OS=Sphingobium indicum B90A GN=argJ PE=3 SV=1
 2198 : J2ZU25_9LACO        0.44  0.67   16  191   13  184  177    3    6  398  J2ZU25     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus coryniformis subsp. coryniformis CECT 5711 GN=argJ PE=3 SV=1
 2199 : J9H2J2_9THEM        0.44  0.65   15  191    3  179  178    2    2  397  J9H2J2     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga sp. EMP GN=argJ PE=3 SV=1
 2200 : K7SFK3_GLUOY        0.44  0.65  193  405  196  409  218    5    9  411  K7SFK3     Arginine biosynthesis bifunctional protein ArgJ OS=Gluconobacter oxydans H24 GN=argJ PE=3 SV=1
 2201 : K8DYJ1_9FIRM        0.44  0.64   11  191   12  192  184    3    6  406  K8DYJ1     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotomaculum hydrothermale Lam5 = DSM 18033 GN=argJ PE=3 SV=1
 2202 : K9PZJ7_9CYAN        0.44  0.64  193  405  191  412  222    3    9  414  K9PZJ7     Arginine biosynthesis bifunctional protein ArgJ OS=Leptolyngbya sp. PCC 7376 GN=argJ PE=3 SV=1
 2203 : K9SCV5_9CYAN        0.44  0.66  193  405  199  419  221    1    8  421  K9SCV5     Arginine biosynthesis bifunctional protein ArgJ OS=Geitlerinema sp. PCC 7407 GN=argJ PE=3 SV=1
 2204 : K9SJU4_9CYAN        0.44  0.67  193  405  190  402  214    2    2  404  K9SJU4     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudanabaena sp. PCC 7367 GN=argJ PE=3 SV=1
 2205 : L8K137_9BACT        0.44  0.65   23  191   15  184  172    4    5  403  L8K137     Arginine biosynthesis bifunctional protein ArgJ OS=Fulvivirga imtechensis AK7 GN=argJ PE=3 SV=1
 2206 : M1LP05_9CLOT        0.44  0.68    9  191    6  189  185    3    3  407  M1LP05     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium saccharoperbutylacetonicum N1-4(HMT) GN=argJ PE=3 SV=1
 2207 : M2W8E5_GALSU        0.44  0.64  193  405  261  481  223    3   12  483  M2W8E5     Bifunctional glutamate N-acetyltransferase / amino-acid N-acetyltransferase OS=Galdieria sulphuraria GN=Gasu_05650 PE=3 SV=1
 2208 : M4R887_PASTR        0.44  0.65  193  405  189  404  217    2    5  406  M4R887     Arginine biosynthesis bifunctional protein ArgJ OS=Bibersteinia trehalosi USDA-ARS-USMARC-192 GN=argJ PE=3 SV=1
 2209 : M8DTM7_THETY        0.44  0.64  193  405  189  404  217    2    5  406  M8DTM7     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter thermohydrosulfuricus WC1 GN=argJ PE=3 SV=1
 2210 : N9Y394_9CLOT        0.44  0.64  193  405  187  402  217    2    5  404  N9Y394     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium colicanis 209318 GN=argJ PE=3 SV=1
 2211 : Q1JZ39_DESAC        0.44  0.61   12  191    2  181  182    3    4  396  Q1JZ39     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfuromonas acetoxidans DSM 684 GN=argJ PE=3 SV=1
 2212 : Q28VQ4_JANSC        0.44  0.66  193  405  203  412  214    3    5  414  Q28VQ4     Arginine biosynthesis bifunctional protein ArgJ OS=Jannaschia sp. (strain CCS1) GN=argJ PE=3 SV=1
 2213 : R2S861_9ENTE        0.44  0.64   11  191    6  182  188    5   18  396  R2S861     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus asini ATCC 700915 GN=argJ PE=3 SV=1
 2214 : R5AXZ6_9FIRM        0.44  0.62    7  191    2  185  187    5    5  403  R5AXZ6     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:103 GN=argJ PE=3 SV=1
 2215 : R5HVV9_9FIRM        0.44  0.62    7  190    2  188  187    2    3  407  R5HVV9     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:60 GN=argJ PE=3 SV=1
 2216 : R5LLW1_9FIRM        0.44  0.68  193  405  194  409  217    2    5  411  R5LLW1     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:115 GN=argJ PE=3 SV=1
 2217 : R5V329_9FIRM        0.44  0.69  193  405  206  421  217    2    5  423  R5V329     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:254 GN=argJ PE=3 SV=1
 2218 : R6BGI1_9FIRM        0.44  0.65    7  190    2  188  187    2    3  407  R6BGI1     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:56 GN=argJ PE=3 SV=1
 2219 : R6BV33_9FIRM        0.44  0.61    7  190    2  188  191    4   11  407  R6BV33     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia intestinalis CAG:13 GN=argJ PE=3 SV=1
 2220 : R6HPM8_9FIRM        0.44  0.65    7  191    2  186  186    2    2  401  R6HPM8     Arginine biosynthesis bifunctional protein ArgJ OS=Phascolarctobacterium sp. CAG:266 GN=argJ PE=3 SV=1
 2221 : R6I9J1_9FIRM        0.44  0.66  193  405  187  399  219    4   12  401  R6I9J1     Arginine biosynthesis bifunctional protein ArgJ OS=Phascolarctobacterium sp. CAG:207 GN=argJ PE=3 SV=1
 2222 : R6LVD4_9CLOT        0.44  0.66  193  405  197  412  217    2    5  414  R6LVD4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:253 GN=argJ PE=3 SV=1
 2223 : R6QXH9_9CLOT        0.44  0.65    7  191    4  188  187    4    4  406  R6QXH9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:352 GN=argJ PE=3 SV=1
 2224 : R6QXW9_9FIRM        0.44  0.65  193  405  187  402  217    2    5  404  R6QXW9     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:466 GN=argJ PE=3 SV=1
 2225 : R6ZKJ4_9FIRM        0.44  0.62    7  190    2  188  188    4    5  407  R6ZKJ4     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:534 GN=argJ PE=3 SV=1
 2226 : R7HDN2_9FIRM        0.44  0.63    7  191    2  189  189    4    5  407  R7HDN2     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:38 GN=argJ PE=3 SV=1
 2227 : R7JWK5_9CLOT        0.44  0.69  193  405  197  413  218    3    6  415  R7JWK5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:277 GN=argJ PE=3 SV=1
 2228 : R7N4A3_9FIRM        0.44  0.67  193  405  190  405  217    2    5  407  R7N4A3     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:95 GN=argJ PE=3 SV=1
 2229 : R7QZ28_9FIRM        0.44  0.65    7  190    2  188  187    2    3  407  R7QZ28     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:182 GN=argJ PE=3 SV=1
 2230 : R9MWB7_9FIRM        0.44  0.63    7  190    2  188  187    2    3  407  R9MWB7     Arginine biosynthesis bifunctional protein ArgJ OS=Dorea sp. 5-2 GN=argJ PE=3 SV=1
 2231 : R9N1T4_9FIRM        0.44  0.63    7  190    2  188  187    2    3  407  R9N1T4     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 10-1 GN=argJ PE=3 SV=1
 2232 : S0FXB9_9DELT        0.44  0.62   17  191    2  180  180    3    6  393  S0FXB9     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotignum phosphitoxidans DSM 13687 GN=argJ PE=3 SV=1
 2233 : S0L2Q0_9ENTE        0.44  0.68   16  191   13  184  176    1    4  398  S0L2Q0     Arginine biosynthesis bifunctional protein ArgJ OS=Enterococcus sulfureus ATCC 49903 GN=argJ PE=3 SV=1
 2234 : S3HAH4_9RHIZ        0.44  0.64  193  405  195  411  221    6   12  413  S3HAH4     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium grahamii CCGE 502 GN=argJ PE=3 SV=1
 2235 : T0IQV0_9FIRM        0.44  0.68   11  191    7  187  182    2    2  403  T0IQV0     Arginine biosynthesis bifunctional protein ArgJ OS=Sporomusa ovata DSM 2662 GN=argJ PE=3 SV=1
 2236 : T1D7F2_GLUTH        0.44  0.65  193  405  196  409  218    5    9  411  T1D7F2     Arginine biosynthesis bifunctional protein ArgJ OS=Gluconobacter thailandicus NBRC 3257 GN=argJ PE=3 SV=1
 2237 : U1SUN7_9STAP        0.44  0.66  193  405  199  410  218    2   11  412  U1SUN7     Arginine biosynthesis bifunctional protein ArgJ OS=Staphylococcus equorum UMC-CNS-924 GN=argJ PE=3 SV=1
 2238 : U4R081_9CLOT        0.44  0.69  193  405  187  398  213    1    1  400  U4R081     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium papyrosolvens C7 GN=argJ PE=3 SV=1
 2239 : U5BS94_9BACT        0.44  0.64   13  191    5  184  184    5    9  403  U5BS94     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodonellum psychrophilum GCM71 = DSM 17998 GN=argJ PE=3 SV=1
 2240 : V8G2B3_CLOPA        0.44  0.67  193  405  190  405  217    2    5  407  V8G2B3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium pasteurianum NRRL B-598 GN=argJ PE=3 SV=1
 2241 : W0FMZ6_9BACT        0.44  0.65    7  191    4  188  188    5    6  395  W0FMZ6     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured bacterium Contig1777_n_1791_cl GN=argJ PE=3 SV=1
 2242 : W0QUY0_PASTR        0.44  0.65  193  405  189  404  217    2    5  406  W0QUY0     Arginine biosynthesis bifunctional protein ArgJ OS=Bibersteinia trehalosi USDA-ARS-USMARC-188 GN=argJ PE=3 SV=1
 2243 : W0R072_PASTR        0.44  0.65  193  405  189  404  217    2    5  406  W0R072     Arginine biosynthesis bifunctional protein ArgJ OS=Bibersteinia trehalosi USDA-ARS-USMARC-189 GN=argJ PE=3 SV=1
 2244 : W5EME1_WHEAT        0.44  0.66  193  405  243  451  218    4   14  453  W5EME1     Uncharacterized protein OS=Triticum aestivum PE=3 SV=1
 2245 : A0Q1E9_CLONN        0.43  0.61    5  191    1  187  188    2    2  405  A0Q1E9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium novyi (strain NT) GN=argJ PE=3 SV=1
 2246 : A3V2A6_9RHOB        0.43  0.67  193  405  195  402  214    3    7  404  A3V2A6     Arginine biosynthesis bifunctional protein ArgJ OS=Loktanella vestfoldensis SKA53 GN=argJ PE=3 SV=1
 2247 : A4WW82_RHOS5        0.43  0.61  193  405  231  443  219    6   12  445  A4WW82     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodobacter sphaeroides (strain ATCC 17025 / ATH 2.4.3) GN=argJ PE=3 SV=1
 2248 : A5VSR6_BRUO2        0.43  0.61  193  405  180  396  221    6   12  398  A5VSR6     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512) GN=argJ PE=3 SV=1
 2249 : A5ZVL6_9FIRM        0.43  0.64    7  190    2  188  187    2    3  407  A5ZVL6     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus obeum ATCC 29174 GN=argJ PE=3 SV=1
 2250 : A6M1Z7_CLOB8        0.43  0.66  193  405  204  419  219    4    9  421  A6M1Z7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052) GN=argJ PE=3 SV=1
 2251 : A8SYH5_9FIRM        0.43  0.65    7  191    2  190  189    3    4  408  A8SYH5     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus eutactus ATCC 27759 GN=argJ PE=3 SV=1
 2252 : ARGJ_BRUME          0.43  0.61  193  405  195  411  221    6   12  413  Q8YJF9     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis biotype 1 (strain 16M / ATCC 23456 / NCTC 10094) GN=argJ PE=3 SV=1
 2253 : ARGJ_THETN          0.43  0.62    7  191    2  185  185    1    1  403  Q8R7B9     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4) GN=argJ PE=3 SV=1
 2254 : B0CIU5_BRUSI        0.43  0.61  193  405  195  411  221    6   12  413  B0CIU5     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis (strain ATCC 23445 / NCTC 10510) GN=argJ PE=3 SV=1
 2255 : B0NZK3_9CLOT        0.43  0.66    7  191    2  190  189    3    4  408  B0NZK3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. SS2/1 GN=argJ PE=3 SV=1
 2256 : B1C854_9FIRM        0.43  0.59    7  191    2  188  191    3   10  406  B1C854     Arginine biosynthesis bifunctional protein ArgJ OS=Anaerofustis stercorihominis DSM 17244 GN=argJ PE=3 SV=1
 2257 : B3EJ66_CHLPB        0.43  0.61  193  405  214  424  213    2    2  426  B3EJ66     Arginine biosynthesis bifunctional protein ArgJ OS=Chlorobium phaeobacteroides (strain BS1) GN=argJ PE=3 SV=1
 2258 : B3QWG9_CHLT3        0.43  0.65  193  405  201  412  214    2    3  414  B3QWG9     Arginine biosynthesis bifunctional protein ArgJ OS=Chloroherpeton thalassium (strain ATCC 35110 / GB-78) GN=argJ PE=3 SV=1
 2259 : B5ZRS8_RHILW        0.43  0.61  193  405  195  411  221    6   12  413  B5ZRS8     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium leguminosarum bv. trifolii (strain WSM2304) GN=argJ PE=3 SV=1
 2260 : B8I410_CLOCE        0.43  0.69  193  405  187  398  213    1    1  400  B8I410     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10) GN=argJ PE=3 SV=1
 2261 : B9LD93_CHLSY        0.43  0.65  193  405  191  403  214    2    2  405  B9LD93     Arginine biosynthesis bifunctional protein ArgJ OS=Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl) GN=argJ PE=3 SV=1
 2262 : B9NU07_9RHOB        0.43  0.69  193  405  199  406  214    3    7  408  B9NU07     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodobacteraceae bacterium KLH11 GN=argJ PE=3 SV=1
 2263 : B9QSP2_9RHOB        0.43  0.61  193  405  217  433  221    6   12  435  B9QSP2     Arginine biosynthesis bifunctional protein ArgJ OS=Labrenzia alexandrii DFL-11 GN=argJ PE=3 SV=1
 2264 : C0EWN8_9FIRM        0.43  0.63    7  191    2  190  189    3    4  408  C0EWN8     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium hallii DSM 3353 GN=argJ PE=3 SV=1
 2265 : C1FGN4_MICSR        0.43  0.65  193  405  278  494  219    2    8  496  C1FGN4     Predicted protein OS=Micromonas sp. (strain RCC299 / NOUM17) GN=MICPUN_102026 PE=3 SV=1
 2266 : C3MHR8_RHISN        0.43  0.61  193  405  195  411  221    6   12  413  C3MHR8     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium sp. (strain NGR234) GN=argJ PE=3 SV=1
 2267 : C4ITD8_BRUAO        0.43  0.61  193  405  208  424  221    6   12  426  C4ITD8     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus str. 2308 A GN=argJ PE=3 SV=1
 2268 : C4WJ87_9RHIZ        0.43  0.62  193  405  195  411  221    6   12  413  C4WJ87     Arginine biosynthesis bifunctional protein ArgJ OS=Ochrobactrum intermedium LMG 3301 GN=argJ PE=3 SV=1
 2269 : C5ZXU5_9HELI        0.43  0.61  193  405  188  394  216    4   12  396  C5ZXU5     Arginine biosynthesis bifunctional protein ArgJ OS=Helicobacter canadensis MIT 98-5491 GN=argJ PE=3 SV=1
 2270 : C6LGL4_9FIRM        0.43  0.60    7  190    2  188  187    2    3  407  C6LGL4     Arginine biosynthesis bifunctional protein ArgJ OS=Marvinbryantia formatexigens DSM 14469 GN=argJ PE=3 SV=1
 2271 : C7ITI8_THEET        0.43  0.65  193  405   30  245  217    2    5  247  C7ITI8     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter ethanolicus CCSD1 GN=argJ PE=3 SV=1
 2272 : C7N0Y9_SLAHD        0.43  0.62  193  405  217  430  218    4    9  432  C7N0Y9     Arginine biosynthesis bifunctional protein ArgJ OS=Slackia heliotrinireducens (strain ATCC 29202 / DSM 20476 / NCTC 11029 / RHS 1) GN=argJ PE=3 SV=1
 2273 : C8S2A2_9RHOB        0.43  0.66  193  405  237  447  214    3    4  449  C8S2A2     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodobacter sp. SW2 GN=argJ PE=3 SV=1
 2274 : C9TVT1_BRUPB        0.43  0.61  193  405  195  411  221    6   12  413  C9TVT1     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella pinnipedialis (strain NCTC 12890 / BCCN 94-73 / B2/94) GN=argJ PE=3 SV=1
 2275 : C9U650_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  C9U650     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus bv. 6 str. 870 GN=argJ PE=3 SV=1
 2276 : C9UFC5_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  C9UFC5     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus bv. 4 str. 292 GN=argJ PE=3 SV=1
 2277 : C9UUK5_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  C9UUK5     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus bv. 2 str. 86/8/59 GN=argJ PE=3 SV=1
 2278 : C9VC53_BRUNE        0.43  0.61  193  405  195  411  221    6   12  413  C9VC53     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella neotomae 5K33 GN=argJ PE=3 SV=1
 2279 : C9VIH0_9RHIZ        0.43  0.61  193  405  195  411  221    6   12  413  C9VIH0     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ceti B1/94 GN=argJ PE=3 SV=1
 2280 : D0AY91_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  D0AY91     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus NCTC 8038 GN=argJ PE=3 SV=1
 2281 : D0B3I9_BRUME        0.43  0.61  193  405  195  411  221    6   12  413  D0B3I9     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis biotype 1 (strain 16M / ATCC 23456 / NCTC 10094) GN=argJ PE=3 SV=1
 2282 : D0BEJ8_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  D0BEJ8     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis bv. 4 str. 40 GN=argJ PE=3 SV=1
 2283 : D0RKB4_9RHIZ        0.43  0.61  193  405  195  411  221    6   12  413  D0RKB4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella sp. F5/99 GN=argJ PE=3 SV=1
 2284 : D1CU56_9RHIZ        0.43  0.61  193  405  195  411  221    6   12  413  D1CU56     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella sp. 83/13 GN=argJ PE=3 SV=1
 2285 : D1F091_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  D1F091     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis bv. 1 str. Rev.1 GN=argJ PE=3 SV=1
 2286 : D1F574_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  D1F574     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis bv. 3 str. Ether GN=argJ PE=3 SV=1
 2287 : D3T5L3_THEIA        0.43  0.65  193  405  189  404  217    2    5  406  D3T5L3     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter italicus (strain DSM 9252 / Ab9) GN=argJ PE=3 SV=1
 2288 : D4J9G8_9FIRM        0.43  0.60    9  190    4  188  185    2    3  407  D4J9G8     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus catus GD/7 GN=argJ PE=3 SV=1
 2289 : D4JUE7_9FIRM        0.43  0.66  193  405  193  408  217    2    5  410  D4JUE7     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium siraeum 70/3 GN=argJ PE=3 SV=1
 2290 : D4ML70_9FIRM        0.43  0.66  193  405  193  408  217    2    5  410  D4ML70     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium siraeum V10Sc8a GN=argJ PE=3 SV=1
 2291 : D4MXX6_9FIRM        0.43  0.66    7  191    2  190  189    3    4  408  D4MXX6     Arginine biosynthesis bifunctional protein ArgJ OS=butyrate-producing bacterium SSC/2 GN=argJ PE=3 SV=1
 2292 : D4Z1K6_SPHJU        0.43  0.61  193  405  193  406  218    5    9  408  D4Z1K6     Arginine biosynthesis bifunctional protein ArgJ OS=Sphingobium japonicum (strain NBRC 101211 / UT26S) GN=argJ PE=3 SV=1
 2293 : D5BW38_NITHN        0.43  0.66  193  405  190  403  216    5    5  405  D5BW38     Arginine biosynthesis bifunctional protein ArgJ OS=Nitrosococcus halophilus (strain Nc4) GN=argJ PE=3 SV=1
 2294 : D5E7K5_METMS        0.43  0.64  193  405  180  390  221    5   18  392  D5E7K5     Arginine biosynthesis bifunctional protein ArgJ OS=Methanohalophilus mahii (strain ATCC 35705 / DSM 5219 / SLP) GN=argJ PE=3 SV=1
 2295 : D6LQG2_9RHIZ        0.43  0.61  193  405  180  396  221    6   12  398  D6LQG2     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella sp. NVSL 07-0026 GN=argJ PE=3 SV=1
 2296 : D9TQ29_THETC        0.43  0.65   10  191    8  188  184    2    5  406  D9TQ29     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacterium thermosaccharolyticum (strain ATCC 7956 / DSM 571 / NCIB 9385 / NCA 3814) GN=argJ PE=3 SV=1
 2297 : E0DJ70_9RHIZ        0.43  0.61  193  405  195  411  221    6   12  413  E0DJ70     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella inopinata BO1 GN=argJ PE=3 SV=1
 2298 : E1IDP2_9CHLR        0.43  0.66  193  405  193  405  214    2    2  407  E1IDP2     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillochloris trichoides DG-6 GN=argJ PE=3 SV=1
 2299 : E1RFP8_METP4        0.43  0.58  193  405  174  388  222    5   16  390  E1RFP8     Arginine biosynthesis bifunctional protein ArgJ OS=Methanoplanus petrolearius (strain DSM 11571 / OCM 486 / SEBR 4847) GN=argJ PE=3 SV=1
 2300 : E2PRD2_9RHIZ        0.43  0.61  193  405  154  370  221    6   12  372  E2PRD2     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella sp. BO2 GN=argJ PE=3 SV=1
 2301 : E5VNX7_9FIRM        0.43  0.66    7  191    2  190  189    3    4  408  E5VNX7     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 5_1_63FAA GN=argJ PE=3 SV=1
 2302 : E6YIQ9_BARC7        0.43  0.62  193  405  200  415  218    5    7  417  E6YIQ9     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella clarridgeiae (strain CIP 104772 / 73) GN=argJ PE=3 SV=1
 2303 : E8LCV0_9FIRM        0.43  0.67  193  405  187  399  219    4   12  401  E8LCV0     Arginine biosynthesis bifunctional protein ArgJ OS=Phascolarctobacterium succinatutens YIT 12067 GN=argJ PE=3 SV=1
 2304 : E8PKJ6_THESS        0.43  0.61  193  405  176  379  213    3    9  381  E8PKJ6     Arginine biosynthesis bifunctional protein ArgJ OS=Thermus scotoductus (strain ATCC 700910 / SA-01) GN=argJ PE=3 SV=1
 2305 : E9RUZ0_9FIRM        0.43  0.58    7  190    2  188  187    2    3  407  E9RUZ0     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 6_1_37FAA GN=argJ PE=3 SV=1
 2306 : E9SFR4_RUMAL        0.43  0.65  193  405  215  430  219    4    9  432  E9SFR4     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus albus 8 GN=argJ PE=3 SV=1
 2307 : F1ZU56_THEET        0.43  0.63  193  405  189  404  217    2    5  406  F1ZU56     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter ethanolicus JW 200 GN=argJ PE=3 SV=1
 2308 : F1ZU56_THEET        0.43  0.62   10  191    8  188  183    2    3  406  F1ZU56     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter ethanolicus JW 200 GN=argJ PE=3 SV=1
 2309 : F3AL45_9FIRM        0.43  0.58    7  190    2  188  187    2    3  407  F3AL45     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 9_1_43BFAA GN=argJ PE=3 SV=1
 2310 : F5JI00_9RHIZ        0.43  0.65  193  405  195  411  221    6   12  413  F5JI00     Arginine biosynthesis bifunctional protein ArgJ OS=Agrobacterium sp. ATCC 31749 GN=argJ PE=3 SV=1
 2311 : F5Y8H2_TREAZ        0.43  0.62    7  191    2  189  189    4    5  407  F5Y8H2     Arginine biosynthesis bifunctional protein ArgJ OS=Treponema azotonutricium (strain ATCC BAA-888 / DSM 13862 / ZAS-9) GN=argJ PE=3 SV=1
 2312 : F6EZE3_SPHCR        0.43  0.61  193  405  193  406  218    5    9  408  F6EZE3     Arginine biosynthesis bifunctional protein ArgJ OS=Sphingobium chlorophenolicum L-1 GN=argJ PE=3 SV=1
 2313 : G0J6C8_CYCMS        0.43  0.66   13  191    5  184  184    5    9  403  G0J6C8     Arginine biosynthesis bifunctional protein ArgJ OS=Cyclobacterium marinum (strain ATCC 25205 / DSM 745) GN=argJ PE=3 SV=1
 2314 : G2MU12_9THEO        0.43  0.62   10  191    8  188  183    2    3  406  G2MU12     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter wiegelii Rt8.B1 GN=argJ PE=3 SV=1
 2315 : G4PHM4_BRUML        0.43  0.61  193  405  180  396  221    6   12  398  G4PHM4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis NI GN=argJ PE=3 SV=1
 2316 : G4REG1_PELHB        0.43  0.67  193  405  195  408  218    5    9  410  G4REG1     Arginine biosynthesis bifunctional protein ArgJ OS=Pelagibacterium halotolerans (strain JCM 15775 / CGMCC 1.7692 / B2) GN=argJ PE=3 SV=1
 2317 : G7Z856_AZOL4        0.43  0.65  193  405  197  410  218    5    9  412  G7Z856     Arginine biosynthesis bifunctional protein ArgJ OS=Azospirillum lipoferum (strain 4B) GN=argJ PE=3 SV=1
 2318 : G8NC96_9DEIN        0.43  0.66  193  405  176  379  213    3    9  381  G8NC96     Arginine biosynthesis bifunctional protein ArgJ OS=Thermus sp. CCB_US3_UF1 GN=argJ PE=3 SV=1
 2319 : G8PFJ6_PSEUV        0.43  0.63  193  405  172  385  218    5    9  387  G8PFJ6     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudovibrio sp. (strain FO-BEG1) GN=argJ PE=3 SV=1
 2320 : G8SQC4_BRUCA        0.43  0.61  193  405  180  396  221    6   12  398  G8SQC4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella canis HSK A52141 GN=argJ PE=3 SV=1
 2321 : G9WJD6_9LACT        0.43  0.65  193  405  180  391  219    2   13  393  G9WJD6     Arginine biosynthesis bifunctional protein ArgJ OS=Oenococcus kitaharae DSM 17330 GN=argJ PE=3 SV=1
 2322 : H0H3Y4_RHIRD        0.43  0.64  193  405  195  411  221    6   12  413  H0H3Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Agrobacterium tumefaciens 5A GN=argJ PE=3 SV=1
 2323 : H3PBN4_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  H3PBN4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus bv. 1 str. NI435a GN=argJ PE=3 SV=1
 2324 : H3PFR0_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  H3PFR0     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus bv. 1 str. NI474 GN=argJ PE=3 SV=1
 2325 : H3QGC6_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  H3QGC6     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus bv. 1 str. NI016 GN=argJ PE=3 SV=1
 2326 : H3R6E8_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  H3R6E8     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus bv. 1 str. NI259 GN=argJ PE=3 SV=1
 2327 : H3RQ44_9LACO        0.43  0.64    2  191    7  192  190    1    4  408  H3RQ44     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus mucosae LM1 GN=argJ PE=3 SV=1
 2328 : I1L8L5_SOYBN        0.43  0.66  193  405  241  458  220    4    9  460  I1L8L5     Uncharacterized protein OS=Glycine max PE=3 SV=2
 2329 : I3VTI0_THESW        0.43  0.63   10  191    8  188  185    4    7  406  I3VTI0     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacterium saccharolyticum (strain DSM 8691 / JW/SL-YS485) GN=argJ PE=3 SV=1
 2330 : I3Z426_BELBD        0.43  0.66   13  191    5  184  186    6   13  403  I3Z426     Arginine biosynthesis bifunctional protein ArgJ OS=Belliella baltica (strain DSM 15883 / CIP 108006 / LMG 21964 / BA134) GN=argJ PE=3 SV=1
 2331 : I7KX84_METBM        0.43  0.64  193  405  174  377  214    4   11  379  I7KX84     Arginine biosynthesis bifunctional protein ArgJ OS=Methanoculleus bourgensis (strain ATCC 43281 / DSM 3045 / OCM 15 / MS2) GN=argJ PE=3 SV=1
 2332 : I9ADD0_9THEO        0.43  0.63  193  405  189  404  217    2    5  406  I9ADD0     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter siderophilus SR4 GN=argJ PE=3 SV=1
 2333 : I9ADD0_9THEO        0.43  0.62   11  191    9  188  182    2    3  406  I9ADD0     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter siderophilus SR4 GN=argJ PE=3 SV=1
 2334 : I9NBR0_RHILT        0.43  0.61  193  405  195  411  221    6   12  413  I9NBR0     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium leguminosarum bv. trifolii WSM597 GN=argJ PE=3 SV=1
 2335 : J3BSR2_9RHIZ        0.43  0.64  193  405  195  411  221    6   12  413  J3BSR2     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Rhizobium sp. CF122 GN=argJ PE=3 SV=1
 2336 : J8VQU1_9SPHN        0.43  0.63  193  405  193  406  218    5    9  408  J8VQU1     Arginine biosynthesis bifunctional protein ArgJ OS=Sphingomonas sp. LH128 GN=argJ PE=3 SV=1
 2337 : K0Q0K0_9RHIZ        0.43  0.64  193  405  172  388  221    6   12  390  K0Q0K0     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium mesoamericanum STM3625 GN=argJ PE=3 SV=1
 2338 : K1JW90_9BURK        0.43  0.62    4  191    7  194  194    5   12  412  K1JW90     Arginine biosynthesis bifunctional protein ArgJ OS=Sutterella wadsworthensis 2_1_59BFAA GN=argJ PE=3 SV=1
 2339 : K2MYV7_9RHIZ        0.43  0.62  193  405  195  411  221    6   12  413  K2MYV7     Arginine biosynthesis bifunctional protein ArgJ OS=Nitratireductor indicus C115 GN=argJ PE=3 SV=1
 2340 : K4A8D1_SETIT        0.43  0.66  193  405  309  526  224    6   17  528  K4A8D1     Uncharacterized protein OS=Setaria italica GN=Si035137m.g PE=3 SV=1
 2341 : K6U5Y6_9CLOT        0.43  0.67    7  191    4  189  187    3    3  407  K6U5Y6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. Maddingley MBC34-26 GN=argJ PE=3 SV=1
 2342 : K7WM21_LACLC        0.43  0.63    7  191    2  182  187    3    8  395  K7WM21     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris UC509.9 GN=argJ PE=3 SV=1
 2343 : L0IIB0_THETR        0.43  0.64   10  191    8  188  185    4    7  406  L0IIB0     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacterium thermosaccharolyticum M0795 GN=argJ PE=3 SV=1
 2344 : L1Q721_9FIRM        0.43  0.66    7  191    2  190  189    3    4  408  L1Q721     Arginine biosynthesis bifunctional protein ArgJ OS=Anaerostipes hadrus DSM 3319 GN=argJ PE=3 SV=1
 2345 : M4HX61_9PROT        0.43  0.61  193  405  195  408  218    5    9  410  M4HX61     Arginine biosynthesis bifunctional protein ArgJ OS=alpha proteobacterium D323 GN=argJ PE=3 SV=1
 2346 : M8A795_RHIRD        0.43  0.64  193  405  217  433  221    6   12  435  M8A795     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein (Fragment) OS=Agrobacterium tumefaciens str. Cherry 2E-2-2 GN=argJ PE=3 SV=1
 2347 : M8DTM7_THETY        0.43  0.62   10  191    8  188  183    2    3  406  M8DTM7     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter thermohydrosulfuricus WC1 GN=argJ PE=3 SV=1
 2348 : N1MKD1_9SPHN        0.43  0.62  193  405  193  406  218    5    9  408  N1MKD1     Arginine biosynthesis bifunctional protein ArgJ OS=Sphingobium japonicum BiD32 GN=argJ PE=3 SV=1
 2349 : N1ZDI0_9CLOT        0.43  0.60  193  405  189  404  220    4   11  408  N1ZDI0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. ASF356 GN=argJ PE=3 SV=1
 2350 : N6ZJL9_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N6ZJL9     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 65/110 GN=argJ PE=3 SV=1
 2351 : N7AYR4_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7AYR4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 67/781 GN=argJ PE=3 SV=1
 2352 : N7B4Z0_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7B4Z0     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 78/36 GN=argJ PE=3 SV=1
 2353 : N7BCB3_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7BCB3     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 80/102 GN=argJ PE=3 SV=1
 2354 : N7BKH0_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7BKH0     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 88/19 GN=argJ PE=3 SV=1
 2355 : N7CX93_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7CX93     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 90/50 GN=argJ PE=3 SV=1
 2356 : N7CXI4_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7CXI4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 88/226 GN=argJ PE=3 SV=1
 2357 : N7D1R0_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7D1R0     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus CNGB 308 GN=argJ PE=3 SV=1
 2358 : N7DFC7_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7DFC7     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus CNGB 1011 GN=argJ PE=3 SV=1
 2359 : N7EZB7_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7EZB7     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus CNGB 759 GN=argJ PE=3 SV=1
 2360 : N7F423_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7F423     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus F3/07-1 GN=argJ PE=3 SV=1
 2361 : N7FUY1_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7FUY1     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus LEVI237 GN=argJ PE=3 SV=1
 2362 : N7G6T4_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7G6T4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus F6/05-2 GN=argJ PE=3 SV=1
 2363 : N7GPP1_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7GPP1     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus levi gila GN=argJ PE=3 SV=1
 2364 : N7GSW3_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7GSW3     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus NI388 GN=argJ PE=3 SV=1
 2365 : N7GYA3_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7GYA3     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus NI240 GN=argJ PE=3 SV=1
 2366 : N7H325_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7H325     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus NI492 GN=argJ PE=3 SV=1
 2367 : N7H5K6_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7H5K6     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus NI518 GN=argJ PE=3 SV=1
 2368 : N7HFV5_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7HFV5     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus NI274 GN=argJ PE=3 SV=1
 2369 : N7I2Q9_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7I2Q9     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus NI622 GN=argJ PE=3 SV=1
 2370 : N7IQP1_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7IQP1     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus NI633 GN=argJ PE=3 SV=1
 2371 : N7IU64_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7IU64     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus NI593 GN=argJ PE=3 SV=1
 2372 : N7IUA1_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7IUA1     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus NI639 GN=argJ PE=3 SV=1
 2373 : N7J7S6_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7J7S6     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus NI649 GN=argJ PE=3 SV=1
 2374 : N7KPC3_BRUCA        0.43  0.61  193  405  195  411  221    6   12  413  N7KPC3     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella canis CNGB 1172 GN=argJ PE=3 SV=1
 2375 : N7KX72_BRUCA        0.43  0.61  193  405  195  411  221    6   12  413  N7KX72     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella canis UK10/02 GN=argJ PE=3 SV=1
 2376 : N7KXT8_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N7KXT8     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis CNGB 1120 GN=argJ PE=3 SV=1
 2377 : N7L876_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N7L876     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis 64/150 GN=argJ PE=3 SV=1
 2378 : N7LEB7_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N7LEB7     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis 66/59 GN=argJ PE=3 SV=1
 2379 : N7N6U1_BRUOV        0.43  0.61  193  405  195  411  221    6   12  413  N7N6U1     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ovis 80/125 GN=argJ PE=3 SV=1
 2380 : N7NHH4_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N7NHH4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis F5/07-239A GN=argJ PE=3 SV=1
 2381 : N7P314_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N7P314     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis UK19/04 GN=argJ PE=3 SV=1
 2382 : N7P780_9RHIZ        0.43  0.61  193  405  195  411  221    6   12  413  N7P780     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella sp. UK5/01 GN=argJ PE=3 SV=1
 2383 : N7PPX2_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  N7PPX2     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis 92/29 GN=argJ PE=3 SV=1
 2384 : N7Q231_9RHIZ        0.43  0.61  193  405  195  411  221    6   12  413  N7Q231     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella sp. UK38/05 GN=argJ PE=3 SV=1
 2385 : N7QWC4_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  N7QWC4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis F4/06-146 GN=argJ PE=3 SV=1
 2386 : N7R5L8_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  N7R5L8     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis 94/11 GN=argJ PE=3 SV=1
 2387 : N7S3R4_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7S3R4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 544 GN=argJ PE=3 SV=1
 2388 : N7SLS7_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  N7SLS7     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis F8/06-2 GN=argJ PE=3 SV=1
 2389 : N7SMR3_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7SMR3     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 225/65 GN=argJ PE=3 SV=1
 2390 : N7TEJ7_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7TEJ7     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 63/294 GN=argJ PE=3 SV=1
 2391 : N7U6P6_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7U6P6     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 63/144 GN=argJ PE=3 SV=1
 2392 : N7VJ35_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7VJ35     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 80/101 GN=argJ PE=3 SV=1
 2393 : N7VRA9_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7VRA9     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 65/63 GN=argJ PE=3 SV=1
 2394 : N7W069_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7W069     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 78/14 GN=argJ PE=3 SV=1
 2395 : N7WCF1_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7WCF1     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 78/32 GN=argJ PE=3 SV=1
 2396 : N7YC73_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7YC73     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus F1/06-B21 GN=argJ PE=3 SV=1
 2397 : N7YF96_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7YF96     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 88/217 GN=argJ PE=3 SV=1
 2398 : N7YRG9_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7YRG9     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus F6/05-9 GN=argJ PE=3 SV=1
 2399 : N7YSP7_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7YSP7     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus F10/05-11 GN=argJ PE=3 SV=1
 2400 : N7Z3Z3_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7Z3Z3     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus F5/04-7 GN=argJ PE=3 SV=1
 2401 : N7ZQP9_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  N7ZQP9     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus F6/05-4 GN=argJ PE=3 SV=1
 2402 : N8AY11_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N8AY11     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis F1/06 B10 GN=argJ PE=3 SV=1
 2403 : N8BSZ1_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N8BSZ1     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis UK14/06 GN=argJ PE=3 SV=1
 2404 : N8C6M6_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N8C6M6     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis UK23/06 GN=argJ PE=3 SV=1
 2405 : N8DQP5_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N8DQP5     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis Uk24/06 GN=argJ PE=3 SV=1
 2406 : N8DVL0_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N8DVL0     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis UK22/04 GN=argJ PE=3 SV=1
 2407 : N8E1J4_BRUOV        0.43  0.61  193  405  195  411  221    6   12  413  N8E1J4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ovis 63/96 GN=argJ PE=3 SV=1
 2408 : N8E484_BRUOV        0.43  0.61  193  405  195  411  221    6   12  413  N8E484     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ovis 81/8 GN=argJ PE=3 SV=1
 2409 : N8EKB6_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N8EKB6     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis UK31/99 GN=argJ PE=3 SV=1
 2410 : N8ELV7_9RHIZ        0.43  0.61  193  405  195  411  221    6   12  413  N8ELV7     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella sp. 56/94 GN=argJ PE=3 SV=1
 2411 : N8F5K2_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N8F5K2     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis UK37/05 GN=argJ PE=3 SV=1
 2412 : N8GKG5_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  N8GKG5     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis 63/198 GN=argJ PE=3 SV=1
 2413 : N8GRM9_9RHIZ        0.43  0.61  193  405  195  411  221    6   12  413  N8GRM9     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella sp. F8/99 GN=argJ PE=3 SV=1
 2414 : N8H690_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  N8H690     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis CNGB 247 GN=argJ PE=3 SV=1
 2415 : N8HI24_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  N8HI24     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis F12/02 GN=argJ PE=3 SV=1
 2416 : N8JF96_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  N8JF96     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis F9/06-1 GN=argJ PE=3 SV=1
 2417 : N8JG79_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  N8JG79     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis F5/05-4 GN=argJ PE=3 SV=1
 2418 : N8K1W5_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N8K1W5     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis F15/06-7 GN=argJ PE=3 SV=1
 2419 : N8K980_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  N8K980     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis F8/06-1 GN=argJ PE=3 SV=1
 2420 : N8KH04_BRUOV        0.43  0.61  193  405  195  411  221    6   12  413  N8KH04     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ovis IntaBari-2009-88-4 GN=argJ PE=3 SV=1
 2421 : N8L828_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  N8L828     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis B115 GN=argJ PE=3 SV=1
 2422 : N8MSB3_BRUOV        0.43  0.61  193  405  195  411  221    6   12  413  N8MSB3     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ovis IntaBari-2006-46-332 GN=argJ PE=3 SV=1
 2423 : N8MTY6_BRUOV        0.43  0.61  193  405  195  411  221    6   12  413  N8MTY6     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ovis IntaBari-1993-758 GN=argJ PE=3 SV=1
 2424 : N8N568_BRUOV        0.43  0.61  193  405  195  411  221    6   12  413  N8N568     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ovis IntaBari-2002-82-58 GN=argJ PE=3 SV=1
 2425 : N8NDM4_BRUOV        0.43  0.61  193  405  195  411  221    6   12  413  N8NDM4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ovis IntaBari-2001-319-5096 GN=argJ PE=3 SV=1
 2426 : N8P0P0_BRUOV        0.43  0.61  193  405  195  411  221    6   12  413  N8P0P0     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ovis IntaBari-2008-114-542 GN=argJ PE=3 SV=1
 2427 : N9TXW2_BRUCA        0.43  0.61  193  405  195  411  221    6   12  413  N9TXW2     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella canis CNGB 1324 GN=argJ PE=3 SV=1
 2428 : Q12WB8_METBU        0.43  0.62  193  405  180  392  223    4   20  394  Q12WB8     Arginine biosynthesis bifunctional protein ArgJ OS=Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M) GN=argJ PE=3 SV=1
 2429 : Q1MB99_RHIL3        0.43  0.62  193  405  195  411  221    6   12  413  Q1MB99     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium leguminosarum bv. viciae (strain 3841) GN=argJ PE=3 SV=1
 2430 : Q2YLU4_BRUA2        0.43  0.61  193  405  195  411  221    6   12  413  Q2YLU4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus (strain 2308) GN=argJ PE=3 SV=1
 2431 : Q3AGR1_SYNSC        0.43  0.63  193  405  207  412  213    2    7  414  Q3AGR1     Arginine biosynthesis bifunctional protein ArgJ OS=Synechococcus sp. (strain CC9605) GN=argJ PE=3 SV=1
 2432 : R4KEF4_9FIRM        0.43  0.66   13  191   13  190  181    2    5  404  R4KEF4     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotomaculum gibsoniae DSM 7213 GN=argJ PE=3 SV=1
 2433 : R5BMD4_9FIRM        0.43  0.64  193  405  193  404  213    1    1  406  R5BMD4     Arginine biosynthesis bifunctional protein ArgJ OS=Veillonella sp. CAG:933 GN=argJ PE=3 SV=1
 2434 : R5DBK2_9FIRM        0.43  0.62    7  190    2  188  187    2    3  407  R5DBK2     Arginine biosynthesis bifunctional protein ArgJ OS=Dorea sp. CAG:105 GN=argJ PE=3 SV=1
 2435 : R5JIF7_9FIRM        0.43  0.66  193  405  191  407  219    4    8  409  R5JIF7     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus sp. CAG:782 GN=argJ PE=3 SV=1
 2436 : R5RJG7_9FIRM        0.43  0.62   10  190    5  188  184    2    3  407  R5RJG7     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:646 GN=argJ PE=3 SV=1
 2437 : R5TY13_9FIRM        0.43  0.60    7  190    2  188  187    2    3  407  R5TY13     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:50 GN=argJ PE=3 SV=1
 2438 : R5VPR4_9FIRM        0.43  0.64    7  191    2  190  189    3    4  408  R5VPR4     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus eutactus CAG:665 GN=argJ PE=3 SV=1
 2439 : R5VR36_9FIRM        0.43  0.65  193  405  197  412  217    2    5  414  R5VR36     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus eutactus CAG:665 GN=argJ PE=3 SV=1
 2440 : R5WEB8_9CLOT        0.43  0.65  193  405  190  404  217    3    6  406  R5WEB8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:167 GN=argJ PE=3 SV=1
 2441 : R5WRT5_9FIRM        0.43  0.64    7  190    2  188  187    2    3  407  R5WRT5     Arginine biosynthesis bifunctional protein ArgJ OS=Blautia sp. CAG:257 GN=argJ PE=3 SV=1
 2442 : R5Z7G0_9FIRM        0.43  0.63    7  190    2  187  187    3    4  406  R5Z7G0     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:156 GN=argJ PE=3 SV=1
 2443 : R5ZRD1_9FIRM        0.43  0.66    7  191    2  190  189    3    4  408  R5ZRD1     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium CAG:25 GN=argJ PE=3 SV=1
 2444 : R6G4P3_9FIRM        0.43  0.63    7  191    2  190  189    3    4  408  R6G4P3     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium hallii CAG:12 GN=argJ PE=3 SV=1
 2445 : R6HPM8_9FIRM        0.43  0.66  193  405  187  399  219    4   12  401  R6HPM8     Arginine biosynthesis bifunctional protein ArgJ OS=Phascolarctobacterium sp. CAG:266 GN=argJ PE=3 SV=1
 2446 : R6I9J1_9FIRM        0.43  0.63    7  191    2  186  187    3    4  401  R6I9J1     Arginine biosynthesis bifunctional protein ArgJ OS=Phascolarctobacterium sp. CAG:207 GN=argJ PE=3 SV=1
 2447 : R6L8V5_9FIRM        0.43  0.66  193  405  191  406  218    4    7  408  R6L8V5     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus sp. CAG:131 GN=argJ PE=3 SV=1
 2448 : R6L8V5_9FIRM        0.43  0.64    7  191    2  190  189    3    4  408  R6L8V5     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus sp. CAG:131 GN=argJ PE=3 SV=1
 2449 : R6LB01_9FIRM        0.43  0.59    7  190    2  188  187    2    3  407  R6LB01     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus comes CAG:19 GN=argJ PE=3 SV=1
 2450 : R6QXW9_9FIRM        0.43  0.62    7  191    2  186  188    5    6  404  R6QXW9     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:466 GN=argJ PE=3 SV=1
 2451 : R6RFM0_9FIRM        0.43  0.65    9  190    4  188  185    2    3  407  R6RFM0     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:424 GN=argJ PE=3 SV=1
 2452 : R6VZ56_9CLOT        0.43  0.65    7  190    2  188  188    4    5  407  R6VZ56     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:91 GN=argJ PE=3 SV=1
 2453 : R6WFH2_9FIRM        0.43  0.67  193  405  195  411  220    5   10  413  R6WFH2     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:380 GN=argJ PE=3 SV=1
 2454 : R6YHI4_9FIRM        0.43  0.63    7  191    2  186  190    5   10  404  R6YHI4     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:94 GN=argJ PE=3 SV=1
 2455 : R7B7Y4_9CLOT        0.43  0.62    7  191    2  186  188    5    6  404  R7B7Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:505 GN=argJ PE=3 SV=1
 2456 : R7BAZ6_9FIRM        0.43  0.65  193  405  198  413  217    2    5  415  R7BAZ6     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:341 GN=argJ PE=3 SV=1
 2457 : R7BYD1_9FIRM        0.43  0.66    7  191    2  190  189    3    4  408  R7BYD1     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:270 GN=argJ PE=3 SV=1
 2458 : R7D799_9FIRM        0.43  0.64    7  190    2  188  187    2    3  407  R7D799     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus obeum CAG:39 GN=argJ PE=3 SV=1
 2459 : R7G210_9FIRM        0.43  0.61    7  190    2  188  187    2    3  407  R7G210     Arginine biosynthesis bifunctional protein ArgJ OS=Dorea longicatena CAG:42 GN=argJ PE=3 SV=1
 2460 : R7IUW5_9FIRM        0.43  0.64    7  190    2  190  189    3    5  409  R7IUW5     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:303 GN=argJ PE=3 SV=1
 2461 : R7JQA9_9FIRM        0.43  0.64    7  190    2  188  187    2    3  407  R7JQA9     Arginine biosynthesis bifunctional protein ArgJ OS=Blautia sp. CAG:37 GN=argJ PE=3 SV=1
 2462 : R7N4A3_9FIRM        0.43  0.62    7  190    2  188  187    2    3  407  R7N4A3     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:95 GN=argJ PE=3 SV=1
 2463 : R7R7I1_9FIRM        0.43  0.64    7  190    2  188  187    2    3  407  R7R7I1     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:100 GN=argJ PE=3 SV=1
 2464 : R8WAM3_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  R8WAM3     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus I103_(UK3/01) GN=argJ PE=3 SV=1
 2465 : R8WH54_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  R8WH54     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 93/2 GN=argJ PE=3 SV=1
 2466 : R9IR27_9FIRM        0.43  0.61    7  190    2  188  190    4    9  407  R9IR27     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 3-1 GN=argJ PE=3 SV=1
 2467 : R9ISQ7_9FIRM        0.43  0.63    7  190    2  188  187    2    3  407  R9ISQ7     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium A4 GN=argJ PE=3 SV=1
 2468 : R9K130_9FIRM        0.43  0.61    7  190    2  188  187    2    3  407  R9K130     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium M18-1 GN=argJ PE=3 SV=1
 2469 : R9KEB6_9FIRM        0.43  0.62    7  190    2  188  191    4   11  407  R9KEB6     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium A2 GN=argJ PE=3 SV=1
 2470 : R9KZG8_9FIRM        0.43  0.63   11  190    6  188  183    2    3  407  R9KZG8     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium COE1 GN=argJ PE=3 SV=1
 2471 : R9MA83_9FIRM        0.43  0.59    7  190    2  188  191    4   11  407  R9MA83     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 3-2 GN=argJ PE=3 SV=1
 2472 : S2YK50_9FIRM        0.43  0.58    7  190    2  188  187    2    3  407  S2YK50     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus sp. HPP0048 GN=argJ PE=3 SV=1
 2473 : S2Z492_9FIRM        0.43  0.58    7  190    2  188  187    2    3  407  S2Z492     Arginine biosynthesis bifunctional protein ArgJ OS=Coprococcus sp. HPP0074 GN=argJ PE=3 SV=1
 2474 : S3PGG0_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  S3PGG0     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus B10-0091 GN=argJ PE=3 SV=1
 2475 : S3PYC7_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  S3PYC7     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 90-1280 GN=argJ PE=3 SV=1
 2476 : S3QYI4_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  S3QYI4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 94-1313 GN=argJ PE=3 SV=1
 2477 : S3R172_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  S3R172     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 90-0962 GN=argJ PE=3 SV=1
 2478 : S3RAN4_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  S3RAN4     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 90-0742 GN=argJ PE=3 SV=1
 2479 : S3RUV2_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  S3RUV2     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 82-3893 GN=argJ PE=3 SV=1
 2480 : S3S7V6_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  S3S7V6     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 80-1399 GN=argJ PE=3 SV=1
 2481 : S3TC87_BRUOV        0.43  0.61  193  405  195  411  221    6   12  413  S3TC87     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ovis IntaBari-2009-88-3 GN=argJ PE=3 SV=1
 2482 : S3TWA2_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  S3TWA2     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 68-3396P GN=argJ PE=3 SV=1
 2483 : S3VS52_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  S3VS52     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 01-0585 GN=argJ PE=3 SV=1
 2484 : S3VTK5_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  S3VTK5     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 01-0065 GN=argJ PE=3 SV=1
 2485 : S3WMS2_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  S3WMS2     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 87-2211 GN=argJ PE=3 SV=1
 2486 : S4NL43_9LACO        0.43  0.62    8  191    9  188  184    1    4  402  S4NL43     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus otakiensis JCM 15040 GN=argJ PE=3 SV=1
 2487 : S9S7Y4_9RHOB        0.43  0.67  193  405  199  407  215    5    8  409  S9S7Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Salipiger mucosus DSM 16094 GN=argJ PE=3 SV=1
 2488 : T0EAL3_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  T0EAL3     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis ADMAS-G1 GN=argJ PE=3 SV=1
 2489 : T0GWA4_9SPHN        0.43  0.61  193  405  193  406  218    5    9  408  T0GWA4     Arginine biosynthesis bifunctional protein ArgJ OS=Sphingobium sp. HDIP04 GN=argJ PE=3 SV=1
 2490 : T0IQV0_9FIRM        0.43  0.66  193  405  188  401  217    5    7  403  T0IQV0     Arginine biosynthesis bifunctional protein ArgJ OS=Sporomusa ovata DSM 2662 GN=argJ PE=3 SV=1
 2491 : T0W3M7_LACLL        0.43  0.63   11  191   19  196  183    3    7  409  T0W3M7     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis bv. diacetylactis str. TIFN4 GN=argJ PE=3 SV=1
 2492 : T0WF65_LACLL        0.43  0.63   11  191   19  196  183    3    7  409  T0WF65     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis bv. diacetylactis str. TIFN2 GN=argJ PE=3 SV=1
 2493 : T2F473_LACLC        0.43  0.64   11  191    6  182  183    3    8  395  T2F473     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris KW2 GN=argJ PE=3 SV=1
 2494 : U2RI95_9FIRM        0.43  0.60    7  190    2  188  187    2    3  407  U2RI95     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium ramulus ATCC 29099 GN=argJ PE=3 SV=1
 2495 : U4PZA9_9RHIZ        0.43  0.63  193  405  195  411  221    6   12  413  U4PZA9     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium sp. IRBG74 GN=argJ PE=3 SV=1
 2496 : U5CDF5_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  U5CDF5     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 82 GN=argJ PE=3 SV=1
 2497 : U5CUC4_THEYO        0.43  0.62    8  191    6  188  184    1    1  406  U5CUC4     Arginine biosynthesis bifunctional protein ArgJ OS=Caldanaerobacter subterraneus subsp. yonseiensis KB-1 GN=argJ PE=3 SV=1
 2498 : U7VIC8_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  U7VIC8     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 03-2770-11 GN=argJ PE=3 SV=1
 2499 : U7VQ00_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  U7VQ00     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis 02-7258 GN=argJ PE=3 SV=1
 2500 : U7WLD8_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  U7WLD8     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis 06-791-1309 GN=argJ PE=3 SV=1
 2501 : U7X7C1_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  U7X7C1     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis 11-1823-3434 GN=argJ PE=3 SV=1
 2502 : U7XBN9_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  U7XBN9     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 99-9971-159 GN=argJ PE=3 SV=1
 2503 : U7Y9T2_BRUCA        0.43  0.61  193  405  195  411  221    6   12  413  U7Y9T2     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella canis 96-7258 GN=argJ PE=3 SV=1
 2504 : U7YR03_BRUCA        0.43  0.61  193  405  195  411  221    6   12  413  U7YR03     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella canis 04-2330-1 GN=argJ PE=3 SV=1
 2505 : U7YRT5_BRUAO        0.43  0.61  193  405  195  411  221    6   12  413  U7YRT5     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella abortus 99-9971-135 GN=argJ PE=3 SV=1
 2506 : U7Z2X2_BRUSS        0.43  0.61  193  405  195  411  221    6   12  413  U7Z2X2     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella suis 06-988-1656 GN=argJ PE=3 SV=1
 2507 : U7ZZF2_BRUML        0.43  0.61  193  405  195  411  221    6   12  413  U7ZZF2     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella melitensis 02-5863-1 GN=argJ PE=3 SV=1
 2508 : V4M7U7_THESL        0.43  0.66  193  405  231  448  220    5    9  450  V4M7U7     Uncharacterized protein OS=Thellungiella salsuginea GN=EUTSA_v10016608mg PE=3 SV=1
 2509 : V4N5K7_9CAUL        0.43  0.66  193  405  246  459  215    3    3  461  V4N5K7     Arginine biosynthesis bifunctional protein ArgJ OS=Asticcacaulis sp. AC402 GN=argJ PE=3 SV=1
 2510 : V5EQJ3_9RHIZ        0.43  0.64  193  405  195  408  218    5    9  410  V5EQJ3     Arginine biosynthesis bifunctional protein ArgJ OS=Shinella zoogloeoides DD12 GN=argJ PE=3 SV=1
 2511 : V5P6X8_9RHIZ        0.43  0.61  193  405  195  411  221    6   12  413  V5P6X8     Arginine biosynthesis bifunctional protein ArgJ OS=Brucella ceti TE10759-12 GN=argJ PE=3 SV=1
 2512 : V7EK11_9RHOB        0.43  0.63  193  405  240  450  218    5   12  452  V7EK11     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodobacter sp. CACIA14H1 GN=argJ PE=3 SV=1
 2513 : W0IM53_RHILT        0.43  0.62  193  405  195  411  221    6   12  413  W0IM53     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium leguminosarum bv. trifolii WSM1689 GN=argJ PE=3 SV=1
 2514 : W1L9W2_RHIRD        0.43  0.64  193  405  216  432  221    6   12  434  W1L9W2     Arginine biosynthesis bifunctional protein ArgJ OS=Agrobacterium radiobacter DSM 30147 GN=argJ PE=3 SV=1
 2515 : W1LCL6_RHIRD        0.43  0.64  193  405  195  411  221    6   12  413  W1LCL6     Arginine biosynthesis bifunctional protein ArgJ OS=Agrobacterium radiobacter DSM 30147 GN=argJ PE=3 SV=1
 2516 : W6JTK8_9MICO        0.43  0.64   12  191    2  178  182    4    7  383  W6JTK8     Glutamate N-acetyltransferase OS=Tetrasphaera australiensis Ben110 GN=argJ PE=4 SV=1
 2517 : W6N758_CLOTY        0.43  0.68  193  405  189  404  217    2    5  406  W6N758     Glutamate N-acetyltransferase / N-acetylglutamate synthase OS=Clostridium tyrobutyricum DIVETGP GN=CTDIVETGP_1224 PE=4 SV=1
 2518 : W6W2X1_9RHIZ        0.43  0.62  193  405  195  411  221    6   12  413  W6W2X1     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium sp. CF080 GN=PMI07_000163 PE=4 SV=1
 2519 : A2RM02_LACLM        0.42  0.63    7  191    2  183  187    3    7  396  A2RM02     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris (strain MG1363) GN=argJ PE=3 SV=1
 2520 : A3HVZ2_9BACT        0.42  0.62   13  191    5  184  184    5    9  403  A3HVZ2     Arginine biosynthesis bifunctional protein ArgJ OS=Algoriphagus machipongonensis GN=argJ PE=3 SV=1
 2521 : A3TWL1_9RHOB        0.42  0.63  193  405  199  407  218    7   14  409  A3TWL1     Arginine biosynthesis bifunctional protein ArgJ OS=Oceanicola batsensis HTCC2597 GN=argJ PE=3 SV=1
 2522 : A5KJM4_9FIRM        0.42  0.59    7  190    2  188  187    2    3  407  A5KJM4     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus torques ATCC 27756 GN=argJ PE=3 SV=1
 2523 : A5N8G5_CLOK5        0.42  0.63    8  191    5  188  185    2    2  406  A5N8G5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680) GN=argJ PE=3 SV=1
 2524 : A7VCH6_9CLOT        0.42  0.66  193  405  191  406  217    2    5  408  A7VCH6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. L2-50 GN=argJ PE=3 SV=1
 2525 : A8SEP6_9FIRM        0.42  0.66  193  405  200  415  217    2    5  417  A8SEP6     Arginine biosynthesis bifunctional protein ArgJ OS=Faecalibacterium prausnitzii M21/2 GN=argJ PE=3 SV=1
 2526 : A9D7T0_9RHIZ        0.42  0.61  193  405  195  411  221    6   12  413  A9D7T0     Arginine biosynthesis bifunctional protein ArgJ OS=Hoeflea phototrophica DFL-43 GN=argJ PE=3 SV=1
 2527 : A9VZI2_METEP        0.42  0.64  193  405  199  412  220    7   13  414  A9VZI2     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Methylobacterium extorquens (strain PA1) GN=argJ PE=3 SV=1
 2528 : ARGJ_CHLTE          0.42  0.59  193  405  193  402  213    2    3  404  P59611     Arginine biosynthesis bifunctional protein ArgJ OS=Chlorobium tepidum (strain ATCC 49652 / DSM 12025 / TLS) GN=argJ PE=3 SV=1
 2529 : ARGJ_DESPS          0.42  0.64  193  405  179  391  219    3   12  393  Q6AJL0     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotalea psychrophila (strain LSv54 / DSM 12343) GN=argJ PE=3 SV=1
 2530 : ARGJ_GLOVI          0.42  0.68  193  405  191  404  214    1    1  406  Q7NE46     Arginine biosynthesis bifunctional protein ArgJ OS=Gloeobacter violaceus (strain PCC 7421) GN=argJ PE=3 SV=1
 2531 : ARGJ_LACLA          0.42  0.63    7  191    2  183  187    3    7  396  Q9CHD4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis (strain IL1403) GN=argJ PE=3 SV=1
 2532 : ARGJ_METM5          0.42  0.57  193  405  189  406  224    5   17  408  A4FXT1     Arginine biosynthesis bifunctional protein ArgJ OS=Methanococcus maripaludis (strain C5 / ATCC BAA-1333) GN=argJ PE=3 SV=1
 2533 : ARGJ_METM6          0.42  0.57  193  405  189  406  224    5   17  408  A9AB46     Arginine biosynthesis bifunctional protein ArgJ OS=Methanococcus maripaludis (strain C6 / ATCC BAA-1332) GN=argJ PE=3 SV=1
 2534 : ARGJ_PSYA2          0.42  0.68  193  405  191  405  216    4    4  407  Q4FSF9     Arginine biosynthesis bifunctional protein ArgJ OS=Psychrobacter arcticus (strain DSM 17307 / 273-4) GN=argJ PE=3 SV=1
 2535 : ARGJ_RHILO          0.42  0.62  193  405  195  411  221    6   12  413  Q98G72     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium loti (strain MAFF303099) GN=argJ PE=3 SV=1
 2536 : ARGJ_RHIME          0.42  0.61  193  405  195  411  221    6   12  413  Q92MJ1     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium meliloti (strain 1021) GN=argJ PE=3 SV=2
 2537 : ARGJ_SYMTH          0.42  0.64   12  191    7  188  183    3    4  402  Q67KC5     Arginine biosynthesis bifunctional protein ArgJ OS=Symbiobacterium thermophilum (strain T / IAM 14863) GN=argJ PE=3 SV=1
 2538 : ARGJ_THENN          0.42  0.64   16  191    4  179  184    5   16  397  Q9Z4S1     Arginine biosynthesis bifunctional protein ArgJ OS=Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NS-E) GN=argJ PE=1 SV=2
 2539 : B0G880_9FIRM        0.42  0.64    7  190    2  188  187    2    3  407  B0G880     Arginine biosynthesis bifunctional protein ArgJ OS=Dorea formicigenerans ATCC 27755 GN=argJ PE=3 SV=1
 2540 : B0KBW0_THEP3        0.42  0.63   10  191    8  188  183    2    3  406  B0KBW0     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E) GN=argJ PE=3 SV=1
 2541 : B0NE91_CLOSV        0.42  0.60    1  190    9  201  197    4   11  420  B0NE91     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium scindens ATCC 35704 GN=argJ PE=3 SV=1
 2542 : B0UCQ2_METS4        0.42  0.63  193  405  197  410  218    5    9  412  B0UCQ2     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Methylobacterium sp. (strain 4-46) GN=argJ PE=3 SV=1
 2543 : B3PP93_RHIE6        0.42  0.62  193  405  195  411  221    6   12  413  B3PP93     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium etli (strain CIAT 652) GN=argJ PE=3 SV=1
 2544 : B4S9U9_PELPB        0.42  0.62  193  405  216  425  213    2    3  427  B4S9U9     Arginine biosynthesis bifunctional protein ArgJ OS=Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1) GN=argJ PE=3 SV=1
 2545 : B7GFS0_ANOFW        0.42  0.62  193  405  191  397  218    5   16  399  B7GFS0     Arginine biosynthesis bifunctional protein ArgJ OS=Anoxybacillus flavithermus (strain DSM 21510 / WK1) GN=argJ PE=3 SV=1
 2546 : B8IR02_METNO        0.42  0.63  193  405  201  414  218    5    9  416  B8IR02     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Methylobacterium nodulans (strain ORS2060 / LMG 21967) GN=argJ PE=3 SV=1
 2547 : B9E1X1_CLOK1        0.42  0.63    8  191    5  188  185    2    2  406  B9E1X1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium kluyveri (strain NBRC 12016) GN=argJ PE=3 SV=1
 2548 : B9KPN8_RHOSK        0.42  0.64  193  405  231  443  216    4    6  445  B9KPN8     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodobacter sphaeroides (strain KD131 / KCTC 12085) GN=argJ PE=3 SV=1
 2549 : C4IM52_CLOBU        0.42  0.67  193  405  190  405  219    4    9  407  C4IM52     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium butyricum E4 str. BoNT E BL5262 GN=argJ PE=3 SV=1
 2550 : C5AP61_METEA        0.42  0.63  193  405  199  412  220    7   13  414  C5AP61     Arginine biosynthesis bifunctional protein ArgJ OS=Methylobacterium extorquens (strain ATCC 14718 / DSM 1338 / AM1) GN=argJ PE=3 SV=1
 2551 : C5CHW8_KOSOT        0.42  0.60  193  405  180  395  219    3    9  397  C5CHW8     Arginine biosynthesis bifunctional protein ArgJ OS=Kosmotoga olearia (strain TBF 19.5.1) GN=argJ PE=3 SV=1
 2552 : C5F212_9HELI        0.42  0.60  193  405  188  394  216    4   12  396  C5F212     Arginine biosynthesis bifunctional protein ArgJ OS=Helicobacter pullorum MIT 98-5489 GN=argJ PE=3 SV=1
 2553 : C7H1M8_9FIRM        0.42  0.66  193  405  192  407  217    2    5  409  C7H1M8     Arginine biosynthesis bifunctional protein ArgJ OS=Faecalibacterium prausnitzii A2-165 GN=argJ PE=3 SV=1
 2554 : C7ITI7_THEET        0.42  0.62    6  158    4  155  153    1    1  156  C7ITI7     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter ethanolicus CCSD1 GN=argJ PE=3 SV=1
 2555 : C7JGZ3_ACEP3        0.42  0.64  193  405  196  413  222    7   13  415  C7JGZ3     Arginine biosynthesis bifunctional protein ArgJ OS=Acetobacter pasteurianus (strain NBRC 3283 / LMG 1513 / CCTM 1153) GN=argJ PE=3 SV=1
 2556 : C7JRQ0_ACEPA        0.42  0.64  193  405  196  413  222    7   13  415  C7JRQ0     Arginine biosynthesis bifunctional protein ArgJ OS=Acetobacter pasteurianus IFO 3283-03 GN=argJ PE=3 SV=1
 2557 : C7KWI3_ACEPA        0.42  0.64  193  405  196  413  222    7   13  415  C7KWI3     Arginine biosynthesis bifunctional protein ArgJ OS=Acetobacter pasteurianus IFO 3283-01-42C GN=argJ PE=3 SV=1
 2558 : C7P6L5_METFA        0.42  0.62  193  405  185  400  223    5   17  402  C7P6L5     Arginine biosynthesis bifunctional protein ArgJ OS=Methanocaldococcus fervens (strain DSM 4213 / JCM 157852 / AG86) GN=argJ PE=3 SV=1
 2559 : D2BPS8_LACLK        0.42  0.63    7  191    2  183  187    3    7  396  D2BPS8     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis (strain KF147) GN=argJ PE=3 SV=1
 2560 : D3S6Y1_METSF        0.42  0.61  193  405  185  400  223    5   17  402  D3S6Y1     Arginine biosynthesis bifunctional protein ArgJ OS=Methanocaldococcus sp. (strain FS406-22) GN=argJ PE=3 SV=1
 2561 : D4L5Y9_9FIRM        0.42  0.65    4  191    2  190  191    4    5  408  D4L5Y9     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus bromii L2-63 GN=argJ PE=3 SV=1
 2562 : D4LUR5_9FIRM        0.42  0.64    7  190    2  188  187    2    3  407  D4LUR5     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus obeum A2-162 GN=argJ PE=3 SV=1
 2563 : D4S0J2_9FIRM        0.42  0.63    5  191    6  195  190    2    3  413  D4S0J2     Arginine biosynthesis bifunctional protein ArgJ OS=Butyrivibrio crossotus DSM 2876 GN=argJ PE=3 SV=1
 2564 : D7A5W1_STAND        0.42  0.64  193  405  197  410  218    5    9  412  D7A5W1     Arginine biosynthesis bifunctional protein ArgJ OS=Starkeya novella (strain ATCC 8093 / DSM 506 / CCM 1077 / IAM 12100 / NBRC 12443 / NCIB 9113) GN=argJ PE=3 SV=1
 2565 : D8IAX9_BRAP9        0.42  0.60   10  191    8  191  186    5    6  409  D8IAX9     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira pilosicoli (strain ATCC BAA-1826 / 95/1000) GN=argJ PE=3 SV=1
 2566 : D8KCT5_LACLN        0.42  0.63    7  191    2  183  187    3    7  396  D8KCT5     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris (strain NZ9000) GN=argJ PE=3 SV=1
 2567 : E0MS40_9RHOB        0.42  0.65  193  405  197  405  218    7   14  407  E0MS40     Arginine biosynthesis bifunctional protein ArgJ OS=Ahrensia sp. R2A130 GN=argJ PE=3 SV=1
 2568 : E0XZG4_9PROT        0.42  0.61  193  405  196  410  221    8   14  412  E0XZG4     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured alpha proteobacterium EB000_37G09 GN=argJ PE=3 SV=1
 2569 : E3PU07_CLOSD        0.42  0.63  193  404  199  414  223    5   18  417  E3PU07     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sticklandii (strain ATCC 12662 / DSM 519 / JCM 1433 / NCIB 10654) GN=argJ PE=3 SV=1
 2570 : E5X7A0_9ACTN        0.42  0.61  193  405   44  258  216    2    4  260  E5X7A0     Arginine biosynthesis bifunctional protein ArgJ OS=Eggerthella sp. 1_3_56FAA GN=argJ PE=3 SV=1
 2571 : E5XDH9_9FIRM        0.42  0.59    7  190    2  188  187    2    3  407  E5XDH9     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 8_1_57FAA GN=argJ PE=3 SV=1
 2572 : E6PHP6_9ZZZZ        0.42  0.58   11  191   18  200  187    4   10  406  E6PHP6     Ornithine acetyltransferase amino-acid acetyltransferase OS=mine drainage metagenome GN=argJ PE=3 SV=1
 2573 : E6YY18_BARSR        0.42  0.62  193  405  195  410  219    6    9  412  E6YY18     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella schoenbuchensis (strain DSM 13525 / NCTC 13165 / R1) GN=argJ PE=3 SV=1
 2574 : E8UU47_THEBF        0.42  0.63   10  191    8  188  183    2    3  406  E8UU47     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoanaerobacter brockii subsp. finnii (strain ATCC 43586 / DSM 3389 / AKO-1) GN=argJ PE=3 SV=1
 2575 : F2HJ93_LACLV        0.42  0.63    7  191    2  183  187    3    7  396  F2HJ93     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis (strain CV56) GN=argJ PE=3 SV=1
 2576 : F2J326_POLGS        0.42  0.61  193  405  195  411  221    6   12  413  F2J326     Arginine biosynthesis bifunctional protein ArgJ OS=Polymorphum gilvum (strain LMG 25793 / CGMCC 1.9160 / SL003B-26A1) GN=argJ PE=3 SV=1
 2577 : F3AR41_9FIRM        0.42  0.59    7  190    2  188  187    2    3  407  F3AR41     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 3_1_46FAA GN=argJ PE=3 SV=1
 2578 : F6E0F0_SINMK        0.42  0.61  193  405  195  411  221    6   12  413  F6E0F0     Arginine biosynthesis bifunctional protein ArgJ OS=Sinorhizobium meliloti (strain AK83) GN=argJ PE=3 SV=1
 2579 : F7JAV6_9FIRM        0.42  0.59    7  190    2  188  187    2    3  407  F7JAV6     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 1_1_57FAA GN=argJ PE=3 SV=1
 2580 : F7KNA7_9FIRM        0.42  0.61    7  190    2  188  191    4   11  407  F7KNA7     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 5_1_57FAA GN=argJ PE=3 SV=1
 2581 : G2T2L4_ROSHA        0.42  0.63    5  190    1  189  189    2    3  408  G2T2L4     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia hominis (strain DSM 16839 / NCIMB 14029 / A2-183) GN=argJ PE=3 SV=1
 2582 : G2T883_RHORU        0.42  0.63  193  405  197  410  218    5    9  412  G2T883     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodospirillum rubrum F11 GN=argJ PE=3 SV=1
 2583 : G4KXE9_OSCVS        0.42  0.63    7  191    2  189  190    5    7  407  G4KXE9     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillibacter valericigenes (strain DSM 18026 / NBRC 101213 / Sjm18-20) GN=argJ PE=3 SV=1
 2584 : G6FFQ4_LACLL        0.42  0.63    7  191    2  183  187    3    7  396  G6FFQ4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis CNCM I-1631 GN=argJ PE=3 SV=1
 2585 : G8P622_LACLC        0.42  0.62    7  191    2  182  187    3    8  395  G8P622     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris A76 GN=argJ PE=3 SV=1
 2586 : H0G6E1_RHIML        0.42  0.61  193  405  195  411  221    6   12  413  H0G6E1     Arginine biosynthesis bifunctional protein ArgJ OS=Sinorhizobium meliloti CCNWSX0020 GN=argJ PE=3 SV=1
 2587 : H1URZ5_ACEPA        0.42  0.64  193  405  196  413  222    7   13  415  H1URZ5     Arginine biosynthesis bifunctional protein ArgJ OS=Acetobacter pasteurianus subsp. pasteurianus LMG 1262 = NBRC 106471 GN=argJ PE=3 SV=1
 2588 : H3K8G7_9FIRM        0.42  0.67  193  405  188  399  215    3    5  401  H3K8G7     Arginine biosynthesis bifunctional protein ArgJ OS=Megamonas funiformis YIT 11815 GN=argJ PE=3 SV=1
 2589 : H5SY24_LACLL        0.42  0.63    7  191    2  183  187    3    7  396  H5SY24     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis IO-1 GN=argJ PE=3 SV=1
 2590 : H8GI74_METAL        0.42  0.67  193  405  189  402  217    4    7  404  H8GI74     Arginine biosynthesis bifunctional protein ArgJ OS=Methylomicrobium album BG8 GN=argJ PE=3 SV=1
 2591 : H9ZR01_THETH        0.42  0.62  193  405  176  379  213    3    9  381  H9ZR01     Arginine biosynthesis bifunctional protein ArgJ OS=Thermus thermophilus JL-18 GN=argJ PE=3 SV=1
 2592 : I1YGI4_METFJ        0.42  0.64  193  405  192  406  218    6    8  408  I1YGI4     Arginine biosynthesis bifunctional protein ArgJ OS=Methylophaga frappieri (strain ATCC BAA-2434 / DSM 25690 / JAM7) GN=argJ PE=3 SV=1
 2593 : J0BPN6_RHILV        0.42  0.62  193  405  195  411  221    6   12  413  J0BPN6     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium leguminosarum bv. viciae WSM1455 GN=argJ PE=3 SV=1
 2594 : J0CPB1_RHILT        0.42  0.61  193  405  195  411  221    6   12  413  J0CPB1     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium leguminosarum bv. trifolii WSM2297 GN=argJ PE=3 SV=1
 2595 : J1A959_BARVI        0.42  0.64  193  405  212  427  217    4    5  429  J1A959     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella vinsonii subsp. arupensis Pm136co GN=argJ PE=3 SV=1
 2596 : J1JA80_9RHIZ        0.42  0.63  193  405  195  408  215    3    3  410  J1JA80     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella sp. DB5-6 GN=argJ PE=3 SV=1
 2597 : J6DL52_9RHIZ        0.42  0.61  193  405  195  411  221    6   12  413  J6DL52     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium sp. CCGE 510 GN=argJ PE=3 SV=1
 2598 : J9ZF23_LEPFM        0.42  0.64  193  405  188  400  216    3    6  404  J9ZF23     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospirillum ferriphilum (strain ML-04) GN=argJ PE=3 SV=1
 2599 : K0JJT1_BRAPL        0.42  0.60   10  191    8  191  186    5    6  409  K0JJT1     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira pilosicoli WesB GN=argJ PE=3 SV=1
 2600 : K1L910_9BACT        0.42  0.65   13  191    5  185  184    4    8  404  K1L910     Arginine biosynthesis bifunctional protein ArgJ OS=Cecembia lonarensis LW9 GN=argJ PE=3 SV=1
 2601 : K1YDK8_9BACT        0.42  0.63  193  405  179  392  218    5    9  394  K1YDK8     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured bacterium GN=argJ PE=3 SV=1
 2602 : K2QEI4_METFO        0.42  0.60  193  405  184  395  223    4   21  397  K2QEI4     Arginine biosynthesis bifunctional protein ArgJ OS=Methanobacterium formicicum DSM 3637 GN=argJ PE=3 SV=1
 2603 : K7QX53_THEOS        0.42  0.61  193  405  176  379  213    3    9  381  K7QX53     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Thermus oshimai JL-2 GN=argJ PE=3 SV=1
 2604 : K8EPW0_9CHLO        0.42  0.66  193  405  284  503  222    4   11  505  K8EPW0     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Bathycoccus prasinos GN=Bathy01g07200 PE=3 SV=1
 2605 : K9D1H1_SPHYA        0.42  0.62  193  405  197  410  218    5    9  412  K9D1H1     Arginine biosynthesis bifunctional protein ArgJ OS=Sphingobium yanoikuyae ATCC 51230 GN=argJ PE=3 SV=1
 2606 : L0EYC8_BRAPL        0.42  0.60   10  191    8  191  186    5    6  409  L0EYC8     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira pilosicoli P43/6/78 GN=argJ PE=3 SV=1
 2607 : L0LR60_RHITR        0.42  0.62  193  405  195  411  221    6   12  413  L0LR60     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium tropici CIAT 899 GN=argJ PE=3 SV=1
 2608 : L8XQC8_9SPIR        0.42  0.59    7  191    5  191  189    4    6  410  L8XQC8     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira hampsonii 30599 GN=argJ PE=3 SV=1
 2609 : L8XWI5_9GAMM        0.42  0.65  193  405  187  403  222    5   14  405  L8XWI5     Arginine biosynthesis bifunctional protein ArgJ OS=Wohlfahrtiimonas chitiniclastica SH04 GN=argJ PE=3 SV=1
 2610 : M4CLV3_BRARP        0.42  0.66  193  405  247  464  220    5    9  466  M4CLV3     Uncharacterized protein OS=Brassica rapa subsp. pekinensis GN=BRA005190 PE=3 SV=1
 2611 : M4DL01_BRARP        0.42  0.66  193  405  250  467  220    5    9  469  M4DL01     Uncharacterized protein OS=Brassica rapa subsp. pekinensis GN=BRA017182 PE=3 SV=1
 2612 : M4IDK6_RHIML        0.42  0.61  193  405  195  411  221    6   12  413  M4IDK6     Arginine biosynthesis bifunctional protein ArgJ OS=Sinorhizobium meliloti GR4 GN=argJ PE=3 SV=1
 2613 : M9RE41_9RHOB        0.42  0.69  193  405  195  402  215    4    9  404  M9RE41     Arginine biosynthesis bifunctional protein ArgJ OS=Octadecabacter antarcticus 307 GN=argJ PE=3 SV=1
 2614 : N6VLW8_9RHIZ        0.42  0.63  193  405  195  410  219    6    9  412  N6VLW8     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella bovis 91-4 GN=argJ PE=3 SV=1
 2615 : N6VQF6_9RHIZ        0.42  0.62  193  405  195  410  219    6    9  412  N6VQF6     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella bovis m02 GN=argJ PE=3 SV=1
 2616 : N9Z7B7_CLOBU        0.42  0.66  193  405  190  405  219    4    9  407  N9Z7B7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium butyricum 60E.3 GN=argJ PE=3 SV=1
 2617 : Q030G4_LACLS        0.42  0.63    7  191    2  182  187    3    8  395  Q030G4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris (strain SK11) GN=argJ PE=3 SV=1
 2618 : Q0A6W0_ALKEH        0.42  0.64  193  405  185  396  216    6    7  398  Q0A6W0     Arginine biosynthesis bifunctional protein ArgJ OS=Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1) GN=argJ PE=3 SV=1
 2619 : Q16D40_ROSDO        0.42  0.63  193  405  199  406  217    5   13  408  Q16D40     Arginine biosynthesis bifunctional protein ArgJ OS=Roseobacter denitrificans (strain ATCC 33942 / OCh 114) GN=argJ PE=3 SV=1
 2620 : Q1GWU3_SPHAL        0.42  0.63  193  405  193  406  218    5    9  408  Q1GWU3     Arginine biosynthesis bifunctional protein ArgJ OS=Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256) GN=argJ PE=3 SV=1
 2621 : Q1QBH9_PSYCK        0.42  0.68  193  405  191  405  216    4    4  407  Q1QBH9     Arginine biosynthesis bifunctional protein ArgJ OS=Psychrobacter cryohalolentis (strain K5) GN=argJ PE=3 SV=1
 2622 : Q2CJX6_9RHOB        0.42  0.66  193  405  196  403  215    5    9  405  Q2CJX6     Arginine biosynthesis bifunctional protein ArgJ OS=Oceanicola granulosus HTCC2516 GN=argJ PE=3 SV=1
 2623 : Q2G6U1_NOVAD        0.42  0.63  193  405  193  406  218    5    9  408  Q2G6U1     Arginine biosynthesis bifunctional protein ArgJ OS=Novosphingobium aromaticivorans (strain DSM 12444) GN=argJ PE=3 SV=1
 2624 : Q2RXE6_RHORT        0.42  0.63  193  405  197  410  218    5    9  412  Q2RXE6     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Rhodospirillum rubrum (strain ATCC 11170 / NCIB 8255) GN=argJ PE=3 SV=1
 2625 : Q3IYN3_RHOS4        0.42  0.64  193  405  231  443  216    4    6  445  Q3IYN3     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodobacter sphaeroides (strain ATCC 17023 / 2.4.1 / NCIB 8253 / DSM 158) GN=argJ PE=3 SV=1
 2626 : R0G008_9BRAS        0.42  0.67  193  405  249  466  218    3    5  468  R0G008     Uncharacterized protein OS=Capsella rubella GN=CARUB_v10024966mg PE=3 SV=1
 2627 : R5A929_9FIRM        0.42  0.63   10  191    5  187  186    5    7  405  R5A929     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:102 GN=argJ PE=3 SV=1
 2628 : R5E5X1_9FIRM        0.42  0.65    4  191    2  190  191    4    5  408  R5E5X1     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:108 GN=argJ PE=3 SV=1
 2629 : R5KH15_9CLOT        0.42  0.66  193  405  191  406  217    2    5  408  R5KH15     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:264 GN=argJ PE=3 SV=1
 2630 : R5KH15_9CLOT        0.42  0.65    7  191    2  190  189    3    4  408  R5KH15     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:264 GN=argJ PE=3 SV=1
 2631 : R5LKJ7_9FIRM        0.42  0.63    5  191    1  190  190    2    3  408  R5LKJ7     Arginine biosynthesis bifunctional protein ArgJ OS=Butyrivibrio crossotus CAG:259 GN=argJ PE=3 SV=1
 2632 : R5NN87_9FIRM        0.42  0.63    7  190    2  188  190    4    9  407  R5NN87     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:17 GN=argJ PE=3 SV=1
 2633 : R5QDP1_9FIRM        0.42  0.59    7  190    2  188  187    2    3  407  R5QDP1     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus torques CAG:61 GN=argJ PE=3 SV=1
 2634 : R6BZM8_9CLOT        0.42  0.62    7  190    2  188  187    2    3  407  R6BZM8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:510 GN=argJ PE=3 SV=1
 2635 : R6EKK0_9FIRM        0.42  0.65    7  190    2  188  188    4    5  407  R6EKK0     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:65 GN=argJ PE=3 SV=1
 2636 : R6GH83_9FIRM        0.42  0.64    7  190    2  188  187    2    3  407  R6GH83     Arginine biosynthesis bifunctional protein ArgJ OS=Blautia sp. CAG:52 GN=argJ PE=3 SV=1
 2637 : R6I555_9FIRM        0.42  0.61    7  191    2  185  187    5    5  403  R6I555     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:177 GN=argJ PE=3 SV=1
 2638 : R6L7I2_9FIRM        0.42  0.65    7  190    2  188  187    2    3  407  R6L7I2     Arginine biosynthesis bifunctional protein ArgJ OS=Blautia sp. CAG:237 GN=argJ PE=3 SV=1
 2639 : R6WIP3_9FIRM        0.42  0.62    7  190    2  188  189    4    7  407  R6WIP3     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:227 GN=argJ PE=3 SV=1
 2640 : R6WTJ2_9FIRM        0.42  0.61    7  190    2  188  187    2    3  407  R6WTJ2     Arginine biosynthesis bifunctional protein ArgJ OS=Dorea sp. CAG:317 GN=argJ PE=3 SV=1
 2641 : R7BR17_9ACTN        0.42  0.62  193  405  202  415  218    5    9  417  R7BR17     Arginine biosynthesis bifunctional protein ArgJ OS=Eggerthella sp. CAG:368 GN=argJ PE=3 SV=1
 2642 : R7EIA7_9FIRM        0.42  0.63    7  190    2  188  187    2    3  407  R7EIA7     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:471 GN=argJ PE=3 SV=1
 2643 : R7GXC7_9FIRM        0.42  0.63    7  190    2  188  190    4    9  407  R7GXC7     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:90 GN=argJ PE=3 SV=1
 2644 : R7H6W3_9FIRM        0.42  0.66  193  405  209  424  217    3    5  426  R7H6W3     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:403 GN=argJ PE=3 SV=1
 2645 : R7NEL3_9FIRM        0.42  0.63    7  191    2  190  189    2    4  408  R7NEL3     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:76 GN=argJ PE=3 SV=1
 2646 : S3NKC9_9GAMM        0.42  0.67  193  405  190  404  216    4    4  406  S3NKC9     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter rudis CIP 110305 GN=argJ PE=3 SV=1
 2647 : S3WQR9_9ACTO        0.42  0.65   12  191    2  178  183    6    9  383  S3WQR9     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium sp. oral taxon 192 str. F0372 GN=argJ PE=3 SV=1
 2648 : S5S0B3_RHIET        0.42  0.61  193  405  195  411  221    6   12  413  S5S0B3     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium etli bv. mimosae str. Mim1 GN=argJ PE=3 SV=1
 2649 : S5Y2S3_PARAH        0.42  0.65  193  405  253  466  217    5    7  468  S5Y2S3     Arginine biosynthesis bifunctional protein ArgJ OS=Paracoccus aminophilus JCM 7686 GN=argJ PE=3 SV=1
 2650 : S6FIU2_LACLL        0.42  0.63    7  191    2  183  187    3    7  396  S6FIU2     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis A12 GN=argJ PE=3 SV=1
 2651 : S7WJV5_9BACT        0.42  0.65   13  191    5  184  184    5    9  403  S7WJV5     Arginine biosynthesis bifunctional protein ArgJ OS=Cyclobacterium qasimii M12-11B GN=argJ PE=3 SV=1
 2652 : S8CCG0_9LAMI        0.42  0.65  193  405  217  434  220    4    9  436  S8CCG0     Uncharacterized protein (Fragment) OS=Genlisea aurea GN=M569_10185 PE=3 SV=1
 2653 : T0HNB4_9SPHN        0.42  0.60  193  405  193  406  219    6   11  408  T0HNB4     Arginine biosynthesis bifunctional protein ArgJ OS=Sphingobium quisquiliarum P25 GN=argJ PE=3 SV=1
 2654 : T0T8T4_LACLC        0.42  0.63    7  191    2  182  187    3    8  395  T0T8T4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris TIFN5 GN=argJ PE=3 SV=1
 2655 : T0UQ81_LACLC        0.42  0.63    7  191    2  182  187    3    8  395  T0UQ81     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris TIFN7 GN=argJ PE=3 SV=1
 2656 : T0UT44_LACLC        0.42  0.63    7  191    2  182  187    3    8  395  T0UT44     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris TIFN1 GN=argJ PE=3 SV=1
 2657 : T0VEQ3_LACLC        0.42  0.63    7  191    2  182  187    3    8  395  T0VEQ3     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris TIFN3 GN=argJ PE=3 SV=1
 2658 : T4AY45_CLODI        0.42  0.60  193  405  209  423  219    4   10  425  T4AY45     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F501 GN=argJ PE=3 SV=1
 2659 : U1D2C9_ENTGA        0.42  0.62   10  191    5  183  184    3    7  302  U1D2C9     Uncharacterized protein (Fragment) OS=Enterococcus gallinarum EGD-AAK12 GN=N036_28540 PE=3 SV=1
 2660 : U1XIP8_9RHIZ        0.42  0.61  193  405  180  396  221    6   12  398  U1XIP8     Arginine biosynthesis bifunctional protein ArgJ OS=Ochrobactrum sp. EGD-AQ16 GN=argJ PE=3 SV=1
 2661 : U2DEC2_9FIRM        0.42  0.62    7  190    2  188  190    4    9  407  U2DEC2     Arginine biosynthesis bifunctional protein ArgJ OS=Blautia sp. KLE 1732 GN=argJ PE=3 SV=1
 2662 : U2R5B4_9FUSO        0.42  0.64    5  191    1  187  188    2    2  410  U2R5B4     Arginine biosynthesis bifunctional protein ArgJ OS=Leptotrichia sp. oral taxon 879 str. F0557 GN=argJ PE=3 SV=1
 2663 : U2WFP0_9FUSO        0.42  0.63    5  191    1  187  188    2    2  410  U2WFP0     Arginine biosynthesis bifunctional protein ArgJ OS=Leptotrichia sp. oral taxon 225 str. F0581 GN=argJ PE=3 SV=1
 2664 : U4T3L8_9GAMM        0.42  0.67  193  405  191  405  216    4    4  407  U4T3L8     Arginine biosynthesis bifunctional protein ArgJ OS=Psychrobacter aquaticus CMS 56 GN=argJ PE=3 SV=1
 2665 : U4V4T7_9RHIZ        0.42  0.61  193  405  195  412  222    7   13  414  U4V4T7     Arginine biosynthesis bifunctional protein ArgJ OS=Ochrobactrum intermedium 229E GN=argJ PE=3 SV=1
 2666 : U5PJW9_LACLL        0.42  0.63    7  191    2  183  187    3    7  396  U5PJW9     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis KLDS 4.0325 GN=argJ PE=3 SV=1
 2667 : U6EAG5_9EURY        0.42  0.61  193  405  184  395  223    4   21  397  U6EAG5     Arginine biosynthesis bifunctional protein ArgJ OS=Methanobacterium sp. MB1 GN=argJ PE=3 SV=1
 2668 : U6EMN2_LACLL        0.42  0.63    7  191    2  183  187    3    7  396  U6EMN2     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis Dephy 1 GN=argJ PE=3 SV=1
 2669 : V2VWH5_LACLL        0.42  0.63    7  191    2  183  187    3    7  396  V2VWH5     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. lactis bv. diacetylactis str. LD61 GN=argJ PE=3 SV=1
 2670 : V8C3C7_9FIRM        0.42  0.58    7  190    2  188  187    2    3  407  V8C3C7     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus lactaris CC59_002D GN=argJ PE=3 SV=1
 2671 : W0JHM1_DESAE        0.42  0.62  193  405  193  404  214    2    3  406  W0JHM1     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfurella acetivorans A63 GN=argJ PE=3 SV=1
 2672 : W0NCJ6_RHILT        0.42  0.62  193  405  195  411  221    6   12  413  W0NCJ6     Arginine biosynthesis bifunctional protein ArgJ OS=Rhizobium leguminosarum bv. trifolii CB782 GN=argJ PE=3 SV=1
 2673 : W0X7J0_RHIML        0.42  0.61  193  405  195  411  221    6   12  413  W0X7J0     Arginine biosynthesis bifunctional protein ArgJ OS=Sinorhizobium meliloti RU11/001 GN=argJ PE=3 SV=1
 2674 : W3TAE0_BARHN        0.42  0.63  193  405  195  408  215    3    3  410  W3TAE0     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella henselae JK 42 GN=argJ PE=3 SV=1
 2675 : W3TYI6_BARHN        0.42  0.63  193  405  195  408  215    3    3  410  W3TYI6     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella henselae JK 41 GN=argJ PE=3 SV=1
 2676 : A0B6F8_METTP        0.41  0.62  193  405  180  386  219    6   18  388  A0B6F8     Arginine biosynthesis bifunctional protein ArgJ OS=Methanosaeta thermophila (strain DSM 6194 / PT) GN=argJ PE=3 SV=1
 2677 : A0NNY9_9RHOB        0.41  0.62  193  405  195  411  221    6   12  413  A0NNY9     Arginine biosynthesis bifunctional protein ArgJ OS=Labrenzia aggregata IAM 12614 GN=argJ PE=3 SV=1
 2678 : A3CRT8_METMJ        0.41  0.62  193  405  174  377  218    6   19  379  A3CRT8     Arginine biosynthesis bifunctional protein ArgJ OS=Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1) GN=argJ PE=3 SV=1
 2679 : A3S9T3_9RHOB        0.41  0.65  193  405  199  406  214    3    7  408  A3S9T3     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfitobacter sp. EE-36 GN=argJ PE=3 SV=1
 2680 : A3SUP1_9RHOB        0.41  0.65  193  405  199  406  214    3    7  408  A3SUP1     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfitobacter sp. NAS-14.1 GN=argJ PE=3 SV=1
 2681 : A6UCG6_SINMW        0.41  0.61  193  405  195  411  221    6   12  413  A6UCG6     Arginine biosynthesis bifunctional protein ArgJ OS=Sinorhizobium medicae (strain WSM419) GN=argJ PE=3 SV=1
 2682 : A7B496_RUMGN        0.41  0.61    7  190    2  188  189    4    7  315  A7B496     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus gnavus ATCC 29149 GN=argJ PE=3 SV=1
 2683 : A7VCH6_9CLOT        0.41  0.65    7  191    2  190  189    3    4  408  A7VCH6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. L2-50 GN=argJ PE=3 SV=1
 2684 : A9BI98_PETMO        0.41  0.62    6  191    4  190  191    4    9  408  A9BI98     Arginine biosynthesis bifunctional protein ArgJ OS=Petrotoga mobilis (strain DSM 10674 / SJ95) GN=argJ PE=3 SV=1
 2685 : A9DYD7_9RHOB        0.41  0.65  193  405  199  406  215    5    9  408  A9DYD7     Arginine biosynthesis bifunctional protein ArgJ OS=Oceanibulbus indolifex HEL-45 GN=argJ PE=3 SV=1
 2686 : ARGJ2_NOSS1         0.41  0.60  193  405  180  385  215    4   11  387  Q8YPF9     Arginine biosynthesis bifunctional protein ArgJ 2 OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) GN=argJ2 PE=3 SV=1
 2687 : ARGJ_BARQU          0.41  0.64  193  405  195  410  217    4    5  412  Q6G0Q6     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella quintana (strain Toulouse) GN=argJ PE=3 SV=1
 2688 : ARGJ_LACPL          0.41  0.64    1  191    2  188  191    1    4  402  O08319     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1) GN=argJ PE=3 SV=2
 2689 : ARGJ_METM7          0.41  0.57  193  405  189  406  223    3   15  408  A6VFI9     Arginine biosynthesis bifunctional protein ArgJ OS=Methanococcus maripaludis (strain C7 / ATCC BAA-1331) GN=argJ PE=3 SV=1
 2690 : ARGJ_METTH          0.41  0.61  193  405  189  400  221    5   17  402  O26284     Arginine biosynthesis bifunctional protein ArgJ OS=Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H) GN=argJ PE=3 SV=1
 2691 : ARGJ_OSTLU          0.41  0.64  193  405  239  459  225    6   16  461  A4S1K1     Arginine biosynthesis bifunctional protein ArgJ, chloroplastic OS=Ostreococcus lucimarinus (strain CCE9901) GN=OSTLU_33128 PE=3 SV=1
 2692 : ARGJ_PHYPA          0.41  0.65  193  405  301  518  220    5    9  520  A9SLE5     Arginine biosynthesis bifunctional protein ArgJ, chloroplastic OS=Physcomitrella patens subsp. patens GN=PHYPADRAFT_213576 PE=3 SV=1
 2693 : B2UYI3_CLOBA        0.41  0.61   11  191    8  189  187    4   11  407  B2UYI3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium botulinum (strain Alaska E43 / Type E3) GN=argJ PE=3 SV=1
 2694 : B5CMA6_9FIRM        0.41  0.58    1  190    6  198  193    2    3  417  B5CMA6     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus lactaris ATCC 29176 GN=argJ PE=3 SV=1
 2695 : B6C5A4_9GAMM        0.41  0.63  193  405  190  403  217    5    7  405  B6C5A4     Arginine biosynthesis bifunctional protein ArgJ OS=Nitrosococcus oceani AFC27 GN=argJ PE=3 SV=1
 2696 : B8FA24_DESAA        0.41  0.60   18  191   11  184  181    5   14  395  B8FA24     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfatibacillum alkenivorans (strain AK-01) GN=argJ PE=3 SV=1
 2697 : C5UXM6_CLOBO        0.41  0.62   11  191    8  189  187    4   11  407  C5UXM6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium botulinum E1 str. 'BoNT E Beluga' GN=argJ PE=3 SV=1
 2698 : C6VKV0_LACPJ        0.41  0.64    1  191    4  190  191    1    4  404  C6VKV0     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum (strain JDM1) GN=argJ PE=3 SV=1
 2699 : C7N8R1_LEPBD        0.41  0.64    5  191    1  187  188    2    2  410  C7N8R1     Arginine biosynthesis bifunctional protein ArgJ OS=Leptotrichia buccalis (strain ATCC 14201 / DSM 1135 / JCM 12969 / NCTC 10249) GN=argJ PE=3 SV=1
 2700 : C8WKE4_EGGLE        0.41  0.59  193  405  209  423  219    4   10  425  C8WKE4     Arginine biosynthesis bifunctional protein ArgJ OS=Eggerthella lenta (strain ATCC 25559 / DSM 2243 / JCM 9979 / NCTC 11813 / VPI 0255) GN=argJ PE=3 SV=1
 2701 : C9MU92_9FUSO        0.41  0.63    5  191    1  187  188    2    2  410  C9MU92     Arginine biosynthesis bifunctional protein ArgJ OS=Leptotrichia hofstadii F0254 GN=argJ PE=3 SV=1
 2702 : D2REU9_ARCPA        0.41  0.63  193  405  168  379  223    6   21  381  D2REU9     Arginine biosynthesis bifunctional protein ArgJ OS=Archaeoglobus profundus (strain DSM 5631 / JCM 9629 / NBRC 100127 / Av18) GN=argJ PE=3 SV=1
 2703 : D3DDI2_9ACTO        0.41  0.64   12  191    2  182  182    3    3  334  D3DDI2     Amino-acid N-acetyltransferase (Fragment) OS=Frankia sp. EUN1f GN=FrEUN1fDRAFT_7854 PE=3 SV=1
 2704 : D3E2W3_METRM        0.41  0.63  193  405  176  395  223    6   13  397  D3E2W3     Arginine biosynthesis bifunctional protein ArgJ OS=Methanobrevibacter ruminantium (strain ATCC 35063 / DSM 1093 / JCM 13430 / M1) GN=argJ PE=3 SV=1
 2705 : D4LJX8_9FIRM        0.41  0.62    7  190    2  188  190    4    9  407  D4LJX8     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. SR1/5 GN=argJ PE=3 SV=1
 2706 : D4LZ93_9FIRM        0.41  0.57    7  190    2  188  188    4    5  407  D4LZ93     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus torques L2-14 GN=argJ PE=3 SV=1
 2707 : D5Q3T5_CLODI        0.41  0.60    7  191    2  187  191    5   11  405  D5Q3T5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile NAP08 GN=argJ PE=3 SV=1
 2708 : D5RZU9_CLODI        0.41  0.60    7  191    2  187  191    5   11  405  D5RZU9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile NAP07 GN=argJ PE=3 SV=1
 2709 : D7VDV0_LACPN        0.41  0.64    1  191    4  190  191    1    4  404  D7VDV0     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum subsp. plantarum ATCC 14917 GN=argJ PE=3 SV=1
 2710 : D8GJQ2_CLOLD        0.41  0.60    9  191    6  188  188    4   10  406  D8GJQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium ljungdahlii (strain ATCC 55383 / DSM 13528 / PETC) GN=argJ PE=3 SV=1
 2711 : D8K8Z8_NITWC        0.41  0.65  193  405  190  403  217    6    7  405  D8K8Z8     Arginine biosynthesis bifunctional protein ArgJ OS=Nitrosococcus watsoni (strain C-113) GN=argJ PE=3 SV=1
 2712 : E0NWN2_9FIRM        0.41  0.65  193  405  195  406  215    3    5  408  E0NWN2     Arginine biosynthesis bifunctional protein ArgJ OS=Selenomonas sp. oral taxon 149 str. 67H29BP GN=argJ PE=3 SV=1
 2713 : E1TTJ1_LACPS        0.41  0.64    1  191    4  190  191    1    4  404  E1TTJ1     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum (strain ST-III) GN=argJ PE=3 SV=1
 2714 : E4LQ54_9CLOT        0.41  0.66  193  405  188  403  217    2    5  405  E4LQ54     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. HGF2 GN=argJ PE=3 SV=1
 2715 : E4VI60_9HELI        0.41  0.60  193  405  195  401  218    7   16  403  E4VI60     Arginine biosynthesis bifunctional protein ArgJ OS=Helicobacter cinaedi CCUG 18818 GN=argJ PE=3 SV=1
 2716 : E6SH25_THEM7        0.41  0.58   18  191   33  224  193    5   20  438  E6SH25     Arginine biosynthesis bifunctional protein ArgJ OS=Thermaerobacter marianensis (strain ATCC 700841 / DSM 12885 / JCM 10246 / 7p75a) GN=argJ PE=3 SV=1
 2717 : E6VZM6_DESAO        0.41  0.61  193  405  181  391  219    7   14  393  E6VZM6     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio aespoeensis (strain ATCC 700646 / DSM 10631 / Aspo-2) GN=argJ PE=3 SV=1
 2718 : E6YWI6_9RHIZ        0.41  0.63  193  405  195  410  218    5    7  412  E6YWI6     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella sp. 1-1C GN=argJ PE=3 SV=1
 2719 : E8TAK3_MESCW        0.41  0.60  193  405  195  411  221    6   12  413  E8TAK3     Arginine biosynthesis bifunctional protein ArgJ OS=Mesorhizobium ciceri bv. biserrulae (strain HAMBI 2942 / LMG 23838 / WSM1271) GN=argJ PE=3 SV=1
 2720 : E8UB82_DEIML        0.41  0.62  193  405  177  380  213    3    9  382  E8UB82     Arginine biosynthesis bifunctional protein ArgJ OS=Deinococcus maricopensis (strain DSM 21211 / LMG 22137 / NRRL B-23946 / LB-34) GN=argJ PE=3 SV=1
 2721 : F0J2A2_ACIMA        0.41  0.62  193  405  196  407  217    5    9  409  F0J2A2     Arginine biosynthesis bifunctional protein ArgJ OS=Acidiphilium multivorum (strain DSM 11245 / JCM 8867 / AIU301) GN=argJ PE=3 SV=1
 2722 : F0TC56_METSL        0.41  0.61  193  405  184  396  222    5   18  398  F0TC56     Arginine biosynthesis bifunctional protein ArgJ OS=Methanobacterium sp. (strain AL-21) GN=argJ PE=3 SV=1
 2723 : F2NDY5_DESAR        0.41  0.63  193  405  185  398  218    5    9  400  F2NDY5     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfobacca acetoxidans (strain ATCC 700848 / DSM 11109 / ASRB2) GN=argJ PE=3 SV=1
 2724 : F4FT26_LACBN        0.41  0.61    1  191    2  188  193    3    8  402  F4FT26     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus buchneri (strain NRRL B-30929) GN=argJ PE=3 SV=1
 2725 : F6BCI3_METIK        0.41  0.60  193  405  189  404  225    6   21  406  F6BCI3     Arginine biosynthesis bifunctional protein ArgJ OS=Methanotorris igneus (strain DSM 5666 / JCM 11834 / Kol 5) GN=argJ PE=3 SV=1
 2726 : F6D694_METSW        0.41  0.64  193  405  184  395  221    4   17  397  F6D694     Arginine biosynthesis bifunctional protein ArgJ OS=Methanobacterium sp. (strain SWAN-1) GN=argJ PE=3 SV=1
 2727 : F6IU00_LACPE        0.41  0.64    1  191   14  200  191    1    4  414  F6IU00     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus pentosus MP-10 GN=argJ PE=3 SV=1
 2728 : F7JT13_9FIRM        0.41  0.61    7  190    2  188  189    4    7  407  F7JT13     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 2_1_58FAA GN=argJ PE=3 SV=1
 2729 : G0M3B7_LACPE        0.41  0.64    1  191   14  200  191    1    4  414  G0M3B7     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus pentosus IG1 GN=argJ PE=3 SV=1
 2730 : G1VY34_9FIRM        0.41  0.66  193  405  188  403  217    2    5  405  G1VY34     Arginine biosynthesis bifunctional protein ArgJ OS=Erysipelotrichaceae bacterium 2_2_44A GN=argJ PE=3 SV=1
 2731 : G6B905_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  G6B905     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 002-P50-2011 GN=argJ PE=3 SV=1
 2732 : G6BKF6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  G6BKF6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 050-P50-2011 GN=argJ PE=3 SV=1
 2733 : G6BRN6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  G6BRN6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 70-100-2010 GN=argJ PE=3 SV=1
 2734 : G6EI19_9SPHN        0.41  0.63  193  405  193  406  218    5    9  408  G6EI19     Arginine biosynthesis bifunctional protein ArgJ OS=Novosphingobium pentaromativorans US6-1 GN=argJ PE=3 SV=1
 2735 : H0HMY6_9RHIZ        0.41  0.62  193  405  195  411  221    6   12  413  H0HMY6     Arginine biosynthesis bifunctional protein ArgJ OS=Mesorhizobium alhagi CCNWXJ12-2 GN=argJ PE=3 SV=1
 2736 : H1B3A3_9FIRM        0.41  0.66  193  405  188  403  217    2    5  405  H1B3A3     Arginine biosynthesis bifunctional protein ArgJ OS=Erysipelotrichaceae bacterium 21_3 GN=argJ PE=3 SV=1
 2737 : H1B897_9FIRM        0.41  0.66  193  405  188  403  217    2    5  405  H1B897     Arginine biosynthesis bifunctional protein ArgJ OS=Erysipelotrichaceae bacterium 6_1_45 GN=argJ PE=3 SV=1
 2738 : H3P2E1_LACPN        0.41  0.64    1  191    4  190  191    1    4  404  H3P2E1     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum subsp. plantarum NC8 GN=argJ PE=3 SV=1
 2739 : H8Z3H2_9GAMM        0.41  0.60  193  405  187  401  218    6    8  403  H8Z3H2     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Thiorhodovibrio sp. 970 GN=argJ PE=3 SV=1
 2740 : I0IIL0_PHYMF        0.41  0.65  193  405  199  414  217    3    5  416  I0IIL0     Arginine biosynthesis bifunctional protein ArgJ OS=Phycisphaera mikurensis (strain NBRC 102666 / KCTC 22515 / FYK2301M01) GN=argJ PE=3 SV=1
 2741 : I0IRC7_LEPFC        0.41  0.63  193  405  188  400  214    2    2  404  I0IRC7     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospirillum ferrooxidans (strain C2-3) GN=argJ PE=3 SV=1
 2742 : I2FJB2_HELCP        0.41  0.60  193  405  195  401  218    7   16  403  I2FJB2     Arginine biosynthesis bifunctional protein ArgJ OS=Helicobacter cinaedi (strain PAGU611) GN=argJ PE=3 SV=1
 2743 : I4ZU36_9GAMM        0.41  0.65  193  405  190  404  218    6    8  406  I4ZU36     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. HA GN=argJ PE=3 SV=1
 2744 : I5B3X1_9DELT        0.41  0.55   17  191    2  184  184    4   10  397  I5B3X1     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfobacter postgatei 2ac9 GN=argJ PE=3 SV=1
 2745 : I7GTZ3_9HELI        0.41  0.60  193  405  195  401  218    7   16  403  I7GTZ3     Arginine biosynthesis bifunctional protein ArgJ OS=Helicobacter cinaedi ATCC BAA-847 GN=argJ PE=3 SV=1
 2746 : I9APS3_LACPE        0.41  0.64    1  191    2  188  191    1    4  402  I9APS3     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus pentosus KCA1 GN=argJ PE=3 SV=1
 2747 : J0Z6B8_9RHIZ        0.41  0.62  193  405  195  410  217    3    5  412  J0Z6B8     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella washoensis 085-0475 GN=argJ PE=3 SV=1
 2748 : J1IV48_9RHIZ        0.41  0.61  193  405  195  408  215    3    3  410  J1IV48     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella alsatica IBS 382 GN=argJ PE=3 SV=1
 2749 : J1JZ53_BARVI        0.41  0.64  193  405  212  427  217    4    5  429  J1JZ53     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella vinsonii subsp. arupensis OK-94-513 GN=argJ PE=3 SV=1
 2750 : J1KF18_BAREL        0.41  0.63  193  405  195  408  215    3    3  410  J1KF18     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella elizabethae F9251 GN=argJ PE=3 SV=1
 2751 : J7QS66_METSZ        0.41  0.62  193  405  197  413  221    6   12  415  J7QS66     Arginine biosynthesis bifunctional protein ArgJ OS=Methylocystis sp. (strain SC2) GN=argJ PE=3 SV=1
 2752 : J9UHU8_BRAPL        0.41  0.60   10  191    8  191  186    5    6  409  J9UHU8     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira pilosicoli B2904 GN=argJ PE=3 SV=1
 2753 : J9W9Q4_LACBU        0.41  0.61    1  191    2  188  193    3    8  402  J9W9Q4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus buchneri CD034 GN=argJ PE=3 SV=1
 2754 : K1L910_9BACT        0.41  0.61  193  405  186  402  219    4    8  404  K1L910     Arginine biosynthesis bifunctional protein ArgJ OS=Cecembia lonarensis LW9 GN=argJ PE=3 SV=1
 2755 : K1YX94_9BACT        0.41  0.61  193  405   66  279  215    3    3  281  K1YX94     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured bacterium GN=argJ PE=3 SV=1
 2756 : K4HHW1_BARQI        0.41  0.64  193  405  195  410  217    4    5  412  K4HHW1     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella quintana RM-11 GN=argJ PE=3 SV=1
 2757 : K8NYX4_9BRAD        0.41  0.61  193  405  195  411  221    6   12  413  K8NYX4     Arginine biosynthesis bifunctional protein ArgJ OS=Afipia clevelandensis ATCC 49720 GN=argJ PE=3 SV=1
 2758 : K9RPT2_SYNP3        0.41  0.61  193  405  191  415  227    4   16  417  K9RPT2     Arginine biosynthesis bifunctional protein ArgJ OS=Synechococcus sp. (strain ATCC 27167 / PCC 6312) GN=argJ PE=3 SV=1
 2759 : L0A2P4_DEIPD        0.41  0.60  193  405  177  380  222    6   27  382  L0A2P4     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Deinococcus peraridilitoris (strain DSM 19664 / LMG 22246 / CIP 109416 / KR-200) GN=argJ PE=3 SV=1
 2760 : L0DDM3_SINAD        0.41  0.64  193  405  190  400  214    3    4  402  L0DDM3     Arginine biosynthesis bifunctional protein ArgJ OS=Singulisphaera acidiphila (strain ATCC BAA-1392 / DSM 18658 / VKM B-2454 / MOB10) GN=argJ PE=3 SV=1
 2761 : L0WZ68_9SPIR        0.41  0.60    7  191    5  191  189    4    6  410  L0WZ68     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira hampsonii 30446 GN=argJ PE=3 SV=1
 2762 : M1PUP7_METMZ        0.41  0.60  193  405  180  393  225    6   23  395  M1PUP7     Arginine biosynthesis bifunctional protein ArgJ OS=Methanosarcina mazei Tuc01 GN=argJ PE=3 SV=1
 2763 : M4KG76_LACPN        0.41  0.64    1  191    4  190  191    1    4  404  M4KG76     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum ZJ316 GN=argJ PE=3 SV=1
 2764 : M7C091_LACPN        0.41  0.64    1  191    2  188  191    1    4  402  M7C091     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum UCMA 3037 GN=argJ PE=3 SV=1
 2765 : N6VMY9_BARVB        0.41  0.62  193  405  195  408  217    5    7  410  N6VMY9     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella vinsonii subsp. berkhoffii str. Tweed GN=argJ PE=3 SV=1
 2766 : N9MT01_9GAMM        0.41  0.65  193  405  190  404  218    6    8  406  N9MT01     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. NIPH 2171 GN=argJ PE=3 SV=1
 2767 : N9UZ83_CLOIN        0.41  0.66  193  405  188  403  217    2    5  405  N9UZ83     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium innocuum 2959 GN=argJ PE=3 SV=1
 2768 : Q0BUI0_GRABC        0.41  0.62  193  405  194  407  218    5    9  409  Q0BUI0     Arginine biosynthesis bifunctional protein ArgJ OS=Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1) GN=argJ PE=3 SV=1
 2769 : Q188A1_CLOD6        0.41  0.61    7  191    2  187  191    5   11  405  Q188A1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile (strain 630) GN=argJ PE=3 SV=1
 2770 : Q1J0E0_DEIGD        0.41  0.62  193  405  185  388  221    7   25  390  Q1J0E0     Arginine biosynthesis bifunctional protein ArgJ OS=Deinococcus geothermalis (strain DSM 11300) GN=argJ PE=3 SV=1
 2771 : Q1NDW7_9SPHN        0.41  0.62  193  405  192  405  218    5    9  407  Q1NDW7     Arginine biosynthesis bifunctional protein ArgJ OS=Sphingomonas sp. SKA58 GN=argJ PE=3 SV=1
 2772 : Q1QQX4_NITHX        0.41  0.61  193  405  208  424  223    7   16  426  Q1QQX4     Arginine biosynthesis bifunctional protein ArgJ OS=Nitrobacter hamburgensis (strain X14 / DSM 10229) GN=argJ PE=3 SV=1
 2773 : Q1YGD3_MOBAS        0.41  0.61  193  405  197  413  221    6   12  415  Q1YGD3     Arginine biosynthesis bifunctional protein ArgJ OS=Manganese-oxidizing bacterium (strain SI85-9A1) GN=argJ PE=3 SV=1
 2774 : Q2SA02_HAHCH        0.41  0.64  193  405  190  404  216    4    4  406  Q2SA02     Arginine biosynthesis bifunctional protein ArgJ OS=Hahella chejuensis (strain KCTC 2396) GN=argJ PE=3 SV=1
 2775 : Q3B421_PELLD        0.41  0.64  193  405  191  400  215    3    7  402  Q3B421     Arginine biosynthesis bifunctional protein ArgJ OS=Pelodictyon luteolum (strain DSM 273) GN=argJ PE=3 SV=1
 2776 : R0DY11_9RHOB        0.41  0.65  193  405  199  406  217    5   13  408  R0DY11     Arginine biosynthesis bifunctional protein ArgJ OS=Ruegeria mobilis F1926 GN=argJ PE=3 SV=1
 2777 : R4PQ50_LACPN        0.41  0.64    1  191    4  190  191    1    4  404  R4PQ50     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum subsp. plantarum P-8 GN=argJ PE=3 SV=1
 2778 : R5A626_9CLOT        0.41  0.62    7  191    2  186  189    5    8  404  R5A626     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:1013 GN=argJ PE=3 SV=1
 2779 : R5DTZ4_9FIRM        0.41  0.58    7  191    2  189  190    3    7  407  R5DTZ4     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:86 GN=argJ PE=3 SV=1
 2780 : R5GZU3_9FIRM        0.41  0.63    7  190    2  188  189    4    7  407  R5GZU3     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:24 GN=argJ PE=3 SV=1
 2781 : R5IUE4_9FIRM        0.41  0.60    7  191    2  185  187    5    5  403  R5IUE4     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:124 GN=argJ PE=3 SV=1
 2782 : R5J3G9_9CLOT        0.41  0.63    7  190    6  192  188    3    5  411  R5J3G9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:7 GN=argJ PE=3 SV=1
 2783 : R5NNH6_9FIRM        0.41  0.59   11  190   10  194  189    5   13  413  R5NNH6     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:603 GN=argJ PE=3 SV=1
 2784 : R5NY47_9CLOT        0.41  0.66    7  191    2  189  190    5    7  407  R5NY47     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:127 GN=argJ PE=3 SV=1
 2785 : R5SIR9_9FIRM        0.41  0.63    8  191    6  192  189    7    7  408  R5SIR9     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:129 GN=argJ PE=3 SV=1
 2786 : R5TKX4_9FIRM        0.41  0.61    7  190    2  188  189    4    7  407  R5TKX4     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus gnavus CAG:126 GN=argJ PE=3 SV=1
 2787 : R5XZ84_9FIRM        0.41  0.58    7  190    2  188  189    4    7  407  R5XZ84     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:212 GN=argJ PE=3 SV=1
 2788 : R5Z9W3_9FIRM        0.41  0.60    2  191    1  192  193    4    4  410  R5Z9W3     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:197 GN=argJ PE=3 SV=1
 2789 : R6LP91_9CLOT        0.41  0.62    1  191   15  206  197    5   11  424  R6LP91     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:265 GN=argJ PE=3 SV=1
 2790 : R6P6S4_9FIRM        0.41  0.57    7  190    2  188  188    4    5  407  R6P6S4     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:55 GN=argJ PE=3 SV=1
 2791 : R6T4L2_9FIRM        0.41  0.63    5  191    1  190  192    5    7  408  R6T4L2     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillibacter sp. CAG:155 GN=argJ PE=3 SV=1
 2792 : R7Q423_CHOCR        0.41  0.59  193  405  194  418  227    4   16  420  R7Q423     Glutamate N-acetyltransferase / amino-acid N-acetyltransferase OS=Chondrus crispus GN=CHC_T00008260001 PE=3 SV=1
 2793 : R9X388_LACPN        0.41  0.64    1  191    2  188  191    1    4  402  R9X388     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum 16 GN=argJ PE=3 SV=1
 2794 : S2VUN1_LACPN        0.41  0.64    1  191    2  188  191    1    4  402  S2VUN1     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum IPLA88 GN=argJ PE=3 SV=1
 2795 : S7WFE2_9GAMM        0.41  0.66  193  405  190  404  216    4    4  406  S7WFE2     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter gerneri MTCC 9824 GN=argJ PE=3 SV=1
 2796 : T0H0X3_9SPHN        0.41  0.63  193  405  193  406  220    7   13  408  T0H0X3     Arginine biosynthesis bifunctional protein ArgJ OS=Novosphingobium lindaniclasticum LE124 GN=argJ PE=3 SV=1
 2797 : T0S4Y9_LACLC        0.41  0.64    6  163    1  154  158    2    4  159  T0S4Y9     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus lactis subsp. cremoris TIFN6 GN=argJ PE=3 SV=1
 2798 : T2TJX6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2TJX6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD9 GN=argJ PE=3 SV=1
 2799 : T2TRR8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2TRR8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD3 GN=argJ PE=3 SV=1
 2800 : T2TY71_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2TY71     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD13 GN=argJ PE=3 SV=1
 2801 : T2TYG6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2TYG6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD8 GN=argJ PE=3 SV=1
 2802 : T2UKW9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2UKW9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD17 GN=argJ PE=3 SV=1
 2803 : T2US57_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2US57     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD18 GN=argJ PE=3 SV=1
 2804 : T2V4L2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2V4L2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD21 GN=argJ PE=3 SV=1
 2805 : T2VFX2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2VFX2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD22 GN=argJ PE=3 SV=1
 2806 : T2VPF8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2VPF8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD34 GN=argJ PE=3 SV=1
 2807 : T2W0E7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2W0E7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD38 GN=argJ PE=3 SV=1
 2808 : T2WE49_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2WE49     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD40 GN=argJ PE=3 SV=1
 2809 : T2WPW7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2WPW7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD41 GN=argJ PE=3 SV=1
 2810 : T2X6G4_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2X6G4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD39 GN=argJ PE=3 SV=1
 2811 : T2X817_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2X817     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD42 GN=argJ PE=3 SV=1
 2812 : T2XLF1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2XLF1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD43 GN=argJ PE=3 SV=1
 2813 : T2Y454_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2Y454     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD44 GN=argJ PE=3 SV=1
 2814 : T2Y9H9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2Y9H9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD46 GN=argJ PE=3 SV=1
 2815 : T2YEE5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2YEE5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD45 GN=argJ PE=3 SV=1
 2816 : T2YV27_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2YV27     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD47 GN=argJ PE=3 SV=1
 2817 : T2ZDA3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2ZDA3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD49 GN=argJ PE=3 SV=1
 2818 : T2ZHF7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2ZHF7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD51 GN=argJ PE=3 SV=1
 2819 : T2ZQW9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T2ZQW9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD68 GN=argJ PE=3 SV=1
 2820 : T3A3U1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3A3U1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD69 GN=argJ PE=3 SV=1
 2821 : T3AMS7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3AMS7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD104 GN=argJ PE=3 SV=1
 2822 : T3AUW3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3AUW3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD70 GN=argJ PE=3 SV=1
 2823 : T3B190_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3B190     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD109 GN=argJ PE=3 SV=1
 2824 : T3BMC3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3BMC3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD131 GN=argJ PE=3 SV=1
 2825 : T3BW80_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3BW80     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD132 GN=argJ PE=3 SV=1
 2826 : T3C6E5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3C6E5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD133 GN=argJ PE=3 SV=1
 2827 : T3CIH7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3CIH7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD144 GN=argJ PE=3 SV=1
 2828 : T3CV10_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3CV10     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD129 GN=argJ PE=3 SV=1
 2829 : T3CX21_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3CX21     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD149 GN=argJ PE=3 SV=1
 2830 : T3DDE2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3DDE2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD160 GN=argJ PE=3 SV=1
 2831 : T3DK30_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3DK30     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD159 GN=argJ PE=3 SV=1
 2832 : T3E045_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3E045     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD165 GN=argJ PE=3 SV=1
 2833 : T3ECB5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3ECB5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD166 GN=argJ PE=3 SV=1
 2834 : T3EHD8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3EHD8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD169 GN=argJ PE=3 SV=1
 2835 : T3EZ01_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3EZ01     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD170 GN=argJ PE=3 SV=1
 2836 : T3FHK2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3FHK2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD178 GN=argJ PE=3 SV=1
 2837 : T3FNN5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3FNN5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD181 GN=argJ PE=3 SV=1
 2838 : T3FUU7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3FUU7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD175 GN=argJ PE=3 SV=1
 2839 : T3G9I6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3G9I6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD200 GN=argJ PE=3 SV=1
 2840 : T3GNW6_CLODC        0.41  0.61    7  191    2  187  191    5   11  405  T3GNW6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile (strain CD196) GN=argJ PE=3 SV=1
 2841 : T3GXE5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3GXE5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD201 GN=argJ PE=3 SV=1
 2842 : T3GXY9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3GXY9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD206 GN=argJ PE=3 SV=1
 2843 : T3HJX6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3HJX6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD212 GN=argJ PE=3 SV=1
 2844 : T3HU63_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3HU63     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD211 GN=argJ PE=3 SV=1
 2845 : T3I0J2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3I0J2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 342 GN=argJ PE=3 SV=1
 2846 : T3IJ64_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3IJ64     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 655 GN=argJ PE=3 SV=1
 2847 : T3IVF3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3IVF3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 824 GN=argJ PE=3 SV=1
 2848 : T3J779_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3J779     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 842 GN=argJ PE=3 SV=1
 2849 : T3JE33_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3JE33     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 840 GN=argJ PE=3 SV=1
 2850 : T3JN76_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3JN76     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 6042 GN=argJ PE=3 SV=1
 2851 : T3JTA1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3JTA1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 6041 GN=argJ PE=3 SV=1
 2852 : T3KBH0_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3KBH0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00044 GN=argJ PE=3 SV=1
 2853 : T3KFH5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3KFH5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile 6057 GN=argJ PE=3 SV=1
 2854 : T3L1R1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3L1R1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00065 GN=argJ PE=3 SV=1
 2855 : T3L5E3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3L5E3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00062 GN=argJ PE=3 SV=1
 2856 : T3LKN9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3LKN9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00114 GN=argJ PE=3 SV=1
 2857 : T3LU56_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3LU56     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00126 GN=argJ PE=3 SV=1
 2858 : T3MES3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3MES3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00129 GN=argJ PE=3 SV=1
 2859 : T3MFS5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3MFS5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00128 GN=argJ PE=3 SV=1
 2860 : T3MZX6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3MZX6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00131 GN=argJ PE=3 SV=1
 2861 : T3N1L0_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3N1L0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00132 GN=argJ PE=3 SV=1
 2862 : T3NAC5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3NAC5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00134 GN=argJ PE=3 SV=1
 2863 : T3NW12_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3NW12     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00141 GN=argJ PE=3 SV=1
 2864 : T3PHC6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3PHC6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00149 GN=argJ PE=3 SV=1
 2865 : T3PQ64_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3PQ64     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00142 GN=argJ PE=3 SV=1
 2866 : T3PUU8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3PUU8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00154 GN=argJ PE=3 SV=1
 2867 : T3Q8Y6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3Q8Y6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00160 GN=argJ PE=3 SV=1
 2868 : T3QZ33_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3QZ33     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00167 GN=argJ PE=3 SV=1
 2869 : T3R968_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3R968     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00183 GN=argJ PE=3 SV=1
 2870 : T3RFE9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3RFE9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00174 GN=argJ PE=3 SV=1
 2871 : T3RXS0_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3RXS0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00191 GN=argJ PE=3 SV=1
 2872 : T3SAB5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3SAB5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00189 GN=argJ PE=3 SV=1
 2873 : T3SBI1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3SBI1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00193 GN=argJ PE=3 SV=1
 2874 : T3SVK4_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3SVK4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00196 GN=argJ PE=3 SV=1
 2875 : T3T7J3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3T7J3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00195 GN=argJ PE=3 SV=1
 2876 : T3TBV4_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3TBV4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00197 GN=argJ PE=3 SV=1
 2877 : T3TT36_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3TT36     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00203 GN=argJ PE=3 SV=1
 2878 : T3U578_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3U578     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00210 GN=argJ PE=3 SV=1
 2879 : T3UIC5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3UIC5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00212 GN=argJ PE=3 SV=1
 2880 : T3UIT4_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3UIT4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00211 GN=argJ PE=3 SV=1
 2881 : T3V331_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3V331     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00215 GN=argJ PE=3 SV=1
 2882 : T3VIH8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3VIH8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00232 GN=argJ PE=3 SV=1
 2883 : T3VV24_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3VV24     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00238 GN=argJ PE=3 SV=1
 2884 : T3VX86_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3VX86     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00216 GN=argJ PE=3 SV=1
 2885 : T3W0P6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3W0P6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00244 GN=argJ PE=3 SV=1
 2886 : T3WPC8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3WPC8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00246 GN=argJ PE=3 SV=1
 2887 : T3WXH9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3WXH9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00245 GN=argJ PE=3 SV=1
 2888 : T3X547_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3X547     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00261 GN=argJ PE=3 SV=1
 2889 : T3XTA2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3XTA2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00275 GN=argJ PE=3 SV=1
 2890 : T3XVM4_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3XVM4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00273 GN=argJ PE=3 SV=1
 2891 : T3Y8I1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3Y8I1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00256 GN=argJ PE=3 SV=1
 2892 : T3YF45_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3YF45     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00306 GN=argJ PE=3 SV=1
 2893 : T3YVA5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3YVA5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00307 GN=argJ PE=3 SV=1
 2894 : T3YVQ2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3YVQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00305 GN=argJ PE=3 SV=1
 2895 : T3ZCX0_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3ZCX0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00313 GN=argJ PE=3 SV=1
 2896 : T3ZD24_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3ZD24     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00310 GN=argJ PE=3 SV=1
 2897 : T3ZY73_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T3ZY73     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F152 GN=argJ PE=3 SV=1
 2898 : T4AC27_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4AC27     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F249 GN=argJ PE=3 SV=1
 2899 : T4ARC1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4ARC1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F501 GN=argJ PE=3 SV=1
 2900 : T4B9E8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4B9E8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y10 GN=argJ PE=3 SV=1
 2901 : T4BUD5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4BUD5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y21 GN=argJ PE=3 SV=1
 2902 : T4CD32_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4CD32     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y41 GN=argJ PE=3 SV=1
 2903 : T4CKD3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4CKD3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y155 GN=argJ PE=3 SV=1
 2904 : T4CVU9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4CVU9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y165 GN=argJ PE=3 SV=1
 2905 : T4D3Y7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4D3Y7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y171 GN=argJ PE=3 SV=1
 2906 : T4DP94_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4DP94     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y215 GN=argJ PE=3 SV=1
 2907 : T4DTI7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4DTI7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y184 GN=argJ PE=3 SV=1
 2908 : T4E1M8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4E1M8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y202 GN=argJ PE=3 SV=1
 2909 : T4E2M8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4E2M8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y231 GN=argJ PE=3 SV=1
 2910 : T4EHL3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4EHL3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y247 GN=argJ PE=3 SV=1
 2911 : T4F0D3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4F0D3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y270 GN=argJ PE=3 SV=1
 2912 : T4FFK2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4FFK2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y312 GN=argJ PE=3 SV=1
 2913 : T4FLK2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4FLK2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y266 GN=argJ PE=3 SV=1
 2914 : T4FUU6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4FUU6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y307 GN=argJ PE=3 SV=1
 2915 : T4GCD1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4GCD1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y343 GN=argJ PE=3 SV=1
 2916 : T4GHN1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4GHN1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y358 GN=argJ PE=3 SV=1
 2917 : T4GNU0_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4GNU0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y381 GN=argJ PE=3 SV=1
 2918 : T4HEF4_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4HEF4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P1 GN=argJ PE=3 SV=1
 2919 : T4HGI1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4HGI1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y401 GN=argJ PE=3 SV=1
 2920 : T4HN11_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4HN11     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile Y384 GN=argJ PE=3 SV=1
 2921 : T4HXX5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4HXX5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P2 GN=argJ PE=3 SV=1
 2922 : T4ICA6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4ICA6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P3 GN=argJ PE=3 SV=1
 2923 : T4IRV0_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4IRV0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P5 GN=argJ PE=3 SV=1
 2924 : T4J3W9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4J3W9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P6 GN=argJ PE=3 SV=1
 2925 : T4JN07_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4JN07     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P7 GN=argJ PE=3 SV=1
 2926 : T4JVR0_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4JVR0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P8 GN=argJ PE=3 SV=1
 2927 : T4KBI9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4KBI9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P13 GN=argJ PE=3 SV=1
 2928 : T4KKG3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4KKG3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P11 GN=argJ PE=3 SV=1
 2929 : T4KSK9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4KSK9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P9 GN=argJ PE=3 SV=1
 2930 : T4KYG1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4KYG1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P15 GN=argJ PE=3 SV=1
 2931 : T4LIA2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4LIA2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P19 GN=argJ PE=3 SV=1
 2932 : T4M0M5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4M0M5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P20 GN=argJ PE=3 SV=1
 2933 : T4MB23_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4MB23     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P21 GN=argJ PE=3 SV=1
 2934 : T4MWM5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4MWM5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P25 GN=argJ PE=3 SV=1
 2935 : T4MYV7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4MYV7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P24 GN=argJ PE=3 SV=1
 2936 : T4NRG1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4NRG1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P32 GN=argJ PE=3 SV=1
 2937 : T4PIY0_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4PIY0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P38 GN=argJ PE=3 SV=1
 2938 : T4PL38_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4PL38     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P42 GN=argJ PE=3 SV=1
 2939 : T4PY86_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4PY86     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P36 GN=argJ PE=3 SV=1
 2940 : T4QJT5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4QJT5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P46 GN=argJ PE=3 SV=1
 2941 : T4QUV2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4QUV2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P48 GN=argJ PE=3 SV=1
 2942 : T4R9F1_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4R9F1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P49 GN=argJ PE=3 SV=1
 2943 : T4REW0_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4REW0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P50 GN=argJ PE=3 SV=1
 2944 : T4RYL8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4RYL8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P51 GN=argJ PE=3 SV=1
 2945 : T4S8X7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4S8X7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P61 GN=argJ PE=3 SV=1
 2946 : T4SI04_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4SI04     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P59 GN=argJ PE=3 SV=1
 2947 : T4SR18_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4SR18     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P78 GN=argJ PE=3 SV=1
 2948 : T4T5Y6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4T5Y6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P69 GN=argJ PE=3 SV=1
 2949 : T4TJY6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4TJY6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P70 GN=argJ PE=3 SV=1
 2950 : T4TQU5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4TQU5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P72 GN=argJ PE=3 SV=1
 2951 : T4U137_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4U137     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P71 GN=argJ PE=3 SV=1
 2952 : T4UHF5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4UHF5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P73 GN=argJ PE=3 SV=1
 2953 : T4USJ9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4USJ9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P74 GN=argJ PE=3 SV=1
 2954 : T4VZ71_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4VZ71     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P77 GN=argJ PE=3 SV=1
 2955 : T4WAU8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4WAU8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F480 GN=argJ PE=3 SV=1
 2956 : T4WJY9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4WJY9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F525 GN=argJ PE=3 SV=1
 2957 : T4WW80_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4WW80     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F200 GN=argJ PE=3 SV=1
 2958 : T4X539_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4X539     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F548 GN=argJ PE=3 SV=1
 2959 : T4XK72_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4XK72     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F601 GN=argJ PE=3 SV=1
 2960 : T4XLV3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4XLV3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD90 GN=argJ PE=3 SV=1
 2961 : T4Y836_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4Y836     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD92 GN=argJ PE=3 SV=1
 2962 : T4YAM8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4YAM8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD111 GN=argJ PE=3 SV=1
 2963 : T4YBH5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4YBH5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD113 GN=argJ PE=3 SV=1
 2964 : T4ZE98_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4ZE98     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P30 GN=argJ PE=3 SV=1
 2965 : T4ZNW8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T4ZNW8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD127 GN=argJ PE=3 SV=1
 2966 : T5AXS4_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T5AXS4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD88 GN=argJ PE=3 SV=1
 2967 : T5B1G7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  T5B1G7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD86 GN=argJ PE=3 SV=1
 2968 : T5JV41_LACPN        0.41  0.64    1  191    2  188  191    1    4  402  T5JV41     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum EGD-AQ4 GN=argJ PE=3 SV=1
 2969 : U2IAP1_LACPN        0.41  0.64    1  191    2  188  191    1    4  402  U2IAP1     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum 2165 GN=argJ PE=3 SV=1
 2970 : U2WJ57_LACPN        0.41  0.63    1  191    2  188  191    1    4  402  U2WJ57     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum AY01 GN=argJ PE=3 SV=1
 2971 : U2ZSQ2_9SPHN        0.41  0.64  193  405  193  406  218    5    9  408  U2ZSQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Novosphingobium tardaugens NBRC 16725 GN=argJ PE=3 SV=1
 2972 : U3UDV0_CLODI        0.41  0.60    7  191    2  187  191    5   11  405  U3UDV0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T5 GN=argJ PE=3 SV=1
 2973 : U3UQ04_CLODI        0.41  0.60    7  191    2  187  191    5   11  405  U3UQ04     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T20 GN=argJ PE=3 SV=1
 2974 : U3UWE0_CLODI        0.41  0.60    7  191    2  187  191    5   11  405  U3UWE0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E1 GN=argJ PE=3 SV=1
 2975 : U3V7V8_CLODI        0.41  0.60    7  191    2  187  191    5   11  405  U3V7V8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E10 GN=argJ PE=3 SV=1
 2976 : U3VKV3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U3VKV3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E13 GN=argJ PE=3 SV=1
 2977 : U3W392_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U3W392     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile CD002 GN=argJ PE=3 SV=1
 2978 : U3WD17_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U3WD17     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E16 GN=argJ PE=3 SV=1
 2979 : U3WJT9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U3WJT9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T22 GN=argJ PE=3 SV=1
 2980 : U3WWC2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U3WWC2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E25 GN=argJ PE=3 SV=1
 2981 : U3X785_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U3X785     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T15 GN=argJ PE=3 SV=1
 2982 : U3YNC2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U3YNC2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E24 GN=argJ PE=3 SV=1
 2983 : U3Z6T6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U3Z6T6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T42 GN=argJ PE=3 SV=1
 2984 : U3ZC83_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U3ZC83     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T6 GN=argJ PE=3 SV=1
 2985 : U3ZRA9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U3ZRA9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E14 GN=argJ PE=3 SV=1
 2986 : U4A4Z2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4A4Z2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T17 GN=argJ PE=3 SV=1
 2987 : U4AFH6_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4AFH6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E9 GN=argJ PE=3 SV=1
 2988 : U4ARY8_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4ARY8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E7 GN=argJ PE=3 SV=1
 2989 : U4B6R0_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4B6R0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T3 GN=argJ PE=3 SV=1
 2990 : U4BAY7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4BAY7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E28 GN=argJ PE=3 SV=1
 2991 : U4BT32_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4BT32     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E23 GN=argJ PE=3 SV=1
 2992 : U4BTC2_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4BTC2     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile E12 GN=argJ PE=3 SV=1
 2993 : U4C7Q9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4C7Q9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T19 GN=argJ PE=3 SV=1
 2994 : U4CH91_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4CH91     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T10 GN=argJ PE=3 SV=1
 2995 : U4CPV7_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4CPV7     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T14 GN=argJ PE=3 SV=1
 2996 : U4DBJ9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4DBJ9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile T61 GN=argJ PE=3 SV=1
 2997 : U4X5X5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4X5X5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P33 GN=argJ PE=3 SV=1
 2998 : U4XFI4_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4XFI4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P41 GN=argJ PE=3 SV=1
 2999 : U4XQF3_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4XQF3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile DA00130 GN=argJ PE=3 SV=1
 3000 : U4Y7W4_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4Y7W4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P37 GN=argJ PE=3 SV=1
 3001 : U4YFM4_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4YFM4     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P64 GN=argJ PE=3 SV=1
 3002 : U4YR44_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4YR44     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P68 GN=argJ PE=3 SV=1
 3003 : U4Z0F9_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4Z0F9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile F665 GN=argJ PE=3 SV=1
 3004 : U4Z2A5_CLODI        0.41  0.61    7  191    2  187  191    5   11  405  U4Z2A5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium difficile P53 GN=argJ PE=3 SV=1
 3005 : U5RSZ9_9CLOT        0.41  0.60    9  191    6  188  188    4   10  406  U5RSZ9     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium autoethanogenum DSM 10061 GN=argJ PE=3 SV=1
 3006 : U6Z4U1_LACPN        0.41  0.64    1  191    2  188  191    1    4  402  U6Z4U1     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum WJL GN=argJ PE=3 SV=1
 3007 : U7FPF4_9RHOB        0.41  0.62  193  405  195  411  221    6   12  413  U7FPF4     Arginine biosynthesis bifunctional protein ArgJ OS=Labrenzia sp. C1B10 GN=argJ PE=3 SV=1
 3008 : U7HI29_9RHOB        0.41  0.62  193  405  195  411  221    6   12  413  U7HI29     Arginine biosynthesis bifunctional protein ArgJ OS=Labrenzia sp. C1B70 GN=argJ PE=3 SV=1
 3009 : U9W147_9CYAN        0.41  0.57  193  405  195  447  255    5   44  449  U9W147     Arginine biosynthesis bifunctional protein ArgJ OS=Leptolyngbya sp. Heron Island J GN=argJ PE=3 SV=1
 3010 : V4JFU3_9GAMM        0.41  0.64  193  405  182  395  216    5    5  397  V4JFU3     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured Thiohalocapsa sp. PB-PSB1 GN=argJ PE=3 SV=1
 3011 : V7HS96_9RHIZ        0.41  0.61  193  405  195  411  221    6   12  413  V7HS96     Arginine biosynthesis bifunctional protein ArgJ OS=Mesorhizobium sp. L103C120A0 GN=argJ PE=3 SV=1
 3012 : V7Z414_LACPN        0.41  0.64    1  191    2  188  191    1    4  322  V7Z414     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum 2025 GN=argJ PE=3 SV=1
 3013 : V8C0Q1_RUMGN        0.41  0.61    7  190    2  188  189    4    7  407  V8C0Q1     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus gnavus CC55_001C GN=argJ PE=3 SV=1
 3014 : V8RIC1_LACPN        0.41  0.64    1  191    2  188  191    1    4  402  V8RIC1     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus plantarum 4_3 GN=argJ PE=3 SV=1
 3015 : V9WJK0_9RHOB        0.41  0.67  193  405  200  407  215    5    9  409  V9WJK0     Arginine biosynthesis bifunctional protein ArgJ OS=Phaeobacter gallaeciensis DSM 26640 GN=argJ PE=3 SV=1
 3016 : W6IF85_9PROT        0.41  0.62  193  405  194  407  218    5    9  409  W6IF85     Glutamate N-acetyltransferase OS=Granulibacter bethesdensis CGDNIH2 GN=GbCGDNIH2_0624 PE=4 SV=1
 3017 : A0L7G4_MAGSM        0.40  0.67  193  405  208  421  215    3    3  423  A0L7G4     Arginine biosynthesis bifunctional protein ArgJ OS=Magnetococcus sp. (strain MC-1) GN=argJ PE=3 SV=1
 3018 : A2BZG8_PROM1        0.40  0.63  193  405  204  418  222    3   16  420  A2BZG8     Arginine biosynthesis bifunctional protein ArgJ OS=Prochlorococcus marinus (strain NATL1A) GN=argJ PE=3 SV=1
 3019 : A3M2L2_ACIBT        0.40  0.65  193  405  190  404  218    6    8  406  A3M2L2     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii (strain ATCC 17978 / NCDC KC 755) GN=argJ PE=3 SV=2
 3020 : A5G0Q7_ACICJ        0.40  0.61  193  405  196  407  217    5    9  409  A5G0Q7     Arginine biosynthesis bifunctional protein ArgJ OS=Acidiphilium cryptum (strain JF-5) GN=argJ PE=3 SV=1
 3021 : A5UK56_METS3        0.40  0.62  193  405  186  404  224    6   16  406  A5UK56     Arginine biosynthesis bifunctional protein ArgJ OS=Methanobrevibacter smithii (strain PS / ATCC 35061 / DSM 861) GN=argJ PE=3 SV=1
 3022 : A5V0K0_ROSS1        0.40  0.62  193  405  187  405  226    6   20  407  A5V0K0     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Roseiflexus sp. (strain RS-1) GN=argJ PE=3 SV=1
 3023 : A5WEW3_PSYWF        0.40  0.66  193  405  197  411  216    4    4  413  A5WEW3     Arginine biosynthesis bifunctional protein ArgJ OS=Psychrobacter sp. (strain PRwf-1) GN=argJ PE=3 SV=1
 3024 : A7I1F5_CAMHC        0.40  0.61  193  405  186  391  216    4   13  393  A7I1F5     Arginine biosynthesis bifunctional protein ArgJ OS=Campylobacter hominis (strain ATCC BAA-381 / LMG 19568 / NCTC 13146 / CH001A) GN=argJ PE=3 SV=1
 3025 : A7III3_XANP2        0.40  0.60  193  405  195  411  221    6   12  413  A7III3     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2) GN=argJ PE=3 SV=1
 3026 : A7NPA9_ROSCS        0.40  0.60  193  405  187  405  226    6   20  407  A7NPA9     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Roseiflexus castenholzii (strain DSM 13941 / HLO8) GN=argJ PE=3 SV=1
 3027 : A9QP46_9BACT        0.40  0.65  193  405  201  414  218    5    9  416  A9QP46     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured marine bacterium EB000_55B11 GN=argJ PE=3 SV=1
 3028 : ARGJ_NITWN          0.40  0.59  193  405  199  415  221    6   12  417  Q3SVN6     Arginine biosynthesis bifunctional protein ArgJ OS=Nitrobacter winogradskyi (strain Nb-255 / ATCC 25391) GN=argJ PE=3 SV=1
 3029 : ARGJ_RHOPA          0.40  0.59  193  405  195  411  222    7   14  413  P62064     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009) GN=argJ PE=3 SV=1
 3030 : ARGJ_WOLSU          0.40  0.62  193  405  188  394  216    4   12  396  Q7MAC9     Arginine biosynthesis bifunctional protein ArgJ OS=Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / LMG 7466 / NCTC 11488 / FDC 602W) GN=argJ PE=3 SV=1
 3031 : B0U0M4_FRAP2        0.40  0.59  193  405  184  394  222    7   20  396  B0U0M4     Arginine biosynthesis bifunctional protein ArgJ OS=Francisella philomiragia subsp. philomiragia (strain ATCC 25017) GN=argJ PE=3 SV=1
 3032 : B0V7S0_ACIBY        0.40  0.65  193  405  190  404  218    6    8  406  B0V7S0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii (strain AYE) GN=argJ PE=3 SV=1
 3033 : B0VUP2_ACIBS        0.40  0.65  193  405  190  404  218    6    8  406  B0VUP2     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii (strain SDF) GN=argJ PE=3 SV=1
 3034 : B2IGW5_BEII9        0.40  0.61  193  405  195  411  221    6   12  413  B2IGW5     Arginine biosynthesis bifunctional protein ArgJ OS=Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIB 8712) GN=argJ PE=3 SV=1
 3035 : B6B6Q6_9RHOB        0.40  0.64  193  405  199  406  217    5   13  408  B6B6Q6     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodobacterales bacterium Y4I GN=argJ PE=3 SV=1
 3036 : B6JAC5_OLICO        0.40  0.59  193  405  201  415  220    7   12  417  B6JAC5     Arginine biosynthesis bifunctional protein ArgJ OS=Oligotropha carboxidovorans (strain ATCC 49405 / DSM 1227 / OM5) GN=argJ PE=3 SV=1
 3037 : B7GZG0_ACIB3        0.40  0.65  193  405  190  404  218    6    8  406  B7GZG0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii (strain AB307-0294) GN=argJ PE=3 SV=1
 3038 : B7I6E9_ACIB5        0.40  0.65  193  405  190  404  218    6    8  406  B7I6E9     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii (strain AB0057) GN=argJ PE=3 SV=1
 3039 : B7QUK0_9RHOB        0.40  0.64  193  405  201  408  217    5   13  410  B7QUK0     Arginine biosynthesis bifunctional protein ArgJ OS=Ruegeria sp. R11 GN=argJ PE=3 SV=1
 3040 : B9AH52_METSM        0.40  0.62  193  405  186  404  224    6   16  406  B9AH52     Arginine biosynthesis bifunctional protein ArgJ OS=Methanobrevibacter smithii DSM 2375 GN=argJ PE=3 SV=1
 3041 : B9NZB8_PROMR        0.40  0.58  193  405  196  410  224    3   20  412  B9NZB8     Arginine biosynthesis bifunctional protein ArgJ OS=Prochlorococcus marinus str. MIT 9202 GN=argJ PE=3 SV=1
 3042 : C0D5U1_9CLOT        0.40  0.59    9  190   10  194  189    5   11  413  C0D5U1     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium asparagiforme DSM 15981 GN=argJ PE=3 SV=1
 3043 : C0FYU9_9FIRM        0.40  0.59    7  190    2  188  196    7   21  407  C0FYU9     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia inulinivorans DSM 16841 GN=argJ PE=3 SV=1
 3044 : C0QYU8_BRAHW        0.40  0.60    7  191    5  191  189    4    6  409  C0QYU8     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira hyodysenteriae (strain ATCC 49526 / WA1) GN=argJ PE=3 SV=1
 3045 : C0WS42_LACBU        0.40  0.61    1  191    2  188  193    3    8  402  C0WS42     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus buchneri ATCC 11577 GN=argJ PE=3 SV=1
 3046 : C0XHE8_LACHI        0.40  0.61    1  191    2  188  193    3    8  402  C0XHE8     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus hilgardii ATCC 8290 GN=argJ PE=3 SV=1
 3047 : C1CUN5_DEIDV        0.40  0.60  193  405  180  383  222    6   27  385  C1CUN5     Arginine biosynthesis bifunctional protein ArgJ OS=Deinococcus deserti (strain VCD115 / DSM 17065 / LMG 22923) GN=argJ PE=3 SV=1
 3048 : C2D3D1_LACBR        0.40  0.61    1  191    2  188  193    3    8  402  C2D3D1     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus brevis subsp. gravesensis ATCC 27305 GN=argJ PE=3 SV=1
 3049 : C3XM36_9HELI        0.40  0.62  193  405  188  394  216    5   12  396  C3XM36     Arginine biosynthesis bifunctional protein ArgJ OS=Helicobacter winghamensis ATCC BAA-430 GN=argJ PE=3 SV=1
 3050 : C6ABL1_BARGA        0.40  0.64  193  405  195  408  215    3    3  410  C6ABL1     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella grahamii (strain as4aup) GN=argJ PE=3 SV=1
 3051 : C6HZ52_9BACT        0.40  0.62  193  405  189  401  216    4    6  405  C6HZ52     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospirillum ferrodiazotrophum GN=argJ PE=3 SV=1
 3052 : C6NSS8_9GAMM        0.40  0.66  193  405  191  405  216    4    4  407  C6NSS8     Arginine biosynthesis bifunctional protein ArgJ OS=Acidithiobacillus caldus ATCC 51756 GN=argJ PE=3 SV=1
 3053 : C6XHQ6_LIBAP        0.40  0.61  193  404  198  413  217    5    6  416  C6XHQ6     Arginine biosynthesis bifunctional protein ArgJ OS=Liberibacter asiaticus (strain psy62) GN=argJ PE=3 SV=1
 3054 : C6YST3_9GAMM        0.40  0.59  193  405  184  394  222    7   20  396  C6YST3     Arginine biosynthesis bifunctional protein ArgJ OS=Francisella philomiragia subsp. philomiragia ATCC 25015 GN=argJ PE=3 SV=1
 3055 : D0C9A2_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  D0C9A2     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ATCC 19606 = CIP 70.34 GN=argJ PE=3 SV=1
 3056 : D0SZ81_ACILW        0.40  0.65  193  405  190  404  218    6    8  406  D0SZ81     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter lwoffii SH145 GN=argJ PE=3 SV=1
 3057 : D1JBH9_9ARCH        0.40  0.59  193  403  185  392  218    8   17  395  D1JBH9     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured archaeon GN=argJ PE=3 SV=1
 3058 : D3QAF1_STANL        0.40  0.61   12  191    2  177  183    4   10  382  D3QAF1     Arginine biosynthesis bifunctional protein ArgJ OS=Stackebrandtia nassauensis (strain DSM 44728 / NRRL B-16338 / NBRC 102104 / LLR-40K-21) GN=argJ PE=3 SV=1
 3059 : D3RVI6_ALLVD        0.40  0.62  193  405  189  403  216    4    4  405  D3RVI6     Arginine biosynthesis bifunctional protein ArgJ OS=Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / D) GN=argJ PE=3 SV=1
 3060 : D5RI29_9PROT        0.40  0.62  193  405  196  409  218    5    9  411  D5RI29     Arginine biosynthesis bifunctional protein ArgJ OS=Roseomonas cervicalis ATCC 49957 GN=argJ PE=3 SV=1
 3061 : D5U6S5_BRAM5        0.40  0.58   11  191    9  191  187    5   10  410  D5U6S5     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira murdochii (strain ATCC 51284 / DSM 12563 / 56-150) GN=argJ PE=3 SV=1
 3062 : D5WRZ0_KYRT2        0.40  0.64   16  191   22  200  183    4   11  414  D5WRZ0     Arginine biosynthesis bifunctional protein ArgJ OS=Kyrpidia tusciae (strain DSM 2912 / NBRC 15312 / T2) GN=argJ PE=3 SV=1
 3063 : D6JSK8_ACIPI        0.40  0.66  193  405  190  404  216    4    4  406  D6JSK8     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. SH024 GN=argJ PE=3 SV=1
 3064 : D8PGS5_9BACT        0.40  0.63    7  191    2  188  190    4    8  403  D8PGS5     Arginine biosynthesis bifunctional protein ArgJ OS=Candidatus Nitrospira defluvii GN=argJ PE=3 SV=1
 3065 : E0UPN4_SULAO        0.40  0.59  193  405  184  390  219    7   18  392  E0UPN4     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfurimonas autotrophica (strain ATCC BAA-671 / DSM 16294 / JCM 11897 / OK10) GN=argJ PE=3 SV=1
 3066 : E0XX72_9PROT        0.40  0.65  193  405  193  406  217    4    7  408  E0XX72     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured alpha proteobacterium HF0070_05I22 GN=argJ PE=3 SV=1
 3067 : E3I5R1_RHOVT        0.40  0.61  193  405  197  414  222    7   13  416  E3I5R1     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodomicrobium vannielii (strain ATCC 17100 / ATH 3.1.1 / DSM 162 / LMG 4299) GN=argJ PE=3 SV=1
 3068 : F0QDQ1_ACIBD        0.40  0.65  193  405  190  404  218    6    8  406  F0QDQ1     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii (strain TCDC-AB0715) GN=argJ PE=3 SV=1
 3069 : F4GLD9_SPICD        0.40  0.58    7  191    2  211  212    6   29  428  F4GLD9     Arginine biosynthesis bifunctional protein ArgJ OS=Spirochaeta coccoides (strain ATCC BAA-1237 / DSM 17374 / SPN1) GN=argJ PE=3 SV=1
 3070 : F4LKD7_TREBD        0.40  0.61    7  191    2  187  191    5   11  405  F4LKD7     Arginine biosynthesis bifunctional protein ArgJ OS=Treponema brennaborense (strain DSM 12168 / CIP 105900 / DD5/3) GN=argJ PE=3 SV=1
 3071 : F4QW47_BREDI        0.40  0.63  193  405  189  402  215    3    3  404  F4QW47     Arginine biosynthesis bifunctional protein ArgJ OS=Brevundimonas diminuta ATCC 11568 GN=argJ PE=3 SV=1
 3072 : F5I916_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  F5I916     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii 6013113 GN=argJ PE=3 SV=1
 3073 : F5IQF8_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  F5IQF8     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii 6014059 GN=argJ PE=3 SV=1
 3074 : F5S8Q7_9NEIS        0.40  0.63  193  405  209  422  215    3    3  424  F5S8Q7     Arginine biosynthesis bifunctional protein ArgJ OS=Kingella kingae ATCC 23330 GN=argJ PE=3 SV=1
 3075 : F7NF53_9FIRM        0.40  0.60  193  405  187  399  217    4    8  401  F7NF53     Arginine biosynthesis bifunctional protein ArgJ OS=Acetonema longum DSM 6540 GN=argJ PE=3 SV=1
 3076 : F7QGI7_9BRAD        0.40  0.60  193  405  216  432  222    7   14  434  F7QGI7     Arginine biosynthesis bifunctional protein ArgJ OS=Bradyrhizobiaceae bacterium SG-6C GN=argJ PE=3 SV=1
 3077 : F8ACE5_THEID        0.40  0.60  193  405  180  388  219    6   16  390  F8ACE5     Arginine biosynthesis bifunctional protein ArgJ OS=Thermodesulfatator indicus (strain DSM 15286 / JCM 11887 / CIR29812) GN=argJ PE=3 SV=1
 3078 : F9IBU5_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  F9IBU5     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ABNIH1 GN=argJ PE=3 SV=1
 3079 : F9IGE1_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  F9IGE1     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ABNIH2 GN=argJ PE=3 SV=1
 3080 : F9JC17_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  F9JC17     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ABNIH4 GN=argJ PE=3 SV=1
 3081 : G6XFV2_9PROT        0.40  0.64  193  405  196  409  219    7   11  411  G6XFV2     Arginine biosynthesis bifunctional protein ArgJ OS=Gluconobacter morbifer G707 GN=argJ PE=3 SV=1
 3082 : G8QXM1_SPHPG        0.40  0.62    9  191    4  190  188    4    6  408  G8QXM1     Arginine biosynthesis bifunctional protein ArgJ OS=Sphaerochaeta pleomorpha (strain ATCC BAA-1885 / DSM 22778 / Grapes) GN=argJ PE=3 SV=1
 3083 : H0RSG9_9BRAD        0.40  0.60  193  405  195  411  221    6   12  413  H0RSG9     Arginine biosynthesis bifunctional protein ArgJ OS=Bradyrhizobium sp. ORS 285 GN=argJ PE=3 SV=1
 3084 : H1L1S8_9EURY        0.40  0.60  193  405  185  400  225    7   21  402  H1L1S8     Arginine biosynthesis bifunctional protein ArgJ OS=Methanotorris formicicus Mc-S-70 GN=argJ PE=3 SV=1
 3085 : H1LEC7_9LACO        0.40  0.62    1  191    2  188  194    5   10  402  H1LEC7     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus kisonensis F0435 GN=argJ PE=3 SV=1
 3086 : H6SNW5_RHOPH        0.40  0.66  193  405  203  416  215    3    3  418  H6SNW5     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodospirillum photometricum DSM 122 GN=argJ PE=3 SV=1
 3087 : H8FTU3_PHAMO        0.40  0.62  193  405  194  407  218    5    9  409  H8FTU3     Arginine biosynthesis bifunctional protein ArgJ OS=Phaeospirillum molischianum DSM 120 GN=argJ PE=3 SV=1
 3088 : I0GSI1_SELRL        0.40  0.65  193  405  190  401  215    3    5  403  I0GSI1     Arginine biosynthesis bifunctional protein ArgJ OS=Selenomonas ruminantium subsp. lactilytica (strain NBRC 103574 / TAM6421) GN=argJ PE=3 SV=1
 3089 : I0JVE4_9BACT        0.40  0.63    1  191    2  192  192    2    2  404  I0JVE4     Arginine biosynthesis bifunctional protein ArgJ OS=Methylacidiphilum fumariolicum SolV GN=argJ PE=3 SV=1
 3090 : I0JVE4_9BACT        0.40  0.62  193  402  193  401  217    5   15  404  I0JVE4     Arginine biosynthesis bifunctional protein ArgJ OS=Methylacidiphilum fumariolicum SolV GN=argJ PE=3 SV=1
 3091 : I1Y460_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  I1Y460     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii MDR-TJ GN=argJ PE=3 SV=1
 3092 : I3BX26_9GAMM        0.40  0.63  193  405  190  400  221    8   18  402  I3BX26     Arginine biosynthesis bifunctional protein ArgJ OS=Thiothrix nivea DSM 5205 GN=argJ PE=3 SV=1
 3093 : I5C297_9BACT        0.40  0.62  193  405   97  313  219    4    8  315  I5C297     Arginine biosynthesis bifunctional protein ArgJ OS=Nitritalea halalkaliphila LW7 GN=argJ PE=3 SV=1
 3094 : I7A2K2_MELRP        0.40  0.59  193  405  198  406  222    7   22  408  I7A2K2     Arginine biosynthesis bifunctional protein ArgJ OS=Melioribacter roseus (strain JCM 17771 / P3M-2) GN=argJ PE=3 SV=1
 3095 : I7ERE3_PHAG2        0.40  0.66  193  405  200  407  215    5    9  409  I7ERE3     Arginine biosynthesis bifunctional protein ArgJ OS=Phaeobacter gallaeciensis (strain 2.10) GN=argJ PE=3 SV=1
 3096 : I9LAJ9_9RHIZ        0.40  0.64  193  405  201  414  220    7   13  416  I9LAJ9     Arginine biosynthesis bifunctional protein ArgJ OS=Methylobacterium sp. GXF4 GN=argJ PE=3 SV=1
 3097 : J0SEP4_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  J0SEP4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii OIFC137 GN=argJ PE=3 SV=1
 3098 : J0SRE2_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  J0SRE2     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii OIFC189 GN=argJ PE=3 SV=1
 3099 : J0ZX15_9RHIZ        0.40  0.62  193  405  192  407  217    4    5  409  J0ZX15     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella tamiae Th307 GN=argJ PE=3 SV=1
 3100 : J1FCC1_9HELI        0.40  0.59  193  405  186  392  219    6   18  394  J1FCC1     Arginine biosynthesis bifunctional protein ArgJ OS=Thiovulum sp. ES GN=argJ PE=3 SV=1
 3101 : J1MWR6_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  J1MWR6     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii Naval-17 GN=argJ PE=3 SV=1
 3102 : J3J080_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  J3J080     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii AC12 GN=argJ PE=3 SV=1
 3103 : J4KK49_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  J4KK49     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii Naval-18 GN=argJ PE=3 SV=1
 3104 : J4V6Y2_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  J4V6Y2     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii OIFC032 GN=argJ PE=3 SV=1
 3105 : J5AH37_ACIBA        0.40  0.67  193  405  116  330  216    4    4  332  J5AH37     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii IS-123 GN=argJ PE=3 SV=1
 3106 : J6UCD9_9RHOB        0.40  0.62  193  405  194  410  221    6   12  412  J6UCD9     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodovulum sp. PH10 GN=argJ PE=3 SV=1
 3107 : J9DEY9_9PROT        0.40  0.61  193  405  211  426  220    6   11  428  J9DEY9     Arginine biosynthesis bifunctional protein ArgJ OS=alpha proteobacterium IMCC14465 GN=argJ PE=3 SV=1
 3108 : K0HBB8_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K0HBB8     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii TYTH-1 GN=argJ PE=3 SV=1
 3109 : K1EP81_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K1EP81     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii IS-143 GN=argJ PE=3 SV=1
 3110 : K1F7I1_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K1F7I1     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii IS-58 GN=argJ PE=3 SV=1
 3111 : K1KW93_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K1KW93     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii Ab44444 GN=argJ PE=3 SV=1
 3112 : K2FPE7_9BACT        0.40  0.65  193  405  190  404  218    6    8  406  K2FPE7     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured bacterium GN=argJ PE=3 SV=1
 3113 : K2ISC4_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K2ISC4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ZWS1219 GN=argJ PE=3 SV=1
 3114 : K5E117_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  K5E117     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii Naval-72 GN=argJ PE=3 SV=1
 3115 : K5ELZ9_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K5ELZ9     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii IS-251 GN=argJ PE=3 SV=1
 3116 : K5EYZ3_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  K5EYZ3     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii OIFC0162 GN=argJ PE=3 SV=1
 3117 : K5R946_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  K5R946     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii OIFC110 GN=argJ PE=3 SV=1
 3118 : K5RLB7_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K5RLB7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii Naval-83 GN=argJ PE=3 SV=1
 3119 : K6GXL7_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K6GXL7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii AC30 GN=argJ PE=3 SV=1
 3120 : K6LEC1_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K6LEC1     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii OIFC099 GN=argJ PE=3 SV=1
 3121 : K6MSB0_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K6MSB0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii Naval-21 GN=argJ PE=3 SV=1
 3122 : K6N3G5_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K6N3G5     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii Naval-82 GN=argJ PE=3 SV=1
 3123 : K6NGN7_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  K6NGN7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii WC-A-694 GN=argJ PE=3 SV=1
 3124 : K6NPX9_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K6NPX9     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii OIFC035 GN=argJ PE=3 SV=1
 3125 : K8NQD5_AFIFE        0.40  0.60  193  405  195  409  220    7   12  411  K8NQD5     Arginine biosynthesis bifunctional protein ArgJ OS=Afipia felis ATCC 53690 GN=argJ PE=3 SV=1
 3126 : K9BIU9_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  K9BIU9     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii WC-348 GN=argJ PE=3 SV=1
 3127 : K9BYL7_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  K9BYL7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii Naval-113 GN=argJ PE=3 SV=1
 3128 : K9QCN0_9NOSO        0.40  0.60  193  405  191  435  245    3   32  437  K9QCN0     Arginine biosynthesis bifunctional protein ArgJ OS=Nostoc sp. PCC 7107 GN=argJ PE=3 SV=1
 3129 : L0DZ44_THIND        0.40  0.61  193  405  190  401  215    4    5  403  L0DZ44     Arginine biosynthesis bifunctional protein ArgJ OS=Thioalkalivibrio nitratireducens (strain DSM 14787 / UNIQEM 213 / ALEN2) GN=argJ [H] PE=3 SV=1
 3130 : L0H2N3_9GAMM        0.40  0.62  193  405  187  401  216    4    4  403  L0H2N3     Arginine biosynthesis bifunctional protein ArgJ OS=Thioflavicoccus mobilis 8321 GN=argJ PE=3 SV=1
 3131 : L9MJZ8_9GAMM        0.40  0.63  193  405  190  404  217    6    6  406  L9MJZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. WC-743 GN=argJ PE=3 SV=1
 3132 : L9MS02_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  L9MS02     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii WC-A-92 GN=argJ PE=3 SV=1
 3133 : L9N8J9_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  L9N8J9     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii Naval-78 GN=argJ PE=3 SV=1
 3134 : L9NLP2_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  L9NLP2     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii OIFC047 GN=argJ PE=3 SV=1
 3135 : M4Q4W1_LIBAS        0.40  0.61  193  404  198  413  217    5    6  416  M4Q4W1     Arginine biosynthesis bifunctional protein ArgJ OS=Candidatus Liberibacter asiaticus str. gxpsy GN=argJ PE=3 SV=1
 3136 : M4R887_PASTR        0.40  0.63   11  191    8  188  185    6    8  406  M4R887     Arginine biosynthesis bifunctional protein ArgJ OS=Bibersteinia trehalosi USDA-ARS-USMARC-192 GN=argJ PE=3 SV=1
 3137 : M4S5G1_9SPHN        0.40  0.63  193  405  207  420  218    5    9  422  M4S5G1     Arginine biosynthesis bifunctional protein ArgJ OS=Sphingomonas sp. MM-1 GN=argJ PE=3 SV=1
 3138 : M5FH25_9RHIZ        0.40  0.60  193  405  195  411  221    6   12  413  M5FH25     Arginine biosynthesis bifunctional protein ArgJ OS=Mesorhizobium sp. STM 4661 GN=argJ PE=3 SV=1
 3139 : M8EUG8_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  M8EUG8     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ABNIH26 GN=argJ PE=3 SV=1
 3140 : M8FTN6_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  M8FTN6     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ABNIH11 GN=argJ PE=3 SV=1
 3141 : M8GYD0_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  M8GYD0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ABNIH16 GN=argJ PE=3 SV=1
 3142 : M8H5H8_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  M8H5H8     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ABNIH14 GN=argJ PE=3 SV=1
 3143 : M8JNB5_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  M8JNB5     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ABNIH23 GN=argJ PE=3 SV=1
 3144 : M8K3L4_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  M8K3L4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ABNIH24 GN=argJ PE=3 SV=1
 3145 : N8ND54_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  N8ND54     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii NIPH 24 GN=argJ PE=3 SV=1
 3146 : N8Q7X5_9GAMM        0.40  0.65  193  405  190  404  218    6    8  406  N8Q7X5     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. CIP A162 GN=argJ PE=3 SV=1
 3147 : N8QID7_ACIJO        0.40  0.65  193  405  190  404  217    6    6  406  N8QID7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter johnsonii CIP 64.6 GN=argJ PE=3 SV=1
 3148 : N8SRQ1_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  N8SRQ1     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii NIPH 1669 GN=argJ PE=3 SV=1
 3149 : N8U7C4_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  N8U7C4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii NIPH 146 GN=argJ PE=3 SV=1
 3150 : N8UDZ0_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  N8UDZ0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii NIPH 615 GN=argJ PE=3 SV=1
 3151 : N8YB31_ACIGI        0.40  0.65  193  405  190  404  217    6    6  406  N8YB31     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter guillouiae NIPH 991 GN=argJ PE=3 SV=1
 3152 : N8ZD48_9GAMM        0.40  0.66  193  405  190  404  216    4    4  406  N8ZD48     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter brisouii ANC 4119 GN=argJ PE=3 SV=1
 3153 : N9HNB6_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  N9HNB6     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii NIPH 67 GN=argJ PE=3 SV=1
 3154 : N9IFI5_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  N9IFI5     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii NIPH 329 GN=argJ PE=3 SV=1
 3155 : N9IND0_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  N9IND0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii NIPH 290 GN=argJ PE=3 SV=1
 3156 : N9JSW6_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  N9JSW6     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii NIPH 70 GN=argJ PE=3 SV=1
 3157 : N9KM95_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  N9KM95     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii NIPH 80 GN=argJ PE=3 SV=1
 3158 : N9KY11_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  N9KY11     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii ANC 4097 GN=argJ PE=3 SV=1
 3159 : N9NCF3_9GAMM        0.40  0.65  193  405  190  404  218    6    8  406  N9NCF3     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. CIP 102136 GN=argJ PE=3 SV=1
 3160 : N9P9R4_9GAMM        0.40  0.65  193  405  190  404  218    6    8  406  N9P9R4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. CIP 51.11 GN=argJ PE=3 SV=1
 3161 : Q13EY8_RHOPS        0.40  0.60  193  405  195  411  221    6   12  413  Q13EY8     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodopseudomonas palustris (strain BisB5) GN=argJ PE=3 SV=1
 3162 : Q1QVH7_CHRSD        0.40  0.66  193  405  190  400  215    5    6  402  Q1QVH7     Arginine biosynthesis bifunctional protein ArgJ OS=Chromohalobacter salexigens (strain DSM 3043 / ATCC BAA-138 / NCIMB 13768) GN=argJ PE=3 SV=1
 3163 : Q21MG0_SACD2        0.40  0.66  193  405  190  404  218    5    8  406  Q21MG0     Arginine biosynthesis bifunctional protein ArgJ OS=Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024) GN=argJ PE=3 SV=1
 3164 : R5ULB0_9FIRM        0.40  0.61    7  191    6  192  188    4    4  410  R5ULB0     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:18 GN=argJ PE=3 SV=1
 3165 : R6NNH3_9FIRM        0.40  0.60    7  190    2  188  188    4    5  407  R6NNH3     Arginine biosynthesis bifunctional protein ArgJ OS=Roseburia sp. CAG:45 GN=argJ PE=3 SV=1
 3166 : R6PT05_9CLOT        0.40  0.58    7  190    2  188  188    4    5  407  R6PT05     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium nexile CAG:348 GN=argJ PE=3 SV=1
 3167 : R6SXZ0_9CLOT        0.40  0.61    7  191    2  185  187    5    5  403  R6SXZ0     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:448 GN=argJ PE=3 SV=1
 3168 : R7GJ04_9FIRM        0.40  0.63  193  405  187  402  218    4    7  404  R7GJ04     Arginine biosynthesis bifunctional protein ArgJ OS=Catenibacterium sp. CAG:290 GN=argJ PE=3 SV=1
 3169 : R8YD24_ACIPI        0.40  0.66  193  405  190  404  218    6    8  406  R8YD24     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter pittii ANC 4050 GN=argJ PE=3 SV=1
 3170 : S0FXB9_9DELT        0.40  0.66  193  405  181  391  219    6   14  393  S0FXB9     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfotignum phosphitoxidans DSM 13687 GN=argJ PE=3 SV=1
 3171 : S3TLQ4_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  S3TLQ4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii NIPH 410 GN=argJ PE=3 SV=1
 3172 : S3YXL1_ACIGI        0.40  0.65  193  405  190  404  217    6    6  406  S3YXL1     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter guillouiae MSP4-18 GN=argJ PE=3 SV=1
 3173 : S5CVJ4_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  S5CVJ4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii BJAB0715 GN=argJ PE=3 SV=1
 3174 : S5DBL0_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  S5DBL0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii BJAB07104 GN=argJ PE=3 SV=1
 3175 : S7V301_DESML        0.40  0.62  193  405  182  392  220    6   16  394  S7V301     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfococcus multivorans DSM 2059 GN=argJ PE=3 SV=1
 3176 : S7YMH1_ACIHA        0.40  0.67  193  405  190  404  218    6    8  406  S7YMH1     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter haemolyticus MTCC 9819 GN=argJ PE=3 SV=1
 3177 : S8EFG5_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  S8EFG5     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii 1605 GN=argJ PE=3 SV=1
 3178 : T2GIK5_METTF        0.40  0.62  193  405  186  397  221    5   17  399  T2GIK5     Arginine biosynthesis bifunctional protein ArgJ OS=Methanothermobacter thermautotrophicus CaT2 GN=argJ PE=3 SV=1
 3179 : U2KKS2_9FIRM        0.40  0.65  193  405  190  401  213    1    1  403  U2KKS2     Arginine biosynthesis bifunctional protein ArgJ OS=Selenomonas sp. oral taxon 892 str. F0426 GN=argJ PE=3 SV=1
 3180 : U2R2R5_9FIRM        0.40  0.63    5  191    1  190  192    5    7  408  U2R2R5     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillibacter sp. KLE 1728 GN=argJ PE=3 SV=1
 3181 : U2S7R2_9FIRM        0.40  0.63    5  191    1  190  192    5    7  408  U2S7R2     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillibacter sp. KLE 1745 GN=argJ PE=3 SV=1
 3182 : U3T5D3_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  U3T5D3     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii NCGM 237 GN=argJ PE=3 SV=1
 3183 : U4NH88_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  U4NH88     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii 107m GN=argJ PE=3 SV=1
 3184 : V2Q248_ACILW        0.40  0.65  193  405  190  404  218    6    8  406  V2Q248     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter lwoffii NIPH 512 GN=argJ PE=3 SV=1
 3185 : V5C0X5_9GAMM        0.40  0.65  193  405  189  402  215    3    3  404  V5C0X5     Arginine biosynthesis bifunctional protein ArgJ OS=Methyloglobulus morosus KoM1 GN=argJ PE=3 SV=1
 3186 : W0FSP2_9BACT        0.40  0.61  193  405  218  431  218    4    9  433  W0FSP2     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured bacterium Contigcl_1769 GN=argJ PE=3 SV=1
 3187 : W0QUY0_PASTR        0.40  0.63   11  191    8  188  185    6    8  406  W0QUY0     Arginine biosynthesis bifunctional protein ArgJ OS=Bibersteinia trehalosi USDA-ARS-USMARC-188 GN=argJ PE=3 SV=1
 3188 : W0R072_PASTR        0.40  0.63   11  191    8  188  185    6    8  406  W0R072     Arginine biosynthesis bifunctional protein ArgJ OS=Bibersteinia trehalosi USDA-ARS-USMARC-189 GN=argJ PE=3 SV=1
 3189 : W0R473_PASTR        0.40  0.63   11  191    8  188  185    6    8  406  W0R473     Arginine biosynthesis bifunctional protein ArgJ OS=Bibersteinia trehalosi USDA-ARS-USMARC-190 GN=argJ PE=3 SV=1
 3190 : W3AU93_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3AU93     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH0207 GN=argJ PE=3 SV=1
 3191 : W3C4Y4_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3C4Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH10107 GN=argJ PE=3 SV=1
 3192 : W3D877_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3D877     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH10007 GN=argJ PE=3 SV=1
 3193 : W3DNJ3_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3DNJ3     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH12308 GN=argJ PE=3 SV=1
 3194 : W3E6H4_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  W3E6H4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH12208 GN=argJ PE=3 SV=1
 3195 : W3EMA3_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3EMA3     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH13908 GN=argJ PE=3 SV=1
 3196 : W3EUH4_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3EUH4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH12808 GN=argJ PE=3 SV=1
 3197 : W3F8J7_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3F8J7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH15208 GN=argJ PE=3 SV=1
 3198 : W3FSA6_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3FSA6     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH16008 GN=argJ PE=3 SV=1
 3199 : W3G2N6_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3G2N6     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH18608 GN=argJ PE=3 SV=1
 3200 : W3GPG0_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  W3GPG0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH16208 GN=argJ PE=3 SV=1
 3201 : W3HDN0_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3HDN0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH20108 GN=argJ PE=3 SV=1
 3202 : W3I6A0_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  W3I6A0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH22908 GN=argJ PE=3 SV=1
 3203 : W3J5D6_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3J5D6     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH2707 GN=argJ PE=3 SV=1
 3204 : W3JEA2_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3JEA2     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH5207 GN=argJ PE=3 SV=1
 3205 : W3JPW4_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3JPW4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH5707 GN=argJ PE=3 SV=1
 3206 : W3MN86_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3MN86     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH7807 GN=argJ PE=3 SV=1
 3207 : W3N2W2_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3N2W2     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH7707 GN=argJ PE=3 SV=1
 3208 : W3PEK6_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3PEK6     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH9007 GN=argJ PE=3 SV=1
 3209 : W3PHY7_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3PHY7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii UH8807 GN=argJ PE=3 SV=1
 3210 : W3SR15_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  W3SR15     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii CI79 GN=argJ PE=3 SV=1
 3211 : W3SRU1_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W3SRU1     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii CI77 GN=argJ PE=3 SV=1
 3212 : W3T3H8_ACIBA        0.40  0.66  193  405  190  404  218    6    8  406  W3T3H8     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii CI78 GN=argJ PE=3 SV=1
 3213 : W4MYN4_ACIBA        0.40  0.65  193  405  190  404  218    6    8  406  W4MYN4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii MDR_MMC4 GN=argJ PE=3 SV=1
 3214 : W6I888_9PROT        0.40  0.61  193  405  194  407  220    7   13  409  W6I888     Glutamate N-acetyltransferase OS=Granulibacter bethesdensis CGDNIH4 GN=GbCGDNIH4_0624 PE=4 SV=1
 3215 : W6K931_9PROT        0.40  0.62  193  405  196  409  219    6   11  411  W6K931     Arginine biosynthesis bifunctional protein OS=Magnetospirillum GN=argJ PE=4 SV=1
 3216 : W6LQD2_9GAMM        0.40  0.64  193  405  182  394  218    6   10  396  W6LQD2     Bifunctional protein OS=Candidatus Contendobacter odensis Run_B_J11 GN=argJ PE=4 SV=1
 3217 : A2BNH8_PROMS        0.39  0.58  193  405  196  410  224    3   20  412  A2BNH8     Arginine biosynthesis bifunctional protein ArgJ OS=Prochlorococcus marinus (strain AS9601) GN=argJ PE=3 SV=1
 3218 : A2CDJ3_PROM3        0.39  0.61  193  405  211  425  222    3   16  427  A2CDJ3     Arginine biosynthesis bifunctional protein ArgJ OS=Prochlorococcus marinus (strain MIT 9303) GN=argJ PE=3 SV=1
 3219 : A3JA90_9ALTE        0.39  0.65  193  405  190  403  215    3    3  405  A3JA90     Arginine biosynthesis bifunctional protein ArgJ OS=Marinobacter sp. ELB17 GN=argJ PE=3 SV=1
 3220 : A4A5G8_9GAMM        0.39  0.67  193  405  194  408  216    4    4  410  A4A5G8     Arginine biosynthesis bifunctional protein ArgJ OS=Congregibacter litoralis KT71 GN=argJ PE=3 SV=2
 3221 : A4BQH6_9GAMM        0.39  0.61  193  405  191  403  216    5    6  405  A4BQH6     Arginine biosynthesis bifunctional protein ArgJ OS=Nitrococcus mobilis Nb-231 GN=argJ PE=3 SV=1
 3222 : A4T9V8_MYCGI        0.39  0.60   12  191    9  193  189    6   13  398  A4T9V8     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium gilvum (strain PYR-GCK) GN=argJ PE=3 SV=1
 3223 : A4YKU8_BRASO        0.39  0.59  193  405  195  411  221    6   12  413  A4YKU8     Arginine biosynthesis bifunctional protein ArgJ OS=Bradyrhizobium sp. (strain ORS278) GN=argJ PE=3 SV=1
 3224 : A6GR31_9BURK        0.39  0.66  193  405  193  407  217    6    6  409  A6GR31     Arginine biosynthesis bifunctional protein ArgJ OS=Limnobacter sp. MED105 GN=argJ PE=3 SV=1
 3225 : A6UV84_META3        0.39  0.61  193  405  192  410  224    6   16  412  A6UV84     Arginine biosynthesis bifunctional protein ArgJ OS=Methanococcus aeolicus (strain Nankai-3 / ATCC BAA-1280) GN=argJ PE=3 SV=1
 3226 : A8G248_PROM2        0.39  0.57  193  405  196  410  225    4   22  412  A8G248     Arginine biosynthesis bifunctional protein ArgJ OS=Prochlorococcus marinus (strain MIT 9215) GN=argJ PE=3 SV=1
 3227 : A8ZRV2_DESOH        0.39  0.62  193  405  180  391  222    8   19  393  A8ZRV2     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfococcus oleovorans (strain DSM 6200 / Hxd3) GN=argJ PE=3 SV=1
 3228 : ARGJ2_CLOAB         0.39  0.59  193  405  178  384  218    8   16  388  Q97ET6     Arginine biosynthesis bifunctional protein ArgJ 2 OS=Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / LMG 5710 / VKM B-1787) GN=argJ2 PE=3 SV=1
 3229 : ARGJ_ACIAD          0.39  0.67  193  405  190  404  217    6    6  406  Q6FED8     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1) GN=argJ PE=3 SV=1
 3230 : ARGJ_CAUCR          0.39  0.62  193  405  188  401  215    3    3  403  Q9A3Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Caulobacter crescentus (strain ATCC 19089 / CB15) GN=argJ PE=3 SV=1
 3231 : ARGJ_PROMM          0.39  0.60  193  405  211  425  222    3   16  427  Q7V436     Arginine biosynthesis bifunctional protein ArgJ OS=Prochlorococcus marinus (strain MIT 9313) GN=argJ PE=3 SV=1
 3232 : ARGJ_ZYMMO          0.39  0.61  193  405  194  407  218    5    9  409  Q5NP13     Arginine biosynthesis bifunctional protein ArgJ OS=Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4) GN=argJ PE=3 SV=1
 3233 : B7RSP8_9GAMM        0.39  0.67  193  405  192  406  216    4    4  408  B7RSP8     Arginine biosynthesis bifunctional protein ArgJ OS=marine gamma proteobacterium HTCC2148 GN=argJ PE=3 SV=1
 3234 : B8GD14_CHLAD        0.39  0.56    5  191    2  190  193    4   10  405  B8GD14     Arginine biosynthesis bifunctional protein ArgJ OS=Chloroflexus aggregans (strain MD-66 / DSM 9485) GN=argJ PE=3 SV=1
 3235 : B8GMP0_THISH        0.39  0.66  193  405  190  401  215    4    5  403  B8GMP0     Arginine biosynthesis bifunctional protein ArgJ OS=Thioalkalivibrio sp. (strain HL-EbGR7) GN=argJ PE=3 SV=1
 3236 : B8KR42_9GAMM        0.39  0.65  193  405  183  396  217    6    7  398  B8KR42     Arginine biosynthesis bifunctional protein ArgJ OS=Luminiphilus syltensis NOR5-1B GN=argJ PE=3 SV=1
 3237 : C0VMN0_9GAMM        0.39  0.67  193  405  190  404  218    6    8  406  C0VMN0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. ATCC 27244 GN=argJ PE=3 SV=1
 3238 : C4FFX1_9BIFI        0.39  0.58   12  191    2  182  188    9   15  390  C4FFX1     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium angulatum DSM 20098 = JCM 7096 GN=argJ PE=3 SV=1
 3239 : C6RN80_ACIRA        0.39  0.64  193  405  190  404  218    6    8  406  C6RN80     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter radioresistens SK82 GN=argJ PE=3 SV=1
 3240 : C8WB40_ZYMMN        0.39  0.61  193  405  194  407  218    5    9  409  C8WB40     Arginine biosynthesis bifunctional protein ArgJ OS=Zymomonas mobilis subsp. mobilis (strain NCIB 11163) GN=argJ PE=3 SV=1
 3241 : C9RKC9_FIBSS        0.39  0.64  193  405  190  403  218    5    9  405  C9RKC9     Arginine biosynthesis bifunctional protein ArgJ OS=Fibrobacter succinogenes (strain ATCC 19169 / S85) GN=argJ PE=3 SV=1
 3242 : D0C402_9GAMM        0.39  0.65  193  405  190  404  218    6    8  406  D0C402     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. RUH2624 GN=argJ PE=3 SV=1
 3243 : D0DAL3_9RHOB        0.39  0.64  193  405  199  407  218    7   14  409  D0DAL3     Arginine biosynthesis bifunctional protein ArgJ OS=Citreicella sp. SE45 GN=argJ PE=3 SV=1
 3244 : D0SKY7_ACIJU        0.39  0.64  193  405  190  404  218    6    8  406  D0SKY7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter junii SH205 GN=argJ PE=3 SV=1
 3245 : D4S8Q6_9FIRM        0.39  0.64  193  405  195  406  213    1    1  408  D4S8Q6     Arginine biosynthesis bifunctional protein ArgJ OS=Selenomonas noxia ATCC 43541 GN=argJ PE=3 SV=1
 3246 : D5VR44_METIM        0.39  0.60  193  405  169  384  233    7   37  386  D5VR44     Arginine biosynthesis bifunctional protein ArgJ OS=Methanocaldococcus infernus (strain DSM 11812 / JCM 15783 / ME) GN=argJ PE=3 SV=1
 3247 : D5X4I4_THIK1        0.39  0.64  193  405  195  409  218    6    8  411  D5X4I4     Arginine biosynthesis bifunctional protein ArgJ OS=Thiomonas intermedia (strain K12) GN=argJ PE=3 SV=1
 3248 : D7AL29_GEOSK        0.39  0.60  193  405  179  391  219    3   12  393  D7AL29     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacter sulfurreducens (strain DL-1 / KN400) GN=argJ PE=3 SV=1
 3249 : D7BCR8_MEISD        0.39  0.62  193  405  175  378  213    4    9  380  D7BCR8     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Meiothermus silvanus (strain ATCC 700542 / DSM 9946 / VI-R2) GN=argJ PE=3 SV=1
 3250 : D7BTL7_STRBB        0.39  0.62  193  405  192  397  217    6   15  399  D7BTL7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces bingchenggensis (strain BCW-1) GN=argJ PE=3 SV=1
 3251 : D8HU18_AMYMU        0.39  0.57  193  405  182  384  219    6   22  386  D8HU18     Arginine biosynthesis bifunctional protein ArgJ OS=Amycolatopsis mediterranei (strain U-32) GN=argJ PE=3 SV=1
 3252 : D8PGS5_9BACT        0.39  0.66  193  405  189  401  216    3    6  403  D8PGS5     Arginine biosynthesis bifunctional protein ArgJ OS=Candidatus Nitrospira defluvii GN=argJ PE=3 SV=1
 3253 : E1YF09_9DELT        0.39  0.66  193  405  199  409  217    6   10  411  E1YF09     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured Desulfobacterium sp. GN=argJ PE=3 SV=1
 3254 : E4PP28_MARAH        0.39  0.64  193  405  190  403  215    3    3  405  E4PP28     Arginine biosynthesis bifunctional protein ArgJ OS=Marinobacter adhaerens (strain HP15) GN=argJ PE=3 SV=1
 3255 : E6PHP6_9ZZZZ        0.39  0.60  193  405  201  404  217    5   17  406  E6PHP6     Ornithine acetyltransferase amino-acid acetyltransferase OS=mine drainage metagenome GN=argJ PE=3 SV=1
 3256 : E6TP60_MYCSR        0.39  0.60    8  191    2  190  193    6   13  395  E6TP60     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Mycobacterium sp. (strain Spyr1) GN=argJ PE=3 SV=1
 3257 : E6VMC7_RHOPX        0.39  0.61  193  405  195  411  221    6   12  413  E6VMC7     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodopseudomonas palustris (strain DX-1) GN=argJ PE=3 SV=1
 3258 : E6W406_DESIS        0.39  0.61  193  405  193  405  218    5   10  407  E6W406     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfurispirillum indicum (strain ATCC BAA-1389 / S5) GN=argJ PE=3 SV=1
 3259 : E7CA08_9PROT        0.39  0.58  217  405    1  190  193    4    7  192  E7CA08     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured SAR11 cluster alpha proteobacterium H17925_38M03 GN=argJ PE=3 SV=1
 3260 : E8WPQ6_GEOS8        0.39  0.58  193  405  177  389  228    3   30  391  E8WPQ6     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacter sp. (strain M18) GN=argJ PE=3 SV=1
 3261 : F1Z9R4_9SPHN        0.39  0.63  193  405  193  406  219    7   11  408  F1Z9R4     Arginine biosynthesis bifunctional protein ArgJ OS=Novosphingobium nitrogenifigens DSM 19370 GN=argJ PE=3 SV=1
 3262 : F4GRU7_PUSST        0.39  0.66  193  405  193  406  217    5    7  408  F4GRU7     Arginine biosynthesis bifunctional protein ArgJ OS=Pusillimonas sp. (strain T7-7) GN=argJ PE=3 SV=1
 3263 : F5SLX4_9GAMM        0.39  0.69  193  405  197  411  216    4    4  413  F5SLX4     Arginine biosynthesis bifunctional protein ArgJ OS=Psychrobacter sp. 1501(2011) GN=argJ PE=3 SV=1
 3264 : F8DVI0_ZYMMA        0.39  0.61  193  405  194  407  218    5    9  409  F8DVI0     Arginine biosynthesis bifunctional protein ArgJ OS=Zymomonas mobilis subsp. mobilis (strain ATCC 10988 / DSM 424 / LMG 404 / NCIMB 8938 / NRRL B-806 / ZM1) GN=argJ PE=3 SV=1
 3265 : F8G8F6_FRAST        0.39  0.61  193  405  184  394  218    8   12  396  F8G8F6     Arginine biosynthesis bifunctional protein ArgJ OS=Francisella sp. (strain TX077308) GN=argJ PE=3 SV=1
 3266 : F8JRT3_STREN        0.39  0.57  193  405  177  382  218    5   17  384  F8JRT3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces cattleya (strain ATCC 35852 / DSM 46488 / JCM 4925 / NBRC 14057 / NRRL 8057) GN=oat PE=3 SV=1
 3267 : F9ZIE6_9PROT        0.39  0.67  193  405  191  405  216    4    4  407  F9ZIE6     Arginine biosynthesis bifunctional protein ArgJ OS=Nitrosomonas sp. AL212 GN=argJ PE=3 SV=1
 3268 : G0EIP2_BRAIP        0.39  0.59    7  191    5  191  189    4    6  409  G0EIP2     Arginine biosynthesis bifunctional protein ArgJ OS=Brachyspira intermedia (strain ATCC 51140 / PWS/A) GN=argJ PE=3 SV=1
 3269 : G0FYJ7_AMYMS        0.39  0.57  193  405  182  384  219    6   22  386  G0FYJ7     Arginine biosynthesis bifunctional protein ArgJ OS=Amycolatopsis mediterranei (strain S699) GN=argJ PE=3 SV=1
 3270 : G0HB88_CORVD        0.39  0.60   13  191    8  188  188    7   16  392  G0HB88     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium variabile (strain DSM 44702 / JCM 12073 / NCIMB 30131) GN=argJ PE=3 SV=1
 3271 : G2E012_9GAMM        0.39  0.66  193  405  187  401  218    6    8  403  G2E012     Arginine biosynthesis bifunctional protein ArgJ OS=Thiorhodococcus drewsii AZ1 GN=argJ PE=3 SV=1
 3272 : G4CGR0_9NEIS        0.39  0.66  193  405  189  403  216    4    4  405  G4CGR0     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria shayeganii 871 GN=argJ PE=3 SV=1
 3273 : G4KUS7_OSCVS        0.39  0.64    9  191    6  190  186    3    4  406  G4KUS7     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillibacter valericigenes (strain DSM 18026 / NBRC 101213 / Sjm18-20) GN=argJ PE=3 SV=1
 3274 : G5GMT5_9FIRM        0.39  0.64  193  405  190  401  213    1    1  403  G5GMT5     Arginine biosynthesis bifunctional protein ArgJ OS=Selenomonas infelix ATCC 43532 GN=argJ PE=3 SV=1
 3275 : G5H188_9FIRM        0.39  0.64  193  405  190  401  213    1    1  403  G5H188     Arginine biosynthesis bifunctional protein ArgJ OS=Selenomonas noxia F0398 GN=argJ PE=3 SV=1
 3276 : G9ZTC4_9LACO        0.39  0.60    1  191    2  190  197    5   14  404  G9ZTC4     Arginine biosynthesis bifunctional protein ArgJ OS=Lactobacillus parafarraginis F0439 GN=argJ PE=3 SV=1
 3277 : H1BLD3_9FIRM        0.39  0.65    5  191    1  187  189    4    4  405  H1BLD3     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. 3_1_31 GN=argJ PE=3 SV=1
 3278 : H3NXW6_9GAMM        0.39  0.69  193  405  183  396  216    5    5  398  H3NXW6     Arginine biosynthesis bifunctional protein ArgJ OS=gamma proteobacterium HIMB55 GN=argJ PE=3 SV=1
 3279 : H5WHI3_9BURK        0.39  0.66  193  405  193  407  218    6    8  409  H5WHI3     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderiales bacterium JOSHI_001 GN=argJ PE=3 SV=1
 3280 : H7ELQ1_9SPIO        0.39  0.57  193  405  190  421  240    6   35  423  H7ELQ1     Arginine biosynthesis bifunctional protein ArgJ OS=Treponema saccharophilum DSM 2985 GN=argJ PE=3 SV=1
 3281 : H8W671_MARHY        0.39  0.66  193  405  190  403  215    3    3  405  H8W671     Arginine biosynthesis bifunctional protein ArgJ OS=Marinobacter hydrocarbonoclasticus ATCC 49840 GN=argJ PE=3 SV=1
 3282 : I0HN11_RUBGI        0.39  0.66  193  405  193  407  216    4    4  409  I0HN11     Arginine biosynthesis bifunctional protein ArgJ OS=Rubrivivax gelatinosus (strain NBRC 100245 / IL144) GN=argJ PE=3 SV=1
 3283 : I1XHK0_METNJ        0.39  0.64  193  405  192  406  216    4    4  408  I1XHK0     Arginine biosynthesis bifunctional protein ArgJ OS=Methylophaga nitratireducenticrescens (strain ATCC BAA-2433 / DSM 25689 / JAM1) GN=argJ PE=3 SV=1
 3284 : I5B3X1_9DELT        0.39  0.64  193  405  185  395  218    5   12  397  I5B3X1     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfobacter postgatei 2ac9 GN=argJ PE=3 SV=1
 3285 : I6YPS5_ZYMMB        0.39  0.61  193  405  194  407  218    5    9  409  I6YPS5     Arginine biosynthesis bifunctional protein ArgJ OS=Zymomonas mobilis subsp. mobilis ATCC 29191 GN=argJ PE=3 SV=1
 3286 : J4Z2Q3_ACIRA        0.39  0.64  193  405  190  404  218    6    8  406  J4Z2Q3     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter radioresistens WC-A-157 GN=argJ PE=3 SV=1
 3287 : J7ETH3_STRCI        0.39  0.58   12  191    2  178  189    7   21  383  J7ETH3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces cacaoi subsp. asoensis GN=argJ PE=3 SV=1
 3288 : K6VG60_ACIRA        0.39  0.64  193  405  190  404  218    6    8  406  K6VG60     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 GN=argJ PE=3 SV=1
 3289 : K9PAU9_CYAGP        0.39  0.59  193  405  193  407  221    2   14  409  K9PAU9     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Cyanobium gracile (strain ATCC 27147 / PCC 6307) GN=argJ PE=3 SV=1
 3290 : L0KZU6_METHD        0.39  0.58    7  191    2  179  190    6   17  394  L0KZU6     Arginine biosynthesis bifunctional protein ArgJ OS=Methanomethylovorans hollandica (strain DSM 15978 / NBRC 107637 / DMS1) GN=argJ PE=3 SV=1
 3291 : L7EL75_CLOPA        0.39  0.58    2  191    1  189  195    5   11  407  L7EL75     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium pasteurianum DSM 525 GN=argJ PE=3 SV=1
 3292 : L9M6G7_ACIBA        0.39  0.66  193  405  190  404  218    6    8  406  L9M6G7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter baumannii OIFC021 GN=argJ PE=3 SV=1
 3293 : M2Z4K7_9NOCA        0.39  0.56  193  405  175  380  226    4   33  382  M2Z4K7     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodococcus ruber BKS 20-38 GN=argJ PE=3 SV=1
 3294 : M4YKE7_9EURY        0.39  0.62  193  405  193  406  221    6   15  408  M4YKE7     Arginine biosynthesis bifunctional protein ArgJ OS=Thermoplasmatales archaeon BRNA1 GN=argJ PE=3 SV=1
 3295 : M7PSF0_9GAMM        0.39  0.62  193  405  192  406  218    6    8  408  M7PSF0     Arginine biosynthesis bifunctional protein ArgJ OS=Methylophaga lonarensis MPL GN=argJ PE=3 SV=1
 3296 : N8PJR8_ACICA        0.39  0.66  193  405  190  404  218    6    8  406  N8PJR8     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter calcoaceticus NIPH 13 GN=argJ PE=3 SV=1
 3297 : N8Q6B8_9GAMM        0.39  0.65  193  405  190  404  218    6    8  406  N8Q6B8     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. ANC 3994 GN=argJ PE=3 SV=1
 3298 : N8QWD3_9GAMM        0.39  0.66  193  405  190  404  218    6    8  406  N8QWD3     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. NIPH 973 GN=argJ PE=3 SV=1
 3299 : N8SKA0_9GAMM        0.39  0.66  193  405  190  404  218    6    8  406  N8SKA0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter nosocomialis NIPH 2119 GN=argJ PE=3 SV=1
 3300 : N8WFV3_9GAMM        0.39  0.64  193  405  190  404  218    6    8  406  N8WFV3     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. NIPH 758 GN=argJ PE=3 SV=1
 3301 : N8XEF3_9GAMM        0.39  0.65  193  405  194  408  218    6    8  410  N8XEF3     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. CIP 102637 GN=argJ PE=3 SV=1
 3302 : N8ZKR2_ACIJU        0.39  0.64  193  405  190  404  218    6    8  406  N8ZKR2     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter junii CIP 107470 GN=argJ PE=3 SV=1
 3303 : N9BRB3_9GAMM        0.39  0.66  193  405  190  404  216    4    4  406  N9BRB3     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter soli CIP 110264 GN=argJ PE=3 SV=1
 3304 : N9D3A1_9GAMM        0.39  0.66  193  405  194  408  216    4    4  410  N9D3A1     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter ursingii DSM 16037 = CIP 107286 GN=argJ PE=3 SV=1
 3305 : N9D973_ACICA        0.39  0.67  193  405  190  404  218    6    8  406  N9D973     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter calcoaceticus ANC 3680 GN=argJ PE=3 SV=1
 3306 : N9DYW5_ACIRA        0.39  0.64  193  405  190  404  218    6    8  406  N9DYW5     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter radioresistens NIPH 2130 GN=argJ PE=3 SV=1
 3307 : N9EHJ2_ACIPI        0.39  0.65  193  405  190  404  218    6    8  406  N9EHJ2     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter pittii CIP 70.29 GN=argJ PE=3 SV=1
 3308 : N9EY94_ACICA        0.39  0.67  193  405  190  404  218    6    8  406  N9EY94     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter calcoaceticus DSM 30006 = CIP 81.8 GN=argJ PE=3 SV=1
 3309 : N9FVP0_9GAMM        0.39  0.64  193  405  190  404  218    6    8  406  N9FVP0     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter beijerinckii CIP 110307 GN=argJ PE=3 SV=1
 3310 : N9GIR9_ACIHA        0.39  0.67  193  405  190  404  218    6    8  406  N9GIR9     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter haemolyticus NIPH 261 GN=argJ PE=3 SV=1
 3311 : N9MTL6_9GAMM        0.39  0.63  193  405  190  404  218    6    8  406  N9MTL6     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. ANC 4105 GN=argJ PE=3 SV=1
 3312 : N9PUW8_9GAMM        0.39  0.64  193  405  190  404  218    6    8  406  N9PUW8     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. NIPH 2168 GN=argJ PE=3 SV=1
 3313 : N9SGG7_9GAMM        0.39  0.66  193  405  194  408  216    4    4  410  N9SGG7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter ursingii NIPH 706 GN=argJ PE=3 SV=1
 3314 : Q2WA11_MAGSA        0.39  0.60  193  405  195  408  218    5    9  410  Q2WA11     Arginine biosynthesis bifunctional protein ArgJ OS=Magnetospirillum magneticum (strain AMB-1 / ATCC 700264) GN=argJ PE=3 SV=1
 3315 : R4YUW8_OLEAN        0.39  0.65  193  405  201  415  218    6    8  417  R4YUW8     Arginine biosynthesis bifunctional protein ArgJ OS=Oleispira antarctica RB-8 GN=argJ PE=3 SV=1
 3316 : R6ZBY2_9ACTN        0.39  0.59  193  405  206  419  219    5   11  421  R6ZBY2     Arginine biosynthesis bifunctional protein ArgJ OS=Collinsella sp. CAG:398 GN=argJ PE=3 SV=1
 3317 : R7H6W3_9FIRM        0.39  0.58   13  191   16  208  195    4   18  426  R7H6W3     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:403 GN=argJ PE=3 SV=1
 3318 : R8Z1D7_ACIPI        0.39  0.65  193  405  232  446  218    6    8  448  R8Z1D7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter pittii ANC 4052 GN=argJ PE=3 SV=1
 3319 : S2KPM7_9GAMM        0.39  0.63  193  405  190  400  215    5    6  402  S2KPM7     Arginine biosynthesis bifunctional protein ArgJ OS=Halomonas anticariensis FP35 = DSM 16096 GN=argJ PE=3 SV=1
 3320 : S3KMS1_TRESO        0.39  0.59  193  405  196  432  238    3   26  434  S3KMS1     Arginine biosynthesis bifunctional protein ArgJ OS=Treponema socranskii subsp. paredis ATCC 35535 GN=argJ PE=3 SV=1
 3321 : S6BAH8_9GAMM        0.39  0.65  193  405  185  394  214    3    5  396  S6BAH8     Arginine biosynthesis bifunctional protein ArgJ OS=endosymbiont of unidentified scaly snail isolate Monju GN=argJ PE=3 SV=1
 3322 : U4R081_9CLOT        0.39  0.61    7  191    2  186  188    5    6  400  U4R081     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium papyrosolvens C7 GN=argJ PE=3 SV=1
 3323 : U5WXT4_MYCKA        0.39  0.59   13  191   16  198  188    6   14  403  U5WXT4     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium kansasii ATCC 12478 GN=argJ PE=3 SV=1
 3324 : U7HG56_9ALTE        0.39  0.66  193  405  190  403  215    3    3  405  U7HG56     Arginine biosynthesis bifunctional protein ArgJ OS=Marinobacter sp. EN3 GN=argJ PE=3 SV=1
 3325 : V5SBU1_9RHIZ        0.39  0.60  193  405  197  413  221    6   12  415  V5SBU1     Arginine biosynthesis bifunctional protein ArgJ OS=Hyphomicrobium nitrativorans NL23 GN=argJ PE=3 SV=1
 3326 : V8G8Z5_9BURK        0.39  0.64  193  405  193  405  215    4    4  407  V8G8Z5     Arginine biosynthesis bifunctional protein ArgJ OS=Pelistega sp. HM-7 GN=argJ PE=3 SV=1
 3327 : W0E1X1_MARPU        0.39  0.66  193  405  188  402  216    4    4  404  W0E1X1     Arginine biosynthesis bifunctional protein ArgJ OS=Marichromatium purpuratum 984 GN=argJ PE=3 SV=1
 3328 : W5YHI9_9ALTE        0.39  0.65  193  405  190  403  215    3    3  405  W5YHI9     N-acetylglutamate synthase OS=Marinobacter sp. A3d10 GN=argJ PE=4 SV=1
 3329 : W7WGE7_9BURK        0.39  0.66  193  405    8  222  216    4    4  224  W7WGE7     Arginine biosynthesis bifunctional protein ArgJ OS=Methylibium sp. T29 GN=argJ_1 PE=4 SV=1
 3330 : W7WJY0_9BURK        0.39  0.66  193  405  193  407  216    4    4  409  W7WJY0     Arginine biosynthesis bifunctional protein ArgJ OS=Methylibium sp. T29-B GN=argJ PE=4 SV=1
 3331 : A0LHJ2_SYNFM        0.38  0.62  193  405  179  393  226    4   24  395  A0LHJ2     Arginine biosynthesis bifunctional protein ArgJ OS=Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB) GN=argJ PE=3 SV=1
 3332 : A0QHB3_MYCA1        0.38  0.59    8  191   11  199  193    6   13  404  A0QHB3     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium (strain 104) GN=argJ PE=3 SV=1
 3333 : A0Z7B5_9GAMM        0.38  0.64  193  405  183  396  217    6    7  398  A0Z7B5     Arginine biosynthesis bifunctional protein ArgJ OS=marine gamma proteobacterium HTCC2080 GN=argJ PE=3 SV=1
 3334 : A1ALX6_PELPD        0.38  0.57  193  405  179  391  229    5   32  393  A1ALX6     Arginine biosynthesis bifunctional protein ArgJ OS=Pelobacter propionicus (strain DSM 2379) GN=argJ PE=3 SV=1
 3335 : A1TAB1_MYCVP        0.38  0.61   13  191   10  193  188    7   13  398  A1TAB1     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium vanbaalenii (strain DSM 7251 / PYR-1) GN=argJ PE=3 SV=1
 3336 : A1TTE8_ACIAC        0.38  0.65  193  405  193  407  216    4    4  409  A1TTE8     Arginine biosynthesis bifunctional protein ArgJ OS=Acidovorax citrulli (strain AAC00-1) GN=argJ PE=3 SV=1
 3337 : A1VFF7_DESVV        0.38  0.56  193  405  182  391  218    6   13  393  A1VFF7     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio vulgaris subsp. vulgaris (strain DP4) GN=argJ PE=3 SV=1
 3338 : A1W466_ACISJ        0.38  0.63  193  405  193  407  216    4    4  409  A1W466     Arginine biosynthesis bifunctional protein ArgJ OS=Acidovorax sp. (strain JS42) GN=argJ PE=3 SV=1
 3339 : A2BU05_PROM5        0.38  0.60  193  405  199  413  222    3   16  415  A2BU05     Arginine biosynthesis bifunctional protein ArgJ OS=Prochlorococcus marinus (strain MIT 9515) GN=argJ PE=3 SV=1
 3340 : A3HVZ2_9BACT        0.38  0.59  193  405  185  401  219    4    8  403  A3HVZ2     Arginine biosynthesis bifunctional protein ArgJ OS=Algoriphagus machipongonensis GN=argJ PE=3 SV=1
 3341 : A3YHJ0_9GAMM        0.38  0.66  193  405  190  404  216    4    4  406  A3YHJ0     Arginine biosynthesis bifunctional protein ArgJ OS=Marinomonas sp. MED121 GN=argJ PE=3 SV=1
 3342 : A4A2L4_9PLAN        0.38  0.63  193  405  190  400  216    3    8  402  A4A2L4     Arginine biosynthesis bifunctional protein ArgJ OS=Blastopirellula marina DSM 3645 GN=argJ PE=3 SV=1
 3343 : A4E9A8_9ACTN        0.38  0.61  193  405  207  420  218    4    9  422  A4E9A8     Arginine biosynthesis bifunctional protein ArgJ OS=Collinsella aerofaciens ATCC 25986 GN=argJ PE=3 SV=1
 3344 : A5GEY0_GEOUR        0.38  0.62  193  405  179  391  219    3   12  393  A5GEY0     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacter uraniireducens (strain Rf4) GN=argJ PE=3 SV=1
 3345 : A5GPE4_SYNPW        0.38  0.58  193  405  214  428  223    5   18  430  A5GPE4     Arginine biosynthesis bifunctional protein ArgJ OS=Synechococcus sp. (strain WH7803) GN=argJ PE=3 SV=1
 3346 : A5GWL7_SYNR3        0.38  0.61  193  405  200  414  221    3   14  416  A5GWL7     Arginine biosynthesis bifunctional protein ArgJ OS=Synechococcus sp. (strain RCC307) GN=argJ PE=3 SV=1
 3347 : A6F2S8_9ALTE        0.38  0.67  193  405  190  403  215    3    3  405  A6F2S8     Arginine biosynthesis bifunctional protein ArgJ OS=Marinobacter algicola DG893 GN=argJ PE=3 SV=1
 3348 : A8LE41_FRASN        0.38  0.55   12  191    2  185  199   10   34  390  A8LE41     Arginine biosynthesis bifunctional protein ArgJ OS=Frankia sp. (strain EAN1pec) GN=argJ PE=3 SV=1
 3349 : ARGJ_METMP          0.38  0.52  193  405  189  406  234    7   37  408  P62065     Arginine biosynthesis bifunctional protein ArgJ OS=Methanococcus maripaludis (strain S2 / LL) GN=argJ PE=3 SV=1
 3350 : ARGJ_MYCLE          0.38  0.59    8  191   14  202  193    6   13  407  Q9CC14     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium leprae (strain TN) GN=argJ PE=3 SV=1
 3351 : ARGJ_MYCPA          0.38  0.59    8  191   11  199  193    6   13  404  P62063     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium paratuberculosis (strain ATCC BAA-968 / K-10) GN=argJ PE=3 SV=1
 3352 : ARGJ_PSEU2          0.38  0.66  193  405  189  403  216    4    4  405  Q4ZNZ9     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. syringae (strain B728a) GN=argJ PE=3 SV=1
 3353 : B2JHF0_BURP8        0.38  0.65  193  405  197  411  216    4    4  413  B2JHF0     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia phymatum (strain DSM 17167 / STM815) GN=argJ PE=3 SV=1
 3354 : B3E0T9_METI4        0.38  0.61    1  191   11  201  196    4   10  413  B3E0T9     Arginine biosynthesis bifunctional protein ArgJ OS=Methylacidiphilum infernorum (isolate V4) GN=argJ PE=3 SV=1
 3355 : B4CZS9_9BACT        0.38  0.62  193  402  191  399  214    4    9  402  B4CZS9     Arginine biosynthesis bifunctional protein ArgJ OS=Chthoniobacter flavus Ellin428 GN=argJ PE=3 SV=1
 3356 : B4WGA0_9SYNE        0.38  0.54  193  405  191  445  257    5   46  447  B4WGA0     Arginine biosynthesis bifunctional protein ArgJ OS=Synechococcus sp. PCC 7335 GN=argJ PE=3 SV=1
 3357 : B5WM87_9BURK        0.38  0.64  193  405  197  411  216    4    4  413  B5WM87     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia sp. H160 GN=argJ PE=3 SV=1
 3358 : B6BKX0_9HELI        0.38  0.59  193  405  183  389  222    6   24  391  B6BKX0     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfurimonas gotlandica GD1 GN=argJ PE=3 SV=1
 3359 : B6FJL6_9CLOT        0.38  0.57    1  190   12  204  196    4    9  423  B6FJL6     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium nexile DSM 1787 GN=argJ PE=3 SV=1
 3360 : B8ZRK3_MYCLB        0.38  0.59    8  191   14  202  193    6   13  407  B8ZRK3     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium leprae (strain Br4923) GN=argJ PE=3 SV=1
 3361 : B9M3K8_GEODF        0.38  0.61  193  405  179  391  221    5   16  393  B9M3K8     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacter daltonii (strain DSM 22248 / JCM 15807 / FRC-32) GN=argJ PE=3 SV=1
 3362 : B9MDY5_ACIET        0.38  0.64  193  405  193  407  216    4    4  409  B9MDY5     Arginine biosynthesis bifunctional protein ArgJ OS=Acidovorax ebreus (strain TPSY) GN=argJ PE=3 SV=1
 3363 : C1DQA9_AZOVD        0.38  0.66  193  405  189  403  216    4    4  405  C1DQA9     Arginine biosynthesis bifunctional protein ArgJ OS=Azotobacter vinelandii (strain DJ / ATCC BAA-1303) GN=argJ PE=3 SV=1
 3364 : C6WU23_METML        0.38  0.66  193  405  193  406  217    5    7  408  C6WU23     Arginine biosynthesis bifunctional protein ArgJ OS=Methylotenera mobilis (strain JLW8 / ATCC BAA-1282 / DSM 17540) GN=argJ PE=3 SV=1
 3365 : C8PZP8_9GAMM        0.38  0.67  193  405  190  402  215    4    4  404  C8PZP8     Arginine biosynthesis bifunctional protein ArgJ OS=Enhydrobacter aerosaccus SK60 GN=argJ PE=3 SV=1
 3366 : D0KVI9_HALNC        0.38  0.65  193  405  192  406  216    4    4  408  D0KVI9     Arginine biosynthesis bifunctional protein ArgJ OS=Halothiobacillus neapolitanus (strain ATCC 23641 / c2) GN=argJ PE=3 SV=1
 3367 : D0U4I6_9GAMM        0.38  0.63  193  405  183  392  216    6    9  394  D0U4I6     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured SUP05 cluster bacterium GN=argJ PE=3 SV=1
 3368 : D3PNJ5_MEIRD        0.38  0.63  193  405  175  378  214    5   11  380  D3PNJ5     Arginine biosynthesis bifunctional protein ArgJ OS=Meiothermus ruber (strain ATCC 35948 / DSM 1279 / VKM B-1258 / 21) GN=argJ PE=3 SV=1
 3369 : D5MKU2_9BACT        0.38  0.54  193  405  191  403  224    3   22  405  D5MKU2     Arginine biosynthesis bifunctional protein ArgJ OS=Candidatus Methylomirabilis oxyfera GN=argJ PE=3 SV=1
 3370 : D6ALR6_STRFL        0.38  0.60   12  191    2  179  188    8   18  384  D6ALR6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces roseosporus NRRL 15998 GN=argJ PE=3 SV=1
 3371 : D6CRC0_THIA3        0.38  0.65  193  405  195  409  218    6    8  411  D6CRC0     Arginine biosynthesis bifunctional protein ArgJ OS=Thiomonas arsenitoxydans (strain DSM 22701 / CIP 110005 / 3As) GN=argJ PE=3 SV=1
 3372 : D6Z478_DESAT        0.38  0.62  193  405  189  401  216    3    6  403  D6Z478     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfurivibrio alkaliphilus (strain DSM 19089 / UNIQEM U267 / AHT2) GN=argJ PE=3 SV=1
 3373 : D7GED7_PROFC        0.38  0.59   12  191    2  178  189    7   21  383  D7GED7     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium freudenreichii subsp. shermanii (strain ATCC 9614 / CIP 103027 / CIRM-BIA1) GN=ArgJ PE=3 SV=1
 3374 : D7I479_PSESS        0.38  0.66  193  405  189  403  216    4    4  405  D7I479     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas savastanoi pv. savastanoi NCPPB 3335 GN=argJ PE=3 SV=1
 3375 : D8FDU6_9DELT        0.38  0.60  193  405  188  398  221    6   18  400  D8FDU6     Arginine biosynthesis bifunctional protein ArgJ OS=delta proteobacterium NaphS2 GN=argJ PE=3 SV=1
 3376 : E0N4Z5_9ACTO        0.38  0.55  193  405  180  385  219    6   19  387  E0N4Z5     Arginine biosynthesis bifunctional protein ArgJ OS=Mobiluncus curtisii subsp. curtisii ATCC 35241 GN=argJ PE=3 SV=1
 3377 : E1V9M2_HALED        0.38  0.61  193  405  197  407  215    5    6  409  E1V9M2     Arginine biosynthesis bifunctional protein ArgJ OS=Halomonas elongata (strain ATCC 33173 / DSM 2581 / NBRC 15536 / NCIMB 2198 / 1H9) GN=argJ PE=3 SV=1
 3378 : E4UD10_LIBSC        0.38  0.61  193  404  197  412  217    5    6  415  E4UD10     Arginine biosynthesis bifunctional protein ArgJ OS=Liberibacter solanacearum (strain CLso-ZC1) GN=argJ PE=3 SV=1
 3379 : E5ALH6_BURRH        0.38  0.63  193  405  197  411  216    4    4  413  E5ALH6     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia rhizoxinica (strain DSM 19002 / CIP 109453 / HKI 454) GN=argJ PE=3 SV=1
 3380 : E7MZ91_9FIRM        0.38  0.63  193  405  195  406  213    1    1  408  E7MZ91     Arginine biosynthesis bifunctional protein ArgJ OS=Selenomonas artemidis F0399 GN=argJ PE=3 SV=1
 3381 : E7P9V0_PSESG        0.38  0.66  193  405  189  403  216    4    4  405  E7P9V0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. glycinea str. B076 GN=argJ PE=3 SV=1
 3382 : E7PKA5_PSESG        0.38  0.66  193  405  189  403  216    4    4  405  E7PKA5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. glycinea str. race 4 GN=argJ PE=3 SV=1
 3383 : F0QCL9_ACIAP        0.38  0.63  193  405  193  407  216    4    4  409  F0QCL9     Arginine biosynthesis bifunctional protein ArgJ OS=Acidovorax avenae (strain ATCC 19860 / DSM 7227 / JCM 20985 / NCPPB 1011) GN=argJ PE=3 SV=1
 3384 : F2KRM0_ARCVS        0.38  0.57  193  405  180  386  229    7   38  388  F2KRM0     Arginine biosynthesis bifunctional protein ArgJ OS=Archaeoglobus veneficus (strain DSM 11195 / SNP6) GN=argJ PE=3 SV=1
 3385 : F3DGI8_9PSED        0.38  0.66  193  405  189  403  216    4    4  405  F3DGI8     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. aesculi str. 0893_23 GN=argJ PE=3 SV=1
 3386 : F3EGE0_PSESL        0.38  0.66  193  405  189  403  216    4    4  405  F3EGE0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. lachrymans str. M301315 GN=argJ PE=3 SV=1
 3387 : F3ETE1_9PSED        0.38  0.66  193  405  189  403  216    4    4  405  F3ETE1     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. mori str. 301020 GN=argJ PE=3 SV=1
 3388 : F3HFV5_PSEYM        0.38  0.66  193  405  189  403  216    4    4  405  F3HFV5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. maculicola str. ES4326 GN=argJ PE=3 SV=1
 3389 : F3HY76_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  F3HY76     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae str. M302091 GN=argJ PE=3 SV=1
 3390 : F3II37_PSESL        0.38  0.66  193  405  189  403  216    4    4  405  F3II37     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. lachrymans str. M302278 GN=argJ PE=3 SV=1
 3391 : F3JNM0_PSESX        0.38  0.66  193  405  189  403  216    4    4  405  F3JNM0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. aceris str. M302273 GN=argJ PE=3 SV=1
 3392 : F3K3A1_PSESZ        0.38  0.66  193  405  189  403  216    4    4  405  F3K3A1     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. tabaci str. ATCC 11528 GN=argJ PE=3 SV=1
 3393 : F3KGU2_9GAMM        0.38  0.64  193  405  190  404  216    4    4  406  F3KGU2     Arginine biosynthesis bifunctional protein ArgJ OS=gamma proteobacterium IMCC2047 GN=argJ PE=3 SV=1
 3394 : F3YUA1_DESAF        0.38  0.60  193  405  182  395  219    5   11  397  F3YUA1     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio africanus str. Walvis Bay GN=argJ PE=3 SV=1
 3395 : F4F4L5_VERMA        0.38  0.61  193  405  186  388  217    5   18  390  F4F4L5     Arginine biosynthesis bifunctional protein ArgJ OS=Verrucosispora maris (strain AB-18-032) GN=argJ PE=3 SV=1
 3396 : F5RMF5_9FIRM        0.38  0.66  193  405  190  401  213    1    1  403  F5RMF5     Arginine biosynthesis bifunctional protein ArgJ OS=Centipeda periodontii DSM 2778 GN=argJ PE=3 SV=1
 3397 : F6FY20_RALS8        0.38  0.66  193  405  193  407  216    4    4  409  F6FY20     Arginine biosynthesis bifunctional protein ArgJ OS=Ralstonia solanacearum (strain Po82) GN=argJ PE=3 SV=1
 3398 : F7PDJ3_MYCPC        0.38  0.59    8  191   11  199  193    6   13  404  F7PDJ3     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. paratuberculosis S397 GN=argJ PE=3 SV=1
 3399 : F7SJU7_9GAMM        0.38  0.62  193  405  197  407  215    5    6  409  F7SJU7     Arginine biosynthesis bifunctional protein ArgJ OS=Halomonas sp. TD01 GN=argJ PE=3 SV=1
 3400 : F8GHS4_NITSI        0.38  0.67  193  405  192  406  218    6    8  408  F8GHS4     Arginine biosynthesis bifunctional protein ArgJ OS=Nitrosomonas sp. (strain Is79A3) GN=argJ PE=3 SV=1
 3401 : F8JC20_HYPSM        0.38  0.60  193  405  197  413  221    6   12  415  F8JC20     Arginine biosynthesis bifunctional protein ArgJ OS=Hyphomicrobium sp. (strain MC1) GN=argJ PE=3 SV=1
 3402 : F8K3S3_STREN        0.38  0.60  193  405  180  382  215    4   14  384  F8K3S3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces cattleya (strain ATCC 35852 / DSM 46488 / JCM 4925 / NBRC 14057 / NRRL 8057) GN=argJ PE=3 SV=1
 3403 : G0H024_METMI        0.38  0.52  193  405  189  406  233    5   35  408  G0H024     Arginine biosynthesis bifunctional protein ArgJ OS=Methanococcus maripaludis X1 GN=argJ PE=3 SV=1
 3404 : G2ZR22_9RALS        0.38  0.67  193  405  193  407  216    4    4  409  G2ZR22     Arginine biosynthesis bifunctional protein ArgJ OS=blood disease bacterium R229 GN=argJ PE=3 SV=1
 3405 : G4CTR3_9NEIS        0.38  0.62  193  405  190  403  217    5    7  405  G4CTR3     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria wadsworthii 9715 GN=argJ PE=3 SV=1
 3406 : G4F3E9_9GAMM        0.38  0.65  224  405    1  180  184    4    6  182  G4F3E9     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein (Fragment) OS=Halomonas sp. HAL1 GN=HAL1_04477 PE=3 SV=1
 3407 : G8M869_9BURK        0.38  0.64  193  405  197  411  216    4    4  413  G8M869     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia sp. YI23 GN=argJ PE=3 SV=1
 3408 : G8RQ74_MYCRN        0.38  0.59   12  191   23  207  189    7   13  412  G8RQ74     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium rhodesiae (strain NBB3) GN=argJ PE=3 SV=1
 3409 : G9YMG0_9FIRM        0.38  0.53    7  191    2  189  201    9   29  407  G9YMG0     Arginine biosynthesis bifunctional protein ArgJ OS=Flavonifractor plautii ATCC 29863 GN=argJ PE=3 SV=1
 3410 : H0J2Y4_9GAMM        0.38  0.62  193  405  197  407  215    5    6  409  H0J2Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Halomonas sp. GFAJ-1 GN=argJ PE=3 SV=1
 3411 : H1CGD1_9FIRM        0.38  0.53    7  191    2  189  201    9   29  407  H1CGD1     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae bacterium 7_1_58FAA GN=argJ PE=3 SV=1
 3412 : H5WEM7_RALSL        0.38  0.67  193  405  193  407  216    4    4  409  H5WEM7     Arginine biosynthesis bifunctional protein ArgJ OS=Ralstonia solanacearum K60-1 GN=argJ PE=3 SV=1
 3413 : H6LEN7_ACEWD        0.38  0.58    5  191    1  189  195    6   14  407  H6LEN7     Arginine biosynthesis bifunctional protein ArgJ OS=Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655) GN=argJ PE=3 SV=1
 3414 : I0HZC3_CALAS        0.38  0.58  193  405  183  405  239    5   42  407  I0HZC3     Arginine biosynthesis bifunctional protein ArgJ OS=Caldilinea aerophila (strain DSM 14535 / JCM 11387 / NBRC 104270 / STL-6-O1) GN=argJ PE=3 SV=1
 3415 : I0IRC7_LEPFC        0.38  0.56    5  191    1  187  199    9   24  404  I0IRC7     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospirillum ferrooxidans (strain C2-3) GN=argJ PE=3 SV=1
 3416 : I2QLI3_9BRAD        0.38  0.60  193  405  195  411  221    6   12  413  I2QLI3     Arginine biosynthesis bifunctional protein ArgJ OS=Bradyrhizobium sp. WSM1253 GN=argJ PE=3 SV=1
 3417 : I3Z426_BELBD        0.38  0.60  193  405  185  401  219    4    8  403  I3Z426     Arginine biosynthesis bifunctional protein ArgJ OS=Belliella baltica (strain DSM 15883 / CIP 108006 / LMG 21964 / BA134) GN=argJ PE=3 SV=1
 3418 : I4BJC5_MYCCN        0.38  0.60   13  191   16  199  188    7   13  404  I4BJC5     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium chubuense (strain NBB4) GN=argJ PE=3 SV=1
 3419 : I4YM80_9RHIZ        0.38  0.58  193  405  195  411  221    6   12  413  I4YM80     Arginine biosynthesis bifunctional protein ArgJ OS=Microvirga lotononidis GN=argJ PE=3 SV=1
 3420 : J2WSV9_9PSED        0.38  0.66  193  405  189  403  216    4    4  405  J2WSV9     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Pseudomonas sp. GM21 GN=argJ PE=3 SV=1
 3421 : J3CJH3_9BRAD        0.38  0.60  193  405  195  411  221    6   12  413  J3CJH3     Arginine biosynthesis bifunctional protein ArgJ OS=Bradyrhizobium sp. YR681 GN=argJ PE=3 SV=1
 3422 : J5I0C6_9FIRM        0.38  0.64  193  405  190  401  213    1    1  403  J5I0C6     Arginine biosynthesis bifunctional protein ArgJ OS=Selenomonas sp. FOBRC9 GN=argJ PE=3 SV=1
 3423 : K0V230_MYCFO        0.38  0.61   13  191   16  203  189    6   11  408  K0V230     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium fortuitum subsp. fortuitum DSM 46621 GN=argJ PE=3 SV=1
 3424 : K0V5Y4_MYCVA        0.38  0.61   13  191   10  193  188    7   13  398  K0V5Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium vaccae ATCC 25954 GN=argJ PE=3 SV=1
 3425 : K2T2D6_PSESY        0.38  0.66  193  405  189  403  216    4    4  405  K2T2D6     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. avellanae str. ISPaVe037 GN=argJ PE=3 SV=1
 3426 : K4RD61_9ACTO        0.38  0.61  193  405  179  381  213    3   10  383  K4RD61     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces davawensis JCM 4913 GN=argJ PE=3 SV=1
 3427 : K9CLD9_9FIRM        0.38  0.63  193  405  190  401  213    1    1  403  K9CLD9     Arginine biosynthesis bifunctional protein ArgJ OS=Selenomonas sp. F0473 GN=argJ PE=3 SV=1
 3428 : K9XM55_9CHRO        0.38  0.57  193  405  229  482  254    3   41  484  K9XM55     Arginine biosynthesis bifunctional protein ArgJ OS=Gloeocapsa sp. PCC 7428 GN=argJ PE=3 SV=1
 3429 : L7DJS9_MYCPC        0.38  0.59    8  191   11  199  193    6   13  404  L7DJS9     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. paratuberculosis S5 GN=argJ PE=3 SV=1
 3430 : L7FZN9_PSESX        0.38  0.66  193  405  189  403  216    4    4  405  L7FZN9     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae BRIP34876 GN=argJ PE=3 SV=1
 3431 : M1AHA0_SOLTU        0.38  0.58  193  405  251  447  219    5   28  449  M1AHA0     Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400008852 PE=3 SV=1
 3432 : M1L896_9PROT        0.38  0.64  193  405  191  403  216    5    6  405  M1L896     Arginine biosynthesis bifunctional protein ArgJ OS=Candidatus Kinetoplastibacterium galatii TCC219 GN=argJ PE=3 SV=1
 3433 : M2YT08_9PSEU        0.38  0.57  193  405  182  384  219    6   22  386  M2YT08     Arginine biosynthesis bifunctional protein ArgJ OS=Amycolatopsis decaplanina DSM 44594 GN=argJ PE=3 SV=1
 3434 : M4UFV2_RALSL        0.38  0.67  193  405  193  407  216    4    4  409  M4UFV2     Arginine biosynthesis bifunctional protein ArgJ OS=Ralstonia solanacearum FQY_4 GN=argJ PE=3 SV=1
 3435 : M5Q023_DESAF        0.38  0.60  193  405  182  395  219    5   11  397  M5Q023     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio africanus PCS GN=argJ PE=3 SV=1
 3436 : M5QIC0_9PSED        0.38  0.65  193  405  189  403  216    4    4  405  M5QIC0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas sp. Lz4W GN=argJ PE=3 SV=1
 3437 : N0A5N3_BURTH        0.38  0.64  193  405  197  411  216    4    4  413  N0A5N3     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia thailandensis MSMB121 GN=argJ PE=3 SV=1
 3438 : N0BH91_9RHIZ        0.38  0.60  193  405  197  413  221    6   12  415  N0BH91     Arginine biosynthesis bifunctional protein ArgJ OS=Hyphomicrobium denitrificans 1NES1 GN=argJ PE=3 SV=1
 3439 : N0BIW1_9EURY        0.38  0.58  193  405  181  385  231    7   44  387  N0BIW1     Arginine biosynthesis bifunctional protein ArgJ OS=Archaeoglobus sulfaticallidus PM70-1 GN=argJ PE=3 SV=1
 3440 : N0CSQ4_9ACTO        0.38  0.60   12  191    2  179  188    8   18  384  N0CSQ4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces fulvissimus DSM 40593 GN=argJ PE=3 SV=1
 3441 : N8PHU5_9GAMM        0.38  0.64  193  405  190  404  217    6    6  406  N8PHU5     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. NIPH 236 GN=argJ PE=3 SV=1
 3442 : N8RJJ5_9GAMM        0.38  0.65  193  405  194  408  218    6    8  410  N8RJJ5     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter parvus DSM 16617 = CIP 108168 GN=argJ PE=3 SV=1
 3443 : N8UM82_9GAMM        0.38  0.65  193  405  194  408  218    6    8  410  N8UM82     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. CIP 102529 GN=argJ PE=3 SV=1
 3444 : N8WG05_9GAMM        0.38  0.65  193  405  194  408  218    6    8  410  N8WG05     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. CIP 102082 GN=argJ PE=3 SV=1
 3445 : N9KDM4_9GAMM        0.38  0.64  193  405  190  404  218    6    8  406  N9KDM4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. ANC 3929 GN=argJ PE=3 SV=1
 3446 : N9MF69_9GAMM        0.38  0.64  193  405  190  404  218    6    8  406  N9MF69     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. NIPH 1847 GN=argJ PE=3 SV=1
 3447 : N9Q9Z4_9GAMM        0.38  0.64  193  405  190  404  218    6    8  406  N9Q9Z4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. NIPH 2100 GN=argJ PE=3 SV=1
 3448 : N9R6X9_9GAMM        0.38  0.63  193  405  190  404  218    6    8  406  N9R6X9     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. NIPH 1859 GN=argJ PE=3 SV=1
 3449 : N9RTD3_9GAMM        0.38  0.64  193  405  190  404  218    6    8  406  N9RTD3     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. ANC 3880 GN=argJ PE=3 SV=1
 3450 : Q0W930_UNCMA        0.38  0.57  193  405  181  392  234    5   43  394  Q0W930     Arginine biosynthesis bifunctional protein ArgJ OS=Uncultured methanogenic archaeon RC-I GN=argJ PE=3 SV=1
 3451 : Q1GZ38_METFK        0.38  0.67  193  405  194  408  218    6    8  410  Q1GZ38     Arginine biosynthesis bifunctional protein ArgJ OS=Methylobacillus flagellatus (strain KT / ATCC 51484 / DSM 6875) GN=argJ PE=3 SV=1
 3452 : Q1PZS8_9BACT        0.38  0.63  193  405  199  409  218    5   12  411  Q1PZS8     Arginine biosynthesis bifunctional protein ArgJ OS=Candidatus Kuenenia stuttgartiensis GN=argJ PE=3 SV=1
 3453 : Q21BY7_RHOPB        0.38  0.60  193  405  195  411  221    6   12  413  Q21BY7     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodopseudomonas palustris (strain BisB18) GN=argJ PE=3 SV=1
 3454 : Q2BGF0_NEPCE        0.38  0.65  193  405  191  404  217    6    7  406  Q2BGF0     Arginine biosynthesis bifunctional protein ArgJ OS=Neptuniibacter caesariensis GN=argJ PE=3 SV=1
 3455 : R0CI34_RALPI        0.38  0.68  193  405  193  407  216    4    4  409  R0CI34     Arginine biosynthesis bifunctional protein ArgJ OS=Ralstonia pickettii OR214 GN=argJ PE=3 SV=1
 3456 : R1G1R6_9PSEU        0.38  0.56  193  405  182  384  219    6   22  386  R1G1R6     Arginine biosynthesis bifunctional protein ArgJ OS=Amycolatopsis vancoresmycina DSM 44592 GN=argJ PE=3 SV=1
 3457 : R4NA14_MYCPC        0.38  0.59    8  191   11  199  193    6   13  404  R4NA14     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. paratuberculosis MAP4 GN=argJ PE=3 SV=1
 3458 : R5FK14_9ACTN        0.38  0.55    8  191    9  206  198    5   14  424  R5FK14     Arginine biosynthesis bifunctional protein ArgJ OS=Eggerthella sp. CAG:1427 GN=argJ PE=3 SV=1
 3459 : R5Z8H5_9ACTN        0.38  0.61  193  405  207  420  218    4    9  422  R5Z8H5     Arginine biosynthesis bifunctional protein ArgJ OS=Collinsella sp. CAG:166 GN=argJ PE=3 SV=1
 3460 : R6HGR9_9ACTN        0.38  0.58    4  191    5  201  197    4    9  418  R6HGR9     Arginine biosynthesis bifunctional protein ArgJ OS=Eggerthella sp. CAG:209 GN=argJ PE=3 SV=1
 3461 : R6N9V8_9FIRM        0.38  0.61   10  191    8  190  190    7   15  408  R6N9V8     Arginine biosynthesis bifunctional protein ArgJ OS=Eubacterium sp. CAG:202 GN=argJ PE=3 SV=1
 3462 : R7HVX5_9CLOT        0.38  0.59    7  191    2  197  196    3   11  415  R7HVX5     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. CAG:411 GN=argJ PE=3 SV=1
 3463 : R7IKF2_9BURK        0.38  0.58    5  191    1  189  195    7   14  407  R7IKF2     Arginine biosynthesis bifunctional protein ArgJ OS=Sutterella sp. CAG:351 GN=argJ PE=3 SV=1
 3464 : R9M9N8_9FIRM        0.38  0.59    5  191    1  190  194    6   11  408  R9M9N8     Arginine biosynthesis bifunctional protein ArgJ OS=Oscillibacter sp. 1-3 GN=argJ PE=3 SV=1
 3465 : S2X0K3_DELAC        0.38  0.61  193  405  194  408  218    6    8  410  S2X0K3     Arginine biosynthesis bifunctional protein ArgJ OS=Delftia acidovorans CCUG 274B GN=argJ PE=3 SV=1
 3466 : S3MJS2_PSESY        0.38  0.66  193  405  189  403  216    4    4  405  S3MJS2     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. syringae SM GN=argJ PE=3 SV=1
 3467 : S3T7I4_9GAMM        0.38  0.64  193  405  190  404  218    6    8  406  S3T7I4     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter sp. NIPH 2036 GN=argJ PE=3 SV=1
 3468 : S3YNW9_9GAMM        0.38  0.63  193  405  190  404  218    6    8  406  S3YNW9     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter gyllenbergii MTCC 11365 GN=argJ PE=3 SV=1
 3469 : S6KHP6_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6KHP6     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 19098 GN=argJ PE=3 SV=1
 3470 : S6LPW1_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6LPW1     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 19073 GN=argJ PE=3 SV=1
 3471 : S6N450_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6N450     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 19072 GN=argJ PE=3 SV=1
 3472 : S6PS75_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6PS75     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 19104 GN=argJ PE=3 SV=1
 3473 : S6RLA7_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6RLA7     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 19102 GN=argJ PE=3 SV=1
 3474 : S6S2G5_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6S2G5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 19099 GN=argJ PE=3 SV=1
 3475 : S6S492_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6S492     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 9855 GN=argJ PE=3 SV=1
 3476 : S6SPT3_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6SPT3     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 18883 GN=argJ PE=3 SV=1
 3477 : S6SU69_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6SU69     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 19100 GN=argJ PE=3 SV=1
 3478 : S6USA5_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6USA5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 19095 GN=argJ PE=3 SV=1
 3479 : S6UWZ0_PSESF        0.38  0.66  193  405   68  282  216    4    4  284  S6UWZ0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 18807 GN=argJ PE=3 SV=1
 3480 : S6VE83_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6VE83     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 19094 GN=argJ PE=3 SV=1
 3481 : S6WHA8_PSESF        0.38  0.66  193  405  189  403  216    4    4  405  S6WHA8     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae pv. actinidiae ICMP 18801 GN=argJ PE=3 SV=1
 3482 : S9RWX2_9RALS        0.38  0.67  193  405  193  407  216    4    4  409  S9RWX2     Arginine biosynthesis bifunctional protein ArgJ OS=Ralstonia sp. AU12-08 GN=argJ PE=3 SV=1
 3483 : T0JG99_9HELI        0.38  0.57  193  405  183  389  224    6   28  391  T0JG99     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfurimonas sp. AST-10 GN=argJ PE=3 SV=1
 3484 : T2GUC3_MYCAV        0.38  0.60    8  191   11  199  193    7   13  404  T2GUC3     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. hominissuis TH135 GN=argJ PE=3 SV=1
 3485 : U3G732_9RALS        0.38  0.68  193  405  193  407  216    4    4  409  U3G732     Arginine biosynthesis bifunctional protein ArgJ OS=Ralstonia sp. 5_2_56FAA GN=argJ PE=3 SV=1
 3486 : U5BS94_9BACT        0.38  0.60  193  405  185  401  221    6   12  403  U5BS94     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodonellum psychrophilum GCM71 = DSM 17998 GN=argJ PE=3 SV=1
 3487 : V2V247_9GAMM        0.38  0.63  193  405  190  404  218    6    8  406  V2V247     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter gyllenbergii NIPH 230 GN=argJ PE=3 SV=1
 3488 : V4ZTM6_RALSL        0.38  0.67  193  405  193  407  216    4    4  409  V4ZTM6     Arginine biosynthesis bifunctional protein ArgJ OS=Ralstonia solanacearum SD54 GN=argJ PE=3 SV=1
 3489 : V6UC82_9ACTO        0.38  0.60   12  191    2  179  188    8   18  384  V6UC82     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces sp. HCCB10043 GN=argJ PE=3 SV=1
 3490 : V7J0R1_MYCAV        0.38  0.59    8  191   11  199  193    6   13  404  V7J0R1     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium 05-4293 GN=argJ PE=3 SV=1
 3491 : V7JH95_MYCAV        0.38  0.59    8  191   11  199  193    6   13  404  V7JH95     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium 10-5581 GN=argJ PE=3 SV=1
 3492 : V7JT40_MYCPC        0.38  0.59    8  191   11  199  193    6   13  404  V7JT40     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. paratuberculosis 10-4404 GN=argJ PE=3 SV=1
 3493 : V7K069_MYCPC        0.38  0.59    8  191   11  199  193    6   13  404  V7K069     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. paratuberculosis 10-5864 GN=argJ PE=3 SV=1
 3494 : V7KE80_MYCAV        0.38  0.59    8  191   11  199  193    6   13  404  V7KE80     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. silvaticum ATCC 49884 GN=argJ PE=3 SV=1
 3495 : V7KZY9_MYCAV        0.38  0.59    8  191   11  199  193    6   13  404  V7KZY9     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. avium 10-9275 GN=argJ PE=3 SV=1
 3496 : V7LE75_MYCAV        0.38  0.59    8  191   11  199  193    6   13  404  V7LE75     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. avium 11-4751 GN=argJ PE=3 SV=1
 3497 : V7LNJ9_MYCAV        0.38  0.59    8  191   11  199  193    6   13  404  V7LNJ9     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium 09-5983 GN=argJ PE=3 SV=1
 3498 : V7M0X2_MYCAV        0.38  0.59    8  191   11  199  193    6   13  404  V7M0X2     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. hominissuis 10-4249 GN=argJ PE=3 SV=1
 3499 : V7MVF2_MYCPC        0.38  0.59    8  191   11  199  193    6   13  404  V7MVF2     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. paratuberculosis 11-1786 GN=argJ PE=3 SV=1
 3500 : V7MY92_MYCAV        0.38  0.59    8  191   11  199  193    6   13  404  V7MY92     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium avium subsp. hominissuis 10-5606 GN=argJ PE=3 SV=1
 3501 : V7NH44_MYCAV        0.38  0.60   13  191   16  199  188    6   13  210  V7NH44     N-acetylglutamate synthase (Fragment) OS=Mycobacterium avium 11-0986 GN=O974_14600 PE=3 SV=1
 3502 : V9TUV8_9PROT        0.38  0.59  193  405  196  411  220    6   11  413  V9TUV8     Arginine biosynthesis bifunctional protein ArgJ OS=Candidatus Endolissoclinum faulkneri L5 GN=argJ PE=3 SV=1
 3503 : W0MMC1_PSESX        0.38  0.66  193  405  189  403  216    4    4  405  W0MMC1     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas syringae CC1557 GN=argJ PE=3 SV=1
 3504 : W4HVC4_MYCGS        0.38  0.60   13  191   16  198  188    6   14  403  W4HVC4     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium gastri 'Wayne' GN=argJ PE=3 SV=1
 3505 : W6LLB7_CAMFE        0.38  0.60  193  405  187  393  216    5   12  395  W6LLB7     Glutamate N-acetyltransferaseN-acetylglutamate synthase OS=Campylobacter fetus subsp. venerealis str. 84-112 GN=CSG_10210 PE=4 SV=1
 3506 : W7PRG3_9GAMM        0.38  0.64  193  405   24  234  215    5    6  236  W7PRG3     N-acetylglutamate synthase OS=Halomonas sp. BC04 GN=argJ PE=4 SV=1
 3507 : A1V0Q7_BURMS        0.37  0.64  193  405  197  411  216    4    4  413  A1V0Q7     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia mallei (strain SAVP1) GN=argJ PE=3 SV=1
 3508 : A1VK80_POLNA        0.37  0.64  193  405  197  411  218    6    8  413  A1VK80     Arginine biosynthesis bifunctional protein ArgJ OS=Polaromonas naphthalenivorans (strain CJ2) GN=argJ PE=3 SV=1
 3509 : A4FKC6_SACEN        0.37  0.57   12  191    2  180  190    8   21  385  A4FKC6     Arginine biosynthesis bifunctional protein ArgJ OS=Saccharopolyspora erythraea (strain NRRL 23338) GN=argJ PE=3 SV=1
 3510 : A4JBA4_BURVG        0.37  0.65  193  405  197  411  216    4    4  413  A4JBA4     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia vietnamiensis (strain G4 / LMG 22486) GN=argJ PE=3 SV=1
 3511 : A5GEY0_GEOUR        0.37  0.57   17  191    4  178  188    7   26  393  A5GEY0     Arginine biosynthesis bifunctional protein ArgJ OS=Geobacter uraniireducens (strain Rf4) GN=argJ PE=3 SV=1
 3512 : A8EVQ8_ARCB4        0.37  0.55  193  405  185  391  218    7   16  393  A8EVQ8     Arginine biosynthesis bifunctional protein ArgJ OS=Arcobacter butzleri (strain RM4018) GN=argJ PE=3 SV=1
 3513 : ARGJ3_STRC2         0.37  0.61  193  405  181  391  222    6   20  393  P0DJQ6     Arginine biosynthesis bifunctional protein ArgJ 3 OS=Streptomyces clavuligerus (strain ATCC 27064 / DSM 738 / JCM 4710 / NBRC 13307 / NCIMB 12785 / NRRL 3585 / VKM Ac-602) GN=argJ3 PE=3 SV=1
 3514 : ARGJ_BURP1          0.37  0.64  193  405  197  411  216    4    4  413  Q3JNE9     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia pseudomallei (strain 1710b) GN=argJ PE=3 SV=1
 3515 : ARGJ_BURPS          0.37  0.64  193  405  197  411  216    4    4  413  Q63QK7     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia pseudomallei (strain K96243) GN=argJ PE=3 SV=1
 3516 : ARGJ_PSEAE          0.37  0.66  193  405  189  403  216    4    4  405  Q9HW04     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) GN=argJ PE=3 SV=1
 3517 : ARGJ_SCHJY          0.37  0.53    2  191   17  215  204    8   19  435  B6JYD2     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Schizosaccharomyces japonicus (strain yFS275 / FY16936) GN=SJAG_01592 PE=3 SV=1
 3518 : B1JV88_BURCC        0.37  0.64  193  405  197  411  216    4    4  413  B1JV88     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia cenocepacia (strain MC0-3) GN=argJ PE=3 SV=1
 3519 : B1N2A9_BURPE        0.37  0.64  193  405  197  411  216    4    4  413  B1N2A9     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia pseudomallei S13 GN=argJ PE=3 SV=1
 3520 : B2SYW5_BURPP        0.37  0.64  193  405  197  411  216    4    4  413  B2SYW5     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia phytofirmans (strain DSM 17436 / PsJN) GN=argJ PE=3 SV=1
 3521 : B4E5Y2_BURCJ        0.37  0.64  193  405  197  411  216    4    4  413  B4E5Y2     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610) GN=argJ PE=3 SV=1
 3522 : B6GAZ4_9ACTN        0.37  0.54    8  191   20  214  199    7   19  430  B6GAZ4     Arginine biosynthesis bifunctional protein ArgJ OS=Collinsella stercoris DSM 13279 GN=argJ PE=3 SV=1
 3523 : B9CJR5_9BURK        0.37  0.64  193  405  197  411  216    4    4  413  B9CJR5     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia multivorans CGD2M GN=argJ PE=3 SV=1
 3524 : B9XQ46_9BACT        0.37  0.57   11  191    8  199  198    4   23  446  B9XQ46     Arginine biosynthesis bifunctional protein ArgJ OS=Pedosphaera parvula Ellin514 GN=argJ PE=3 SV=1
 3525 : C1A9Z6_GEMAT        0.37  0.57  193  405  187  392  214    4    9  395  C1A9Z6     Arginine biosynthesis bifunctional protein ArgJ OS=Gemmatimonas aurantiaca (strain T-27 / DSM 14586 / JCM 11422 / NBRC 100505) GN=argJ PE=3 SV=1
 3526 : C1DTK8_SULAA        0.37  0.57  193  405  176  384  215    6    8  386  C1DTK8     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfurihydrogenibium azorense (strain Az-Fu1 / DSM 15241 / OCM 825) GN=argJ PE=3 SV=1
 3527 : C5CXY8_VARPS        0.37  0.64  193  405  193  407  218    6    8  409  C5CXY8     Arginine biosynthesis bifunctional protein ArgJ OS=Variovorax paradoxus (strain S110) GN=argJ PE=3 SV=1
 3528 : C7Q9I3_CATAD        0.37  0.59  193  405  179  381  217    7   18  383  C7Q9I3     Arginine biosynthesis bifunctional protein ArgJ OS=Catenulispora acidiphila (strain DSM 44928 / NRRL B-24433 / NBRC 102108 / JCM 14897) GN=argJ PE=3 SV=1
 3529 : D7AV55_NOCDD        0.37  0.55  193  405  179  384  226    6   33  386  D7AV55     Arginine biosynthesis bifunctional protein ArgJ OS=Nocardiopsis dassonvillei (strain ATCC 23218 / DSM 43111 / IMRU 509 / JCM 7437 / NCTC 10488) GN=argJ PE=3 SV=1
 3530 : D7DRU9_METV3        0.37  0.59  193  405  240  455  233    7   37  457  D7DRU9     Arginine biosynthesis bifunctional protein ArgJ OS=Methanococcus voltae (strain ATCC BAA-1334 / A3) GN=argJ PE=3 SV=1
 3531 : D8D1F0_COMTE        0.37  0.63  193  405  193  407  218    6    8  409  D8D1F0     Arginine biosynthesis bifunctional protein ArgJ OS=Comamonas testosteroni S44 GN=argJ PE=3 SV=1
 3532 : E4N7Y6_KITSK        0.37  0.59  193  405  188  390  216    5   16  392  E4N7Y6     Arginine biosynthesis bifunctional protein ArgJ OS=Kitasatospora setae (strain ATCC 33774 / DSM 43861 / JCM 3304 / KCC A-0304 / NBRC 14216 / KM-6054) GN=argJ PE=3 SV=1
 3533 : E7BDH0_NEIMW        0.37  0.63  193  405  190  404  218    6    8  406  E7BDH0     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis serogroup A (strain WUE 2594) GN=argJ PE=3 SV=1
 3534 : E8S348_MICSL        0.37  0.63  193  405  186  388  213    4   10  390  E8S348     Arginine biosynthesis bifunctional protein ArgJ OS=Micromonospora sp. (strain L5) GN=argJ PE=3 SV=1
 3535 : E8YFH7_9BURK        0.37  0.64  193  405  197  411  216    4    4  413  E8YFH7     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia sp. CCGE1001 GN=argJ PE=3 SV=1
 3536 : F0A2D7_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  F0A2D7     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis OX99.30304 GN=argJ PE=3 SV=1
 3537 : F0GKZ1_9BURK        0.37  0.64  193  405  197  411  216    4    4  413  F0GKZ1     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia sp. TJI49 GN=argJ PE=3 SV=1
 3538 : F0MVM5_NEIMP        0.37  0.63  193  405  190  404  218    6    8  406  F0MVM5     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis serogroup B (strain M01-240355) GN=argJ PE=3 SV=1
 3539 : F1THU8_9CLOT        0.37  0.59    7  191    2  186  192    7   14  400  F1THU8     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium papyrosolvens DSM 2782 GN=argJ PE=3 SV=1
 3540 : F2JVW0_MARM1        0.37  0.65  193  405  190  404  216    4    4  406  F2JVW0     Arginine biosynthesis bifunctional protein ArgJ OS=Marinomonas mediterranea (strain ATCC 700492 / JCM 21426 / NBRC 103028 / MMB-1) GN=argJ PE=3 SV=1
 3541 : F3B3L7_9FIRM        0.37  0.59    7  190    2  188  187    2    3  350  F3B3L7     Arginine biosynthesis bifunctional protein ArgJ OS=Lachnospiraceae oral taxon 107 str. F0167 GN=argJ PE=3 SV=1
 3542 : F3L1Q1_9GAMM        0.37  0.64  193  405  183  396  215    3    3  398  F3L1Q1     Arginine biosynthesis bifunctional protein ArgJ OS=gamma proteobacterium IMCC3088 GN=argJ PE=3 SV=1
 3543 : F3NL80_9ACTO        0.37  0.62  193  405  179  381  213    3   10  383  F3NL80     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces griseoaurantiacus M045 GN=argJ PE=3 SV=1
 3544 : F4CLG2_PSEUX        0.37  0.57  193  405  182  384  219    6   22  386  F4CLG2     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudonocardia dioxanivorans (strain ATCC 55486 / DSM 44775 / JCM 13855 / CB1190) GN=argJ PE=3 SV=1
 3545 : F6AE05_PSEF1        0.37  0.65  193  405  189  403  216    4    4  405  F6AE05     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas fulva (strain 12-X) GN=argJ PE=3 SV=1
 3546 : G2DCJ1_9GAMM        0.37  0.66  193  405  185  399  218    6    8  401  G2DCJ1     Arginine biosynthesis bifunctional protein ArgJ OS=endosymbiont of Riftia pachyptila (vent Ph05) GN=argJ PE=3 SV=1
 3547 : G2FES3_9GAMM        0.37  0.66  193  405  185  399  218    6    8  401  G2FES3     Arginine biosynthesis bifunctional protein ArgJ OS=endosymbiont of Tevnia jerichonana (vent Tica) GN=argJ PE=3 SV=1
 3548 : G2FR56_9FIRM        0.37  0.55    7  191    9  208  206    8   27  419  G2FR56     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfosporosinus sp. OT GN=argJ PE=3 SV=1
 3549 : G2HPR5_9PROT        0.37  0.55  193  405  185  391  218    7   16  393  G2HPR5     Arginine biosynthesis bifunctional protein ArgJ OS=Arcobacter butzleri ED-1 GN=argJ PE=3 SV=1
 3550 : G2L8K2_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  G2L8K2     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa M18 GN=argJ PE=3 SV=1
 3551 : G4LLN9_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  G4LLN9     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa NCGM2.S1 GN=argJ PE=3 SV=1
 3552 : G5G071_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  G5G071     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas sp. 2_1_26 GN=argJ PE=3 SV=1
 3553 : G8QMR6_AZOSU        0.37  0.63  193  405  194  411  221    7   11  413  G8QMR6     Arginine biosynthesis bifunctional protein ArgJ OS=Azospira oryzae (strain ATCC BAA-33 / DSM 13638 / PS) GN=argJ PE=3 SV=1
 3554 : H0B419_9ACTO        0.37  0.61   12  191    2  179  188    8   18  384  H0B419     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces sp. W007 GN=argJ PE=3 SV=1
 3555 : H0BYJ8_9BURK        0.37  0.64  193  405  193  407  218    6    8  409  H0BYJ8     Arginine biosynthesis bifunctional protein ArgJ OS=Acidovorax sp. NO-1 GN=argJ PE=3 SV=1
 3556 : H2JFH3_9CLOT        0.37  0.59    7  191    2  186  192    7   14  400  H2JFH3     Arginine biosynthesis bifunctional protein ArgJ OS=Clostridium sp. BNL1100 GN=argJ PE=3 SV=1
 3557 : H3SST0_PSEAE        0.37  0.66  193  405  189  403  216    4    4  405  H3SST0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa MPAO1/P1 GN=argJ PE=3 SV=1
 3558 : H3T8Y5_PSEAE        0.37  0.66  193  405  189  403  216    4    4  405  H3T8Y5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa MPAO1/P2 GN=argJ PE=3 SV=1
 3559 : H5XQ20_9PSEU        0.37  0.59  193  405  179  381  215    5   14  383  H5XQ20     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Saccharomonospora cyanea NA-134 GN=argJ PE=3 SV=1
 3560 : H5XRW6_9FIRM        0.37  0.57   11  191   13  208  198    6   19  419  H5XRW6     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfosporosinus youngiae DSM 17734 GN=argJ PE=3 SV=1
 3561 : I0HEE0_ACTM4        0.37  0.64  193  405  186  388  214    4   12  390  I0HEE0     Arginine biosynthesis bifunctional protein ArgJ OS=Actinoplanes missouriensis (strain ATCC 14538 / DSM 43046 / CBS 188.64 / JCM 3121 / NCIMB 12654 / NBRC 102363 / 431) GN=argJ PE=3 SV=1
 3562 : I2BPC5_PSEFL        0.37  0.67  193  405  189  403  216    4    4  405  I2BPC5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas fluorescens A506 GN=argJ PE=3 SV=1
 3563 : I2DJM6_9BURK        0.37  0.65  193  405  185  399  216    4    4  401  I2DJM6     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia sp. KJ006 GN=argJ PE=3 SV=1
 3564 : I2HCJ8_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  I2HCJ8     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM233 GN=argJ PE=3 SV=1
 3565 : I2IFU2_9BURK        0.37  0.64  193  405  197  411  216    4    4  413  I2IFU2     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia sp. Ch1-1 GN=argJ PE=3 SV=1
 3566 : I2KDC4_BURPE        0.37  0.64  193  405  197  411  216    4    4  413  I2KDC4     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia pseudomallei 1026a GN=argJ PE=3 SV=1
 3567 : I2LQS6_BURPE        0.37  0.64  193  405  197  411  216    4    4  413  I2LQS6     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia pseudomallei 1258a GN=argJ PE=3 SV=1
 3568 : I2MET9_BURPE        0.37  0.64  193  405  197  411  216    4    4  413  I2MET9     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia pseudomallei 354e GN=argJ PE=3 SV=1
 3569 : I2MS93_BURPE        0.37  0.64  193  405  197  411  216    4    4  413  I2MS93     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia pseudomallei 354a GN=argJ PE=3 SV=1
 3570 : I3IJ28_9PLAN        0.37  0.61  193  405  195  410  220    5   11  412  I3IJ28     Arginine biosynthesis bifunctional protein ArgJ OS=planctomycete KSU-1 GN=argJ PE=3 SV=1
 3571 : I4C0C3_DESTA        0.37  0.64  193  405  186  398  217    5    8  400  I4C0C3     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfomonile tiedjei (strain ATCC 49306 / DSM 6799 / DCB-1) GN=argJ PE=3 SV=1
 3572 : I4D1C1_DESAJ        0.37  0.54   11  191   13  208  201    7   25  419  I4D1C1     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfosporosinus acidiphilus (strain DSM 22704 / JCM 16185 / SJ4) GN=argJ PE=3 SV=1
 3573 : I7JEB6_9LACT        0.37  0.58  193  405   55  260  216    5   13  262  I7JEB6     Arginine biosynthesis bifunctional protein ArgJ OS=Lactococcus raffinolactis 4877 GN=argJ PE=3 SV=1
 3574 : J2U658_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  J2U658     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Pseudomonas sp. GM60 GN=argJ PE=3 SV=1
 3575 : J2XSY6_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  J2XSY6     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Pseudomonas sp. GM25 GN=argJ PE=3 SV=1
 3576 : J3EYY6_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  J3EYY6     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Pseudomonas sp. GM18 GN=argJ PE=3 SV=1
 3577 : J3G2R5_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  J3G2R5     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Pseudomonas sp. GM48 GN=argJ PE=3 SV=1
 3578 : J3GU20_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  J3GU20     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Pseudomonas sp. GM49 GN=argJ PE=3 SV=1
 3579 : J3H169_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  J3H169     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Pseudomonas sp. GM67 GN=argJ PE=3 SV=1
 3580 : J3H608_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  J3H608     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Pseudomonas sp. GM74 GN=argJ PE=3 SV=1
 3581 : J4JHS9_9BURK        0.37  0.63  193  405  197  411  218    6    8  413  J4JHS9     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia multivorans CF2 GN=argJ PE=3 SV=1
 3582 : J4RHD6_9BURK        0.37  0.64  193  405  197  411  216    4    4  413  J4RHD6     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia multivorans ATCC BAA-247 GN=argJ PE=3 SV=1
 3583 : J8W8V0_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  J8W8V0     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 93003 GN=argJ PE=3 SV=1
 3584 : K0DM41_9BURK        0.37  0.64  193  405  197  411  216    4    4  413  K0DM41     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia phenoliruptrix BR3459a GN=argJ PE=3 SV=1
 3585 : K0Y9F5_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  K0Y9F5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa PAO579 GN=argJ PE=3 SV=1
 3586 : K1BRG7_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  K1BRG7     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa ATCC 700888 GN=argJ PE=3 SV=1
 3587 : K1C9W7_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  K1C9W7     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa CI27 GN=argJ PE=3 SV=1
 3588 : K1D8E7_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  K1D8E7     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa E2 GN=argJ PE=3 SV=1
 3589 : K5YRU7_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  K5YRU7     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas sp. Chol1 GN=argJ PE=3 SV=1
 3590 : K7PWC6_BURPE        0.37  0.64  193  405  197  411  216    4    4  413  K7PWC6     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia pseudomallei BPC006 GN=argJ PE=3 SV=1
 3591 : K8RKD4_9BURK        0.37  0.63  193  405  197  411  216    4    4  413  K8RKD4     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia sp. SJ98 GN=argJ PE=3 SV=1
 3592 : K9NPH3_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  K9NPH3     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas sp. UW4 GN=argJ PE=3 SV=1
 3593 : L5U495_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  L5U495     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM3652 GN=argJ PE=3 SV=1
 3594 : L5U5P9_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  L5U5P9     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM3642 GN=argJ PE=3 SV=1
 3595 : L5UKI1_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  L5UKI1     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2001212 GN=argJ PE=3 SV=1
 3596 : L8P6U9_STRVR        0.37  0.60  193  405  179  381  213    3   10  383  L8P6U9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces viridochromogenes Tue57 GN=argJ PE=3 SV=1
 3597 : M1LVH6_9PROT        0.37  0.65  193  405  191  403  216    5    6  405  M1LVH6     Arginine biosynthesis bifunctional protein ArgJ OS=Candidatus Kinetoplastibacterium oncopeltii TCC290E GN=argJ PE=3 SV=1
 3598 : M4K226_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  M4K226     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas poae RE*1-1-14 GN=argJ PE=3 SV=1
 3599 : M5A3F5_9ACTN        0.37  0.57  193  405  178  383  222    6   25  385  M5A3F5     Arginine biosynthesis bifunctional protein ArgJ OS=Ilumatobacter coccineus YM16-304 GN=argJ PE=3 SV=1
 3600 : M9SAK3_9EURY        0.37  0.61  193  405  193  406  221    6   15  408  M9SAK3     Arginine biosynthesis bifunctional protein ArgJ OS=Candidatus Methanomethylophilus alvus Mx1201 GN=argJ PE=3 SV=1
 3601 : M9SBF5_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  M9SBF5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa B136-33 GN=argJ PE=3 SV=1
 3602 : N2CIT1_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  N2CIT1     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa str. Stone 130 GN=argJ PE=3 SV=1
 3603 : Q02H38_PSEAB        0.37  0.66  193  405  189  403  216    4    4  405  Q02H38     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa (strain UCBPP-PA14) GN=argJ PE=3 SV=1
 3604 : Q21UD2_RHOFD        0.37  0.64  193  405  193  407  217    6    6  409  Q21UD2     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodoferax ferrireducens (strain DSM 15236 / ATCC BAA-621 / T118) GN=argJ PE=3 SV=1
 3605 : Q40II2_EHRCH        0.37  0.60  193  405  205  419  217    5    6  421  Q40II2     Arginine biosynthesis bifunctional protein ArgJ OS=Ehrlichia chaffeensis str. Sapulpa GN=argJ PE=3 SV=1
 3606 : Q6SHA0_9BACT        0.37  0.61  193  405  183  392  215    5    7  394  Q6SHA0     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured marine bacterium 441 GN=argJ PE=3 SV=1
 3607 : R0KJ62_SETT2        0.37  0.54  193  405  241  462  235    5   35  464  R0KJ62     Uncharacterized protein OS=Setosphaeria turcica (strain 28A) GN=SETTUDRAFT_167746 PE=3 SV=1
 3608 : R0NXL1_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  R0NXL1     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 75689 GN=argJ PE=3 SV=1
 3609 : R0Q8W0_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  R0Q8W0     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 94018 GN=argJ PE=3 SV=1
 3610 : R0QHT9_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  R0QHT9     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 96024 GN=argJ PE=3 SV=1
 3611 : R0QUR7_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  R0QUR7     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 97018 GN=argJ PE=3 SV=1
 3612 : R0R221_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  R0R221     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2004085 GN=argJ PE=3 SV=1
 3613 : R0RGR0_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  R0RGR0     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2000063 GN=argJ PE=3 SV=1
 3614 : R0SQF3_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  R0SQF3     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2003022 GN=argJ PE=3 SV=1
 3615 : R0TKF2_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  R0TKF2     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM606 GN=argJ PE=3 SV=1
 3616 : R0TRL7_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  R0TRL7     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM607 GN=argJ PE=3 SV=1
 3617 : R0XA00_NEIME        0.37  0.64  216  405    5  196  193    4    4  198  R0XA00     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM90 GN=argJ PE=3 SV=1
 3618 : R0YQD0_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  R0YQD0     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM27 GN=argJ PE=3 SV=1
 3619 : R7B6Q2_9ACTN        0.37  0.55    1  191   11  210  200    6    9  425  R7B6Q2     Arginine biosynthesis bifunctional protein ArgJ OS=Eggerthella sp. CAG:298 GN=argJ PE=3 SV=1
 3620 : R7CLW0_9ACTN        0.37  0.57    8  191    9  206  199    7   16  439  R7CLW0     Arginine biosynthesis bifunctional protein ArgJ OS=Cryptobacterium sp. CAG:338 GN=argJ PE=3 SV=1
 3621 : R7K881_9FIRM        0.37  0.58    7  191    2  186  196    7   22  404  R7K881     Arginine biosynthesis bifunctional protein ArgJ OS=Acidaminococcus sp. CAG:917 GN=argJ PE=3 SV=1
 3622 : R7MPW2_9FIRM        0.37  0.56    7  191   10  212  205    5   22  430  R7MPW2     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:624 GN=argJ PE=3 SV=1
 3623 : R7X962_9BURK        0.37  0.65  193  405  193  407  216    4    4  409  R7X962     Arginine biosynthesis bifunctional protein ArgJ OS=Pandoraea sp. SD6-2 GN=argJ PE=3 SV=1
 3624 : R9ZKE4_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  R9ZKE4     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa RP73 GN=argJ PE=3 SV=1
 3625 : S0H3V7_STRA9        0.37  0.56  193  405  180  385  229    7   39  387  S0H3V7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces albulus CCRC 11814 GN=argJ PE=3 SV=1
 3626 : S0HE19_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  S0HE19     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa MSH-10 GN=argJ PE=3 SV=1
 3627 : S0I0Y4_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  S0I0Y4     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa PAK GN=argJ PE=3 SV=1
 3628 : S0IQ05_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  S0IQ05     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa PA14 GN=argJ PE=3 SV=1
 3629 : S3CNE5_GLAL2        0.37  0.56  193  405  243  472  235    6   27  474  S3CNE5     DmpA/ArgJ-like protein OS=Glarea lozoyensis (strain ATCC 20868 / MF5171) GN=GLAREA_04803 PE=3 SV=1
 3630 : S3LT66_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  S3LT66     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM134 GN=argJ PE=3 SV=1
 3631 : S3WQR9_9ACTO        0.37  0.56  193  405  179  381  217    7   18  383  S3WQR9     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium sp. oral taxon 192 str. F0372 GN=argJ PE=3 SV=1
 3632 : S4MS77_9ACTO        0.37  0.61  193  405  177  379  213    3   10  381  S4MS77     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces afghaniensis 772 GN=argJ PE=3 SV=1
 3633 : S5NLM9_BURPE        0.37  0.64  193  405  197  411  216    4    4  413  S5NLM9     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia pseudomallei MSHR305 GN=argJ PE=3 SV=1
 3634 : S5PRB8_9PROT        0.37  0.55  193  405  185  391  218    7   16  393  S5PRB8     Arginine biosynthesis bifunctional protein ArgJ OS=Arcobacter butzleri 7h1h GN=argJ PE=3 SV=1
 3635 : S6GRB2_9PSED        0.37  0.67  193  405  189  403  216    4    4  405  S6GRB2     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas sp. CFT9 GN=argJ PE=3 SV=1
 3636 : S6J8D0_9PSED        0.37  0.55  193  405  178  383  229    7   39  385  S6J8D0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas sp. CF161 GN=argJ PE=3 SV=1
 3637 : T0K9K9_COLGC        0.37  0.53  193  405  229  458  235    6   27  460  T0K9K9     Uncharacterized protein OS=Colletotrichum gloeosporioides (strain Cg-14) GN=CGLO_12049 PE=3 SV=1
 3638 : T0W450_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  T0W450     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM3139 GN=argJ PE=3 SV=1
 3639 : T0W5J1_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  T0W5J1     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM045 GN=argJ PE=3 SV=1
 3640 : T0WJE4_NEIME        0.37  0.63  193  405  190  404  218    6    8  406  T0WJE4     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM003 GN=argJ PE=3 SV=1
 3641 : T1AG22_9ZZZZ        0.37  0.59   10  191    5  191  187    4    5  201  T1AG22     Arginine biosynthesis protein ArgJ (Fragment) OS=mine drainage metagenome GN=B1B_14748 PE=3 SV=1
 3642 : T2ECW8_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  T2ECW8     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa c7447m GN=argJ PE=3 SV=1
 3643 : T2RQT0_SACER        0.37  0.57   12  191    2  180  190    8   21  385  T2RQT0     Arginine biosynthesis bifunctional protein ArgJ OS=Saccharopolyspora erythraea D GN=argJ PE=3 SV=1
 3644 : T5KG18_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  T5KG18     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa WC55 GN=argJ PE=3 SV=1
 3645 : U5RQ02_PSEAE        0.37  0.66  193  405  189  403  216    4    4  405  U5RQ02     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa PAO1-VE13 GN=argJ PE=3 SV=1
 3646 : U6ATP8_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U6ATP8     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa PA1R GN=argJ PE=3 SV=1
 3647 : U7P9F1_9GAMM        0.37  0.63  193  405  193  403  215    5    6  405  U7P9F1     Arginine biosynthesis bifunctional protein ArgJ OS=Halomonas sp. PBN3 GN=argJ PE=3 SV=1
 3648 : U8BS02_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8BS02     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa C52 GN=argJ PE=3 SV=1
 3649 : U8CE41_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8CE41     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa C51 GN=argJ PE=3 SV=1
 3650 : U8D5Z5_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8D5Z5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa C40 GN=argJ PE=3 SV=1
 3651 : U8DPC6_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8DPC6     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa C41 GN=argJ PE=3 SV=1
 3652 : U8E213_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8E213     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa C23 GN=argJ PE=3 SV=1
 3653 : U8JAJ1_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8JAJ1     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BL11 GN=argJ PE=3 SV=1
 3654 : U8L572_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8L572     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BL08 GN=argJ PE=3 SV=1
 3655 : U8LXX7_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8LXX7     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BL04 GN=argJ PE=3 SV=1
 3656 : U8M755_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8M755     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BWHPSA028 GN=argJ PE=3 SV=1
 3657 : U8QAQ4_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8QAQ4     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BWHPSA022 GN=argJ PE=3 SV=1
 3658 : U8TBI0_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8TBI0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BWHPSA018 GN=argJ PE=3 SV=1
 3659 : U8VHU5_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8VHU5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BWHPSA006 GN=argJ PE=3 SV=1
 3660 : U8VIL8_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8VIL8     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BWHPSA005 GN=argJ PE=3 SV=1
 3661 : U8WUG5_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8WUG5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BWHPSA002 GN=argJ PE=3 SV=1
 3662 : U8XBC5_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8XBC5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BWHPSA003 GN=argJ PE=3 SV=1
 3663 : U8XWK6_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8XWK6     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BWHPSA001 GN=argJ PE=3 SV=1
 3664 : U8YRZ8_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8YRZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa X13273 GN=argJ PE=3 SV=1
 3665 : U8ZS99_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8ZS99     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa 6077 GN=argJ PE=3 SV=1
 3666 : U8ZZA1_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U8ZZA1     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa 19660 GN=argJ PE=3 SV=1
 3667 : U9B1J2_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9B1J2     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa UDL GN=argJ PE=3 SV=1
 3668 : U9DDG8_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9DDG8     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa MSH3 GN=argJ PE=3 SV=1
 3669 : U9DIH9_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9DIH9     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa 62 GN=argJ PE=3 SV=1
 3670 : U9DYX4_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9DYX4     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa M8A.4 GN=argJ PE=3 SV=1
 3671 : U9ELE4_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9ELE4     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BL25 GN=argJ PE=3 SV=1
 3672 : U9F4F3_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9F4F3     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BL23 GN=argJ PE=3 SV=1
 3673 : U9G5Q5_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9G5Q5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BL21 GN=argJ PE=3 SV=1
 3674 : U9H6M2_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9H6M2     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BL20 GN=argJ PE=3 SV=1
 3675 : U9HFB1_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9HFB1     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BL13 GN=argJ PE=3 SV=1
 3676 : U9IST3_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9IST3     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BL06 GN=argJ PE=3 SV=1
 3677 : U9LWF3_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9LWF3     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BWHPSA015 GN=argJ PE=3 SV=1
 3678 : U9N9D3_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9N9D3     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BWHPSA009 GN=argJ PE=3 SV=1
 3679 : U9NBN4_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9NBN4     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa BWHPSA008 GN=argJ PE=3 SV=1
 3680 : U9Q1Y7_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9Q1Y7     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa CF5 GN=argJ PE=3 SV=1
 3681 : U9RGN6_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9RGN6     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa MSH10 GN=argJ PE=3 SV=1
 3682 : U9SL58_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  U9SL58     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa M8A.3 GN=argJ PE=3 SV=1
 3683 : V4N0T0_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  V4N0T0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa HB15 GN=argJ PE=3 SV=1
 3684 : V4X815_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  V4X815     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa DHS01 GN=argJ PE=3 SV=1
 3685 : V4YE89_9PROT        0.37  0.65  193  405  193  405  215    4    4  407  V4YE89     Arginine biosynthesis bifunctional protein ArgJ OS=Betaproteobacteria bacterium MOLA814 GN=argJ PE=3 SV=1
 3686 : V5PMN5_9BURK        0.37  0.65  193  405  193  407  216    4    4  409  V5PMN5     Arginine biosynthesis bifunctional protein ArgJ OS=Pandoraea pnomenusa 3kgm GN=argJ PE=3 SV=1
 3687 : V5T1U6_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  V5T1U6     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa MTB-1 GN=argJ PE=3 SV=1
 3688 : V5UC69_9BURK        0.37  0.65  193  405  193  407  216    4    4  409  V5UC69     Arginine biosynthesis bifunctional protein ArgJ OS=Pandoraea sp. RB-44 GN=argJ PE=3 SV=1
 3689 : V6AL83_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  V6AL83     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa MH27 GN=argJ PE=3 SV=1
 3690 : V6H8V8_9LEPT        0.37  0.53  193  405  179  381  232    7   48  383  V6H8V8     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira inadai serovar Lyme str. 10 GN=argJ PE=3 SV=1
 3691 : V6JNV5_STRRC        0.37  0.58  193  405  188  390  217    5   18  392  V6JNV5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces roseochromogenes subsp. oscitans DS 12.976 GN=argJ PE=3 SV=1
 3692 : V6JNV5_STRRC        0.37  0.58   12  191    2  187  195   10   24  392  V6JNV5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces roseochromogenes subsp. oscitans DS 12.976 GN=argJ PE=3 SV=1
 3693 : V8ENW0_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  V8ENW0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa VRFPA08 GN=argJ PE=3 SV=1
 3694 : V9R1Y5_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  V9R1Y5     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas sp. TKP GN=argJ PE=3 SV=1
 3695 : V9TBT6_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  V9TBT6     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa LES431 GN=argJ PE=3 SV=1
 3696 : V9U9J9_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  V9U9J9     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa SCV20265 GN=argJ PE=3 SV=1
 3697 : V9YQP3_BURPE        0.37  0.64  193  405  197  411  216    4    4  413  V9YQP3     Arginine biosynthesis bifunctional protein ArgJ OS=Burkholderia pseudomallei NAU20B-16 GN=argJ PE=3 SV=1
 3698 : W0EHZ2_9FIRM        0.37  0.56   13  191   15  204  196    6   23  415  W0EHZ2     Arginine biosynthesis bifunctional protein ArgJ OS=Dehalobacter restrictus DSM 9455 GN=argJ PE=3 SV=1
 3699 : W0HA15_PSECI        0.37  0.67  193  405  189  403  216    4    4  405  W0HA15     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas cichorii JBC1 GN=argJ PE=3 SV=1
 3700 : W0PE23_9BURK        0.37  0.63  193  405  193  406  217    6    7  408  W0PE23     Arginine biosynthesis bifunctional protein ArgJ OS=Advenella mimigardefordensis DPN7 GN=argJ PE=3 SV=1
 3701 : W1MRK8_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  W1MRK8     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa VRFPA03 GN=argJ PE=3 SV=1
 3702 : W1PJE0_AMBTC        0.37  0.58  193  405  247  457  220    6   16  459  W1PJE0     Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s00012p00117440 PE=3 SV=1
 3703 : W1QRP6_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  W1QRP6     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas aeruginosa DHS29 GN=argJ PE=3 SV=1
 3704 : W5V486_PSEAI        0.37  0.66  193  405  189  403  216    4    4  405  W5V486     N-acetylglutamate synthase OS=Pseudomonas aeruginosa YL84 GN=argJ PE=4 SV=1
 3705 : W5WF33_9PSEU        0.37  0.62  193  405  196  398  215    4   14  400  W5WF33     Uncharacterized protein OS=Kutzneria albida DSM 43870 GN=KALB_6454 PE=4 SV=1
 3706 : W6BZU8_BURTH        0.37  0.64  193  405  197  411  216    4    4  413  W6BZU8     Glutamate N-acetyltransferase/amino-acid acetyltransferase OS=Burkholderia thailandensis E444 GN=argJ PE=4 SV=1
 3707 : W6JTK8_9MICO        0.37  0.59  193  405  179  381  217    7   18  383  W6JTK8     Glutamate N-acetyltransferase OS=Tetrasphaera australiensis Ben110 GN=argJ PE=4 SV=1
 3708 : W6R158_PSEPS        0.37  0.65  193  405  189  403  218    6    8  405  W6R158     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Pseudomonas pseudoalcaligenes CECT 5344 GN=argJ PE=4 SV=1
 3709 : W6UUB9_9PSED        0.37  0.66  193  405  189  403  216    4    4  405  W6UUB9     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas sp. GM41(2012) GN=PMI27_005371 PE=4 SV=1
 3710 : W6ZT44_9GAMM        0.37  0.68  193  405  185  398  215    3    3  400  W6ZT44     N-acetylglutamate synthase OS=Alcanivorax sp. 97CO-5 GN=argJ PE=4 SV=1
 3711 : W7VUX9_9ACTO        0.37  0.62  193  405   74  276  213    3   10  278  W7VUX9     ArgJ family protein OS=Micromonospora sp. M42 GN=MCBG_01533 PE=4 SV=1
 3712 : W7WYA6_9BURK        0.37  0.62  193  405  199  413  218    6    8  415  W7WYA6     Arginine biosynthesis bifunctional protein ArgJ OS=Hydrogenophaga sp. T4 GN=argJ PE=4 SV=1
 3713 : A1AWY2_RUTMC        0.36  0.62  193  405  198  407  219    7   15  409  A1AWY2     Arginine biosynthesis bifunctional protein ArgJ OS=Ruthia magnifica subsp. Calyptogena magnifica GN=argJ PE=3 SV=1
 3714 : A1KW83_NEIMF        0.36  0.63  193  405  190  404  218    6    8  406  A1KW83     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18) GN=argJ PE=3 SV=1
 3715 : A1SJI8_NOCSJ        0.36  0.59  193  405  179  381  214    4   12  383  A1SJI8     Arginine biosynthesis bifunctional protein ArgJ OS=Nocardioides sp. (strain BAA-499 / JS614) GN=argJ PE=3 SV=1
 3716 : A5CSI7_CLAM3        0.36  0.59  193  405  180  382  214    4   12  384  A5CSI7     Arginine biosynthesis bifunctional protein ArgJ OS=Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382) GN=argJ PE=3 SV=1
 3717 : A5CWB1_VESOH        0.36  0.62  193  405  194  403  218    5   13  405  A5CWB1     Arginine biosynthesis bifunctional protein ArgJ OS=Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA) GN=argJ PE=3 SV=1
 3718 : A6QC91_SULNB        0.36  0.58  193  405  190  396  218    7   16  398  A6QC91     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfurovum sp. (strain NBC37-1) GN=argJ PE=3 SV=1
 3719 : A6VYJ0_MARMS        0.36  0.61  193  405  190  404  218    6    8  406  A6VYJ0     Arginine biosynthesis bifunctional protein ArgJ OS=Marinomonas sp. (strain MWYL1) GN=argJ PE=3 SV=1
 3720 : ARGJ_AQUAE          0.36  0.53  193  405  174  377  216    5   15  379  O67100     Arginine biosynthesis bifunctional protein ArgJ OS=Aquifex aeolicus (strain VF5) GN=argJ PE=3 SV=1
 3721 : ARGJ_ASPFN          0.36  0.51    7  191   39  233  204    9   28  466  B8NEJ3     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / NRRL 3357 / JCM 12722 / SRRC 167) GN=AFLA_061910 PE=3 SV=1
 3722 : ARGJ_ASPOR          0.36  0.51    7  191   29  223  204    9   28  456  Q2U7R8     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Aspergillus oryzae (strain ATCC 42149 / RIB 40) GN=AO090701000729 PE=3 SV=1
 3723 : ARGJ_NEIMB          0.36  0.63  193  405  190  404  218    6    8  406  P63574     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis serogroup B (strain MC58) GN=argJ PE=3 SV=1
 3724 : ARGJ_PICGU          0.36  0.54    7  191   16  208  199    6   20  436  A5DAF0     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324) GN=PGUG_00255 PE=3 SV=2
 3725 : ARGJ_PICST          0.36  0.51   16  191   29  213  200    8   39  441  A3LWC0     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545) GN=PICST_60752 PE=3 SV=2
 3726 : ARGJ_SCHPO          0.36  0.54  193  405  226  443  235    5   39  445  O94346     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=SPBC1271.14 PE=3 SV=1
 3727 : B8KJ25_9GAMM        0.36  0.64  193  405  193  407  218    5    8  409  B8KJ25     Arginine biosynthesis bifunctional protein ArgJ OS=gamma proteobacterium NOR5-3 GN=argJ PE=3 SV=1
 3728 : C0EQN7_NEIFL        0.36  0.64  193  405  190  404  218    6    8  406  C0EQN7     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria flavescens NRL30031/H210 GN=argJ PE=3 SV=1
 3729 : C0W7M0_9ACTO        0.36  0.54   12  191    2  195  199    9   24  403  C0W7M0     Arginine biosynthesis bifunctional protein ArgJ OS=Actinomyces urogenitalis DSM 15434 GN=argJ PE=3 SV=1
 3730 : C1AT01_RHOOB        0.36  0.56    1  191   14  209  202    8   17  414  C1AT01     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodococcus opacus (strain B4) GN=argJ PE=3 SV=1
 3731 : C6SG49_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  C6SG49     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis alpha153 GN=argJ PE=3 SV=1
 3732 : C6WA85_ACTMD        0.36  0.57  193  405  186  388  218    5   20  390  C6WA85     Arginine biosynthesis bifunctional protein ArgJ OS=Actinosynnema mirum (strain ATCC 29888 / DSM 43827 / NBRC 14064 / IMRU 3971) GN=argJ PE=3 SV=1
 3733 : C6XPX2_HIRBI        0.36  0.59  193  405  199  411  226    9   26  413  C6XPX2     Arginine biosynthesis bifunctional protein ArgJ OS=Hirschia baltica (strain ATCC 49814 / DSM 5838 / IFAM 1418) GN=argJ PE=3 SV=1
 3734 : C9Z4K3_STRSW        0.36  0.57   12  191    2  187  197   11   28  392  C9Z4K3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces scabies (strain 87.22) GN=argJ PE=3 SV=1
 3735 : D1KB84_9GAMM        0.36  0.61   12  191    4  182  181    2    3  211  D1KB84     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured SUP05 cluster bacterium GN=argJ PE=3 SV=1
 3736 : D2ZWS7_NEIMU        0.36  0.63  193  405  190  404  218    6    8  406  D2ZWS7     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria mucosa ATCC 25996 GN=argJ PE=3 SV=1
 3737 : D3LKJ2_MICLU        0.36  0.52   12  191    2  178  197    9   37  386  D3LKJ2     Arginine biosynthesis bifunctional protein ArgJ OS=Micrococcus luteus SK58 GN=argJ PE=3 SV=1
 3738 : D3P9R5_DEFDS        0.36  0.61  193  405  190  400  217    6   10  402  D3P9R5     Arginine biosynthesis bifunctional protein ArgJ OS=Deferribacter desulfuricans (strain DSM 14783 / JCM 11476 / NBRC 101012 / SSM1) GN=argJ PE=3 SV=1
 3739 : D4DPT5_NEIEG        0.36  0.63  193  405  190  403  217    5    7  405  D4DPT5     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria elongata subsp. glycolytica ATCC 29315 GN=argJ PE=3 SV=1
 3740 : D5Y3V0_MYCTX        0.36  0.57   38  191    1  158  162    5   12  179  D5Y3V0     Glutamate N-acetyltransferase (Fragment) OS=Mycobacterium tuberculosis T85 GN=TBEG_02961 PE=3 SV=1
 3741 : D6B9F1_9ACTO        0.36  0.61  193  405  179  381  217    6   18  383  D6B9F1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces albus J1074 GN=argJ PE=3 SV=1
 3742 : D7BYQ1_STRBB        0.36  0.59  193  405  180  382  217    5   18  384  D7BYQ1     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces bingchenggensis (strain BCW-1) GN=argJ PE=3 SV=1
 3743 : D7N2C3_9NEIS        0.36  0.63  193  405  190  404  217    6    6  406  D7N2C3     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria sp. oral taxon 014 str. F0314 GN=argJ PE=3 SV=1
 3744 : D9UD91_9ACTO        0.36  0.59  193  405  179  381  217    5   18  383  D9UD91     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces sp. SPB78 GN=argJ PE=3 SV=1
 3745 : D9WQX7_9ACTO        0.36  0.59  193  405  181  383  217    5   18  385  D9WQX7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces himastatinicus ATCC 53653 GN=argJ PE=3 SV=1
 3746 : D9XTV8_9ACTO        0.36  0.62  193  405  179  381  213    3   10  383  D9XTV8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces griseoflavus Tu4000 GN=argJ PE=3 SV=1
 3747 : E0NBN5_NEIME        0.36  0.62  193  405  190  404  219    7   10  406  E0NBN5     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis ATCC 13091 GN=argJ PE=3 SV=1
 3748 : E3HWM0_ACHXA        0.36  0.63  193  405  193  406  217    6    7  408  E3HWM0     Arginine biosynthesis bifunctional protein ArgJ OS=Achromobacter xylosoxidans (strain A8) GN=argJ PE=3 SV=1
 3749 : E4TF47_CALNY        0.36  0.56  193  405  190  400  228    5   32  402  E4TF47     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Calditerrivibrio nitroreducens (strain DSM 19672 / NBRC 101217 / Yu37-1) GN=argJ PE=3 SV=1
 3750 : E9CE36_CAPO3        0.36  0.54  193  405  193  418  241    4   43  420  E9CE36     Amino-acid N-acetyltransferase OS=Capsaspora owczarzaki (strain ATCC 30864) GN=CAOG_06454 PE=3 SV=1
 3751 : E9ELP1_METAR        0.36  0.52  193  405  212  441  240    8   37  443  E9ELP1     Putative glutamate N-acetyltransferase OS=Metarhizium anisopliae (strain ARSEF 23 / ATCC MYA-3075) GN=MAA_01549 PE=3 SV=1
 3752 : F0A817_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  F0A817     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis M6190 GN=argJ PE=3 SV=1
 3753 : F0AVZ7_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  F0AVZ7     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis CU385 GN=argJ PE=3 SV=1
 3754 : F0MG70_NEIMG        0.36  0.63  193  405  190  404  218    6    8  406  F0MG70     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis serogroup B (strain G2136) GN=argJ PE=3 SV=1
 3755 : F2RCV2_STRVP        0.36  0.59  193  405  184  386  217    5   18  388  F2RCV2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces venezuelae (strain ATCC 10712 / CBS 650.69 / DSM 40230 / JCM 4526 / NBRC 13096 / PD 04745) GN=argJ PE=3 SV=1
 3756 : F2RP63_TRIT1        0.36  0.51    7  191   47  243  209   10   36  476  F2RP63     Arginine biosynthesis protein ArgJ OS=Trichophyton tonsurans (strain CBS 112818) GN=TESG_00673 PE=3 SV=1
 3757 : F4DS30_PSEMN        0.36  0.65  193  405  189  403  216    4    4  405  F4DS30     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas mendocina (strain NK-01) GN=argJ PE=3 SV=1
 3758 : F5RE42_9RHOO        0.36  0.63  193  405  192  411  223    7   13  413  F5RE42     Arginine biosynthesis bifunctional protein ArgJ OS=Methyloversatilis universalis FAM5 GN=argJ PE=3 SV=1
 3759 : G2DTC3_9NEIS        0.36  0.63  193  405  190  403  215    3    3  405  G2DTC3     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria weaveri ATCC 51223 GN=argJ PE=3 SV=1
 3760 : G2QRW8_THITE        0.36  0.51  193  405  239  466  236    4   31  468  G2QRW8     Putative uncharacterized protein OS=Thielavia terrestris (strain ATCC 38088 / NRRL 8126) GN=THITE_2106867 PE=3 SV=1
 3761 : G7WA08_DESOD        0.36  0.55    7  191    9  208  207    8   29  419  G7WA08     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfosporosinus orientis (strain ATCC 19365 / DSM 765 / NCIMB 8382 / VKM B-1628) GN=argJ PE=3 SV=1
 3762 : H0Q4G0_9RHOO        0.36  0.61  193  405  192  410  220    5    8  412  H0Q4G0     Arginine biosynthesis bifunctional protein ArgJ OS=Azoarcus sp. KH32C GN=argJ PE=3 SV=1
 3763 : H2JLN9_STRHJ        0.36  0.58  193  405  180  382  217    5   18  384  H2JLN9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces hygroscopicus subsp. jinggangensis (strain 5008) GN=argJ PE=3 SV=1
 3764 : H7EZC0_PSEST        0.36  0.65  193  405  189  403  216    4    4  405  H7EZC0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas stutzeri ATCC 14405 = CCUG 16156 GN=argJ PE=3 SV=1
 3765 : I0CBY8_STRAT        0.36  0.59  193  405  182  392  224    7   24  394  I0CBY8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces antibioticus GN=oat3 PE=3 SV=1
 3766 : I0RVT6_MYCXE        0.36  0.59    2  191    5  199  199    7   13  404  I0RVT6     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium xenopi RIVM700367 GN=argJ PE=3 SV=1
 3767 : I0WYY4_9NOCA        0.36  0.56    1  191   14  209  202    8   17  414  I0WYY4     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodococcus imtechensis RKJ300 = JCM 13270 GN=argJ PE=3 SV=1
 3768 : I2Q474_9DELT        0.36  0.60  193  405  187  397  220    7   16  399  I2Q474     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio sp. U5L GN=argJ PE=3 SV=1
 3769 : I3CN62_9BURK        0.36  0.65  193  405  196  409  217    6    7  411  I3CN62     Arginine biosynthesis bifunctional protein ArgJ OS=Herbaspirillum sp. GW103 GN=argJ PE=3 SV=1
 3770 : I4E8J2_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  I4E8J2     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis alpha522 GN=argJ PE=3 SV=1
 3771 : I8IPZ0_ASPO3        0.36  0.51    7  191   29  223  204    9   28  456  I8IPZ0     Putative glutamate/ornithine acetyltransferase OS=Aspergillus oryzae (strain 3.042) GN=Ao3042_02023 PE=3 SV=1
 3772 : J0KG60_9BURK        0.36  0.64  193  405  193  407  216    4    4  409  J0KG60     Arginine biosynthesis bifunctional protein ArgJ OS=Acidovorax sp. CF316 GN=argJ PE=3 SV=1
 3773 : J0UPD6_ALCFA        0.36  0.64  193  405  193  406  217    5    7  408  J0UPD6     Arginine biosynthesis bifunctional protein ArgJ OS=Alcaligenes faecalis subsp. faecalis NCIB 8687 GN=argJ PE=3 SV=1
 3774 : J1R976_9NOCA        0.36  0.56    1  191   14  209  202    8   17  414  J1R976     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodococcus sp. JVH1 GN=argJ PE=3 SV=1
 3775 : J8TIY1_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  J8TIY1     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM2781 GN=argJ PE=3 SV=1
 3776 : J8W1G5_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  J8W1G5     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 93004 GN=argJ PE=3 SV=1
 3777 : J8X9B7_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  J8X9B7     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM576 GN=argJ PE=3 SV=1
 3778 : J8XLX9_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  J8XLX9     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM2657 GN=argJ PE=3 SV=1
 3779 : J8Y7R3_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  J8Y7R3     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM2795 GN=argJ PE=3 SV=1
 3780 : J8YMA0_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  J8YMA0     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM3001 GN=argJ PE=3 SV=1
 3781 : K0HV31_9BURK        0.36  0.63  193  405  193  407  218    6    8  409  K0HV31     Arginine biosynthesis bifunctional protein ArgJ OS=Acidovorax sp. KKS102 GN=argJ PE=3 SV=1
 3782 : K0NN74_DESTT        0.36  0.56  193  405  177  387  229    6   34  389  K0NN74     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfobacula toluolica (strain DSM 7467 / Tol2) GN=argJ PE=3 SV=1
 3783 : K2MES3_BIFBI        0.36  0.60   12  191    2  181  185    6   10  282  K2MES3     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein (Fragment) OS=Bifidobacterium bifidum IPLA 20015 GN=argJ PE=3 SV=1
 3784 : K5CIL7_RHOBT        0.36  0.62  193  405  195  408  215    3    3  410  K5CIL7     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodopirellula baltica SH28 GN=argJ PE=3 SV=1
 3785 : K6IHT3_9LEPT        0.36  0.59  193  405  177  381  222   10   26  383  K6IHT3     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira sp. Fiocruz LV3954 GN=argJ PE=3 SV=1
 3786 : K6ZDV1_9ALTE        0.36  0.65  193  405  193  412  223    7   13  414  K6ZDV1     Arginine biosynthesis bifunctional protein ArgJ OS=Glaciecola arctica BSs20135 GN=argJ PE=3 SV=1
 3787 : K7RXZ6_PROA4        0.36  0.54   12  191    2  180  196    9   33  388  K7RXZ6     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acidipropionici (strain ATCC 4875 / DSM 20272 / JCM 6432 / NBRC 12425 / NCIMB 8070) GN=argJ PE=3 SV=1
 3788 : K8XTE0_RHOOP        0.36  0.56    1  191   14  209  202    8   17  414  K8XTE0     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodococcus opacus M213 GN=argJ PE=3 SV=1
 3789 : L0GK50_PSEST        0.36  0.65  193  405  189  403  216    4    4  405  L0GK50     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas stutzeri RCH2 GN=argJ PE=3 SV=1
 3790 : L0HDM3_METFS        0.36  0.58  193  405  176  384  226    6   30  386  L0HDM3     Arginine biosynthesis bifunctional protein ArgJ OS=Methanoregula formicica (strain DSM 22288 / NBRC 105244 / SMSP) GN=argJ PE=3 SV=1
 3791 : L0R7X5_9DELT        0.36  0.61  193  405  182  392  218    6   12  394  L0R7X5     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio hydrothermalis AM13 = DSM 14728 GN=argJ PE=3 SV=1
 3792 : L2EAK1_9BURK        0.36  0.63  193  405  193  406  217    6    7  408  L2EAK1     Arginine biosynthesis bifunctional protein ArgJ OS=Cupriavidus sp. HMR-1 GN=argJ PE=3 SV=1
 3793 : L2TEV1_9NOCA        0.36  0.56    1  191   14  209  202    8   17  414  L2TEV1     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodococcus wratislaviensis IFP 2016 GN=argJ PE=3 SV=1
 3794 : L5P275_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5P275     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM422 GN=argJ PE=3 SV=1
 3795 : L5P3G8_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5P3G8     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 87255 GN=argJ PE=3 SV=1
 3796 : L5Q1Z8_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5Q1Z8     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 70012 GN=argJ PE=3 SV=1
 3797 : L5Q492_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5Q492     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 63041 GN=argJ PE=3 SV=1
 3798 : L5R2I2_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5R2I2     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM418 GN=argJ PE=3 SV=1
 3799 : L5RKK7_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5RKK7     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis M7089 GN=argJ PE=3 SV=1
 3800 : L5RMB9_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5RMB9     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis M7124 GN=argJ PE=3 SV=1
 3801 : L5S2W4_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5S2W4     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM126 GN=argJ PE=3 SV=1
 3802 : L5S471_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5S471     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 9506 GN=argJ PE=3 SV=1
 3803 : L5S4Y5_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5S4Y5     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 9757 GN=argJ PE=3 SV=1
 3804 : L5SL29_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5SL29     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 12888 GN=argJ PE=3 SV=1
 3805 : L5T645_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5T645     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 65014 GN=argJ PE=3 SV=1
 3806 : L5TMD2_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5TMD2     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 61103 GN=argJ PE=3 SV=1
 3807 : L5UQ52_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5UQ52     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 70030 GN=argJ PE=3 SV=1
 3808 : L5V335_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  L5V335     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 63006 GN=argJ PE=3 SV=1
 3809 : L8K137_9BACT        0.36  0.59  193  405  185  401  218    3    6  403  L8K137     Arginine biosynthesis bifunctional protein ArgJ OS=Fulvivirga imtechensis AK7 GN=argJ PE=3 SV=1
 3810 : M1E896_9FIRM        0.36  0.59  193  405  183  394  218    5   11  396  M1E896     Arginine biosynthesis bifunctional protein ArgJ OS=Thermodesulfobium narugense DSM 14796 GN=argJ PE=3 SV=1
 3811 : M1W6B5_CLAP2        0.36  0.53  193  405  216  445  237    5   31  447  M1W6B5     Probable glutamate N-acetyltransferase OS=Claviceps purpurea (strain 20.1) GN=CPUR_01257 PE=3 SV=1
 3812 : M2B7T7_9PLAN        0.36  0.62  193  405  195  408  215    3    3  410  M2B7T7     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodopirellula europaea 6C GN=argJ PE=3 SV=1
 3813 : M2VL13_PSEST        0.36  0.66  193  405  189  403  216    4    4  405  M2VL13     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas stutzeri NF13 GN=argJ PE=3 SV=1
 3814 : M3E5Q6_9ACTO        0.36  0.62  193  405  179  381  213    3   10  383  M3E5Q6     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces gancidicus BKS 13-15 GN=argJ PE=3 SV=1
 3815 : M3EAL3_LEPIR        0.36  0.61  193  405    8  212  218    7   18  214  M3EAL3     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Lora str. TE 1992 GN=argJ PE=3 SV=1
 3816 : M3FHJ5_9ACTO        0.36  0.62  193  405  178  380  213    3   10  382  M3FHJ5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces bottropensis ATCC 25435 GN=argJ PE=3 SV=1
 3817 : M3IS81_LEPIT        0.36  0.61  193  405   66  270  218    8   18  272  M3IS81     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Copenhageni str. LT2050 GN=argJ PE=3 SV=1
 3818 : M6DF10_9LEPT        0.36  0.54  193  405  179  381  232    8   48  383  M6DF10     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira sp. B5-022 GN=argJ PE=3 SV=1
 3819 : M6T346_LEPIR        0.36  0.60   13  191    1  178  179    1    1  310  M6T346     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Bataviae str. HAI135 GN=argJ PE=3 SV=1
 3820 : M6ZJ92_9LEPT        0.36  0.59  193  405  177  381  222   10   26  383  M6ZJ92     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira santarosai str. 200702252 GN=argJ PE=3 SV=1
 3821 : N0CSQ4_9ACTO        0.36  0.59  193  405  180  382  217    5   18  384  N0CSQ4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces fulvissimus DSM 40593 GN=argJ PE=3 SV=1
 3822 : N1TL79_LEPIR        0.36  0.61  193  405    8  212  218    8   18  214  N1TL79     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. 2002000626 GN=argJ PE=3 SV=1
 3823 : N6VX58_9EURY        0.36  0.52  193  405  175  386  240    6   55  388  N6VX58     Arginine biosynthesis bifunctional protein ArgJ OS=Methanocaldococcus villosus KIN24-T80 GN=argJ PE=3 SV=1
 3824 : Q0EXE2_9PROT        0.36  0.66  193  405  196  405  218    6   13  407  Q0EXE2     Arginine biosynthesis bifunctional protein ArgJ OS=Mariprofundus ferrooxydans PV-1 GN=argJ PE=3 SV=1
 3825 : Q0SI53_RHOSR        0.36  0.56    1  191   14  209  202    8   17  414  Q0SI53     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodococcus sp. (strain RHA1) GN=argJ PE=3 SV=1
 3826 : Q12FA7_POLSJ        0.36  0.63  193  405  197  411  218    5    8  413  Q12FA7     Arginine biosynthesis bifunctional protein ArgJ OS=Polaromonas sp. (strain JS666 / ATCC BAA-500) GN=argJ PE=3 SV=1
 3827 : R0EB56_9BURK        0.36  0.65  193  405  196  409  217    6    7  411  R0EB56     Arginine biosynthesis bifunctional protein ArgJ OS=Herbaspirillum frisingense GSF30 GN=argJ PE=3 SV=1
 3828 : R0NZ44_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0NZ44     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 69100 GN=argJ PE=3 SV=1
 3829 : R0PAI8_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0PAI8     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 70021 GN=argJ PE=3 SV=1
 3830 : R0PHS6_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0PHS6     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 61106 GN=argJ PE=3 SV=1
 3831 : R0QV44_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0QV44     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 63023 GN=argJ PE=3 SV=1
 3832 : R0RRA5_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0RRA5     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 70082 GN=argJ PE=3 SV=1
 3833 : R0SL94_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0SL94     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM82 GN=argJ PE=3 SV=1
 3834 : R0SNB7_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0SNB7     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM94 GN=argJ PE=3 SV=1
 3835 : R0T6D6_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0T6D6     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM1482 GN=argJ PE=3 SV=1
 3836 : R0TRZ6_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0TRZ6     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM133 GN=argJ PE=3 SV=1
 3837 : R0U3A1_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0U3A1     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2002020 GN=argJ PE=3 SV=1
 3838 : R0UJZ6_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0UJZ6     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM313 GN=argJ PE=3 SV=1
 3839 : R0UU81_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0UU81     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2001072 GN=argJ PE=3 SV=1
 3840 : R0VY32_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0VY32     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2005079 GN=argJ PE=3 SV=1
 3841 : R0VYD5_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0VYD5     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM477 GN=argJ PE=3 SV=1
 3842 : R0W884_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0W884     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis M13265 GN=argJ PE=3 SV=1
 3843 : R0WVC8_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0WVC8     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2000081 GN=argJ PE=3 SV=1
 3844 : R0XMB4_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0XMB4     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2004264 GN=argJ PE=3 SV=1
 3845 : R0YJ10_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0YJ10     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2008223 GN=argJ PE=3 SV=1
 3846 : R0ZCC4_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0ZCC4     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM3131 GN=argJ PE=3 SV=1
 3847 : R0ZXY8_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  R0ZXY8     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM35 GN=argJ PE=3 SV=1
 3848 : R5V329_9FIRM        0.36  0.57   11  191   12  205  199    6   23  423  R5V329     Arginine biosynthesis bifunctional protein ArgJ OS=Ruminococcus sp. CAG:254 GN=argJ PE=3 SV=1
 3849 : S1S4H5_STRLI        0.36  0.59  193  405  179  381  217    5   18  383  S1S4H5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces lividans 1326 GN=argJ PE=3 SV=1
 3850 : S3B4X3_9ACTO        0.36  0.63  193  405  186  388  213    4   10  390  S3B4X3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces sp. HPH0547 GN=argJ PE=3 SV=1
 3851 : S3B4X3_9ACTO        0.36  0.54   12  191    2  185  198   10   32  390  S3B4X3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces sp. HPH0547 GN=argJ PE=3 SV=1
 3852 : S3LRX5_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  S3LRX5     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2007461 GN=argJ PE=3 SV=1
 3853 : S4AQC4_9ACTO        0.36  0.55   12  191    2  179  194    9   30  384  S4AQC4     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces aurantiacus JA 4570 GN=argJ PE=3 SV=1
 3854 : T0WS02_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  T0WS02     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM518 GN=argJ PE=3 SV=1
 3855 : T0X5J6_NEIME        0.36  0.63  193  405  190  404  218    6    8  406  T0X5J6     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis 2002030 GN=argJ PE=3 SV=1
 3856 : U0Z3R2_9NEIS        0.36  0.66  193  405  194  408  218    6    8  410  U0Z3R2     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudogulbenkiania ferrooxidans EGD-HP2 GN=argJ PE=3 SV=1
 3857 : U1GDJ8_ENDPU        0.36  0.53   16  191   48  240  198    9   27  408  U1GDJ8     Arginine biosynthesis bifunctional protein ArgJ OS=Endocarpon pusillum (strain Z07020 / HMAS-L-300199) GN=EPUS_00315 PE=3 SV=1
 3858 : U1GRS6_TRESO        0.36  0.53  193  405  196  432  252    6   54  434  U1GRS6     Arginine biosynthesis bifunctional protein ArgJ OS=Treponema socranskii subsp. socranskii VPI DR56BR1116 = ATCC 35536 GN=argJ PE=3 SV=1
 3859 : U1SN90_PSEME        0.36  0.65  193  405  189  403  218    6    8  405  U1SN90     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas mendocina EGD-AQ5 GN=argJ PE=3 SV=1
 3860 : U2B734_9PSED        0.36  0.66  193  405   87  301  216    4    4  303  U2B734     Uncharacterized protein (Fragment) OS=Pseudomonas sp. EGD-AK9 GN=N878_24150 PE=3 SV=1
 3861 : U2Z6A0_PSEAC        0.36  0.65  193  405  189  403  216    4    4  405  U2Z6A0     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas alcaligenes NBRC 14159 GN=argJ PE=3 SV=1
 3862 : U5T881_9GAMM        0.36  0.60  193  405  190  401  223    8   21  403  U5T881     Arginine biosynthesis bifunctional protein ArgJ OS=Spiribacter sp. UAH-SP71 GN=argJ PE=3 SV=1
 3863 : U5W513_9ACTO        0.36  0.60  193  405  186  388  213    4   10  390  U5W513     Arginine biosynthesis bifunctional protein ArgJ OS=Actinoplanes friuliensis DSM 7358 GN=argJ PE=3 SV=1
 3864 : V2RMU8_9BACT        0.36  0.52    5  191    2  191  199    7   21  403  V2RMU8     Arginine biosynthesis bifunctional protein ArgJ OS=Mucispirillum schaedleri ASF457 GN=argJ PE=3 SV=1
 3865 : V5G603_BYSSN        0.36  0.51    6  191   28  223  205    9   28  456  V5G603     Arginine biosynthesis bifunctional protein ArgJ OS=Byssochlamys spectabilis (strain No. 5 / NBRC 109023) GN=PVAR5_6091 PE=3 SV=1
 3866 : V5VYA1_9GAMM        0.36  0.53  193  405  184  369  221    6   43  371  V5VYA1     Arginine biosynthesis bifunctional protein ArgJ OS=Francisella noatunensis subsp. orientalis LADL--07-285A GN=argJ PE=3 SV=1
 3867 : V7E486_PSEFL        0.36  0.67  193  405  189  403  216    4    4  405  V7E486     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudomonas fluorescens BBc6R8 GN=argJ PE=3 SV=1
 3868 : W0TMY9_9GAMM        0.36  0.62  193  405  185  398  217    6    7  400  W0TMY9     Arginine biosynthesis bifunctional protein ArgJ OS=gamma proteobacterium Hiromi1 GN=argJ PE=3 SV=1
 3869 : W1VHA2_9ACTO        0.36  0.54   12  191    2  195  199    9   24  403  W1VHA2     Arginine biosynthesis bifunctional protein ArgJ OS=Actinomyces urogenitalis DORA_12 GN=argJ PE=3 SV=1
 3870 : W5WF33_9PSEU        0.36  0.56    2  191    6  195  202   10   24  400  W5WF33     Uncharacterized protein OS=Kutzneria albida DSM 43870 GN=KALB_6454 PE=4 SV=1
 3871 : W5X4S4_9BACT        0.36  0.53  193  405  197  402  222    7   25  404  W5X4S4     Uncharacterized protein OS=Fimbriimonas ginsengisoli Gsoil 348 GN=FGOP10_00585 PE=4 SV=1
 3872 : W6XR82_COCCA        0.36  0.53  193  405  241  462  235    5   35  464  W6XR82     Uncharacterized protein OS=Bipolaris zeicola 26-R-13 GN=COCCADRAFT_105114 PE=4 SV=1
 3873 : W7EBV6_COCVI        0.36  0.54  193  405  241  462  235    5   35  464  W7EBV6     Uncharacterized protein OS=Bipolaris victoriae FI3 GN=COCVIDRAFT_40898 PE=4 SV=1
 3874 : W7QSB8_9ALTE        0.36  0.66  193  405  193  411  222    7   12  413  W7QSB8     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Catenovulum agarivorans DS-2 GN=argJ PE=4 SV=1
 3875 : A4X651_SALTO        0.35  0.62  193  405  186  388  213    4   10  390  A4X651     Arginine biosynthesis bifunctional protein ArgJ OS=Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / CNB-440) GN=argJ PE=3 SV=1
 3876 : A6P0Q1_9FIRM        0.35  0.51    7  191    2  203  214    8   41  421  A6P0Q1     Arginine biosynthesis bifunctional protein ArgJ OS=Pseudoflavonifractor capillosus ATCC 29799 GN=argJ PE=3 SV=1
 3877 : A7A7W6_BIFAD        0.35  0.58  193  405  183  388  216    4   13  390  A7A7W6     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium adolescentis L2-32 GN=argJ PE=3 SV=1
 3878 : ARGJ_ASPTN          0.35  0.50    7  191   29  223  204    9   28  457  Q0CDB9     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Aspergillus terreus (strain NIH 2624 / FGSC A1156) GN=ATEG_08315 PE=3 SV=1
 3879 : ARGJ_CHAGB          0.35  0.51  193  405  241  469  237    5   32  471  Q2HAX7     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970) GN=CHGG_02627 PE=3 SV=1
 3880 : ARGJ_NEIG1          0.35  0.62  193  405  190  404  218    6    8  406  Q5F7I3     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090) GN=argJ PE=3 SV=1
 3881 : ARGJ_NEIGO          0.35  0.62  193  405  190  404  218    6    8  406  P38434     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria gonorrhoeae GN=argJ PE=3 SV=1
 3882 : ARGJ_POSPM          0.35  0.50  193  405  236  460  240    8   42  462  B8PH83     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Postia placenta (strain ATCC 44394 / Madison 698-R) GN=POSPLDRAFT_134690 PE=3 SV=1
 3883 : B1W3A8_STRGG        0.35  0.59  193  405  180  382  217    5   18  384  B1W3A8     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces griseus subsp. griseus (strain JCM 4626 / NBRC 13350) GN=argJ PE=3 SV=1
 3884 : B2UKZ7_AKKM8        0.35  0.58  193  402  194  400  218    8   19  417  B2UKZ7     Arginine biosynthesis bifunctional protein ArgJ OS=Akkermansia muciniphila (strain ATCC BAA-835) GN=argJ PE=3 SV=1
 3885 : B4RJD4_NEIG2        0.35  0.62  193  405  190  404  218    6    8  406  B4RJD4     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria gonorrhoeae (strain NCCP11945) GN=argJ PE=3 SV=1
 3886 : B6XUQ1_9BIFI        0.35  0.58  193  405  183  388  216    4   13  390  B6XUQ1     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium catenulatum DSM 16992 = JCM 1194 GN=argJ PE=3 SV=1
 3887 : B8DRH2_DESVM        0.35  0.57  193  405  201  410  223    7   23  412  B8DRH2     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio vulgaris (strain Miyazaki F / DSM 19637) GN=argJ PE=3 SV=1
 3888 : C0BTT9_9BIFI        0.35  0.58  193  405  183  388  216    4   13  390  C0BTT9     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 GN=argJ PE=3 SV=1
 3889 : C4FFX1_9BIFI        0.35  0.58  193  405  183  388  217    5   15  390  C4FFX1     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium angulatum DSM 20098 = JCM 7096 GN=argJ PE=3 SV=1
 3890 : C4XNC4_DESMR        0.35  0.60  193  405  188  398  219    6   14  400  C4XNC4     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1) GN=argJ PE=3 SV=1
 3891 : C5CAN2_MICLC        0.35  0.55  193  405  179  384  216    4   13  386  C5CAN2     Arginine biosynthesis bifunctional protein ArgJ OS=Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230) GN=argJ PE=3 SV=1
 3892 : C7MEG7_BRAFD        0.35  0.52   12  191    2  181  200   10   40  389  C7MEG7     Arginine biosynthesis bifunctional protein ArgJ OS=Brachybacterium faecium (strain ATCC 43885 / DSM 4810 / NCIB 9860) GN=argJ PE=3 SV=1
 3893 : C7N017_SACVD        0.35  0.55  193  405  179  381  220    5   24  383  C7N017     Arginine biosynthesis bifunctional protein ArgJ OS=Saccharomonospora viridis (strain ATCC 15386 / DSM 43017 / JCM 3036 / NBRC 12207 / P101) GN=argJ PE=3 SV=1
 3894 : C7R3R1_JONDD        0.35  0.55  193  405  179  386  221    7   21  388  C7R3R1     Arginine biosynthesis bifunctional protein ArgJ OS=Jonesia denitrificans (strain ATCC 14870 / DSM 20603 / CIP 55134) GN=argJ PE=3 SV=1
 3895 : D1D7Q0_NEIGO        0.35  0.62  193  405  190  404  218    6    8  406  D1D7Q0     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria gonorrhoeae 35/02 GN=argJ PE=3 SV=1
 3896 : D1DTQ2_NEIGO        0.35  0.62  193  405  190  404  218    6    8  406  D1DTQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria gonorrhoeae PID1 GN=argJ PE=3 SV=1
 3897 : D1DZE4_NEIGO        0.35  0.62  193  405  190  404  218    6    8  406  D1DZE4     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria gonorrhoeae PID332 GN=argJ PE=3 SV=1
 3898 : D1EAZ2_NEIGO        0.35  0.62  193  405  190  404  218    6    8  406  D1EAZ2     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria gonorrhoeae SK-92-679 GN=argJ PE=3 SV=1
 3899 : D1EC77_NEIGO        0.35  0.62  193  405  189  403  218    6    8  405  D1EC77     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria gonorrhoeae SK-93-1035 GN=argJ PE=3 SV=1
 3900 : D1YBH3_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  D1YBH3     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes J139 GN=argJ PE=3 SV=1
 3901 : D2QAS7_BIFDB        0.35  0.59  193  405  183  388  216    4   13  390  D2QAS7     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium dentium (strain ATCC 27534 / DSM 20436 / JCM 1195 / Bd1) GN=argJ PE=3 SV=1
 3902 : D4ARK4_ARTBC        0.35  0.50    7  191   47  238  204   10   31  471  D4ARK4     Putative uncharacterized protein OS=Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371) GN=ARB_06747 PE=3 SV=1
 3903 : D5UR19_TSUPD        0.35  0.58    2  191    1  195  199    7   13  400  D5UR19     Arginine biosynthesis bifunctional protein ArgJ OS=Tsukamurella paurometabola (strain ATCC 8368 / DSM 20162 / JCM 10117 / NBRC 16120 / NCTC 13040) GN=argJ PE=3 SV=1
 3904 : D6JNM7_NEIGO        0.35  0.62  193  405  190  404  218    6    8  406  D6JNM7     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria gonorrhoeae F62 GN=argJ PE=3 SV=1
 3905 : D7DMW5_METS0        0.35  0.65  193  405  193  411  220    5    8  413  D7DMW5     Arginine biosynthesis bifunctional protein ArgJ OS=Methylotenera sp. (strain 301) GN=argJ PE=3 SV=1
 3906 : D9T5W4_MICAI        0.35  0.55   12  191    2  185  199   11   34  390  D9T5W4     Arginine biosynthesis bifunctional protein ArgJ OS=Micromonospora aurantiaca (strain ATCC 27029 / DSM 43813 / JCM 10878 / NBRC 16125 / INA 9442) GN=argJ PE=3 SV=1
 3907 : D9UYD5_9ACTO        0.35  0.53  193  405  182  384  228    8   40  386  D9UYD5     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces sp. AA4 GN=argJ PE=3 SV=1
 3908 : D9YBU1_9DELT        0.35  0.60  193  405  183  393  216    4    8  395  D9YBU1     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio sp. 3_1_syn3 GN=argJ PE=3 SV=1
 3909 : E1K1P0_DESFR        0.35  0.60  193  405  187  397  219    6   14  399  E1K1P0     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio fructosivorans JJ GN=argJ PE=3 SV=1
 3910 : E1N883_9BIFI        0.35  0.59  193  405  183  388  216    4   13  390  E1N883     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium dentium JCVIHMP022 GN=argJ PE=3 SV=1
 3911 : E2S9J9_9ACTO        0.35  0.56  193  405  184  386  220    5   24  388  E2S9J9     Arginine biosynthesis bifunctional protein ArgJ OS=Aeromicrobium marinum DSM 15272 GN=argJ PE=3 SV=1
 3912 : E4ABN9_PROAA        0.35  0.56  193  405  181  386  220    8   21  388  E4ABN9     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL037PA3 GN=argJ PE=3 SV=1
 3913 : E4AR00_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  E4AR00     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL002PA1 GN=argJ PE=3 SV=1
 3914 : E4ASV9_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  E4ASV9     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL027PA1 GN=argJ PE=3 SV=1
 3915 : E4B665_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  E4B665     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL110PA3 GN=argJ PE=3 SV=1
 3916 : E4BDZ8_PROAA        0.35  0.56  193  405  181  386  220    8   21  388  E4BDZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL037PA2 GN=argJ PE=3 SV=1
 3917 : E4F965_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  E4F965     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL013PA1 GN=argJ PE=3 SV=1
 3918 : E4FJM8_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  E4FJM8     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL037PA1 GN=argJ PE=3 SV=1
 3919 : E4GVM4_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  E4GVM4     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL082PA2 GN=argJ PE=3 SV=1
 3920 : E4HNP2_PROAA        0.35  0.56  193  405  181  386  220    8   21  388  E4HNP2     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL044PA1 GN=argJ PE=3 SV=1
 3921 : E4I2P0_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  E4I2P0     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL005PA4 GN=argJ PE=3 SV=1
 3922 : E4TF47_CALNY        0.35  0.56    5  191    1  189  200    7   24  402  E4TF47     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Calditerrivibrio nitroreducens (strain DSM 19672 / NBRC 101217 / Yu37-1) GN=argJ PE=3 SV=1
 3923 : E4TZ41_SULKY        0.35  0.53    4  191    2  186  197    8   21  395  E4TZ41     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfuricurvum kujiense (strain ATCC BAA-921 / DSM 16994 / JCM 11577 / YK-1) GN=argJ PE=3 SV=1
 3924 : E4USI2_ARTGP        0.35  0.51    7  191   47  243  208   10   34  476  E4USI2     Arginine biosynthesis ARG7 OS=Arthroderma gypseum (strain ATCC MYA-4604 / CBS 118893) GN=MGYG_04340 PE=3 SV=1
 3925 : E6C4Y6_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  E6C4Y6     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL030PA2 GN=argJ PE=3 SV=1
 3926 : E8S348_MICSL        0.35  0.55   12  191    2  185  199   11   34  390  E8S348     Arginine biosynthesis bifunctional protein ArgJ OS=Micromonospora sp. (strain L5) GN=argJ PE=3 SV=1
 3927 : E8SLG4_NEIGO        0.35  0.62  193  405  190  404  218    6    8  406  E8SLG4     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria gonorrhoeae TCDC-NG08107 GN=argJ PE=3 SV=1
 3928 : E8W849_STRFA        0.35  0.56   12  191    2  187  198   11   30  392  E8W849     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces flavogriseus (strain ATCC 33331 / DSM 40990 / IAF-45CD) GN=argJ PE=3 SV=1
 3929 : E8W8F3_STRFA        0.35  0.55  193  405  181  390  230    6   37  392  E8W8F3     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces flavogriseus (strain ATCC 33331 / DSM 40990 / IAF-45CD) GN=argJ PE=3 SV=1
 3930 : F1U4N6_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  F1U4N6     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL103PA1 GN=argJ PE=3 SV=1
 3931 : F1UT48_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  F1UT48     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL083PA2 GN=argJ PE=3 SV=1
 3932 : F1V5J6_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  F1V5J6     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL087PA3 GN=argJ PE=3 SV=1
 3933 : F2SYZ4_TRIRC        0.35  0.51    7  191   47  243  209   10   36  476  F2SYZ4     Arginine biosynthesis protein ArgJ OS=Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892) GN=TERG_07765 PE=3 SV=1
 3934 : F3NYH8_9ACTO        0.35  0.56  193  405  135  340  219    6   19  342  F3NYH8     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium humerusii P08 GN=argJ PE=3 SV=1
 3935 : F8XL77_9GAMM        0.35  0.65  227  405   13  193  182    4    4  195  F8XL77     Arginine biosynthesis bifunctional protein ArgJ (Fragment) OS=Acidithiobacillus sp. GGI-221 GN=GGI1_00660 PE=3 SV=1
 3936 : F8XVT7_9GAMM        0.35  0.55   27  191   25  191  167    2    2  224  F8XVT7     Arginine biosynthesis bifunctional protein ArgJ (Fragment) OS=Acidithiobacillus sp. GGI-221 GN=GGI1_21874 PE=3 SV=1
 3937 : F9NCH3_9ACTO        0.35  0.55  193  405  181  386  220    8   21  388  F9NCH3     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium sp. CC003-HC2 GN=argJ PE=3 SV=1
 3938 : G0Q8K9_STRGR        0.35  0.59  193  405  180  382  217    5   18  384  G0Q8K9     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces griseus XylebKG-1 GN=argJ PE=3 SV=1
 3939 : G1UTV3_9DELT        0.35  0.60  193  405  183  393  216    4    8  395  G1UTV3     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio sp. 6_1_46AFAA GN=argJ PE=3 SV=1
 3940 : G2HC85_9DELT        0.35  0.57  193  405  205  414  223    7   23  416  G2HC85     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio sp. A2 GN=argJ PE=3 SV=1
 3941 : G2XE80_VERDV        0.35  0.51  193  405  233  462  239    7   35  464  G2XE80     Arginine biosynthesis argJ OS=Verticillium dahliae (strain VdLs.17 / ATCC MYA-4575 / FGSC 10137) GN=VDAG_08462 PE=3 SV=1
 3942 : G3J9I1_CORMM        0.35  0.49  193  405  214  443  239    7   35  445  G3J9I1     Arginine biosynthesis bifunctional protein ArgJ OS=Cordyceps militaris (strain CM01) GN=CCM_03230 PE=3 SV=1
 3943 : G7U658_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  G7U658     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes ATCC 11828 GN=argJ PE=3 SV=1
 3944 : G7XWI9_ASPKW        0.35  0.51    7  191   29  223  204    9   28  456  G7XWI9     Arginine biosynthesis bifunctional protein ArgJ OS=Aspergillus kawachii (strain NBRC 4308) GN=AKAW_09412 PE=3 SV=1
 3945 : G8JYT8_RHOFA        0.35  0.57  193  405  177  384  231    7   41  386  G8JYT8     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodococcus fascians D188 GN=argJ PE=3 SV=1
 3946 : G8VPA2_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  G8VPA2     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes TypeIA2 P.acn31 GN=argJ PE=3 SV=1
 3947 : H0B419_9ACTO        0.35  0.59  193  405  180  382  217    5   18  384  H0B419     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces sp. W007 GN=argJ PE=3 SV=1
 3948 : I0L1E6_9ACTO        0.35  0.61  193  405  186  388  217    5   18  390  I0L1E6     Arginine biosynthesis bifunctional protein ArgJ OS=Micromonospora lupini str. Lupac 08 GN=argJ PE=3 SV=1
 3949 : I1D481_9PSEU        0.35  0.56  193  405  179  381  215    5   14  383  I1D481     Arginine biosynthesis bifunctional protein ArgJ OS=Saccharomonospora glauca K62 GN=argJ PE=3 SV=1
 3950 : I4B5T6_TURPD        0.35  0.61  193  405  192  392  218    8   22  394  I4B5T6     Arginine biosynthesis bifunctional protein ArgJ OS=Turneriella parva (strain ATCC BAA-1111 / DSM 21527 / NCTC 11395 / H) GN=argJ PE=3 SV=1
 3951 : I4J013_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  I4J013     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes PRP-38 GN=argJ PE=3 SV=1
 3952 : I7JW12_9CORY        0.35  0.57  193  405  205  407  224    7   32  409  I7JW12     Arginine biosynthesis bifunctional protein ArgJ OS=Turicella otitidis ATCC 51513 GN=argJ PE=3 SV=1
 3953 : J1ZP17_9ACTO        0.35  0.59  193  405  179  381  217    6   18  383  J1ZP17     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces auratus AGR0001 GN=argJ PE=3 SV=1
 3954 : J3HQY5_9BURK        0.35  0.66  193  405  196  409  217    6    7  411  J3HQY5     Arginine biosynthesis bifunctional protein ArgJ OS=Herbaspirillum sp. YR522 GN=argJ PE=3 SV=1
 3955 : J7IQB2_DESMD        0.35  0.54    8  191   10  208  206    8   29  419  J7IQB2     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfosporosinus meridiei (strain ATCC BAA-275 / DSM 13257 / NCIMB 13706 / S10) GN=argJ PE=3 SV=1
 3956 : K1V375_TRIAC        0.35  0.57   18  161   50  206  157    6   13  228  K1V375     Arginine biosynthesis-related protein OS=Trichosporon asahii var. asahii (strain CBS 8904) GN=A1Q2_07408 PE=4 SV=1
 3957 : K6GEF8_9DELT        0.35  0.60  193  405  188  398  219    6   14  400  K6GEF8     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio magneticus str. Maddingley MBC34 GN=argJ PE=3 SV=1
 3958 : K9EUL5_9ACTO        0.35  0.53  193  405  179  384  217    4   15  386  K9EUL5     Arginine biosynthesis bifunctional protein ArgJ OS=Actinobaculum massiliae ACS-171-V-Col2 GN=argJ PE=3 SV=1
 3959 : L8EQV7_STRRM        0.35  0.59  193  405  180  382  217    5   18  384  L8EQV7     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces rimosus subsp. rimosus ATCC 10970 GN=argJ PE=3 SV=1
 3960 : M1GJH0_LAWIN        0.35  0.56  193  405  182  392  220    7   16  394  M1GJH0     Arginine biosynthesis bifunctional protein ArgJ OS=Lawsonia intracellularis N343 GN=argJ PE=3 SV=1
 3961 : M3VBR5_9ACTO        0.35  0.57    1  191   26  221  203    8   19  426  M3VBR5     Arginine biosynthesis bifunctional protein ArgJ OS=Gordonia malaquae NBRC 108250 GN=argJ PE=3 SV=1
 3962 : M6DIT4_9LEPT        0.35  0.54  193  405  177  381  235    9   52  383  M6DIT4     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira santarosai str. CBC613 GN=argJ PE=3 SV=1
 3963 : M6ELK5_9LEPT        0.35  0.54  193  405  179  383  235    9   52  385  M6ELK5     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira kirschneri serovar Bim str. PUO 1247 GN=argJ PE=3 SV=1
 3964 : M9TTS0_9ACTO        0.35  0.56   12  191    2  187  198   11   30  392  M9TTS0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces sp. PAMC26508 GN=argJ PE=3 SV=1
 3965 : N1JA16_BLUG1        0.35  0.53  193  405  244  472  234    5   26  474  N1JA16     Arginine biosynthesis bifunctional protein ArgJ OS=Blumeria graminis f. sp. hordei (strain DH14) GN=BGHDH14_bgh05851 PE=3 SV=1
 3966 : N1W022_9LEPT        0.35  0.52  193  405  179  382  232    7   47  384  N1W022     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira vanthielii serovar Holland str. Waz Holland = ATCC 700522 GN=argJ PE=3 SV=1
 3967 : N6Y4E2_9RHOO        0.35  0.64  193  405  192  410  220    5    8  412  N6Y4E2     Arginine biosynthesis bifunctional protein ArgJ OS=Thauera sp. 27 GN=argJ PE=3 SV=1
 3968 : N6ZGG1_9RHOO        0.35  0.64  193  405  192  410  220    5    8  412  N6ZGG1     Arginine biosynthesis bifunctional protein ArgJ OS=Thauera sp. 28 GN=argJ PE=3 SV=1
 3969 : Q0UFT9_PHANO        0.35  0.54  193  405  174  397  236    6   35  399  Q0UFT9     Putative uncharacterized protein OS=Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) GN=SNOG_09375 PE=3 SV=2
 3970 : R5HT10_9FIRM        0.35  0.53    7  191    2  193  204    7   31  411  R5HT10     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:114 GN=argJ PE=3 SV=1
 3971 : R7E3N5_9BACT        0.35  0.58  193  402  194  400  218    8   19  417  R7E3N5     Arginine biosynthesis bifunctional protein ArgJ OS=Akkermansia sp. CAG:344 GN=argJ PE=3 SV=1
 3972 : R7YXH4_CONA1        0.35  0.52  193  405  238  459  237    7   39  461  R7YXH4     Arginine biosynthesis ArgJ 1, mitochondrial OS=Coniosporium apollinis (strain CBS 100218) GN=W97_05861 PE=3 SV=1
 3973 : R9ABD0_WALI9        0.35  0.53  193  405  212  439  237    7   33  441  R9ABD0     Uncharacterized protein OS=Wallemia ichthyophaga (strain EXF-994 / CBS 113033) GN=J056_001755 PE=3 SV=1
 3974 : R9KTY4_9ACTN        0.35  0.54   16  191   18  215  198    7   22  431  R9KTY4     Arginine biosynthesis bifunctional protein ArgJ OS=Enterorhabdus caecimuris B7 GN=argJ PE=3 SV=1
 3975 : S6AN76_9PROT        0.35  0.65  193  405  193  407  218    6    8  409  S6AN76     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfuricella denitrificans skB26 GN=argJ PE=3 SV=1
 3976 : U9U7H1_RHIID        0.35  0.53    8  191   35  229  207   10   35  454  U9U7H1     Uncharacterized protein OS=Rhizophagus irregularis (strain DAOM 181602 / DAOM 197198 / MUCL 43194) GN=GLOINDRAFT_22868 PE=3 SV=1
 3977 : V2WHI1_PROAA        0.35  0.55  193  405  181  386  220    8   21  388  V2WHI1     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL042PA3 GN=argJ PE=3 SV=1
 3978 : V2ZI42_9FIRM        0.35  0.55    5  191    1  189  198    6   20  407  V2ZI42     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium ASF500 GN=argJ PE=3 SV=1
 3979 : V6JMN2_STRNV        0.35  0.54   12  191    2  184  199   11   35  389  V6JMN2     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces niveus NCIMB 11891 GN=argJ PE=3 SV=1
 3980 : W1QEF8_OGAPD        0.35  0.50  193  405  206  423  233    4   35  425  W1QEF8     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ogataea parapolymorpha (strain DL-1 / ATCC 26012 / NRRL Y-7560) GN=HPODL_03918 PE=3 SV=1
 3981 : W5TDC1_9NOCA        0.35  0.60    1  191    5  200  200    7   13  405  W5TDC1     Arginine biosynthesis bifunctional protein ArgJ OS=Nocardia nova SH22a GN=argJ PE=4 SV=1
 3982 : W5X4S4_9BACT        0.35  0.53   15  191    2  196  201    6   30  404  W5X4S4     Uncharacterized protein OS=Fimbriimonas ginsengisoli Gsoil 348 GN=FGOP10_00585 PE=4 SV=1
 3983 : W6EFM9_DEHMU        0.35  0.57  193  405  188  394  218    7   16  396  W6EFM9     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfurospirillum multivorans DSM 12446 GN=argJ PE=4 SV=1
 3984 : W6ZGA6_COCMI        0.35  0.54  193  405  241  462  235    5   35  464  W6ZGA6     Uncharacterized protein OS=Bipolaris oryzae ATCC 44560 GN=COCMIDRAFT_2123 PE=4 SV=1
 3985 : A1A1X2_BIFAA        0.34  0.58  193  405  183  388  216    4   13  390  A1A1X2     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a) GN=argJ PE=3 SV=1
 3986 : A2STZ5_METLZ        0.34  0.54   16  191    2  177  186    8   20  387  A2STZ5     Arginine biosynthesis bifunctional protein ArgJ OS=Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z) GN=argJ PE=3 SV=1
 3987 : A4X651_SALTO        0.34  0.55   12  191    2  185  200   10   36  390  A4X651     Arginine biosynthesis bifunctional protein ArgJ OS=Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / CNB-440) GN=argJ PE=3 SV=1
 3988 : ARGJ_ARTOC          0.34  0.51    7  191   47  243  211    9   40  476  C5FHS6     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Arthroderma otae (strain ATCC MYA-4605 / CBS 113480) GN=MCYG_01725 PE=3 SV=1
 3989 : ARGJ_LEPIC          0.34  0.54  193  405  179  383  235    9   52  385  P62062     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130) GN=argJ PE=3 SV=1
 3990 : ARGJ_LODEL          0.34  0.51  193  405  215  439  237    6   36  441  A5E7B9     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239) GN=LELG_05508 PE=3 SV=1
 3991 : ARGJ_PARBP          0.34  0.50    7  191   41  240  212    8   39  446  C0SCV8     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Paracoccidioides brasiliensis (strain Pb03) GN=PABG_05513 PE=3 SV=1
 3992 : ARGJ_PICPG          0.34  0.56    2  191   13  207  201    7   17  428  C4R3R8     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Komagataella pastoris (strain GS115 / ATCC 20864) GN=PAS_chr3_0176 PE=3 SV=1
 3993 : ARGJ_POLPA          0.34  0.55  193  405  204  433  235    6   27  435  D3AXF4     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Polysphondylium pallidum GN=PPL_00785 PE=3 SV=1
 3994 : B1VH35_CORU7        0.34  0.54  193  405  195  398  225    6   33  400  B1VH35     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109) GN=argJ PE=3 SV=1
 3995 : B6WVT3_9DELT        0.34  0.63  193  405  215  424  219    5   15  426  B6WVT3     Arginine biosynthesis bifunctional protein ArgJ OS=Desulfovibrio piger ATCC 29098 GN=argJ PE=3 SV=1
 3996 : B8DU55_BIFA0        0.34  0.58  193  405  183  388  219    6   19  390  B8DU55     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium animalis subsp. lactis (strain AD011) GN=argJ PE=3 SV=1
 3997 : B8GMP0_THISH        0.34  0.49    4  191    2  189  205   11   34  403  B8GMP0     Arginine biosynthesis bifunctional protein ArgJ OS=Thioalkalivibrio sp. (strain HL-EbGR7) GN=argJ PE=3 SV=1
 3998 : C4RHU0_9ACTO        0.34  0.54   12  191    2  184  201   12   39  389  C4RHU0     Arginine biosynthesis bifunctional protein ArgJ OS=Micromonospora sp. ATCC 39149 GN=argJ PE=3 SV=1
 3999 : D3R4R9_BIFAB        0.34  0.58  193  405  183  388  219    6   19  390  D3R4R9     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium animalis subsp. lactis (strain BB-12) GN=argJ PE=3 SV=1
 4000 : D4BNH5_BIFBR        0.34  0.60  193  405  183  389  217    5   14  391  D4BNH5     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium breve DSM 20213 = JCM 1192 GN=argJ PE=3 SV=1
 4001 : D4HED4_PROAS        0.34  0.51  221  405   90  267  190    5   17  269  D4HED4     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes (strain SK137) GN=argJ PE=3 SV=1
 4002 : D5TGQ9_BIFAV        0.34  0.58  193  405  183  388  219    6   19  390  D5TGQ9     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium animalis subsp. lactis (strain V9) GN=argJ PE=3 SV=1
 4003 : D7WD01_9CORY        0.34  0.56  193  405  184  387  216    5   15  389  D7WD01     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium genitalium ATCC 33030 GN=argJ PE=3 SV=1
 4004 : D8KMC9_CORPF        0.34  0.58    8  191    1  180  186    5    8  252  D8KMC9     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium pseudotuberculosis (strain FRC41) GN=argJ PE=3 SV=1
 4005 : D8QE25_SCHCM        0.34  0.52  193  405  214  435  237    4   39  437  D8QE25     Putative uncharacterized protein OS=Schizophyllum commune (strain H4-8 / FGSC 9210) GN=SCHCODRAFT_11960 PE=3 SV=1
 4006 : D9SJP2_GALCS        0.34  0.67  193  405  193  407  216    4    4  409  D9SJP2     Arginine biosynthesis bifunctional protein ArgJ OS=Gallionella capsiferriformans (strain ES-2) GN=argJ PE=3 SV=1
 4007 : E3B852_9MICO        0.34  0.56  193  405  179  381  214    4   12  383  E3B852     Arginine biosynthesis bifunctional protein ArgJ OS=Dermacoccus sp. Ellin185 GN=argJ PE=3 SV=1
 4008 : E4AAP7_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E4AAP7     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL072PA2 GN=argJ PE=3 SV=1
 4009 : E4B545_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E4B545     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL036PA3 GN=argJ PE=3 SV=1
 4010 : E4BSB5_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E4BSB5     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL056PA1 GN=argJ PE=3 SV=1
 4011 : E4CEW8_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E4CEW8     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL036PA1 GN=argJ PE=3 SV=1
 4012 : E4DAY9_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E4DAY9     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL046PA2 GN=argJ PE=3 SV=1
 4013 : E4E2B8_PROAA        0.34  0.52  221  405   90  267  190    5   17  269  E4E2B8     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL110PA2 GN=argJ PE=3 SV=1
 4014 : E4E8W0_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E4E8W0     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL074PA1 GN=argJ PE=3 SV=1
 4015 : E4F3E8_PROAA        0.34  0.52  221  405   90  267  190    5   17  269  E4F3E8     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL110PA1 GN=argJ PE=3 SV=1
 4016 : E4FQH5_PROAA        0.34  0.52  221  405   90  267  190    5   17  269  E4FQH5     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL082PA1 GN=argJ PE=3 SV=1
 4017 : E4G9Z0_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E4G9Z0     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL005PA3 GN=argJ PE=3 SV=1
 4018 : E4GL58_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E4GL58     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL005PA2 GN=argJ PE=3 SV=1
 4019 : E4GS98_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E4GS98     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL005PA1 GN=argJ PE=3 SV=1
 4020 : E4NXE8_BIFBP        0.34  0.58  193  405  182  387  216    4   13  389  E4NXE8     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium bifidum (strain PRL2010) GN=argJ PE=3 SV=1
 4021 : E4VA96_BIFBI        0.34  0.58  193  405  182  387  216    4   13  389  E4VA96     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium bifidum NCIMB 41171 GN=argJ PE=3 SV=1
 4022 : E5AAW8_LEPMJ        0.34  0.53  193  405  242  466  237    7   36  468  E5AAW8     Similar to bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8) GN=LEMA_P019390.1 PE=3 SV=1
 4023 : E6CEY8_PROAA        0.34  0.52  221  405   90  267  190    5   17  269  E6CEY8     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL030PA1 GN=argJ PE=3 SV=1
 4024 : E6CUQ5_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E6CUQ5     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL038PA1 GN=argJ PE=3 SV=1
 4025 : E6DFC0_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E6DFC0     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL002PA3 GN=argJ PE=3 SV=1
 4026 : E6DUL7_PROAA        0.34  0.52  221  405   90  267  190    5   17  269  E6DUL7     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL053PA2 GN=argJ PE=3 SV=1
 4027 : E6E2Z1_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E6E2Z1     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL072PA1 GN=argJ PE=3 SV=1
 4028 : E6E9F9_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  E6E9F9     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL078PA1 GN=argJ PE=3 SV=1
 4029 : F1TQW1_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  F1TQW1     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL096PA3 GN=argJ PE=3 SV=1
 4030 : F1ULR8_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  F1ULR8     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL043PA1 GN=argJ PE=3 SV=1
 4031 : F1UYQ4_PROAA        0.34  0.52  221  405   90  267  190    5   17  269  F1UYQ4     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL092PA1 GN=argJ PE=3 SV=1
 4032 : F4F4L5_VERMA        0.34  0.56   12  191    2  185  198   10   32  390  F4F4L5     Arginine biosynthesis bifunctional protein ArgJ OS=Verrucosispora maris (strain AB-18-032) GN=argJ PE=3 SV=1
 4033 : F5TTM2_9ACTO        0.34  0.52  221  405   90  267  190    5   17  269  F5TTM2     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium sp. 434-HC2 GN=argJ PE=3 SV=1
 4034 : F6C538_BIFBA        0.34  0.60  193  405  183  389  217    5   14  391  F6C538     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium breve (strain ACS-071-V-Sch8b) GN=argJ PE=3 SV=1
 4035 : F8MEF4_NEUT8        0.34  0.51  193  405  239  467  237    6   32  469  F8MEF4     Putative uncharacterized protein OS=Neurospora tetrasperma (strain FGSC 2508 / ATCC MYA-4615 / P0657) GN=NEUTE1DRAFT_76230 PE=3 SV=1
 4036 : F9FC27_FUSOF        0.34  0.53  193  405  221  450  235    6   27  452  F9FC27     Uncharacterized protein OS=Fusarium oxysporum (strain Fo5176) GN=FOXB_03955 PE=3 SV=1
 4037 : F9XY49_BIFBU        0.34  0.60  193  405  183  389  217    5   14  391  F9XY49     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium breve (strain NCIMB 8807 / UCC2003) GN=argJ PE=3 SV=1
 4038 : F9YWT5_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  F9YWT5     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes 266 GN=argJ PE=3 SV=1
 4039 : G0H579_BIFAN        0.34  0.58  193  405  183  388  219    6   19  390  G0H579     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium animalis subsp. lactis CNCM I-2494 GN=argJ PE=3 SV=1
 4040 : G2SVH7_BIFAN        0.34  0.58  193  405  183  388  219    6   19  390  G2SVH7     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium animalis subsp. lactis BLC1 GN=argJ PE=3 SV=1
 4041 : G5EY77_9ACTO        0.34  0.51  221  405   90  267  190    5   17  269  G5EY77     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium sp. 5_U_42AFAA GN=argJ PE=3 SV=1
 4042 : G7E1Q5_MIXOS        0.34  0.53  193  405  238  458  234    4   34  460  G7E1Q5     Uncharacterized protein OS=Mixia osmundae (strain CBS 9802 / IAM 14324 / JCM 22182 / KY 12970) GN=Mo03436 PE=3 SV=1
 4043 : G8JRY8_ERECY        0.34  0.50  193  405  218  442  240    4   42  444  G8JRY8     Uncharacterized protein OS=Eremothecium cymbalariae (strain CBS 270.75 / DBVPG 7215 / KCTC 17166 / NRRL Y-17582) GN=Ecym_3421 PE=3 SV=1
 4044 : H0K5U2_9PSEU        0.34  0.58  193  405  179  381  215    5   14  383  H0K5U2     Arginine biosynthesis bifunctional protein ArgJ OS=Saccharomonospora azurea SZMC 14600 GN=argJ PE=3 SV=1
 4045 : H1W484_COLHI        0.34  0.52  193  405  229  458  238    6   33  460  H1W484     Arginine biosynthesis ArgJ OS=Colletotrichum higginsianum (strain IMI 349063) GN=CH063_00668 PE=3 SV=1
 4046 : H2FLP5_CORPS        0.34  0.58    8  191    1  180  186    5    8  252  H2FLP5     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium pseudotuberculosis 3/99-5 GN=argJ PE=3 SV=1
 4047 : H3KYF9_BIFBR        0.34  0.60  193  405  183  389  217    5   14  391  H3KYF9     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium breve CECT 7263 GN=argJ PE=3 SV=1
 4048 : H5SDW0_9BACT        0.34  0.53  193  405  173  376  222    9   27  378  H5SDW0     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured Aquificae bacterium GN=argJ PE=3 SV=1
 4049 : H5WWU1_9PSEU        0.34  0.56  193  405  179  381  220    6   24  383  H5WWU1     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Saccharomonospora marina XMU15 GN=argJ PE=3 SV=1
 4050 : H8G5H6_9PSEU        0.34  0.58  193  405  179  381  215    5   14  383  H8G5H6     Arginine biosynthesis bifunctional protein ArgJ OS=Saccharomonospora azurea NA-128 GN=argJ PE=3 SV=1
 4051 : I0L1E6_9ACTO        0.34  0.55   12  191    2  185  203   10   42  390  I0L1E6     Arginine biosynthesis bifunctional protein ArgJ OS=Micromonospora lupini str. Lupac 08 GN=argJ PE=3 SV=1
 4052 : I0RVT6_MYCXE        0.34  0.54  193  405  200  402  225    6   34  404  I0RVT6     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium xenopi RIVM700367 GN=argJ PE=3 SV=1
 4053 : I1RPW2_GIBZE        0.34  0.53  193  405  221  450  235    5   27  452  I1RPW2     Uncharacterized protein OS=Gibberella zeae (strain PH-1 / ATCC MYA-4620 / FGSC 9075 / NRRL 31084) GN=FG06094.1 PE=3 SV=1
 4054 : I1W9J7_BIFAR        0.34  0.58  193  405  183  388  219    6   19  390  I1W9J7     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium animalis subsp. animalis (strain ATCC 25527 / DSM 20104 / JCM 1190 / R101-8) GN=argJ PE=3 SV=1
 4055 : I2JWU5_DEKBR        0.34  0.52  193  405  206  424  234    4   36  426  I2JWU5     Mitochondrial ornithine acetyltransferase OS=Dekkera bruxellensis AWRI1499 GN=AWRI1499_2665 PE=3 SV=1
 4056 : I3XYE0_SULBS        0.34  0.52  193  405  188  394  229    5   38  396  I3XYE0     Arginine biosynthesis bifunctional protein ArgJ (Precursor) OS=Sulfurospirillum barnesii (strain ATCC 700032 / DSM 10660 / SES-3) GN=argJ PE=3 SV=1
 4057 : I6PW98_BIFAN        0.34  0.58  193  405  183  388  219    6   19  390  I6PW98     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium animalis subsp. lactis Bi-07 GN=argJ PE=3 SV=1
 4058 : I9NR94_9FIRM        0.34  0.57  193  405  188  401  224    3   21  403  I9NR94     Arginine biosynthesis bifunctional protein ArgJ OS=Pelosinus fermentans JBW45 GN=argJ PE=3 SV=1
 4059 : J5CSD0_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  J5CSD0     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira kirschneri serovar Grippotyphosa str. RM52 GN=argJ PE=3 SV=1
 4060 : J5QWR8_TRIAS        0.34  0.52  193  404  243  472  242   11   42  490  J5QWR8     Arginine biosynthesis-related protein OS=Trichosporon asahii var. asahii (strain ATCC 90039 / CBS 2479 / JCM 2466 / KCTC 7840 / NCYC 2677 / UAMH 7654) GN=A1Q1_01387 PE=3 SV=1
 4061 : J7SQ55_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  J7SQ55     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Bulgarica str. Mallika GN=argJ PE=3 SV=1
 4062 : J7UXA4_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  J7UXA4     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. FPW2026 GN=argJ PE=3 SV=1
 4063 : K0HNC7_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  K0HNC7     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes C1 GN=argJ PE=3 SV=1
 4064 : K0VNC5_9RHIZ        0.34  0.58   12  188   49  225  178    2    2  225  K0VNC5     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein (Fragment) OS=Rhizobium sp. Pop5 GN=argJ PE=3 SV=1
 4065 : K1W9R5_TRIAC        0.34  0.52  193  404  243  472  242   11   42  490  K1W9R5     Arginine biosynthesis-related protein OS=Trichosporon asahii var. asahii (strain CBS 8904) GN=A1Q2_07412 PE=3 SV=1
 4066 : K2HVB5_BIFBI        0.34  0.58  193  405  182  387  216    4   13  389  K2HVB5     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium bifidum LMG 13195 GN=argJ PE=3 SV=1
 4067 : K3VL13_FUSPC        0.34  0.53  193  405  221  450  235    5   27  452  K3VL13     Uncharacterized protein OS=Fusarium pseudograminearum (strain CS3096) GN=FPSE_04250 PE=3 SV=1
 4068 : K5CCL2_LEPME        0.34  0.52  193  405  179  382  232    7   47  384  K5CCL2     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira meyeri serovar Hardjo str. Went 5 GN=argJ PE=3 SV=1
 4069 : K5XG58_AGABU        0.34  0.52  193  405  231  467  243   10   36  469  K5XG58     Uncharacterized protein OS=Agaricus bisporus var. burnettii (strain JB137-S8 / ATCC MYA-4627 / FGSC 10392) GN=AGABI1DRAFT_112297 PE=3 SV=1
 4070 : K6ELU5_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  K6ELU5     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. UI 12621 GN=argJ PE=3 SV=1
 4071 : K6EQ97_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  K6EQ97     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Pomona str. Pomona GN=argJ PE=3 SV=1
 4072 : K6EX25_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  K6EX25     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. 2002000624 GN=argJ PE=3 SV=1
 4073 : K6JHK8_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  K6JHK8     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira kirschneri str. 2008720114 GN=argJ PE=3 SV=1
 4074 : K6NGP4_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  K6NGP4     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Grippotyphosa str. 2006006986 GN=argJ PE=3 SV=1
 4075 : K6THI5_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  K6THI5     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. 2002000621 GN=argJ PE=3 SV=1
 4076 : K7RXZ6_PROA4        0.34  0.58  193  405  181  386  219    8   19  388  K7RXZ6     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acidipropionici (strain ATCC 4875 / DSM 20272 / JCM 6432 / NBRC 12425 / NCIMB 8070) GN=argJ PE=3 SV=1
 4077 : K8HAU4_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  K8HAU4     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira kirschneri serovar Grippotyphosa str. Moskva GN=argJ PE=3 SV=1
 4078 : K8ISV5_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  K8ISV5     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Bataviae str. L1111 GN=argJ PE=3 SV=1
 4079 : K8ISZ1_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  K8ISZ1     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Pyrogenes str. 2006006960 GN=argJ PE=3 SV=1
 4080 : K8JNY9_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  K8JNY9     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Grippotyphosa str. UI 08368 GN=argJ PE=3 SV=1
 4081 : K8KEI0_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  K8KEI0     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. UI 12758 GN=argJ PE=3 SV=1
 4082 : K8KZC1_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  K8KZC1     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira noguchii str. 2006001870 GN=argJ PE=3 SV=1
 4083 : K8LL80_9LEPT        0.34  0.54  193  405  143  347  235    9   52  349  K8LL80     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira santarosai str. CBC379 GN=argJ PE=3 SV=1
 4084 : K8YBY7_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  K8YBY7     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira santarosai serovar Shermani str. LT 821 GN=argJ PE=3 SV=1
 4085 : K9I2H0_AGABB        0.34  0.52  193  405  231  467  243   10   36  469  K9I2H0     Uncharacterized protein OS=Agaricus bisporus var. bisporus (strain H97 / ATCC MYA-4626 / FGSC 10389) GN=AGABI2DRAFT_193487 PE=3 SV=1
 4086 : M2PJ36_9PSEU        0.34  0.52   12  191    2  181  197    9   34  386  M2PJ36     Arginine biosynthesis bifunctional protein ArgJ OS=Amycolatopsis azurea DSM 43854 GN=argJ PE=3 SV=1
 4087 : M3DA73_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M3DA73     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Pomona str. Fox 32256 GN=argJ PE=3 SV=1
 4088 : M4RET5_9BIFI        0.34  0.56  193  405  182  387  216    4   13  389  M4RET5     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium thermophilum RBL67 GN=argJ PE=3 SV=1
 4089 : M5PK97_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  M5PK97     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes FZ1/2/0 GN=argJ PE=3 SV=1
 4090 : M5VPA9_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  M5VPA9     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira noguchii str. Bonito GN=argJ PE=3 SV=1
 4091 : M5YDT4_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M5YDT4     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. FPW1039 GN=argJ PE=3 SV=1
 4092 : M5Z6P9_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M5Z6P9     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. UT126 GN=argJ PE=3 SV=1
 4093 : M5ZAP1_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M5ZAP1     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Valbuzzi str. Duyster GN=argJ PE=3 SV=1
 4094 : M6BBG4_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6BBG4     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. 2002000632 GN=argJ PE=3 SV=1
 4095 : M6CDK7_LEPME        0.34  0.52  193  405  179  382  232    7   47  384  M6CDK7     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira meyeri serovar Semaranga str. Veldrot Semarang 173 GN=argJ PE=3 SV=1
 4096 : M6CY09_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  M6CY09     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira alstoni serovar Sichuan str. 79601 GN=argJ PE=3 SV=1
 4097 : M6GN04_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  M6GN04     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira santarosai str. 2000027870 GN=argJ PE=3 SV=1
 4098 : M6H672_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6H672     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Djasiman str. LT1649 GN=argJ PE=3 SV=1
 4099 : M6HQI1_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  M6HQI1     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira noguchii str. 2007001578 GN=argJ PE=3 SV=1
 4100 : M6KMN2_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6KMN2     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Pyrogenes str. L0374 GN=argJ PE=3 SV=1
 4101 : M6KYQ4_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6KYQ4     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Medanensis str. L0448 GN=argJ PE=3 SV=1
 4102 : M6L6R8_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6L6R8     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. L0996 GN=argJ PE=3 SV=1
 4103 : M6MG52_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6MG52     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. L1207 GN=argJ PE=3 SV=1
 4104 : M6N444_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6N444     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Pyrogenes str. R168 GN=argJ PE=3 SV=1
 4105 : M6NJK2_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6NJK2     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Grippotyphosa str. UI 08434 GN=argJ PE=3 SV=1
 4106 : M6PC90_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6PC90     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Grippotyphosa str. UI 12764 GN=argJ PE=3 SV=1
 4107 : M6Q1R3_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6Q1R3     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Grippotyphosa str. UI 12769 GN=argJ PE=3 SV=1
 4108 : M6R531_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6R531     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Medanensis str. UT053 GN=argJ PE=3 SV=1
 4109 : M6R7W0_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6R7W0     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Pomona str. UT364 GN=argJ PE=3 SV=1
 4110 : M6SFI8_LEPIT        0.34  0.54  193  405  177  381  235    9   52  383  M6SFI8     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Copenhageni str. HAI0188 GN=argJ PE=3 SV=1
 4111 : M6TB11_9LEPT        0.34  0.54  193  405  143  347  235    9   52  349  M6TB11     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira santarosai str. HAI134 GN=argJ PE=3 SV=1
 4112 : M6TXS8_9LEPT        0.34  0.54  193  405  143  347  235    9   52  349  M6TXS8     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira santarosai str. HAI821 GN=argJ PE=3 SV=1
 4113 : M6VSL0_LEPBO        0.34  0.59  193  405   59  263  223    9   28  265  M6VSL0     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira borgpetersenii serovar Pomona str. 200901868 GN=argJ PE=3 SV=1
 4114 : M6W8T3_9LEPT        0.34  0.54  193  405  143  347  235    9   52  349  M6W8T3     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira santarosai str. CBC1416 GN=argJ PE=3 SV=1
 4115 : M6X0P8_9LEPT        0.34  0.54  193  405  177  381  235    9   52  383  M6X0P8     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira kirschneri str. 200801925 GN=argJ PE=3 SV=1
 4116 : M6YSX7_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  M6YSX7     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans str. UI 13372 GN=argJ PE=3 SV=1
 4117 : M9VFZ8_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  M9VFZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes HL096PA1 GN=argJ PE=3 SV=1
 4118 : N1RVV1_FUSC4        0.34  0.53  193  405  221  450  235    6   27  452  N1RVV1     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Fusarium oxysporum f. sp. cubense (strain race 4) GN=FOC4_g10012721 PE=3 SV=1
 4119 : N1UVA3_LEPIR        0.34  0.54  193  405  177  381  235    9   52  383  N1UVA3     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Australis str. 200703203 GN=argJ PE=3 SV=1
 4120 : N1VKI0_LEPIT        0.34  0.54  193  405  177  381  235    9   52  383  N1VKI0     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira interrogans serovar Copenhageni str. M20 GN=argJ PE=3 SV=1
 4121 : N4UF40_FUSC1        0.34  0.54  193  405  221  450  235    6   27  452  N4UF40     Uncharacterized protein OS=Fusarium oxysporum f. sp. cubense (strain race 1) GN=FOC1_g10014399 PE=3 SV=1
 4122 : Q2LTQ2_SYNAS        0.34  0.60  193  405  187  398  218    3   11  400  Q2LTQ2     Arginine biosynthesis bifunctional protein ArgJ OS=Syntrophus aciditrophicus (strain SB) GN=argJ PE=3 SV=1
 4123 : R7CZS2_9ACTN        0.34  0.52   10  191   16  208  198    7   21  424  R7CZS2     Arginine biosynthesis bifunctional protein ArgJ OS=Collinsella sp. CAG:289 GN=argJ PE=3 SV=1
 4124 : R9A360_9LEPT        0.34  0.52  193  405  179  382  232    7   47  384  R9A360     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira wolbachii serovar Codice str. CDC GN=argJ PE=3 SV=1
 4125 : S0A705_BIFAN        0.34  0.58  193  405  183  388  219    6   19  390  S0A705     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium animalis subsp. lactis Bl12 GN=argJ PE=3 SV=1
 4126 : S3H7A1_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  S3H7A1     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira noguchii str. 1993005606 GN=argJ PE=3 SV=1
 4127 : S6CKH2_9ACTN        0.34  0.54   14  191   22  222  201    7   23  438  S6CKH2     Arginine biosynthesis bifunctional protein ArgJ OS=Adlercreutzia equolifaciens DSM 19450 GN=argJ PE=3 SV=1
 4128 : S7QBC7_GLOTA        0.34  0.49  193  405  229  454  241    8   43  456  S7QBC7     Ornithine acetyltransferase OS=Gloeophyllum trabeum (strain ATCC 11539 / FP-39264 / Madison 617) GN=GLOTRDRAFT_138320 PE=3 SV=1
 4129 : S8EDH6_FOMPI        0.34  0.51  193  405  235  460  241    8   43  462  S8EDH6     Arginine biosynthesis protein OS=Fomitopsis pinicola (strain FP-58527) GN=FOMPIDRAFT_149525 PE=3 SV=1
 4130 : T0G2Z6_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  T0G2Z6     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira alstoni serovar Pingchang str. 80-412 GN=argJ PE=3 SV=1
 4131 : U2BZX8_BIFBI        0.34  0.58  193  405  182  387  216    4   13  389  U2BZX8     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium bifidum ATCC 29521 = JCM 1255 = DSM 20456 GN=argJ PE=3 SV=1
 4132 : U3Q9X1_BIFAN        0.34  0.58  193  405  183  388  219    6   19  390  U3Q9X1     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium animalis subsp. lactis ATCC 27673 GN=argJ PE=3 SV=1
 4133 : U7IFX9_9ACTO        0.34  0.51  221  405   90  267  190    5   17  269  U7IFX9     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium sp. KPL2009 GN=argJ PE=3 SV=1
 4134 : U7IK73_9ACTO        0.34  0.52  221  405   90  267  190    5   17  269  U7IK73     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium sp. KPL2008 GN=argJ PE=3 SV=1
 4135 : U7J315_9ACTO        0.34  0.51  221  405   90  267  190    5   17  269  U7J315     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium sp. KPL2003 GN=argJ PE=3 SV=1
 4136 : U7JP93_9ACTO        0.34  0.51  221  405   90  267  190    5   17  269  U7JP93     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium sp. KPL1854 GN=argJ PE=3 SV=1
 4137 : U9U7H1_RHIID        0.34  0.50  193  405  230  452  238    6   40  454  U9U7H1     Uncharacterized protein OS=Rhizophagus irregularis (strain DAOM 181602 / DAOM 197198 / MUCL 43194) GN=GLOINDRAFT_22868 PE=3 SV=1
 4138 : V5D7R2_PROAA        0.34  0.52  221  405   90  267  190    5   17  269  V5D7R2     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes P6 GN=argJ PE=3 SV=1
 4139 : V6GUZ5_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  V6GUZ5     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira noguchii str. Hook GN=argJ PE=3 SV=1
 4140 : V6GYW3_9LEPT        0.34  0.54  193  405  179  383  235    9   52  385  V6GYW3     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira noguchii str. Cascata GN=argJ PE=3 SV=1
 4141 : V6I093_9LEPT        0.34  0.54  193  405  177  381  235    9   52  383  V6I093     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira alexanderi serovar Manhao 3 str. L 60 GN=argJ PE=3 SV=1
 4142 : V6L5U8_9ACTO        0.34  0.61  193  405   47  249  213    3   10  251  V6L5U8     Uncharacterized protein (Fragment) OS=Streptomycetaceae bacterium MP113-05 GN=N566_00855 PE=3 SV=1
 4143 : V6UW21_9PSED        0.34  0.66  193  405   86  300  216    4    4  302  V6UW21     N-acetylglutamate synthase (Fragment) OS=Pseudomonas mosselii SJ10 GN=argJ PE=3 SV=1
 4144 : V9DA17_9EURO        0.34  0.49   16  191   43  237  205   11   39  476  V9DA17     Glutamate N-acetyltransferase/amino-acid acetyltransferase OS=Cladophialophora carrionii CBS 160.54 GN=G647_05488 PE=3 SV=1
 4145 : W4NC12_9BIFI        0.34  0.58  193  405  183  388  216    4   13  390  W4NC12     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium moukalabense DSM 27321 GN=argJ PE=3 SV=1
 4146 : W4TY51_PROAA        0.34  0.51  221  405   90  267  190    5   17  269  W4TY51     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium acnes JCM 18916 GN=argJ PE=3 SV=1
 4147 : W6EVX8_BIFBR        0.34  0.60  193  405  183  389  217    5   14  391  W6EVX8     Glutamate N-acetyltransferase/Amino-acid acetyltransferase OS=Bifidobacterium breve JCM 7019 GN=B7019_0656 PE=4 SV=1
 4148 : W6F190_BIFBR        0.34  0.60  193  405  183  389  217    5   14  391  W6F190     Glutamate N-acetyltransferase/Amino-acid acetyltransferase OS=Bifidobacterium breve NCFB 2258 GN=B2258_0651 PE=4 SV=1
 4149 : W6FBL7_BIFBR        0.34  0.60  193  405  183  389  217    5   14  391  W6FBL7     Glutamate N-acetyltransferase/Amino-acid acetyltransferase OS=Bifidobacterium breve S27 GN=argJ PE=4 SV=1
 4150 : W7T907_9PSEU        0.34  0.56    2  191    3  192  201    9   22  397  W7T907     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase argJ OS=Kutzneria sp. 744 GN=KUTG_07548 PE=4 SV=1
 4151 : W7W318_9BURK        0.34  0.57    4  184    4  185  182    1    1  185  W7W318     Arginine biosynthesis bifunctional protein ArgJ OS=Methylibium sp. T29 GN=argJ_2 PE=4 SV=1
 4152 : A3SUP1_9RHOB        0.33  0.52    5  191    1  198  203    7   21  408  A3SUP1     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfitobacter sp. NAS-14.1 GN=argJ PE=3 SV=1
 4153 : A4BKG0_9GAMM        0.33  0.55    4  191    2  190  201    9   25  407  A4BKG0     Arginine biosynthesis bifunctional protein ArgJ OS=Reinekea blandensis MED297 GN=argJ PE=3 SV=1
 4154 : A8LY50_SALAI        0.33  0.54   12  191    2  184  198   10   33  389  A8LY50     Arginine biosynthesis bifunctional protein ArgJ OS=Salinispora arenicola (strain CNS-205) GN=argJ PE=3 SV=1
 4155 : ARGJ1_BOTFB         0.33  0.47   16  191   54  243  203    9   40  475  A6S146     Arginine biosynthesis bifunctional protein ArgJ 1, mitochondrial OS=Botryotinia fuckeliana (strain B05.10) GN=BC1G_06543 PE=3 SV=1
 4156 : ARGJ_AJECG          0.33  0.49    7  191   41  240  217   10   49  473  C0NE02     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ajellomyces capsulatus (strain G186AR / H82 / ATCC MYA-2454 / RMSCC 2432) GN=HCBG_02095 PE=3 SV=1
 4157 : ARGJ_AJECH          0.33  0.49    7  191   41  240  217   10   49  473  C6HSY8     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ajellomyces capsulatus (strain H143) GN=HCDG_09319 PE=3 SV=1
 4158 : ARGJ_AJEDR          0.33  0.49  193  405  241  471  245    5   46  473  C5GXZ4     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ajellomyces dermatitidis (strain ER-3 / ATCC MYA-2586) GN=BDCG_09234 PE=3 SV=1
 4159 : ARGJ_AJEDR          0.33  0.50    7  191   41  240  215    9   45  473  C5GXZ4     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ajellomyces dermatitidis (strain ER-3 / ATCC MYA-2586) GN=BDCG_09234 PE=3 SV=1
 4160 : ARGJ_AJEDS          0.33  0.49  193  405  241  471  245    5   46  473  C5K110     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ajellomyces dermatitidis (strain SLH14081) GN=BDBG_08504 PE=3 SV=1
 4161 : ARGJ_AJEDS          0.33  0.50    7  191   41  240  215    9   45  473  C5K110     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ajellomyces dermatitidis (strain SLH14081) GN=BDBG_08504 PE=3 SV=1
 4162 : ARGJ_ASHGO          0.33  0.52  193  405  217  441  240    4   42  443  Q759Y5     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) GN=ADR138C PE=3 SV=2
 4163 : ARGJ_ASPFC          0.33  0.49  193  405  234  464  242    6   40  466  B0Y3W4     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Neosartorya fumigata (strain CEA10 / CBS 144.89 / FGSC A1163) GN=AFUB_055650 PE=3 SV=1
 4164 : ARGJ_ASPFN          0.33  0.49  193  405  234  464  244    8   44  466  B8NEJ3     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / NRRL 3357 / JCM 12722 / SRRC 167) GN=AFLA_061910 PE=3 SV=1
 4165 : ARGJ_ASPNC          0.33  0.48    7  191   29  223  209   10   38  456  A2QGS5     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Aspergillus niger (strain CBS 513.88 / FGSC A1513) GN=An03g04330 PE=3 SV=1
 4166 : ARGJ_BIFLO          0.33  0.60  193  405  183  389  217    5   14  391  Q8G5F0     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium longum (strain NCC 2705) GN=argJ PE=3 SV=1
 4167 : ARGJ_CANAL          0.33  0.49  193  405  212  437  241    6   43  439  Q5AH38     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Candida albicans (strain SC5314 / ATCC MYA-2876) GN=ECM42 PE=3 SV=1
 4168 : ARGJ_COCP7          0.33  0.51  193  405  247  477  242    6   40  479  C5P7K2     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Coccidioides posadasii (strain C735) GN=CPC735_027380 PE=3 SV=1
 4169 : ARGJ_CORJK          0.33  0.55  193  405  200  403  225    9   33  405  Q4JW03     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium jeikeium (strain K411) GN=argJ PE=3 SV=1
 4170 : ARGJ_CRYNB          0.33  0.50  193  405  237  474  253    9   55  476  P0CM21     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Cryptococcus neoformans var. neoformans serotype D (strain B-3501A) GN=CNBD2760 PE=3 SV=1
 4171 : ARGJ_CRYNJ          0.33  0.50  193  405  237  474  253    9   55  476  P0CM20     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) GN=CND03570 PE=3 SV=1
 4172 : ARGJ_NEOFI          0.33  0.49  193  405  224  454  242    6   40  456  A1DF20     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / FGSC A1164 / NRRL 181) GN=NFIA_079180 PE=3 SV=1
 4173 : ARGJ_PARBD          0.33  0.49    7  191   41  240  214   10   43  473  C1GEZ1     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Paracoccidioides brasiliensis (strain Pb18) GN=PADG_05827 PE=3 SV=1
 4174 : ARGJ_PICGU          0.33  0.49  193  405  209  434  242    8   45  436  A5DAF0     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324) GN=PGUG_00255 PE=3 SV=2
 4175 : ARGJ_SCHPO          0.33  0.50    2  191   21  225  211    7   27  445  O94346     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=SPBC1271.14 PE=3 SV=1
 4176 : B3DSZ2_BIFLD        0.33  0.60  193  405  183  389  217    5   14  391  B3DSZ2     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium longum (strain DJO10A) GN=argJ PE=3 SV=1
 4177 : B7GTP5_BIFLS        0.33  0.60  193  405  183  389  217    5   14  391  B7GTP5     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12) GN=argJ PE=3 SV=1
 4178 : C5E7V4_BIFLI        0.33  0.60  193  405  183  389  217    5   14  391  C5E7V4     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium longum subsp. infantis CCUG 52486 GN=argJ PE=3 SV=1
 4179 : C6WA85_ACTMD        0.33  0.53    8  191    2  185  201    9   34  390  C6WA85     Arginine biosynthesis bifunctional protein ArgJ OS=Actinosynnema mirum (strain ATCC 29888 / DSM 43827 / NBRC 14064 / IMRU 3971) GN=argJ PE=3 SV=1
 4180 : C7N0Y9_SLAHD        0.33  0.50    2  191   20  216  210    7   33  432  C7N0Y9     Arginine biosynthesis bifunctional protein ArgJ OS=Slackia heliotrinireducens (strain ATCC 29202 / DSM 20476 / NCTC 11029 / RHS 1) GN=argJ PE=3 SV=1
 4181 : C8XIF4_NAKMY        0.33  0.55  193  405  184  388  221    8   24  390  C8XIF4     Arginine biosynthesis bifunctional protein ArgJ OS=Nakamurella multipartita (strain ATCC 700099 / DSM 44233 / JCM 9543 / Y-104) GN=argJ PE=3 SV=1
 4182 : D1NTY2_9BIFI        0.33  0.57  193  405  183  388  218    6   17  390  D1NTY2     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium gallicum DSM 20093 GN=argJ PE=3 SV=1
 4183 : D4D896_TRIVH        0.33  0.51  193  405  239  469  243    8   42  471  D4D896     Putative uncharacterized protein OS=Trichophyton verrucosum (strain HKI 0517) GN=TRV_03332 PE=3 SV=1
 4184 : D6ZTA6_BIFLJ        0.33  0.60  193  405  183  389  217    5   14  391  D6ZTA6     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium longum subsp. longum (strain JDM301) GN=argJ PE=3 SV=1
 4185 : E3S1W6_PYRTT        0.33  0.47    7  191   39  238  213    8   41  462  E3S1W6     Putative uncharacterized protein OS=Pyrenophora teres f. teres (strain 0-1) GN=PTT_16255 PE=3 SV=1
 4186 : E4QZL2_BIFLM        0.33  0.60  193  405  183  389  217    5   14  391  E4QZL2     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium longum subsp. longum (strain BBMN68) GN=argJ PE=3 SV=1
 4187 : E5XW83_9BIFI        0.33  0.60  193  405  183  389  217    5   14  391  E5XW83     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium sp. 12_1_47BFAA GN=argJ PE=3 SV=1
 4188 : E6R4C9_CRYGW        0.33  0.50  193  405  238  475  253    9   55  477  E6R4C9     Arginine biosynthesis-related protein, putative OS=Cryptococcus gattii serotype B (strain WM276 / ATCC MYA-4071) GN=CGB_D6270C PE=3 SV=1
 4189 : F0SY46_SYNGF        0.33  0.52    9  191    6  200  203    7   28  411  F0SY46     Arginine biosynthesis bifunctional protein ArgJ OS=Syntrophobotulus glycolicus (strain DSM 8271 / FlGlyR) GN=argJ PE=3 SV=1
 4190 : F0UFC1_AJEC8        0.33  0.49  193  405  241  471  245    5   46  473  F0UFC1     Arginine biosynthesis ArgJ OS=Ajellomyces capsulatus (strain H88) GN=HCEG_04140 PE=3 SV=1
 4191 : F0UFC1_AJEC8        0.33  0.49    7  191   41  240  217   10   49  473  F0UFC1     Arginine biosynthesis ArgJ OS=Ajellomyces capsulatus (strain H88) GN=HCEG_04140 PE=3 SV=1
 4192 : F2RP63_TRIT1        0.33  0.51  193  405  244  474  242    6   40  476  F2RP63     Arginine biosynthesis protein ArgJ OS=Trichophyton tonsurans (strain CBS 112818) GN=TESG_00673 PE=3 SV=1
 4193 : F2TI11_AJEDA        0.33  0.49  193  405  241  471  245    5   46  473  F2TI11     Arginine biosynthesis ArgJ OS=Ajellomyces dermatitidis (strain ATCC 18188 / CBS 674.68) GN=BDDG_05805 PE=3 SV=1
 4194 : F2TI11_AJEDA        0.33  0.50    7  191   41  240  215    9   45  473  F2TI11     Arginine biosynthesis ArgJ OS=Ajellomyces dermatitidis (strain ATCC 18188 / CBS 674.68) GN=BDDG_05805 PE=3 SV=1
 4195 : F3C1V6_PSESG        0.33  0.54   19  191   17  188  178    4   11  276  F3C1V6     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein (Fragment) OS=Pseudomonas syringae pv. glycinea str. race 4 GN=argJ PE=3 SV=1
 4196 : F6FT37_ISOV2        0.33  0.53   11  191    2  188  203   11   38  397  F6FT37     Arginine biosynthesis bifunctional protein ArgJ OS=Isoptericola variabilis (strain 225) GN=argJ PE=3 SV=1
 4197 : F8ARJ4_BIFLN        0.33  0.60  193  405  183  389  217    5   14  391  F8ARJ4     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium longum subsp. longum KACC 91563 GN=argJ PE=3 SV=1
 4198 : F8E0S9_CORRG        0.33  0.55  193  405  219  422  226    8   35  424  F8E0S9     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium resistens (strain DSM 45100 / JCM 12819 / GTC 2026) GN=argJ PE=3 SV=1
 4199 : F8Q9S5_SERL3        0.33  0.51  193  405  246  470  240    8   42  472  F8Q9S5     Putative uncharacterized protein OS=Serpula lacrymans var. lacrymans (strain S7.3) GN=SERLA73DRAFT_125549 PE=3 SV=1
 4200 : G0I5V9_CORPS        0.33  0.56    8  191   21  200  190    7   16  272  G0I5V9     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium pseudotuberculosis PAT10 GN=argJ PE=3 SV=1
 4201 : G0V7C5_NAUCC        0.33  0.49  193  405  215  439  242    6   46  441  G0V7C5     Uncharacterized protein OS=Naumovozyma castellii (strain ATCC 76901 / CBS 4309 / NBRC 1992 / NRRL Y-12630) GN=NCAS0A08150 PE=3 SV=1
 4202 : G1WIW5_9ACTN        0.33  0.55    5  191   10  207  204    6   23  423  G1WIW5     Arginine biosynthesis bifunctional protein ArgJ OS=Collinsella tanakaei YIT 12063 GN=argJ PE=3 SV=1
 4203 : G1XUN1_ARTOA        0.33  0.49  193  405  240  461  239    8   43  463  G1XUN1     Uncharacterized protein OS=Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491) GN=AOL_s00215g689 PE=3 SV=1
 4204 : G2XWI6_BOTF4        0.33  0.47   16  191   54  243  203    9   40  475  G2XWI6     Similar to bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein OS=Botryotinia fuckeliana (strain T4) GN=BofuT4_P052050.1 PE=3 SV=1
 4205 : G3Y7B9_ASPNA        0.33  0.48    7  191   29  223  209   10   38  456  G3Y7B9     Uncharacterized protein OS=Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7) GN=ASPNIDRAFT_50689 PE=3 SV=1
 4206 : G8B933_CANPC        0.33  0.51  193  405  210  435  237    7   35  437  G8B933     Putative uncharacterized protein OS=Candida parapsilosis (strain CDC 317 / ATCC MYA-4646) GN=CPAR2_301210 PE=3 SV=1
 4207 : G8ZQF6_TORDC        0.33  0.50  193  405  215  439  239    5   40  441  G8ZQF6     Uncharacterized protein OS=Torulaspora delbrueckii (strain ATCC 10662 / CBS 1146 / NBRC 0425 / NCYC 2629 / NRRL Y-866) GN=TDEL0B07210 PE=3 SV=1
 4208 : G9P569_HYPAI        0.33  0.54  193  405  216  445  235    6   27  447  G9P569     Putative uncharacterized protein OS=Hypocrea atroviridis (strain ATCC 20476 / IMI 206040) GN=TRIATDRAFT_29026 PE=3 SV=1
 4209 : H2AM72_KAZAF        0.33  0.50  193  405  222  446  242    6   46  448  H2AM72     Uncharacterized protein OS=Kazachstania africana (strain ATCC 22294 / BCRC 22015 / CBS 2517 / CECT 1963 / NBRC 1671 / NRRL Y-8276) GN=KAFR0A00340 PE=3 SV=1
 4210 : H6BZB6_EXODN        0.33  0.47    6  191   33  244  218   11   38  481  H6BZB6     Arginine biosynthesis ArgJ, mitochondrial OS=Exophiala dermatitidis (strain ATCC 34100 / CBS 525.76 / NIH/UT8656) GN=HMPREF1120_05035 PE=3 SV=1
 4211 : H8J0D4_MYCIT        0.33  0.58  193  405  199  401  222    9   28  403  H8J0D4     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium intracellulare MOTT-02 GN=argJ PE=3 SV=1
 4212 : I3BLE7_BIFLN        0.33  0.60  193  405  183  389  217    5   14  391  I3BLE7     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium longum subsp. longum 44B GN=argJ PE=3 SV=1
 4213 : I6Y169_PROPF        0.33  0.58  193  405  179  381  217    5   18  383  I6Y169     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium propionicum (strain F0230a) GN=argJ PE=3 SV=1
 4214 : J9VL07_CRYNH        0.33  0.50  193  405  237  474  253    9   55  476  J9VL07     Arginine biosynthesis ArgJ, mitochondrial OS=Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487) GN=CNAG_01238 PE=3 SV=1
 4215 : K1WMC8_MARBU        0.33  0.46   16  191   59  248  206   11   46  480  K1WMC8     ArgJ family protein OS=Marssonina brunnea f. sp. multigermtubi (strain MB_m1) GN=MBM_08205 PE=3 SV=1
 4216 : K2RMT9_MACPH        0.33  0.49   16  191   31  220  203    8   40  444  K2RMT9     Arginine biosynthesis protein ArgJ OS=Macrophomina phaseolina (strain MS6) GN=MPH_06814 PE=3 SV=1
 4217 : K4IPB6_BIFAP        0.33  0.54  193  405  182  387  218    7   17  389  K4IPB6     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium asteroides (strain PRL2011) GN=argJ PE=3 SV=1
 4218 : K6VJ55_9MICO        0.33  0.54  193  405  179  381  220    7   24  383  K6VJ55     Arginine biosynthesis bifunctional protein ArgJ OS=Kineosphaera limosa NBRC 100340 GN=argJ PE=3 SV=1
 4219 : K8HT14_LEPBO        0.33  0.54  193  405  177  381  235    9   52  383  K8HT14     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira borgpetersenii serovar Castellonis str. 200801910 GN=argJ PE=3 SV=1
 4220 : K8M254_LEPBO        0.33  0.54  193  405  177  381  235    9   52  383  K8M254     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira borgpetersenii str. 200901122 GN=argJ PE=3 SV=1
 4221 : L8GC11_PSED2        0.33  0.48   16  191   54  243  205   11   44  475  L8GC11     Arginine biosynthesis ArgJ 1, mitochondrial OS=Pseudogymnoascus destructans (strain ATCC MYA-4855 / 20631-21) GN=GMDG_00836 PE=3 SV=1
 4222 : M2PR19_CERS8        0.33  0.51  193  405  240  463  239    8   41  465  M2PR19     Uncharacterized protein OS=Ceriporiopsis subvermispora (strain B) GN=CERSUDRAFT_151839 PE=3 SV=1
 4223 : M5GBQ1_DACSP        0.33  0.51  193  405  251  473  238    7   40  475  M5GBQ1     Arginine biosynthesis protein ArgJ OS=Dacryopinax sp. (strain DJM 731) GN=DACRYDRAFT_49608 PE=3 SV=1
 4224 : M6EHX9_9LEPT        0.33  0.54  193  405  177  381  235    9   52  383  M6EHX9     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira sp. serovar Kenya str. Sh9 GN=argJ PE=3 SV=1
 4225 : M6FP67_9LEPT        0.33  0.54  193  405  177  381  235    9   52  383  M6FP67     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira weilii str. 2006001855 GN=argJ PE=3 SV=1
 4226 : M6J1J6_LEPBO        0.33  0.54  193  405  177  381  235    9   52  383  M6J1J6     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira borgpetersenii str. Brem 307 GN=argJ PE=3 SV=1
 4227 : M6J7R4_LEPBO        0.33  0.54  193  405  177  381  235    9   52  383  M6J7R4     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira borgpetersenii str. Brem 328 GN=argJ PE=3 SV=1
 4228 : M6M0S2_9LEPT        0.33  0.54  193  405  177  381  235    9   52  383  M6M0S2     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira weilii str. LNT 1234 GN=argJ PE=3 SV=1
 4229 : M6RQV2_LEPBO        0.33  0.54  193  405  177  381  235    9   52  383  M6RQV2     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira borgpetersenii str. Noumea 25 GN=argJ PE=3 SV=1
 4230 : M7TIV3_BOTF1        0.33  0.47   16  191   54  243  203    9   40  475  M7TIV3     Putative arginine biosynthesis bifunctional protein argj protein OS=Botryotinia fuckeliana (strain BcDW1) GN=BcDW1_7980 PE=3 SV=1
 4231 : N6XPB1_LEPBO        0.33  0.54  193  405  177  381  235    9   52  383  N6XPB1     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira borgpetersenii serovar Mini str. 201000851 GN=argJ PE=3 SV=1
 4232 : Q04VZ5_LEPBJ        0.33  0.54  193  405  179  383  235    9   52  385  Q04VZ5     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197) GN=argJ PE=3 SV=1
 4233 : Q04XH7_LEPBL        0.33  0.54  193  405  179  383  235    9   52  385  Q04XH7     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira borgpetersenii serovar Hardjo-bovis (strain L550) GN=argJ PE=3 SV=1
 4234 : Q0AIA5_NITEC        0.33  0.54    5  191    5  192  199    9   23  409  Q0AIA5     Arginine biosynthesis bifunctional protein ArgJ OS=Nitrosomonas eutropha (strain C91) GN=argJ PE=3 SV=1
 4235 : R0XCJ0_NEIME        0.33  0.54    2  191    2  189  192    3    6  207  R0XCJ0     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis NM90 GN=argJ PE=3 SV=1
 4236 : R5NG31_9BIFI        0.33  0.60  193  405  183  389  217    5   14  391  R5NG31     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium longum CAG:69 GN=argJ PE=3 SV=1
 4237 : R5Z8H5_9ACTN        0.33  0.55    7  191   11  206  200    6   19  422  R5Z8H5     Arginine biosynthesis bifunctional protein ArgJ OS=Collinsella sp. CAG:166 GN=argJ PE=3 SV=1
 4238 : R7BAZ6_9FIRM        0.33  0.53    7  191    2  197  201    5   21  415  R7BAZ6     Arginine biosynthesis bifunctional protein ArgJ OS=Firmicutes bacterium CAG:341 GN=argJ PE=3 SV=1
 4239 : R8ZU64_9LEPT        0.33  0.52  193  405  179  382  232    7   47  384  R8ZU64     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira yanagawae serovar Saopaulo str. Sao Paulo = ATCC 700523 GN=argJ PE=3 SV=1
 4240 : S0DXC7_GIBF5        0.33  0.52  193  405  221  450  235    6   27  452  S0DXC7     Probable glutamate N-acetyltransferase OS=Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831) GN=FFUJ_13289 PE=3 SV=1
 4241 : S3CNE5_GLAL2        0.33  0.47   16  191   53  242  205   10   44  474  S3CNE5     DmpA/ArgJ-like protein OS=Glarea lozoyensis (strain ATCC 20868 / MF5171) GN=GLAREA_04803 PE=3 SV=1
 4242 : S3DNA1_BIFLN        0.33  0.60  193  405  183  389  217    5   14  391  S3DNA1     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium longum D2957 GN=argJ PE=3 SV=1
 4243 : S3UNY5_LEPBO        0.33  0.54  193  405  177  381  235    9   52  383  S3UNY5     Arginine biosynthesis bifunctional protein ArgJ OS=Leptospira borgpetersenii serovar Javanica str. UI 09931 GN=argJ PE=3 SV=1
 4244 : S9ZD86_9RHOO        0.33  0.64  193  405  192  410  222    7   12  412  S9ZD86     Arginine biosynthesis bifunctional protein ArgJ OS=Thauera terpenica 58Eu GN=argJ PE=3 SV=1
 4245 : T2I298_BIFLN        0.33  0.60  193  405  183  389  217    5   14  391  T2I298     Arginine biosynthesis bifunctional protein ArgJ OS=Bifidobacterium longum subsp. longum CECT 7347 GN=argJ PE=3 SV=1
 4246 : T5BUT9_AJEDE        0.33  0.51    7  191   41  240  215    9   45  473  T5BUT9     Arginine biosynthesis ArgJ, mitochondrial OS=Ajellomyces dermatitidis ATCC 26199 GN=BDFG_05053 PE=3 SV=1
 4247 : U1GEB9_9ACTO        0.33  0.55  193  405  181  386  219    8   19  388  U1GEB9     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium avidum TM16 GN=argJ PE=3 SV=1
 4248 : U2A6Z6_9BACI        0.33  0.56  195  405    1  205  218    6   20  207  U2A6Z6     Uncharacterized protein (Fragment) OS=Bacillus sp. EGD-AK10 GN=N880_29095 PE=3 SV=1
 4249 : U2XJZ0_9MICO        0.33  0.57  193  405  181  383  221    7   26  385  U2XJZ0     Arginine biosynthesis bifunctional protein ArgJ OS=Microbacterium sp. TS-1 GN=argJ PE=3 SV=1
 4250 : U5H895_USTV1        0.33  0.56  193  405  295  518  232    9   27  520  U5H895     Uncharacterized protein OS=Microbotryum violaceum (strain p1A1 Lamole) GN=MVLG_03461 PE=3 SV=1
 4251 : U7JTG9_9ACTO        0.33  0.55  193  405  181  386  219    8   19  388  U7JTG9     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium sp. KPL1838 GN=argJ PE=3 SV=1
 4252 : U7M772_9ACTO        0.33  0.55  193  405  181  386  219    8   19  388  U7M772     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium sp. KPL1852 GN=argJ PE=3 SV=1
 4253 : W0DBD5_9AQUI        0.33  0.53  193  405  173  376  222    9   27  378  W0DBD5     Arginine biosynthesis bifunctional protein ArgJ OS=Thermocrinis ruber DSM 12173 GN=argJ PE=3 SV=1
 4254 : W0FSP2_9BACT        0.33  0.53    8  191   25  217  205    8   33  433  W0FSP2     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured bacterium Contigcl_1769 GN=argJ PE=3 SV=1
 4255 : W1TT98_9ACTO        0.33  0.52  193  405  188  391  222    7   27  393  W1TT98     Arginine biosynthesis bifunctional protein ArgJ OS=Varibaculum cambriense DORA_20 GN=argJ PE=3 SV=1
 4256 : W6MXI0_9ASCO        0.33  0.51  193  405  212  430  234    4   36  432  W6MXI0     Genomic scaffold, Kuraishia_capsulata_scaffold_6 OS=Kuraishia capsulata CBS 1993 GN=KUCA_T00004910001 PE=4 SV=1
 4257 : W7M6L9_GIBM7        0.33  0.52  193  405  221  450  235    6   27  452  W7M6L9     Arginine biosynthesis ArgJ, mitochondrial OS=Gibberella moniliformis (strain M3125 / FGSC 7600) GN=FVEG_04728 PE=4 SV=1
 4258 : A8UVX3_9AQUI        0.32  0.49  193  405  174  377  222    9   27  379  A8UVX3     Arginine biosynthesis bifunctional protein ArgJ OS=Hydrogenivirga sp. 128-5-R1-1 GN=argJ PE=3 SV=1
 4259 : ARGJ_AJECG          0.32  0.48  193  405  241  471  247    7   50  473  C0NE02     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ajellomyces capsulatus (strain G186AR / H82 / ATCC MYA-2454 / RMSCC 2432) GN=HCBG_02095 PE=3 SV=1
 4260 : ARGJ_AJECH          0.32  0.49  193  405  241  471  245    5   46  473  C6HSY8     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ajellomyces capsulatus (strain H143) GN=HCDG_09319 PE=3 SV=1
 4261 : ARGJ_AJECN          0.32  0.47  193  405  241  469  250    8   58  471  A6R040     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ajellomyces capsulatus (strain NAm1 / WU24) GN=HCAG_02997 PE=3 SV=1
 4262 : ARGJ_AJECN          0.32  0.48    7  191   41  240  215   11   45  471  A6R040     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Ajellomyces capsulatus (strain NAm1 / WU24) GN=HCAG_02997 PE=3 SV=1
 4263 : ARGJ_ARTOC          0.32  0.50  193  405  244  474  242    6   40  476  C5FHS6     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Arthroderma otae (strain ATCC MYA-4605 / CBS 113480) GN=MCYG_01725 PE=3 SV=1
 4264 : ARGJ_ASPOR          0.32  0.49  193  405  224  454  242    6   40  456  Q2U7R8     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Aspergillus oryzae (strain ATCC 42149 / RIB 40) GN=AO090701000729 PE=3 SV=1
 4265 : ARGJ_ASPTN          0.32  0.49  193  405  224  455  243    7   41  457  Q0CDB9     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Aspergillus terreus (strain NIH 2624 / FGSC A1156) GN=ATEG_08315 PE=3 SV=1
 4266 : ARGJ_CANAL          0.32  0.49   16  191   27  211  203   10   45  439  Q5AH38     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Candida albicans (strain SC5314 / ATCC MYA-2876) GN=ECM42 PE=3 SV=1
 4267 : ARGJ_CANAW          0.32  0.49   16  191   27  211  203   10   45  439  C4YTS0     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Candida albicans (strain WO-1) GN=CAWG_05565 PE=3 SV=1
 4268 : ARGJ_EMENI          0.32  0.49  193  405  234  462  242    7   42  464  Q5AVF8     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) GN=ornA PE=3 SV=2
 4269 : ARGJ_MYCLE          0.32  0.57  193  405  203  405  225    7   34  407  Q9CC14     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium leprae (strain TN) GN=argJ PE=3 SV=1
 4270 : ARGJ_NECH7          0.32  0.48    7  191   26  219  203    8   27  451  C7YUB3     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Nectria haematococca (strain 77-13-4 / ATCC MYA-4622 / FGSC 9596 / MPVI) GN=NECHADRAFT_96275 PE=3 SV=1
 4271 : ARGJ_PARBA          0.32  0.48    7  191   41  240  214   10   43  473  C1H986     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Paracoccidioides lutzii (strain ATCC MYA-826 / Pb01) GN=PAAG_07327 PE=3 SV=1
 4272 : ARGJ_VANPO          0.32  0.51  193  405  215  439  240    4   42  441  A7TPS8     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294) GN=Kpol_1073p15 PE=3 SV=1
 4273 : ARGJ_YEAS1          0.32  0.51  193  405  215  439  240    4   42  441  B3LLV5     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Saccharomyces cerevisiae (strain RM11-1a) GN=ARG7 PE=3 SV=1
 4274 : ARGJ_YEAS7          0.32  0.51  193  405  215  439  240    4   42  441  A6ZMC1     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Saccharomyces cerevisiae (strain YJM789) GN=ARG7 PE=3 SV=1
 4275 : ARGJ_YEAS8          0.32  0.50  193  405  215  439  240    4   42  441  C8ZER4     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse) GN=ARG7 PE=3 SV=1
 4276 : ARGJ_YEAST          0.32  0.51  193  405  215  439  240    4   42  441  Q04728     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=ARG7 PE=1 SV=1
 4277 : ARGJ_ZYGRC          0.32  0.51  193  405  211  435  242    6   46  437  C5E3Y4     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Zygosaccharomyces rouxii (strain ATCC 2623 / CBS 732 / NBRC 1130 / NCYC 568 / NRRL Y-229) GN=ZYRO0E01232g PE=3 SV=1
 4278 : D5Y3V1_MYCTX        0.32  0.57  209  405   28  214  197    3   10  216  D5Y3V1     Glutamate N-acetyltransferase (Fragment) OS=Mycobacterium tuberculosis T85 GN=TBEG_02962 PE=3 SV=1
 4279 : D9QA51_CORP2        0.32  0.55  193  405  181  384  215    5   13  386  D9QA51     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium pseudotuberculosis (strain C231) GN=argJ PE=3 SV=1
 4280 : E0MXL7_9CORY        0.32  0.54  193  405  185  388  220    9   23  390  E0MXL7     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium accolens ATCC 49726 GN=argJ PE=3 SV=1
 4281 : E3S1W6_PYRTT        0.32  0.49  193  405  239  460  239    9   43  462  E3S1W6     Putative uncharacterized protein OS=Pyrenophora teres f. teres (strain 0-1) GN=PTT_16255 PE=3 SV=1
 4282 : E7LYD3_YEASV        0.32  0.51  193  405  215  439  240    4   42  441  E7LYD3     Ecm40p OS=Saccharomyces cerevisiae (strain VIN 13) GN=VIN13_3643 PE=3 SV=1
 4283 : E7N6U8_9ACTO        0.32  0.52  193  405  191  396  227    7   35  398  E7N6U8     Arginine biosynthesis bifunctional protein ArgJ OS=Actinomyces sp. oral taxon 171 str. F0337 GN=argJ PE=3 SV=1
 4284 : F2PRQ0_TRIEC        0.32  0.52  193  405  124  354  242    6   40  356  F2PRQ0     Arginine biosynthesis ArgJ OS=Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97) GN=TEQG_03439 PE=3 SV=1
 4285 : F2RKK0_STRVP        0.32  0.57  193  405  179  381  224    7   32  383  F2RKK0     Arginine biosynthesis bifunctional protein ArgJ OS=Streptomyces venezuelae (strain ATCC 10712 / CBS 650.69 / DSM 40230 / JCM 4526 / NBRC 13096 / PD 04745) GN=argJ PE=3 SV=1
 4286 : F2UUB6_ACTVI        0.32  0.53  193  405  191  396  222    8   25  398  F2UUB6     Arginine biosynthesis bifunctional protein ArgJ OS=Actinomyces viscosus C505 GN=argJ PE=3 SV=1
 4287 : F9PH24_9ACTO        0.32  0.53  193  405  191  396  222    8   25  398  F9PH24     Arginine biosynthesis bifunctional protein ArgJ OS=Actinomyces sp. oral taxon 175 str. F0384 GN=argJ PE=3 SV=1
 4288 : G4CYL0_9ACTO        0.32  0.55  193  405  181  386  219    8   19  388  G4CYL0     Arginine biosynthesis bifunctional protein ArgJ OS=Propionibacterium avidum ATCC 25577 GN=argJ PE=3 SV=1
 4289 : G4SYF9_META2        0.32  0.50    4  191    2  188  199    7   23  404  G4SYF9     Arginine biosynthesis bifunctional protein ArgJ OS=Methylomicrobium alcaliphilum (strain DSM 19304 / NCIMB 14124 / VKM B-2133 / 20Z) GN=argJ PE=3 SV=1
 4290 : G7E1Q5_MIXOS        0.32  0.48   18  191   41  233  205   10   43  460  G7E1Q5     Uncharacterized protein OS=Mixia osmundae (strain CBS 9802 / IAM 14324 / JCM 22182 / KY 12970) GN=Mo03436 PE=3 SV=1
 4291 : G8B933_CANPC        0.32  0.45   16  191   25  209  206   11   51  437  G8B933     Putative uncharacterized protein OS=Candida parapsilosis (strain CDC 317 / ATCC MYA-4646) GN=CPAR2_301210 PE=3 SV=1
 4292 : G8C065_TETPH        0.32  0.53  193  405  215  439  241    7   44  441  G8C065     Uncharacterized protein OS=Tetrapisispora phaffii (strain ATCC 24235 / CBS 4417 / NBRC 1672 / NRRL Y-8282 / UCD 70-5) GN=TPHA0L01900 PE=3 SV=1
 4293 : G9MZJ2_HYPVG        0.32  0.54  193  405  216  445  235    6   27  447  G9MZJ2     Uncharacterized protein OS=Hypocrea virens (strain Gv29-8 / FGSC 10586) GN=TRIVIDRAFT_77249 PE=3 SV=1
 4294 : H0GKY5_9SACH        0.32  0.51  193  405  215  439  240    4   42  441  H0GKY5     Ecm40p OS=Saccharomyces cerevisiae x Saccharomyces kudriavzevii VIN7 GN=VIN7_3712 PE=3 SV=1
 4295 : H6M2V1_CORPS        0.32  0.55  193  405  181  384  215    5   13  386  H6M2V1     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium pseudotuberculosis 316 GN=argJ PE=3 SV=1
 4296 : H8JEA7_MYCIT        0.32  0.57  193  405  199  401  222    9   28  403  H8JEA7     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium intracellulare MOTT-64 GN=argJ PE=3 SV=1
 4297 : H8LSM6_CORPS        0.32  0.55  193  405  181  384  215    5   13  386  H8LSM6     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium pseudotuberculosis P54B96 GN=argJ PE=3 SV=1
 4298 : H8XAZ1_CANO9        0.32  0.53  193  405  212  437  237    7   35  439  H8XAZ1     Ecm42 ornithine acetyltransferase OS=Candida orthopsilosis (strain 90-125) GN=CORT_0H01230 PE=3 SV=1
 4299 : I0PJL5_MYCAB        0.32  0.55  193  405  200  402  224    7   32  404  I0PJL5     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus M94 GN=argJ PE=3 SV=1
 4300 : I3QX90_CORPS        0.32  0.55  193  405  181  384  215    5   13  386  I3QX90     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium pseudotuberculosis 258 GN=argJ PE=3 SV=1
 4301 : I4ATL3_CORPS        0.32  0.55  193  405  181  384  215    5   13  386  I4ATL3     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium pseudotuberculosis Cp162 GN=argJ PE=3 SV=1
 4302 : I4EZ15_MODMB        0.32  0.53  193  405  179  381  224    7   32  383  I4EZ15     Arginine biosynthesis bifunctional protein ArgJ OS=Modestobacter marinus (strain BC501) GN=argJ PE=3 SV=1
 4303 : I8JJH4_MYCAB        0.32  0.55  193  405  200  402  224    7   32  404  I8JJH4     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus 4S-0206 GN=argJ PE=3 SV=1
 4304 : J3NN06_GAGT3        0.32  0.46  193  405  243  478  256    6   63  480  J3NN06     Uncharacterized protein OS=Gaeumannomyces graminis var. tritici (strain R3-111a-1) GN=GGTG_02664 PE=3 SV=1
 4305 : J3NN06_GAGT3        0.32  0.49    7  191   49  242  210   11   41  480  J3NN06     Uncharacterized protein OS=Gaeumannomyces graminis var. tritici (strain R3-111a-1) GN=GGTG_02664 PE=3 SV=1
 4306 : M3JWP3_CANMX        0.32  0.49   16  191   27  211  203    7   45  439  M3JWP3     Uncharacterized protein OS=Candida maltosa (strain Xu316) GN=G210_2323 PE=3 SV=1
 4307 : M5GBQ1_DACSP        0.32  0.50   19  191   40  237  204   11   37  475  M5GBQ1     Arginine biosynthesis protein ArgJ OS=Dacryopinax sp. (strain DJM 731) GN=DACRYDRAFT_49608 PE=3 SV=1
 4308 : Q16D40_ROSDO        0.32  0.53    5  191    1  198  203    7   21  408  Q16D40     Arginine biosynthesis bifunctional protein ArgJ OS=Roseobacter denitrificans (strain ATCC 33942 / OCh 114) GN=argJ PE=3 SV=1
 4309 : S4XDP0_9CORY        0.32  0.54  193  405  189  390  225    9   35  392  S4XDP0     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium terpenotabidum Y-11 GN=argJ PE=3 SV=1
 4310 : T0Z5S0_9BACT        0.32  0.53   12  191    2  183  186    6   10  259  T0Z5S0     Uncharacterized protein (Fragment) OS=Leptospirillum sp. Group IV 'UBA BS' GN=D084_Lepto4C00462G0002 PE=3 SV=1
 4311 : U5W513_9ACTO        0.32  0.55   12  191    2  185  199   10   34  390  U5W513     Arginine biosynthesis bifunctional protein ArgJ OS=Actinoplanes friuliensis DSM 7358 GN=argJ PE=3 SV=1
 4312 : V5EKR7_PSEBG        0.32  0.52  193  405  244  466  238    7   40  468  V5EKR7     Amino-acid acetyltransferase OS=Pseudozyma brasiliensis (strain GHG001) GN=PSEUBRA_SCAF5g02378 PE=3 SV=1
 4313 : V7NDU2_MYCAV        0.32  0.58  203  405    1  193  203    3   10  195  V7NDU2     N-acetylglutamate synthase (Fragment) OS=Mycobacterium avium 11-0986 GN=O974_14595 PE=3 SV=1
 4314 : V9DA17_9EURO        0.32  0.53  193  405  238  474  244    8   38  476  V9DA17     Glutamate N-acetyltransferase/amino-acid acetyltransferase OS=Cladophialophora carrionii CBS 160.54 GN=G647_05488 PE=3 SV=1
 4315 : W0Z9G9_9MICO        0.32  0.56  193  405  181  383  221    7   26  385  W0Z9G9     Arginine biosynthesis bifunctional protein ArgJ OS=Microbacterium sp. C448 GN=argJ PE=3 SV=1
 4316 : W6XR82_COCCA        0.32  0.49   16  191   48  240  203   10   37  464  W6XR82     Uncharacterized protein OS=Bipolaris zeicola 26-R-13 GN=COCCADRAFT_105114 PE=4 SV=1
 4317 : W7EBV6_COCVI        0.32  0.49   16  191   48  240  203   10   37  464  W7EBV6     Uncharacterized protein OS=Bipolaris victoriae FI3 GN=COCVIDRAFT_40898 PE=4 SV=1
 4318 : W7PEM4_YEASX        0.32  0.51  193  405  215  439  240    4   42  441  W7PEM4     Ecm40p OS=Saccharomyces cerevisiae R008 GN=Ecm40 PE=4 SV=1
 4319 : W7Q4I5_9GAMM        0.32  0.54   13  161   11  166  156    4    7  169  W7Q4I5     Uncharacterized protein OS=Halomonas sp. BC04 GN=Q427_26680 PE=4 SV=1
 4320 : W7RFZ2_YEASX        0.32  0.51  193  405  215  439  240    4   42  441  W7RFZ2     Ecm40p OS=Saccharomyces cerevisiae P283 GN=Ecm40 PE=4 SV=1
 4321 : ARGJ_CANGA          0.31  0.51  193  405  215  439  241    7   44  441  Q6FU44     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Candida glabrata (strain ATCC 2001 / CBS 138 / JCM 3761 / NBRC 0622 / NRRL Y-65) GN=CAGL0F06501g PE=3 SV=1
 4322 : ARGJ_TALSN          0.31  0.49  193  405  239  468  246    6   49  470  B8M9V7     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006) GN=TSTA_118750 PE=3 SV=1
 4323 : ARGJ_THAPS          0.31  0.53  193  405  261  486  236   12   33  488  B8BVB6     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Thalassiosira pseudonana GN=THAPSDRAFT_2779 PE=3 SV=1
 4324 : ARGJ_UNCRE          0.31  0.49   16  191   35  226  206   10   44  459  C4JMY4     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Uncinocarpus reesii (strain UAMH 1704) GN=UREG_04192 PE=3 SV=1
 4325 : B7RL16_9RHOB        0.31  0.49   16  191   12  198  200   10   37  408  B7RL16     Arginine biosynthesis bifunctional protein ArgJ OS=Roseobacter sp. GAI101 GN=argJ PE=3 SV=1
 4326 : D2S8Q6_GEOOG        0.31  0.54  193  405  179  381  219    7   22  383  D2S8Q6     Arginine biosynthesis bifunctional protein ArgJ OS=Geodermatophilus obscurus (strain ATCC 25078 / DSM 43160 / JCM 3152 / G-20) GN=argJ PE=3 SV=1
 4327 : D3F0H1_CONWI        0.31  0.50    2  191   11  201  206    7   31  413  D3F0H1     Arginine biosynthesis bifunctional protein ArgJ OS=Conexibacter woesei (strain DSM 14684 / JCM 11494 / NBRC 100937 / ID131577) GN=argJ PE=3 SV=1
 4328 : D3SL33_THEAH        0.31  0.51  193  405  173  376  224    8   31  378  D3SL33     Arginine biosynthesis bifunctional protein ArgJ OS=Thermocrinis albus (strain DSM 14484 / JCM 11386 / HI 11/12) GN=argJ PE=3 SV=1
 4329 : E5XMF4_9ACTO        0.31  0.55  193  405  199  401  224    8   32  403  E5XMF4     Arginine biosynthesis bifunctional protein ArgJ OS=Segniliparus rugosus ATCC BAA-974 GN=argJ PE=3 SV=1
 4330 : F4RMS1_MELLP        0.31  0.50  193  399  231  454  234    9   37  456  F4RMS1     Putative uncharacterized protein OS=Melampsora larici-populina (strain 98AG31 / pathotype 3-4-7) GN=MELLADRAFT_63474 PE=3 SV=1
 4331 : G0CQZ3_CORUL        0.31  0.52  193  405  181  384  227    9   37  386  G0CQZ3     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium ulcerans 809 GN=argJ PE=3 SV=1
 4332 : G0CTB6_CORUB        0.31  0.52  193  405  181  384  227    9   37  386  G0CTB6     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium ulcerans (strain BR-AD22) GN=argJ PE=3 SV=1
 4333 : G3BB70_CANTC        0.31  0.48  193  405  209  434  240    8   41  436  G3BB70     Arginine biosynthesis protein ArgJ OS=Candida tenuis (strain ATCC 10573 / BCRC 21748 / CBS 615 / JCM 9827 / NBRC 10315 / NRRL Y-1498 / VKM Y-70) GN=CANTEDRAFT_108799 PE=3 SV=1
 4334 : G3Y7B9_ASPNA        0.31  0.48  193  405  224  454  245    5   46  456  G3Y7B9     Uncharacterized protein OS=Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7) GN=ASPNIDRAFT_50689 PE=3 SV=1
 4335 : G4F8U2_9GAMM        0.31  0.54   27  191   25  196  173    6    9  226  G4F8U2     Bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein (Fragment) OS=Halomonas sp. HAL1 GN=HAL1_14081 PE=3 SV=1
 4336 : G6X2T9_MYCAB        0.31  0.54  193  405  202  404  227    8   38  406  G6X2T9     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus 47J26 GN=argJ PE=3 SV=1
 4337 : H0IPE5_MYCAB        0.31  0.55  193  405  190  392  227    8   38  394  H0IPE5     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus subsp. bolletii BD GN=argJ PE=3 SV=1
 4338 : I0ASD4_CORPS        0.31  0.53  193  405  181  384  215    5   13  386  I0ASD4     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium pseudotuberculosis 267 GN=argJ PE=3 SV=1
 4339 : I2H0J2_TETBL        0.31  0.50    2  191   14  218  213    9   31  447  I2H0J2     Uncharacterized protein OS=Tetrapisispora blattae (strain ATCC 34711 / CBS 6284 / DSM 70876 / NBRC 10599 / NRRL Y-10934 / UCD 77-7) GN=TBLA0C00780 PE=3 SV=1
 4340 : I6ZAA6_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I6ZAA6     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus subsp. bolletii str. GO 06 GN=argJ PE=3 SV=1
 4341 : I7H2Z8_CORUL        0.31  0.52  193  405  181  384  227    9   37  386  I7H2Z8     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium ulcerans 0102 GN=argJ PE=3 SV=1
 4342 : I8CPX5_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I8CPX5     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus 5S-0304 GN=argJ PE=3 SV=1
 4343 : I8HNE7_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I8HNE7     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus subsp. bolletii 2B-0626 GN=argJ PE=3 SV=1
 4344 : I8LNB0_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I8LNB0     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus 5S-0422 GN=argJ PE=3 SV=1
 4345 : I8MUA6_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I8MUA6     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus 5S-1212 GN=argJ PE=3 SV=1
 4346 : I8XVE8_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I8XVE8     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus 5S-0817 GN=argJ PE=3 SV=1
 4347 : I8ZBD3_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I8ZBD3     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus subsp. bolletii 2B-0107 GN=argJ PE=3 SV=1
 4348 : I8ZDI3_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I8ZDI3     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus 5S-1215 GN=argJ PE=3 SV=1
 4349 : I9C5P5_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I9C5P5     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus subsp. bolletii 1S-154-0310 GN=argJ PE=3 SV=1
 4350 : I9DAI5_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I9DAI5     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus 5S-0921 GN=argJ PE=3 SV=1
 4351 : I9EQZ8_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I9EQZ8     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus subsp. bolletii 2B-0912-R GN=argJ PE=3 SV=1
 4352 : I9JP65_MYCAB        0.31  0.54  193  405  195  397  227    8   38  399  I9JP65     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus subsp. bolletii 2B-1231 GN=argJ PE=3 SV=1
 4353 : M2TE83_COCSN        0.31  0.48   16  191   48  240  203   10   37  464  M2TE83     Uncharacterized protein OS=Cochliobolus sativus (strain ND90Pr / ATCC 201652) GN=COCSADRAFT_197324 PE=3 SV=1
 4354 : Q0A6W0_ALKEH        0.31  0.51   13  191    1  184  200   12   37  398  Q0A6W0     Arginine biosynthesis bifunctional protein ArgJ OS=Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1) GN=argJ PE=3 SV=1
 4355 : R6ZBY2_9ACTN        0.31  0.51    5  191   10  205  206    7   29  421  R6ZBY2     Arginine biosynthesis bifunctional protein ArgJ OS=Collinsella sp. CAG:398 GN=argJ PE=3 SV=1
 4356 : R7YXH4_CONA1        0.31  0.45   16  191   45  237  208    9   47  461  R7YXH4     Arginine biosynthesis ArgJ 1, mitochondrial OS=Coniosporium apollinis (strain CBS 100218) GN=W97_05861 PE=3 SV=1
 4357 : S7P360_MYCAB        0.31  0.54  193  405  202  404  227    8   38  406  S7P360     Arginine biosynthesis bifunctional protein ArgJ OS=Mycobacterium abscessus subsp. bolletii CRM-0020 GN=argJ PE=3 SV=1
 4358 : U2I0Q6_9CORY        0.31  0.53  193  405  186  389  226    9   35  391  U2I0Q6     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium pseudodiphtheriticum 090104 GN=argJ PE=3 SV=1
 4359 : W2RX78_9EURO        0.31  0.52  193  405  231  461  246    7   48  463  W2RX78     Glutamate N-acetyltransferase/amino-acid acetyltransferase OS=Cyphellophora europaea CBS 101466 GN=HMPREF1541_04585 PE=3 SV=1
 4360 : W3X1A0_9PEZI        0.31  0.48    7  191   30  223  209   11   39  455  W3X1A0     Arginine biosynthesis bifunctional protein ArgJ OS=Pestalotiopsis fici W106-1 GN=PFICI_09632 PE=3 SV=1
 4361 : W4HJ14_9RHOB        0.31  0.52    5  191    1  199  203    5   20  410  W4HJ14     Arginine biosynthesis bifunctional protein ArgJ OS=Roseivivax sp. 22II-s10s GN=argJ PE=3 SV=1
 4362 : W6ZGA6_COCMI        0.31  0.49   16  191   48  240  203   10   37  464  W6ZGA6     Uncharacterized protein OS=Bipolaris oryzae ATCC 44560 GN=COCMIDRAFT_2123 PE=4 SV=1
 4363 : A3KAU3_9RHOB        0.30  0.48   16  191    9  195  200   10   37  405  A3KAU3     Arginine biosynthesis bifunctional protein ArgJ OS=Sagittula stellata E-37 GN=argJ PE=3 SV=1
 4364 : A3S9T3_9RHOB        0.30  0.49    5  191    1  198  212    8   39  408  A3S9T3     Arginine biosynthesis bifunctional protein ArgJ OS=Sulfitobacter sp. EE-36 GN=argJ PE=3 SV=1
 4365 : ARGJ_PENCW          0.30  0.49  193  398  225  442  235   10   46  485  B6HQD4     Arginine biosynthesis bifunctional protein ArgJ, mitochondrial OS=Penicillium chrysogenum (strain ATCC 28089 / DSM 1075 / Wisconsin 54-1255) GN=Pc22g15960 PE=3 SV=1
 4366 : B9NU07_9RHOB        0.30  0.49    5  191    1  198  206    6   27  408  B9NU07     Arginine biosynthesis bifunctional protein ArgJ OS=Rhodobacteraceae bacterium KLH11 GN=argJ PE=3 SV=1
 4367 : C6SHD1_NEIME        0.30  0.60  226  405    1  182  183    4    4  184  C6SHD1     Arginine biosynthesis bifunctional protein ArgJ OS=Neisseria meningitidis alpha275 GN=argJ PE=3 SV=1
 4368 : E0XVC1_9ACTN        0.30  0.48  193  402  182  383  227    6   42  387  E0XVC1     Arginine biosynthesis bifunctional protein ArgJ OS=uncultured actinobacterium HF4000_04C13 GN=argJ PE=3 SV=1
 4369 : E9ELP1_METAR        0.30  0.47    7  191   18  211  207    9   35  443  E9ELP1     Putative glutamate N-acetyltransferase OS=Metarhizium anisopliae (strain ARSEF 23 / ATCC MYA-3075) GN=MAA_01549 PE=3 SV=1
 4370 : H0E7M3_9ACTN        0.30  0.49  193  405  214  436  232   10   28  438  H0E7M3     Arginine biosynthesis bifunctional protein ArgJ OS=Patulibacter medicamentivorans GN=argJ PE=3 SV=1
 4371 : H2G333_CORD3        0.30  0.55  193  405  181  384  226    8   35  386  H2G333     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium diphtheriae (strain 31A) GN=argJ PE=3 SV=1
 4372 : H2GGT3_CORDN        0.30  0.55  193  405  181  384  226    8   35  386  H2GGT3     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium diphtheriae (strain INCA 402) GN=argJ PE=3 SV=1
 4373 : H2GR30_CORDB        0.30  0.55  193  405  181  384  226    8   35  386  H2GR30     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium diphtheriae (strain BH8) GN=argJ PE=3 SV=1
 4374 : I4JVZ3_CORDP        0.30  0.55  193  405  181  384  226    8   35  386  I4JVZ3     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium diphtheriae bv. intermedius str. NCTC 5011 GN=argJ PE=3 SV=1
 4375 : L2F644_9GAMM        0.30  0.45   11  191    4  193  209   10   47  400  L2F644     Arginine biosynthesis bifunctional protein ArgJ OS=Moraxella macacae 0408225 GN=argJ PE=3 SV=1
 4376 : M1NVK5_BARVW        0.30  0.48    1  191    4  194  204    7   26  410  M1NVK5     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella vinsonii subsp. berkhoffii (strain Winnie) GN=argJ PE=3 SV=1
 4377 : M2UFX8_COCH5        0.30  0.48   16  191   48  240  208    9   47  464  M2UFX8     Uncharacterized protein OS=Cochliobolus heterostrophus (strain C5 / ATCC 48332 / race O) GN=COCHEDRAFT_1135419 PE=3 SV=1
 4378 : N4XT30_COCH4        0.30  0.48   16  191   48  240  208    9   47  464  N4XT30     Uncharacterized protein OS=Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T) GN=COCC4DRAFT_79407 PE=3 SV=1
 4379 : N6VMY9_BARVB        0.30  0.48    1  191    4  194  204    7   26  410  N6VMY9     Arginine biosynthesis bifunctional protein ArgJ OS=Bartonella vinsonii subsp. berkhoffii str. Tweed GN=argJ PE=3 SV=1
 4380 : R8Z1D7_ACIPI        0.30  0.49    4  191   39  231  205   10   29  448  R8Z1D7     Arginine biosynthesis bifunctional protein ArgJ OS=Acinetobacter pittii ANC 4052 GN=argJ PE=3 SV=1
 4381 : S9Q222_SCHOY        0.30  0.51    2  191   21  224  210    8   26  444  S9Q222     Glutamate N-acetyltransferase OS=Schizosaccharomyces octosporus (strain yFS286) GN=SOCG_04588 PE=3 SV=1
 4382 : T9WYT2_CORDP        0.30  0.55  193  405  181  384  226    8   35  386  T9WYT2     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium diphtheriae str. Aberdeen GN=argJ PE=3 SV=1
 4383 : T9Y2W6_CORDP        0.30  0.55  193  405  181  384  226    8   35  386  T9Y2W6     Arginine biosynthesis bifunctional protein ArgJ OS=Corynebacterium diphtheriae DSM 43988 GN=argJ PE=3 SV=1
## ALIGNMENTS    1 -   70
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1    6 A E              0   0  185  269   47  E                      N  K     KN                                 QK 
     2    7 A T        +     0   0   77  323   57  T                      A  E     EAT                                TV 
     3    8 A A  S    S-     0   0   31  329   73  A                      P  V     VPT                                AA 
     4    9 A N        -     0   0  108  343   71  N                      A  H     HVP                                QS 
     5   10 A V        -     0   0   30  395   54  V                      I  I     IIV                                VI 
     6   11 A L  E     -A  166   0A  98  402   65  L                      E  S     STV                                TT 
     7   12 A K  E     -A  165   0A  71 1080   60  K                      K  K     KEE                                AK 
     8   13 A L    >   -     0   0   50 1295   43  L                      I  I     ILV                                LV 
     9   14 A E  T 3  S+     0   0  146 1310   73  E                      E  D     DEE                                AE 
    10   15 A T  T 3  S+     0   0  126 1623   74  T                      N  E     ENQ                                GD 
    11   16 A G    <   +     0   0    5 1724   15  G                      G  G     GGG                                GG 
    12   17 A S    >   -     0   0    0 1771   60  S                      S  G     GSS                                TS 
    13   18 A V  G >  S+     0   0    1 1816   22  V                      I  I     III                                VI 
    14   19 A T  G 3  S+     0   0   18 1819   70  T                      V  T     TVV                                VV 
    15   20 A S  G <  S+     0   0   47 1827   71  S                      T  T     TTT                                TT 
    16   21 A A  S X  S-     0   0    2 1861   32  A                      P  P     PPP                                PP 
    17   22 A K  T 3  S+     0   0  118 1867   72  K                      K  K     KKK                                KK 
    18   23 A G  T 3  S+     0   0   11 1876    1  G                      G  G     GGG                                GG 
    19   24 A F  E <   +B   40   0A   3 1879    2  F                      F  F     FFF                                FF 
    20   25 A S  E     -B   39   0A  27 1879   93  S                      Q  S     SSA                                QS 
    21   26 A A  E     +BC  38 140A   0 1879   15  A                      A  A     AAA                                AA 
    22   27 A V  E     -B   37   0A  14 1879   71  V                      T  V     VII                                AI 
    23   28 A G  E     -B   36   0A   5 1880   10  G                      G  G     GGG                                GG 
    24   29 A I  E     -B   35   0A  42 1881   62  I                      L  V     VLI                                VT 
    25   30 A H        +     0   0   90 1881   50  H                      Y  H     HHH                                HA 
    26   31 A T        -     0   0   32 1881   71  T                      S  T     TTT                                AI 
    27   32 A G  S    S+     0   0   47 1883    6  G                      G  G     GGG                                GG 
    28   33 A V  S    S+     0   0   44 1883   24  V                      V  V     VVL                                LL 
    29   34 A K  S    S-     0   0   29 1883   26  K                      K  K     KKK                                HK 
    30   35 A R  S    S-     0   0  100 1883   79  R                      R  R     RRR                                HK 
    31   36 A K  S    S+     0   0  111 1865   68  K                      K  K     KKK                                SG 
    32   37 A R  S    S-     0   0   83 1846   32  R                      R  R     RRR                                KK 
    33   38 A K        +     0   0   69 1851   64  K                      L  N     NLF                                KK 
    34   39 A D        +     0   0    1 1866    0  D                      D  D     DDD                                DD 
    35   40 A L  E     +BD  24  79A   0 1883   24  L                      L  L     LLI                                IL 
    36   41 A G  E     -BD  23  78A   0 1883   31  G                      G  G     GGG                                GG 
    37   42 A A  E     -BD  22  77A   0 1862   72  A                      A  A     AAA                                VA 
    38   43 A I  E     -BD  21  76A   2 1877   15  I                      I  I     III                                II 
    39   44 A V  E     -BD  20  75A  22 1877   61  V                      Y  F     FYV                                VV 
    40   45 A C  E     -B   19   0A   5 1878   27  C                      C  S     SCC                                CC 
    41   46 A E  E    S+     0   0A 145 1878   53  E                      E  D     DDS                                DD 
    42   47 A V  E    S-     0   0A  44 1882   71  V                      V  V     VVV                                VV 
    43   48 A P  E     -     0   0A  54 1883   66  P                      P  P     PPL                                PP 
    44   49 A A  E     - D   0  73A   0 1883   43  A                      A  C     CAA                                AA 
    45   50 A S  E     -ED 240  72A   8 1883   69  S                      S  S     SSS                                SS 
    46   51 A S  E     +E  239   0A   2 1884   62  S                      V  A     AAS                                AC 
    47   52 A A  E     -E  238   0A   0 1881    2  A                      A  A     AAA                                AA 
    48   53 A A  E     -E  237   0A   5 1882   26  A                      A  A     AAA                                AA 
    49   54 A V  E     -E  236   0A   1 1884   15  V                      V  V     VVV                                VV 
    50   55 A Y  E     -E  235   0A  25 1884   26  Y                      Y  Y     YYY                                YY 
    51   56 A T  B     -K  190   0B   2 1884    0  T                      T  T     TTT                                TT 
    52   57 A L        +     0   0   97 1884   80  L                      L  L     LCT                                QT 
    53   58 A N        -     0   0   51 1884    8  N                      N  N     NNN                                SN 
    54   59 A K  S    S+     0   0  207 1884   65  K                      R  K     KRR                                HQ 
    55   60 A V  S    S+     0   0   76 1884   48  V                      I  M     MII                                FI 
    56   61 A Q        -     0   0   72 1884   65  Q                      Q  Q     QQQ                                QQ 
    57   62 A A    >>  -     0   0    1 1884   16  A                      A  A     AAA                                AA 
    58   63 A A  H >> S+     0   0   17 1883   22  A                      A  A     AAA                                AA 
    59   64 A P  H 3> S+     0   0    1 1884    3  P                      P  P     PPP                                PP 
    60   65 A L  H <> S+     0   0    0 1884   31  L                      I  L     LLL                                LL 
    61   66 A K  H X S+     0   0    0 1884   84  S                      S  S     SSS                                SS 
    67   72 A I  H 3X S+     0   0   19 1884   32  I                      I  I     IIL                                LI 
    68   73 A A  H 3< S+     0   0   84 1884   72  A                      A  Q     QAA                                AT 
    69   74 A V  H << S-     0   0   89 1884   71  V                      E  K     KQK                                VT 
    70   75 A E  H  < S-     0   0   85 1882   64  E                      A  E     DEE                                EE 
    71   76 A G  S  < S+     0   0    3 1263   50  G                      G  G     GGG                                QG 
    72   77 A K  E     -D   45   0A  59 1702   41  K                      K  K     KKK                                KK 
    73   78 A L  E     -D   44   0A   0 1748   52  L                      I  I     IIL                                LL 
    74   79 A Q  E    S+     0   0A  29 1850   30  Q                      Q  Q     QQQ                                RQ 
    75   80 A A  E     -Df  39 113A   0 1880   17  A                      A  A     AAA                                AA 
    76   81 A X  E     -Df  38 114A   2 1883   28  M                      I  L     LLI                                VI 
    77   82 A I  E     -Df  37 115A   0 1884   17  I                      V  V     VVV                                II 
    78   83 A V  E     -Df  36 116A   0 1884   21  V                      V  V     VVV                                VV 
    79   84 A N  E     -Df  35 117A   1 1884    0  N                      N  N     NNN                                NN 
    80   85 A S  E     + f   0 118A   0 1884    6  S                      S  S     SSS                                SS 
    81   86 A G  E    S+ f   0 119A  21 1884   29  G                      G  G     GGG                                SG 
    82   87 A I  E     -Gf 118 120A   3 1884   63  I                      N  N     NNN                                CN 
    83   88 A A        -     0   0    0 1884    0  A                      A  A     AAA                                AA 
    84   89 A N        +     0   0    0 1884    0  N                      N  N     NNN                                NN 
    85   90 A A        +     0   0    0 1884   50  A                      A  A     AAA                                AA 
    86   91 A C  S    S+     0   0   78 1884   38  C                      C  C     CCC                                CC 
    87   92 A T     >  -     0   0    9 1884   26  T                      T  T     TTT                                TT 
    88   93 A G  H  >  -     0   0   56 1883    4  G                      G  G     GGG                                GG 
    89   94 A K  H  > S+     0   0  100 1884   77  K                      K  Q     QEE                                EM 
    90   95 A R  H  > S+     0   0  137 1884   52  R                      K  K     KKR                                QK 
    91   96 A G  H  X S+     0   0    0 1884    5  G                      G  G     GGG                                GG 
    92   97 A L  H  X S+     0   0   26 1883   55  L                      L  L     LLL                                LL 
    93   98 A D  H  X S+     0   0   83 1884   76  D                      E  E     EEA                                RQ 
    94   99 A D  H  X S+     0   0   18 1884   41  D                      D  D     DDD                                DD 
    95  100 A A  H  X S+     0   0    0 1884   21  A                      A  A     AAA                                AA 
    96  101 A Y  H  X S+     0   0   64 1884   90  Y                      Y  Y     YYY                                YY 
    97  102 A T  H  X S+     0   0   59 1884   74  T                      E  K     KKA                                EE 
    98  103 A X  H  X S+     0   0    1 1883   59  M                      M  M     MMM                                MM 
    99  104 A R  H  X S+     0   0   32 1884   72  R                      R  R     RRR                                RR 
   100  105 A A  H  X S+     0   0   21 1714   75  A                      K  Q     HNK                                DA 
   101  106 A V  H  X S+     0   0    9 1759   75  V                      Q  L     LEQ                                LL 
   102  107 A G  H  X S+     0   0    0 1762   69  G                      S  S     SSG                                CG 
   103  108 A A  H  X>S+     0   0    7 1763   27  A                      A  A     AAA                                AA 
   104  109 A E  H  <5S+     0   0  111 1864   59  E                      Q  V     VEN                                KE 
   105  110 A T  H  <5S+     0   0   39 1871   76  T                      H  H     HHH                                QH 
   106  111 A F  H  <5S-     0   0   41 1882   16  F                      F  F     FFF                                FF 
   107  112 A H  T  <5 +     0   0  175 1884   67  H                      Q  G     GTN                                GG 
   108  113 A I  S      -     0   0   58 1863   72  P                      P  E     EPA                                AK 
   110  115 A E  G >  S+     0   0   94 1870   74  E                      E  D     DPE                                PE 
   111  116 A H  G 3  S+     0   0   45 1878   61  H                      H  H     HHH                                HK 
   112  117 A Y  G <  S+     0   0   25 1878   90  Y                      Y  L     LYH                                YY 
   113  118 A V  E <   -f   75   0A   0 1884   12  V                      V  V     VVV                                VV 
   114  119 A A  E     -f   76   0A   0 1884   66  A                      A  A     AAA                                AA 
   115  120 A V  E     +f   77   0A   0 1884    7  V                      V  V     VVV                                VV 
   116  121 A T  E     -f   78   0A   0 1884   34  T                      T  T     TTT                                AA 
   117  122 A S  E     -f   79   0A   0 1884    0  S                      S  S     SSS                                SS 
   118  123 A T  E     +fG  80  82A   1 1884    0  T                      T  T     TTT                                TT 
   119  124 A G  E    S+f   81   0A  23 1884    0  G                      G  G     GGG                                GG 
   120  125 A V  E     -f   82   0A  80 1884   10  V                      V  V     VVV                                VV 
   121  126 A I  S    S+     0   0   69 1884    0  I                      I  I     III                                II 
   122  127 A G  S    S+     0   0   35 1884    0  G                      G  G     GGG                                GG 
   123  128 A E        -     0   0   93 1884   72  E                      E  E     EEE                                EV 
   124  129 A F        -     0   0   83 1884   98  F                      F  F     FYF                                HP 
   125  130 A L        -     0   0    5 1884    3  L                      L  L     LLL                                LL 
   126  131 A P     >  -     0   0   50 1884   38  P                      A  Q     QPD                                PP 
   127  132 A X  H  > S+     0   0   32 1883   28  M                      M  M     MMM                                MM 
   128  133 A D  H  > S+     0   0  130 1884   28  D                      D  D     DDD                                ED 
   129  134 A V  H  > S+     0   0   59 1884   74  V                      K  K     KKK                                KI 
   130  135 A I  H  X S+     0   0    1 1884   20  I                      I  I     IIL                                II 
   131  136 A T  H  X S+     0   0   19 1884   80  T                      V  E     ELL                                RR 
   132  137 A N  H  X S+     0   0   96 1884   74  N                      P  K     KPT                                AK 
   133  138 A G  H >X S+     0   0    6 1884   27  G                      G  G     GGG                                GG 
   134  139 A I  H >< S+     0   0    0 1881   58  I                      I  I     III                                II 
   135  140 A R  H 3< S+     0   0  110 1884   72  R                      K  T     TKE                                EV 
   136  141 A Q  H << S+     0   0  115 1884   83  Q                      Q  Q     QEQ                                KT 
   137  142 A L    <<  -     0   0    4 1884   30  L                      L  L     LLL                                LL 
   138  143 A K        -     0   0  131 1883   86  K                      S  V     VKQ                                AI 
   139  144 A P        -     0   0   33 1884   80  P                      P  P     PPP                                PP 
   140  145 A E  B     -C   21   0A 111 1884   74  E                      N  S     SQV                                GA 
   141  146 A A  S    S+     0   0   71 1884   85  A                      S  S     SSQ                                AK 
   142  147 A T  S  > S-     0   0   44 1884   95  T                      T  T     TTS                                TE 
   143  148 A I  H  > S+     0   0   61 1883   79  I                      L  K     KLN                                IE 
   144  149 A E  H  > S+     0   0  136  606   66  E                      E  E     EDD                                AN 
   145  150 A G  H  > S+     0   0    5 1067   73  G                      D  A     AAG                                DG 
   146  151 A A  H  X S+     0   0    0 1305   72  A                      A  A     AAA                                AA 
   147  152 A H  H  X S+     0   0   73 1573   83  H                      E  Y     YEE                                EH 
   148  153 A A  H  X S+     0   0   18 1878   68  A                      A  A     ASA                                AS 
   149  154 A F  H  X S+     0   0    0 1883   72  F                      F  F     FFF                                FF 
   150  155 A N  H >X S+     0   0    0 1883   75  N                      N  N     NNN                                QS 
   151  156 A E  H >< S+     0   0   49 1884   54  E                      Q  Q     QQQ                                TE 
   152  157 A A  H 3< S+     0   0    0 1884    2  A                      A  A     AAA                                AA 
   153  158 A I  H << S+     0   0    0 1884    1  I                      I  I     III                                II 
   154  159 A L    <<  +     0   0    3 1884   20  L                      L  L     LLL                                LL 
   155  160 A T  S    S-     0   0   39 1884    0  T                      T  T     TTT                                TT 
   156  161 A T  S    S+     0   0   67 1884    0  T                      T  T     TTT                                TT 
   157  162 A D        -     0   0    2 1884    0  D                      D  D     DDD                                DD 
   158  163 A T  S    S+     0   0   94 1884   47  T                      T  T     TTT                                TL 
   159  164 A V  S    S-     0   0   80 1883   83  V                      T  I     III                                VI 
   160  165 A E        -     0   0   46 1883   74  E                      N  Q     QNN                                MT 
   161  166 A K        +     0   0    0 1883    0  K                      K  K     KKK                                KK 
   162  167 A H  E     + H   0 179A  28 1778   69  H                      K  H     HKK                                HE 
   163  168 A T  E     + H   0 178A   2 1781   59  T                      V  T     TVA                                AT 
   164  169 A C  E     + H   0 177A   0 1797   54  C                      C  C     CCC                                CC 
   165  170 A Y  E     -AH   7 176A  26 1810   53  Y                      F  Y     YYF                                YY 
   166  171 A Q  E     +AH   6 175A  61 1819   75  Q                      Q  Q     QQK                                EE 
   167  172 A T  E     - H   0 174A   5 1821   74  T                      T  T     TTT                                TM 
   168  173 A I  E     + H   0 173A  62 1828   84  I                      V  S     SVV                                KI 
   169  174 A V  E >  S- H   0 172A   0 1798   44  V                      V  I     IIV                                VI 
   170  175 A N  T 3  S-     0   0   64 1810   43  N                      N  D     DDN                                DD 
   171  176 A G  T 3  S+     0   0   66 1833   39  G                      G  G     GGG                                GG 
   172  177 A K  E <  S-H  169   0A 100 1857   49  K                      K  E     EKE                                KK 
   173  178 A T  E     -H  168   0A  62 1870   69  T                      T  C     CTT                                TK 
   174  179 A V  E     -H  167   0A   0 1855   31  V                      V  I     III                                VV 
   175  180 A T  E     -H  166   0A   4 1868   38  T                      S  S     SST                                IM 
   176  181 A V  E     +HI 165 200A   0 1880   28  V                      I  I     IIV                                VI 
   177  182 A G  E     +HI 164 199A   0 1880   37  G                      G  G     GGG                                GA 
   178  183 A G  E     -HI 163 198A   0 1880    3  G                      G  G     GGG                                GG 
   179  184 A V  E     +HI 162 197A   0 1880   73  V                      V  V     VVV                                AV 
   180  185 A A  E     - I   0 196A   0 1880   23  A                      A  A     AAA                                AA 
   181  186 A K  E     + I   0 195A   0 1880    0  K                      K  K     KKK                                KK 
   182  187 A G        +     0   0    0 1880    0  G                      G  G     GGG                                GG 
   183  188 A S  S    S+     0   0    2 1880   15  S                      S  S     SSS                                SS 
   184  189 A G  S    S+     0   0    8 1880    0  G                      G  G     GGG                                GG 
   185  190 A X  S    S+     0   0   73 1878    0  M                      M  M     MMM                                MM 
   186  191 A I        +     0   0    0 1879    4  I                      I  I     III                                II 
   187  192 A H        -     0   0   47 1879   23  H                      N  H     HNN                                HH 
   188  193 A P        +     0   0    0 1879    0  P                      P  P     PPP                                PP 
   189  194 A N        +     0   0   80 1878   12  N                      N  N     NNQ                                NN 
   190  195 A X  B      K   51   0B   2 1877    2  M                      M  M     MMM                                MM 
   191  196 A A              0   0   68 1794    3  A                      A  A     AAA                                AA 
   192      ! !              0   0    0   0     0  
   193  197 B T              0   0   13 2458    0   TTTTTTTTTTTTTTTTTTTTTT TT TTTTT   TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  T
   194  198 B X        -     0   0    0 2459   13   MMMMMMMMMMMMMMMMMMMMMM MM MMMMM   MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM  M
   195  199 B L  E     -Ij 181 235A   0 2460    1   LLLLLLLLLLLLLLLLLLLLLL LL LLLLL   LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  L
   196  200 B S  E     -Ij 180 236A   0 2460   54   SSSAAAAAAAAAAAAAAAGAGG AS SSSAS   SSSSSASSSSSSSSSSSSSSSSSSSSGSGGSG  S
   197  201 B F  E     -Ij 179 237A   4 2460   22   FFFFFFFFFFFFFFFFFFFFFF FF FFFFF   FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  F
   198  202 B V  E     -Ij 178 238A   2 2460   22   VIVIIIIVIIIIIIIIIIIIVV II IIIII   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIVII  I
   199  203 B T  E     +Ij 177 239A   1 2460   61   TTTTTTTTTTTTTTTTTTTTTT TT TTTTT   TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  T
   200  204 B T  E     -Ij 176 240A   0 2460   23   TTTTTTTTTTTTTTTTTTTTTT TT TTTTT   TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  T
   201  205 B D        +     0   0    1 2460    0   DDDDDDDDDDDDDDDDDDDDDD DD DDDDD   DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  D
   202  206 B A        -     0   0    0 2460   23   AAAAAAAAAAAAAAAAAAAAAA AA AAAAA   AAAAAAAAAAVAAAAAAAAIIAAAIVAIVAAA  A
   203  207 B N        +     0   0   56 2461   79   NNVNNNNNNNNNNNNNNNANCC NN KNNNN   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNQ  R
   204  208 B I        -     0   0    1 2461   20   IIIIIIIIIIIIIIIIVVIIII II VIIII   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII  I
   205  209 B D     >  -     0   0   69 2461   67   EEESSSSSSSSSSSSSPPEPSS PE EEEPE   EEEEEDEEEEEEEEEEEEEEEEEEEEEESGEE  E
   206  210 B H  H  > S+     0   0   90 2461   75   SPSSSSSSSSSSSSSSSSSSQQ SH AHHSH   HHHHHCHHHHHHHHHHHHHHHHHHHHSHSSHS  H
   207  211 B G  H  > S+     0   0   44 2461   69   DDKATPPPAAPAAAPPDDSDSS DE SEEDE   EEEEEGEEEEEEEEEEEEEEEEEEEEEEEEED  D
   208  212 B H  H  > S+     0   0   63 2452   75   VIVVVVVVVVVVVVLLVVAVVV VV VVVVV   VVVVVDVVVVVVVIVVVVVVIVEEVVVVIAVV  V
   209  213 B L  H  X S+     0   0    0 2459   19   LVLLLLLLLLLLLLLLLLLLLL LL LLLLL   LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  L
   210  214 B Q  H  X S+     0   0   55 2461   45   QQQHHQQQHHQHHHQQQQQQQQ QQ QQQQQ   QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ  Q
   211  215 B G  H  X S+     0   0   45 2461   78   LSQDAAAEDDEDDDEEHDQDKK DT DTTDT   TTTTTFTTTTTTTTTTTTTTTTTTTTATDSTS  T
   212  216 B A  H  X S+     0   0    3 2461   61   AAAAAAAAAAAAAATTAAIAAA AA AAAAA   AAAAAAAAAAAAAAAAAAAAAVAAAAAASLAA  A
   213  217 B L  H  X S+     0   0    0 2461   19   LLLLLLLLLLLLLLLLLLLLLL LL LLLLL   LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  L
   214  218 B S  H  X S+     0   0   44 2461   66   SSARRRRRRRRRRRRRRRARKK RS GSSRS   SSSSSKSSSSSSSSSSSSSSSSSSSSSSSSSS  S
   215  219 B A  H  X S+     0   0   43 2461   81   SSMSASSSSSSSSSSSSSKSEE SQ SQQSQ   QQQQQQQQQQQQQKQQQQQQQQQQQQTQKSQD  Q
   216  220 B I  H >X S+     0   0    0 2462   71   IIIIAIIIIIIIIIIIIIAIVV II IIIII   IIIIIVIIIIIIIIIIIIIIIIIIIIIIVAII  I
   217  221 B T  H ><>S+     0   0    1 2464   57   TTTTTTTTTTTTTTTTTTTTTT TT TTTTT   TTTTTTTTTTTTTTTTTTTTTTTTTTTTITTT  T
   218  222 B N  H 3<5S+     0   0   93 2464   50   NNNDDDDDDDDDDDDDNNDNNN NN NNNNN   NNNNNDNNNNNNNNNNNNNNNNNNNNNNPDNN  N
   219  223 B E  H <<5S+     0   0   67 2464   80   QKEVVVVVVVVVVVVVVVEVSS VH KHHVH   HHHHHRHHHHHHHHHHHHHHHHRRHHLHTRHL  H
   220  224 B T  T X<5S+     0   0    1 2464   41   TTTSSSSSSSSSSSSSSSTSTT ST STTST   TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  T
   221  225 B F  G > 5S+     0   0    0 2498    1   FFFFFFFFFFFFFFFFFFFFFF FF FFFFF   FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  F
   222  226 B N  G 3    +     0   0    9 2501   19   GGGGGGGGGGGGGGGGGGGGGG GG GGGGG   GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  G
   243  247 B L  T 3   +     0   0   43 2466   86   LLLLLLLLLLLLLLLLLLLLLL LL NLLLL   LLLLLTLLLLLLLLLLLLLLLLLLLLLLMLLF  L
   244  248 B A  T 3  S-     0   0    7 2499   54   AAAAAAAAAAAAAAAAAAAAAA AS ASSAS   SSSSSSSSSSSSSSSSSSSSSSSSSSASAASA  S
   245  249 B E    <   +     0   0  122 2500   62   TNEGGGGGGGGGGGGGGGDGGG GE DEEGE   EEEEEGEEEEEEEEEEEEEEEEEEEEGEKGEG  E
   246  250 B N        -     0   0    3 2500   80   HNHNNNNNNNNNNNHHNNNNNN NT HTTNT   TTTTTITTTTTTTTTTTTTTTTTTTTNTNGTN  T
   247  251 B E  S    S-     0   0   78 1841   73   DQEDDDDKDDGDDDKKEEEEQQ EK QKKEK   KKKKKNKKKKKKKKKKKKKKKKRKKKHKEEKK  K
   248  252 B T        -     0   0   66 1873   86   SPPEEEEEEEEEEEEEPPKTPP PT STTPT   TTPPTKPPPPTTPTPPPTPPTTPPPTSPAETT  P
   249  253 B L        +     0   0    0 2304   26   LLLLLLLLLLLLLLLLLLLLLL LM LMMLM   MMIIMLIIIIMMIMIIIMIIMMIIIMLILLML  I
   250  254 B T    >   -     0   0   30 2310   71   TTTTTTTTTTTTTTTTSSTSSS SN TNNSN   NNNNNSNNNNSNNDNNNNNTDNNNTSTTTTNT  D
   251  255 B P  T 3  S+     0   0   66 2323   74   PPPPPPPPPPPPPPPPPPDPPP PM PMMPM   MMMMMPMMMMMMMMMMMMMMMMMMMMPMEPMP  M
   252  256 B E  T 3  S+     0   0  153 2007   67   ASANNDDDNNDNNNDDQQAQEE QE DEEQE   EEEEENEEEEEEEEEEEEEEEEEEEEEEELED  E
   253  257 B H  S X  S-     0   0   20 2163   66   HHHHHHHHHHHHHHHHHHHHHH HH HHHHH   HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  H
   254  258 B P  T 3  S+     0   0   96 2215   68   PPPPPPPPPPPPPPPPPPPPPP PE PEEPE   EETTEPTTTTKETKTTTETKKKAAKKPKPPEP  A
   255  259 B D  T >> S+     0   0   24 2226   74   DDDDDDDDDDDDDDDDDDDDEE DD EDDDD   DDDDDDDDDDEDDDDDDDDDDDDDDEDDDDGD  D
   256  260 B W  H <> S+     0   0   37 2250   59   WWWWWWWWWWWWWWWWWWWWWW WW WWWWW   WWWWWWWWWWWWWWWWWWWWWWWWWWWWYWWW  W
   257  261 B A  H 3> S+     0   0   30 2350   67   EDEEGEEEEEEEEEEEAAQEDD EE NEEEE   EEEEEDEEEEEEEEEEEEEEEEEEEEQEPNEL  E
   258  262 B N  H <> S+     0   0    0 2364   79   NAGHNNNNHHCHHHNNNNINVV NT STTNT   TTTTTVTTTTTTTTTTTTTTTTTTTTNTISTN  T
   259  263 B F  H  X S+     0   0    0 2473   18   FFFFFFFFFFFFFFFFFFFFFF FF FFFFF   FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  F
   260  264 B Y  H  X S+     0   0   49 2473   88   YYYYYYYYYYYYYYYYYYYYLL YV YVVYV   VVVVVIVVVVVVVVVVVLVVVVVVVAFVLSVY  V
   261  265 B K  H  X S+     0   0   51 2476   72   QQQEEEEEEEEEEEEEEEEEGG EV EVVEV   VVFFVQFFFFFVFFFFFVFFFFFFFFYFEDVY  F
   262  266 B A  H  X S+     0   0    0 2493   51   AAAAAAAAAAAAAAAAAAGALL AA AAAAA   AATTAMTTTTAATATTTATTASAATATTLAAT  A
   263  267 B L  H  X S+     0   0    0 2499   19   LLLLLLLLLLLLLLLLLLFLLL LL LLLLL   LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  L
   264  268 B Q  H  X S+     0   0   43 2499   87   KEKRRRRKRRRRRRKKRRKRGG RQ RQQRQ   QQQQQSQQQQQQQQQQQQQQQQQQQQQQSRQK  Q
   265  269 B L  H  X S+     0   0   44 2499   93   LALKKKKKKKKKKKKKKQHQSS QK LKKQK   KKKKKQKKKKKKKKKKKKKKKKKKKKTKAYKT  K
   266  270 B A  H  X S+     0   0    0 2499   31   TATTTTTTTTTTTTTTTTCTCC TV TVVTV   VVVVVTVVVVVVVVVVVVVVVVVVVVVVTVVV  V
   267  271 B C  H  X S+     0   0    0 2499   81   CCCCCCCCCCCCCCCCCCACCC CC CCCCC   CCCCCSCCCCCCCCCCCCCCCCCCCCACCCCA  C
   268  272 B E  H  X S+     0   0   38 2499   85   EEQEEEEEEEEEEEEEEEVEEE EE EEEEE   EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE  E
   269  273 B D  H  X S+     0   0   25 2499   79   SDSDDDDDDDDDDDDDHHAHNN HD DDDHD   DDDDDSDDDDDDDDDDDDDDDDDDDDDDSVDD  D
   270  274 B L  H  X S+     0   0    0 2499    5   LLLLLLLLLLLLLLLLLLLLLL LL LLLLL   LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  L
   271  275 B A  H  X S+     0   0    0 2499   16   SSAAAAAAAAAAAAAAAAAAAA AA AAAAA   AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  A
   272  276 B K  H  X S+     0   0   61 2500   62   KKKKKKKKKKKKKKKKKKKKKK KK KKKKK   KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  K
   273  277 B Q  H  X S+     0   0   51 2500   79   QLQQQQQQQQQQQQQQQQMQQQ QK QKKQK   KKKKKQKKKKKKKKKKKKKKKKKKKKMKQAKM  K
   274  278 B I  H  < S+     0   0    0 2501   20   IIIIIIIIIIIIIIIIIIIIII II IIIII   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII  I
   275  279 B A  H >< S+     0   0    0 2501   51   AAAAAAAAAAAAAAAAAAAAAA AA AAAAA   AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  A
   276  280 B R  H 3< S+     0   0   92 2501   58   RRRRRKKKRRKRRRKKRRRRKK RQ RQQRQ   QQQQQKQQQQQQQQQQQQQQQQQQQQKQKRQK  Q
   277  281 B D  T 3< S+     0   0   13 2501    0   DDDDDDDDDDDDDDDDDDDDDD DD DDDDD   DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  D
   278  282 B G  S X  S-     0   0    2 2501    8   GGGGGGGGGGGGGGGGGGGGGG GG GGGGG   GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  G
   279  283 B E  T 3  S-     0   0    9 2501    0   EEEEEEEEEEEEEEEEEEEEEE EE EEEEE   EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE  E
   280  284 B G  T 3  S+     0   0   17 2501    0   GGGGGGGGGGGGGGGGGGGGGG GG GGGGG   GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  G
   281  285 B A    <   +     0   0   17 2501   19   AAAAAAAAAAAAAAAAAAAAAA AA AAAAA   AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  A
   282  286 B T  S    S+     0   0   65 2500   38   TSTTTTTATTTTTTTTTTTTTT TT TTTTT   TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  T
   283  287 B K        -     0   0   26 2500   28   KKKKKKKKKKKKKKKKKKKKKK KK KKKKK   KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  K
   284  288 B L  E     -M  392   0C  13 2500   40   LLLLLLLLLLLLLLLLLLLLLL LL LLLLL   LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  L
   285  289 B I  E     -Mn 391 374C   0 2501   23   IIIIIIIIIIIIIIIIIIIIII II IIIII   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIVII  I
   286  290 B E  E     -Mn 390 375C  15 2501   61   EEEEEEEEEEEEEEEEEEEEEE EE EEEEE   EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE  E
   287  291 B V  E     -Mn 389 376C   0 2501   30   VVVVVVVVVVVVVVVVAAVAAA AV VVVAV   VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  V
   288  292 B E  E     -Mn 388 377C  71 2500   80   QQHRRRRRRRRRRRRRRRQREE RN NNNRN   NNNNNENNNNNNNNNNNNNNNNNNNNENKRNE  N
   289  293 B V  E     +Mn 387 378C   0 2500    8   VVVVVVVVVVVVVVVVVVVVVV VV VVVVV   VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  V
   290  294 B T  E     + n   0 379C  43 2500   81   SNDRRHHNRRRRRRNNKKDKAA KL SLLKL   LLLLLSLLLLLLLLLLLLLLLQLLLLVLSSLV  L
   291  295 B G  E    S+     0   0C   9 2500   27   GGGGGGGGGGGGGGGGGGGGGG GG GGGGG   GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  G
   292  296 B A  E     -M  385   0C   0 2500   22   AAAAAAAAAAAAAAAAAAAAAA AA AAAAA   AAAAATAAAAAAAAAAAAAAATAAAAAASAAA  V
   293  297 B A  S    S-     0   0   35 2499   79   LKLKKKKKKKKKKKKKRRVRVV KR HRRKR   RRKKRKKKKKRRKRKKKRKLLKRRLRILKQRV  Q
   294  298 B N  S  > S-     0   0   67 2499   59   NNTTTTTTTTTTTTTTTTNTSS TT TTTTT   TTAATSAVAATTATAAATATTTTTTTSTDSTA  T
   295  299 B D  H  > S+     0   0   90 2500   82   DDDDDDDDDDDDDDDDDDDDDD DN NNNDN   NNSSNDSSSSNNSNSSSNSNNNNNNNDNDDND  N
   296  300 B Q  H  > S+     0   0  138 2501   71   HEEEDDDEDDDDDDDDEETEQQ EE EEEEE   EEEEEDEEEEEEEEEEEEEEEEEEEEEEEREE  E
   297  301 B E  H  > S+     0   0   42 2501   56   EEDEEEEDEEEEEEDDEEEEEE EE EEEEE   EEEEEDEEEEEEEEEEEEEEEEEEEEEEESEE  E
   298  302 B A  H  X S+     0   0    0 2501   24   AAAAAAAAAAAAAAAAAAAAGG AA AAAAA   AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  A
   299  303 B G  H  X S+     0   0    1 2501   78   GGSKKKKKKKKKKKKKKKGKAA KK NKKKK   KKKKKRKKKKKKKKKKKKKKKKKKKKRKRAKR  K
   300  304 B X  H  X S+     0   0   87 2501   77   MKKKKKKKKKKKKKKKWWKWAA WK VKKWK   KKKKKMKKKKRKKKKKKQKKKKKKKRKKAAKK  K
   301  305 B V  H  X S+     0   0    0 2501   41   IIVIVIIIVVVVVVIIVAIAAA AI IIIAI   IIIIIIIIIIVIIIIIIIIIIIIIIVIIIIII  I
   302  306 B A  H  X S+     0   0    0 2501   24   AAAAAAAAAAAAAAAAAAAAAA AA AAAAA   AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  A
   303  307 B K  H  X S+     0   0   43 2501   80   KKKKKKKKKKKKKKKKKKKKKK KK KKKKK   KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  K
   304  308 B Q  H  < S+     0   0   68 2501   62   QQKQQQQQQQQQQQQQHHTHQQ HQ QQQHQ   QQQQQQQQQQQQQQQQQQQQQQKKQQTQQTQS  Q
   305  309 B I  H >< S+     0   0    0 2501   16   IIIIIIIIIIIIIIIIIIVIII II IIIII   IIIIIIIIIIIIIIIIIIIIIIIIIIVIIIIV  I
   306  310 B V  H 3< S+     0   0    0 2501   58   VVVVVVVVVVVVVVVVVVVVVV VV VVVVV   VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  V
   307  311 B G  T 3< S+     0   0   30 2501   76   GGGGGGGGGGGGGGGGGGGGGG GG GGGGG   GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  G
   308  312 B S    <>  -     0   0    7 2501    6   SSSSSSSSSSSSSSSSSSSSSS SS SSSSS   SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  S
   309  313 B D  H  > S+     0   0   97 2501   61   DDDNNNNNNNNNNNNNNNDNNN NS NSSNS   SSSSSNSSSSSSSSSSSSSSSSSSSSPSNSSP  S
   310  314 B L  H  > S+     0   0   98 2501    0   LLLLLLLLLLLLLLLLLLLLLL LL LLLLL   LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  L
   311  315 B V  H  > S+     0   0    3 2501   20   VVVVVVVVVVVVVVVVVVVVVV VV VVVVV   VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  V
   312  316 B K  H  X S+     0   0    5 2501    0   KKKKKKKKKKKKKKKKKKKKKK KK KKKKK   KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  K
   313  317 B T  H  X S+     0   0   50 2501   33   TSSTTTTTTTTTTTTTTTTTTT TT TTTTT   TTTTTTTTTTTTTTTTTTTTTTTTTTTTTSTT  T
   314  318 B A  H  <>S+     0   0    4 2501    1   AAAAAAAAAAAAAAAAAAAAAA AA AAAAA   AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  A
   315  319 B I  H ><5S+     0   0    8 2501   37   IVIVVVVVVVVVVVVVVVIVVV VI MIIVI   IIIIIIIIIIIIIIIIIIIIIIIIIIVIIVIV  I
   316  320 B Y  H 3<5S+     0   0   94 2501   52   YYYYYYYYYYYYYYYYYYYYYY YY YYYYY   YYHHYYHHHHYYHYHHHYHYYYHHYYFYYFYF  H
   317  321 B G  T 3<5S-     0   0   56 2501   19   GGGGGGGGGGGGGGGGGGGGGG GG GGGGG   GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  G
   318  322 B A  T < 5 +     0   0    8 2501   67   TTTAAAAAAAAAAAAAAAKAAA AE AEEAE   EEEEEAEEEEEEEEEEEEEEEEEEEECESAEC  E
   319  323 B D      < -     0   0   59 2501    0   DDDDDDDDDDDDDDDDDDDDDD DD DDDDD   DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  D
   320  324 B A        +     0   0    4 2501   36   AAAAAAAAAAAAAAAAAAAAAA AP APPAP   PPPPPAPPPPPPPPPPPPPPPPPPPPAPAAPA  P
   321  325 B N    >>  +     0   0   43 2501    0   NNNNNNNNNNNNNNNNNNNNNN NN NNNNN   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  N
   322  326 B W  H 3> S+     0   0   68 2501   12   WWWWWWWWWWWWWWWWWWWWWW WW WWWWW   WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW  W
   323  327 B G  H 3> S+     0   0   30 2501    0   GGGGGGGGGGGGGGGGGGGGGG GG GGGGG   GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  G
   324  328 B R  H <> S+     0   0   74 2501    0   RRRRRRRRRRRRRRRRRRRRRR RR RRRRR   RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  R
   325  329 B I  H  X S+     0   0    3 2501   15   IIIIIIIIIIIIIIIIIIIIII II IIIII   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII  I
   326  330 B I  H  X S+     0   0   41 2501   36   IIIIIIIIIIIIIIIIIIIIII II IIIII   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII  I
   327  331 B C  H  X S+     0   0   73 2501   70   CCCGGGGCGGGGGGCCGGCGGG GS CSSGS   SSSSSGSSSSSSSSSSSSSSSSSSSSASTASA  S
   328  332 B A  H  X S+     0   0    0 2501   14   AAAAAAAAAAAAAAAAAAAAAA AS SSSAS   SSSSSASSSSSSSSSSSSSSSSSSSSASAASA  S
   329  333 B I  H >< S+     0   0    0 2501   36   IIIIIIIIIIIIIIIIIIIILL II VIIII   ITIITIIIIIITIIIIIIIIIIIIIIVIIATV  I
   330  334 B G  H 3< S+     0   0   56 2501    0   GGGGGGGGGGGGGGGGGGGGGG GG GGGGG   GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  G
   331  335 B Y  H 3< S+     0   0  121 2501   84   YYYYYYYYYYYYYYYYHHYHQQ HQ YQQHQ   QQQQQQQQQQQQQQQQQQQQQQQQQQYQQRQY  Q
   332  336 B S  S << S-     0   0    8 2501   51   SSSSAAAAAAAAAAAASSSSSS SS SSSSS   SSSSSSSSSSSSSSSSSSSSSSSSSSSSTASS  S
   333  337 B G  S    S+     0   0   71 2501   46   GEGDDDDDDDDDDDGGGGEGNN GE GEEGE   EEEEEQEEEEEEEEEEEKEEEEEEEEGENGEG  E
   334  338 B C  S    S-     0   0   17 2074   74   CCCAAAAAAAAAAAAAAACAII AV VVVAV   VVVVVPVVVVVVVVVVVVVVVVVVVVAVTEVA  V
   335  339 B E        +     0   0  112 2101   68   EDEEDDDMDDDDDDMMFFSYSS YI AIIYI   IITTIATTTTAITTTTTTTEATTTEDTEAPIT  A
   336  340 B V        -     0   0   47 2136   41   VIIVVVVVVVVVVVVVVIIILL II LIIII   IIIIIIIIIIIIIIIIIIIIIIIIIIVIVLIV  I
   337  341 B N    >   -     0   0   75 2400   40   NNDNDDDNDDNDDDDDNNNKDD KN NNNKN   NNNNNDNNNNNNNNNNNNNNNNNNNNDNNDND  N
   338  342 B Q  T 3  S+     0   0  139 2402   67   PPPPPPPPPPPPPPPPPPPPPP PP PPPPP   PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  P
   339  343 B E  T 3  S+     0   0  117 2406   66   EDNDDAADDDDDDDDDNNQDEE DN ENNDN   NNNNNSNNNNNNNNNNNNNNNNNNNNDNADND  N
   340  344 B T  S <  S+     0   0   30 2408   80   ETTNNNNNNNNNNNNNDCTCNN CT TTTCT   TTTTTSTTTTTTTTTTTTTTTTTTTTKTSSTK  T
   341  345 B I        -     0   0    2 2413   57   IIIVVVVVVVVVVVVVVVIVVV VI VIIVI   IIIIIVIIIIIIIIIIIIIIIIIIIIIIVVII  I
   342  346 B D  E     -O  379   0C  36 2486   61   DDDDDDDDDDDDDDDDDDDDDD DD NDDDD   DDDDDDDDDDDDDDDDDDDDDDDDDDTDDDDT  D
   343  347 B I  E     -OP 378 351C   1 2256   47   IIIVVVVIVVVVVVIIVVIVII VI VIIVI   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII  I
   344  348 B A  E     -OP 377 349C  15 2256   92   RGAAAAASAAAAAASSWWSWWW WT STTWT   TTTTTATTTTTTTTTTTTTTTTTTTTQTASTQ  T
   345  349 B I  E >  S-OP 376 348C   1 2271   51   LIIIIIIMIIIIIIIIIIIIII IL LLLIL   LLLLLILLLLLLLLLLLLLLLLLLLLILILLI  L
   346  350 B G  T 3  S-     0   0   18 2279   46   GGGGGGGGGGGGGGGGGGGGGG GQ GQQGQ   QQQQQGQQQQQQQQQQQQQQQQQQQQGQGGQG  Q
   347  351 B P  T 3  S+     0   0  112 2284   63   SPPPPPPPPPPPPPPPSSIFPP SS DSSSS   SSSSSPSSSSSSSSSSSSSSSSSSSSGSNPSG  S
   348  352 B I  E <   -P  345   0C  13 2298   37   IIIIIIIIIIIMIIIIVIHIII VI IIIVI   IIIIIIIIIIIIIIIIIIIIIIIIIIAIIIIA  I
   349  353 B V  E     +P  344   0C  70 2306   91   DKQVVVVVVVVVVVSSHQQQCC CA QAACA   AAVVAVVVVVAVVAVVVAVAAATTAATAVLAT  S
   350  354 B T  E     +     0   0C   0 2320   24   TTTMMMMMMMMMMMMMMMTMMM MV MVVMV   VVVVVMVVVVVVVVVVVVVVVVVVVVMVMTVM  V
   351  355 B L  E     -PQ 343 356C   1 2322   77   LLLLLLLLLLLLLLLLLLLLLL LL LLLLL   LLLLLLLLLLLLLLLLLLLLLLLLLLVLLLLV  L
   352  356 B K  E >  S- Q   0 355C  57 2323   76   KEEKKKKKKKKKKKKKKKKKKK KK EKKKK   KKKKKKKKKKKKKKKKKKKKKKKKKKEKKKKE  K
   353  357 B Q  T 3  S-     0   0   80 2333   67   NSKGGGGGGGGGGGRRQQNQNN QN NNNQN   NNNNNNNNNNNNNNNNNNNNNNNNNNNNEENN  N
   354  358 B S  T 3  S+     0   0   23 2333   23   SSSSSSSSSSSSSSSSSSSSSS SS SSSSS   SSSSSSSSSSSSSSSSSSSSSSSSSSGSSSSG  S
   355  359 B E  E <  S-Q  352   0C 139 2407   80   QSQEEEEEEEEEEEEEEQSQEE QE QEEQE   EEEEEVEEEEEEEEEEEEEEEEEEEEEEEREE  E
   356  360 B P  E     -Q  351   0C  86 2408   77   PPPPPPPPPPPPPPPPPPPPPP PP PPPPP   PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  P
   357  361 B T        -     0   0   62 2178   77   VLVQQQQQQQQQQQQQVVVVQQ MQ VQQMQ   QQQQQLQQQQQQQQQQQQQQQQQQQQIQQVQI  Q
   358  362 B G        +     0   0   75 2233   81   HATPPPPPPPPPPPPPPPSPAA PM SMMPM   MMIIMAIIIIMMIMIIIMIMMIMMMMPMSAMP  T
   359  363 B F        -     0   0   34 2259    8   FFFFFFFFFFFFFFFFFFFFFF FF FFFFF   FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  F
   360  364 B S     >  -     0   0   55 2389   69   SSSSSSSSSSSSSSSSCSSSSS SS SSSSS   SSSSSSSSSSSSSSSSSSSSSSSSSPSSSDSS  S
   361  365 B E  H  > S+     0   0  119 2413   38   EEEEEEEEEEEEEEEEEEEEEE EE EEEEE   EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE  E
   362  366 B E  H  > S+     0   0   78 2369   54   EEEEEEEEEEEEEEAAEEEEEE EE EEEQE   EEEEEEEEEEEEEEEEEEEEEEEEEEDEQEED  E
   363  367 B E  H  > S+     0   0  116 2371   73   EEEEEEEEEEEEEEEEEEAEEE EE EEEEE   EEEEEEEEEEEEEEEEEEEEEEEEEEEEVAEE  E
   364  368 B A  H  X S+     0   0    0 2398   72   AAAAAAAAAAAAAAAAAAIAAA AM AMMAM   MMMMMAMMMMMMMMMMMMMMMMMMMMLMAAML  M
   365  369 B T  H  X S+     0   0   43 2457   74   TTKTTVVRTTATTTSSKKTKNN KT KTTKT   TTKKTKKKKKKTKKKKKKKKKTEEKKIKILTI  K
   366  370 B A  H  X S+     0   0   53 2477   75   NAAAAAAAAAAAAAAAAAAAAA AK AKKAK   KKKKKEKKKKKKKKKKKKKKKKMMKKQKNEKQ  E
   367  371 B Y  H  X S+     0   0   49 2483   78   YYYYYYYYYYYYYYYYAAYAYY AK .KKAK   KKKKKYKKKKKKKKKKKKKKKKKKKKIKYYKI  R
   368  372 B L  H  < S+     0   0    1 2488   12   LMMLLLLLLLLLLLLLLLMLLL LL YLLLL   LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  L
   369  373 B K  H  < S+     0   0  123 2501   76   KKEQQQQQQQQQQQQQMMNMQQ MQ LQQMQ   QQKKQSKKKKKQKQKKKQKQKQKKQKKQNKQK  Q
   370  374 B E  H  < S+     0   0  159 1983   71   .EE....N......NN..Q... .E EEE.E   EEEEE.EEEEEEEEEEEEEEEEEEEEME..EM  E
   371  375 B A     <  -     0   0   15 2403   73   NNNQQNNDQQQQQQDDEEEEKK EH NHHEH   HHHHH.HHHHHHHHHHHHHHHHHHHHHHQGHH  D
   372  376 B D  S    S+     0   0   81 2487   20   EDDEEDDEEEEEEEEEDDEDEE DE DEEDE   EEEEEnEEEEEEEEEEEEEEEEEEEEEEDDEE  E
   373  377 B P  S    S-     0   0   36  690   82   VTTTTMM.TTTTTT..VVTVNN V. M..V.   .....a......................FT..  .
   374  378 B V  E     -n  285   0C   0 2498   21   VVIVVIIIVVVVVVIIVVIVII VI VIIVI   IIIIIIIIIIIIIIIIIIIIIIIIIIVIIVIV  I
   375  379 B K  E     -n  286   0C 101 2499   81   QIMVVVVIVVVVVVVVVVVVKK VK EKKVK   KKIIKQIIIIVKIKIIIKIIIKMMIVKIQEKK  V
   376  380 B I  E     -nO 287 345C   1 2500   19   IIIIIIIIIIIIIIIIIIIIII II VIIII   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII  I
   377  381 B S  E     -nO 288 344C  52 2500   85   FSEEEDDEEEEEEEEETTHTSS TD YDDTD   DDDDDTDDDDDDDDDDDDDDDDDDDDYDFIDY  N
   378  382 B V  E     -nO 289 343C   2 2501   25   VVVVVVVVVVVVVVVVVVVVVV VV VVVVV   VVVVVVVVVVVVVAVVVAVVVVVVVVVVVVVV  V
   379  383 B N  E     -nO 290 342C  45 2501   58   DDHDDDDDDDDDDDDDDDQDDD DC DCCDC   CCYYCNYYYYYCYCYYYCYYYCYYYYSYDDCS  Y
   380  384 B L        -     0   0    2 2501   11   LLLLLLLLLLLLLLLLLLLLLL LL LLLLL   LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  L
   381  385 B H        +     0   0   85 2501   63   HHHHHHHHHHHHHHHHHHNHHH HH QHHHH   HHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHG  H
   382  386 B I  S    S-     0   0   50 2495   86   IVVLLLLLLLMLLLLLVVNLNN VL QLLVL   LLVVLQVVVVLLVLVVVLVLLLLLLLVLNILM  L
   383  387 B G  S    S-     0   0   29 2501    2   GGGGGGGGGGGGGGGGGGGGGG GG GGGGG   GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  G
   384  388 B N  S    S+     0   0  156 2493   71   EEEDDDENDDDDDDSSDNHEKK GN NNNEN   NDKKDAKKKKEDKDKKKDKEEDEEEEDEKGDE  K
   385  389 B G  E     + M   0 292C   1 2500   64   GGGGGGGGGGGGGGGGGGGGGG GE GEEGE   EEEEEGEEEEEEEEEEEEEEEEEEEEGEGGEG  E
   386  390 B T  E     +     0   0C  63 2501   77   FFKFFFFTFFVFFFTTEETERR ET ITTET   TTTTTKTTTTKTTTTTTTTNITTTNKKNEATK  T
   387  391 B G  E     - M   0 289C   8 2501   51   GGGGGGGGGGGGGGGGGGGGGG GG GGGGG   GGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGG  G
   388  392 B K  E     - M   0 288C  68 2501   61   KKKVVIIVVVVVVVVVVIKIKK IS KSSIS   SSSSSKSSSSSSSSSSSSSSSSSSSSHSKVSH  S
   389  393 B A  E     - M   0 287C   0 2501   61   AAAAAAAAAAAAAAAAAAAAAA AA AAAAA   AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  A
   390  394 B W  E     +lM 224 286C   4 2501   15   WWWWWWWWWWWWWWWWWWWWWW WW WWWWW   WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW  W
   391  395 B G  E     - M   0 285C   0 2501   43   GGGGGGGGGGGGGGGGGGGGGG GG GGGGG   GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  G
   392  396 B C  E     - M   0 284C   1 2501   32   CCCCCCCCCCCCCCCCCCCCCC CC CCCCC   CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC  C
   393  397 B D        -     0   0    2 2501    0   DDDDDDDDDDDDDDDDDDDDDD DD DDDDD   DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  D
   394  398 B L        +     0   0   32 2501    5   LLLLLLLLLLLLLLLLLLLLLL LL LLLLL   LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  L
   395  399 B T    >>  -     0   0    9 2501   40   TTSTTTTTTTTTTTTTTTTTSS TS TSSTS   SSSSSSSSSSSSSSSSSSSSSSSSSSTSSTST  S
   396  400 B Y  H 3> S+     0   0  182 2501   65   YYYYYYYYYYYYYYYYYYYYYY YY YYYYY   YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY  Y
   397  401 B D  H 3> S+     0   0   75 2501   36   DEDDDDDDDDDDDDDDDDDDDD DE DEEDE   EEDDEDDDDDDEDEDDDEDEEEEEEDDEDDED  E
   398  402 B Y  H <> S+     0   0   46 2501    0   YYYYYYYYYYYYYYYYYYYYYY YY YYYYY   YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY  Y
   399  403 B V  H  X S+     0   0   88 2500    5   VVVVVVVVVVVVVVVVIIVIVV IV VVVIV   VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  V
   400  404 B R  H  <>S+     0   0  120 2499   65   RRRKKKKKKKKKKKKKKKRKKK KK KKKKK   KKKKKKKKKKKKKKKKKKKKKKKKKKQKKRKQ  K
   401  405 B I  H  <5S+     0   0   59 2499   22   IIIIIIIIIIIIIIIIIIIIII II IIIII   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII  I
   402  406 B N  H  <5S+     0   0   83 2499    0   NNNNNNNNNNNNNNNNNNNNNN NN NNNNN   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  N
   403  407 B A  T  <5S-     0   0   55 2494   31   AAAAAAAAAAAAAAAAAAAAAA AA AAAAA   AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  A
   404  408 B G  T   5       0   0   71 2493   69   GGGSSSSSSSSSSSSSSSGSSS SC SCCSC   CCCCCSCCCCCCCCCCCCCCCCCCCCSCSACS  C
   405  409 B Y      <       0   0  219 2487    0   YYYYYYYYYYYYYYYYYYYYYY YY YYYYY   YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY  Y
## ALIGNMENTS   71 -  140
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....8....:....9....:....0....:....1....:....2....:....3....:....4
     1    6 A E              0   0  185  269   47  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
     2    7 A T        +     0   0   77  323   57  V V VVVVV VV     V       VV VVV  V V  V V  VV   V  V   I     V  VV  VV
     3    8 A A  S    S-     0   0   31  329   73  A A AAAAA AA     A       AA AAA  A E  A A  AA   A  A   A     A  AA  AA
     4    9 A N        -     0   0  108  343   71  S S SSSSS SS     S       SS SSS  S S  S S  SS   S  S   S     S  SS  SS
     5   10 A V        -     0   0   30  395   54  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
     6   11 A L  E     -A  166   0A  98  402   65  T T TTTTT TT     T       TT TTT  T T  T T  TT   T  T   T     T  TT  TT
     7   12 A K  E     -A  165   0A  71 1080   60  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
     8   13 A L    >   -     0   0   50 1295   43  L V VVVVV VV     V       VL LLL  L L  L V  LV   V  V   V     V  VV  LL
     9   14 A E  T 3  S+     0   0  146 1310   73  E E EEEEE EE     E       EE EEE  E E  E E  EE   E  E   E     E  EE  EE
    10   15 A T  T 3  S+     0   0  126 1623   74  D D DDDDD DD     D       DS NSS  S H  N D  ND   D  D   N     D  DD  SS
    11   16 A G    <   +     0   0    5 1724   15  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
    12   17 A S    >   -     0   0    0 1771   60  S S SSSSS SS     S       SS SSS  S S  S S  SS   S  S   S     S  SS  SS
    13   18 A V  G >  S+     0   0    1 1816   22  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
    14   19 A T  G 3  S+     0   0   18 1819   70  V V VVVVV VV     V       VV VVV  V V  V V  VV   V  V   V     V  VV  VV
    15   20 A S  G <  S+     0   0   47 1827   71  T T TTTTT TT     T       TT TTT  T A  T T  TT   T  T   T     T  TT  TT
    16   21 A A  S X  S-     0   0    2 1861   32  P P PPPPP PP     P       PP PPP  P P  P P  PP   P  P   P     P  PP  PP
    17   22 A K  T 3  S+     0   0  118 1867   72  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
    18   23 A G  T 3  S+     0   0   11 1876    1  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
    19   24 A F  E <   +B   40   0A   3 1879    2  F F FFFFF FF     F       FF FFF  F F  F F  FF   F  F   F     F  FF  FF
    20   25 A S  E     -B   39   0A  27 1879   93  S S SSSSS SS     S       SS SSS  S S  S S  SS   S  S   S     S  SS  SS
    21   26 A A  E     +BC  38 140A   0 1879   15  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
    22   27 A V  E     -B   37   0A  14 1879   71  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
    23   28 A G  E     -B   36   0A   5 1880   10  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
    24   29 A I  E     -B   35   0A  42 1881   62  T T TTTTT TT     T       TT TTT  T T  T T  TT   T  T   T     T  TT  TT
    25   30 A H        +     0   0   90 1881   50  A A AAAAA AA     A       AS VSS  S A  V A  VA   A  A   T     A  AA  SS
    26   31 A T        -     0   0   32 1881   71  I I IIIII II     I       IN NNN  N N  N I  NI   I  I   I     I  II  NN
    27   32 A G  S    S+     0   0   47 1883    6  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
    28   33 A V  S    S+     0   0   44 1883   24  L L LLLLL LL     L       LL LLL  L L  L L  LL   L  L   L     L  LL  LL
    29   34 A K  S    S-     0   0   29 1883   26  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
    30   35 A R  S    S-     0   0  100 1883   79  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
    31   36 A K  S    S+     0   0  111 1865   68  G G GGGGG GG     G       GE EEE  E E  E G  EG   G  G   E     G  GG  EE
    32   37 A R  S    S-     0   0   83 1846   32  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
    33   38 A K        +     0   0   69 1851   64  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
    34   39 A D        +     0   0    1 1866    0  D D DDDDD DD     D       DD DDD  D D  D D  DD   D  D   D     D  DD  DD
    35   40 A L  E     +BD  24  79A   0 1883   24  L L LLLLL LL     L       LL LLL  L L  L L  LL   L  L   L     L  LL  LL
    36   41 A G  E     -BD  23  78A   0 1883   31  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
    37   42 A A  E     -BD  22  77A   0 1862   72  A A AAAAA AA     A       AA AAA  A V  A A  AA   A  A   A     A  AA  AA
    38   43 A I  E     -BD  21  76A   2 1877   15  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
    39   44 A V  E     -BD  20  75A  22 1877   61  V V VVVVV VV     V       VV VVV  V I  V V  VV   V  V   V     V  VV  VV
    40   45 A C  E     -B   19   0A   5 1878   27  C C CCCCC CC     C       CC CCC  C C  C C  CC   C  C   C     C  CC  CC
    41   46 A E  E    S+     0   0A 145 1878   53  D D DDDDD DD     D       DD DDD  D E  D D  DD   D  D   D     D  DD  DD
    42   47 A V  E    S-     0   0A  44 1882   71  T V VVVVV VV     V       VV VVV  V V  V V  VV   V  V   V     V  VV  VV
    43   48 A P  E     -     0   0A  54 1883   66  P P PPPPP PP     P       PP PPP  P P  P P  PP   P  P   P     P  PP  PP
    44   49 A A  E     - D   0  73A   0 1883   43  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
    45   50 A S  E     -ED 240  72A   8 1883   69  S S SSSSS SS     S       SS SSS  S S  S S  SS   S  S   S     S  SS  SS
    46   51 A S  E     +E  239   0A   2 1884   62  C C CCCCC CC     C       CC CCC  C C  C C  CC   C  C   C     C  CC  CC
    47   52 A A  E     -E  238   0A   0 1881    2  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
    48   53 A A  E     -E  237   0A   5 1882   26  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
    49   54 A V  E     -E  236   0A   1 1884   15  V V VVVVV VV     V       VV VVV  V V  V V  VV   V  V   V     V  VV  VV
    50   55 A Y  E     -E  235   0A  25 1884   26  Y Y YYYYY YY     Y       YY YYY  Y Y  Y Y  YY   Y  Y   Y     Y  YY  YY
    51   56 A T  B     -K  190   0B   2 1884    0  T T TTTTT TT     T       TT TTT  T T  T T  TT   T  T   T     T  TT  TT
    52   57 A L        +     0   0   97 1884   80  T T TTTTT TT     T       TT TTT  T T  T T  TT   T  T   T     T  TT  TT
    53   58 A N        -     0   0   51 1884    8  N N NNNNN NN     N       NN NNN  N N  N N  NN   N  N   N     N  NN  NN
    54   59 A K  S    S+     0   0  207 1884   65  Q Q QQQQQ QQ     Q       QQ QQQ  Q Q  Q Q  QQ   Q  Q   Q     Q  QQ  QQ
    55   60 A V  S    S+     0   0   76 1884   48  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
    56   61 A Q        -     0   0   72 1884   65  Q Q QQQQQ QQ     Q       QQ QQQ  Q Q  Q Q  QQ   Q  Q   Q     Q  QQ  QQ
    57   62 A A    >>  -     0   0    1 1884   16  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
    58   63 A A  H >> S+     0   0   17 1883   22  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
    59   64 A P  H 3> S+     0   0    1 1884    3  P P PPPPP PP     P       PP PPP  P P  P P  PP   P  P   P     P  PP  PP
    60   65 A L  H <> S+     0   0    0 1884   31  L L LLLLL LL     L       LL LLL  L L  L L  LL   L  L   L     L  LL  LL
    61   66 A K  H X S+     0   0    0 1884   84  S S SSSSS SS     S       SS SSS  S S  S S  SS   S  S   S     S  SS  SS
    67   72 A I  H 3X S+     0   0   19 1884   32  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
    68   73 A A  H 3< S+     0   0   84 1884   72  A T TTTTT TT     T       TA TAA  A A  T T  TT   T  T   T     T  TT  AA
    69   74 A V  H << S-     0   0   89 1884   71  T T TTTTT TT     T       TT ATT  T A  A T  AT   T  T   T     T  TT  TT
    70   75 A E  H  < S-     0   0   85 1882   64  E E EEEEE EE     E       EE EEE  E E  E E  EE   E  E   E     E  EE  EE
    71   76 A G  S  < S+     0   0    3 1263   50  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
    72   77 A K  E     -D   45   0A  59 1702   41  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
    73   78 A L  E     -D   44   0A   0 1748   52  L L LLLLL LL     L       LL LLL  L L  L L  LL   L  L   L     L  LL  LL
    74   79 A Q  E    S+     0   0A  29 1850   30  Q Q QQQQQ QQ     Q       QQ QQQ  Q Q  Q Q  QQ   Q  Q   Q     Q  QQ  QQ
    75   80 A A  E     -Df  39 113A   0 1880   17  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
    76   81 A X  E     -Df  38 114A   2 1883   28  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
    77   82 A I  E     -Df  37 115A   0 1884   17  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
    78   83 A V  E     -Df  36 116A   0 1884   21  V V VVVVV VV     V       VV VVV  V V  V V  VV   V  V   V     V  VV  VV
    79   84 A N  E     -Df  35 117A   1 1884    0  N N NNNNN NN     N       NN NNN  N N  N N  NN   N  N   N     N  NN  NN
    80   85 A S  E     + f   0 118A   0 1884    6  S S SSSSS SS     S       SS SSS  S S  S S  SS   S  S   S     S  SS  SS
    81   86 A G  E    S+ f   0 119A  21 1884   29  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
    82   87 A I  E     -Gf 118 120A   3 1884   63  N N NNNNN NN     N       NN NNN  N N  N N  NN   N  N   N     N  NN  NN
    83   88 A A        -     0   0    0 1884    0  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
    84   89 A N        +     0   0    0 1884    0  N N NNNNN NN     N       NN NNN  N N  N N  NN   N  N   N     N  NN  NN
    85   90 A A        +     0   0    0 1884   50  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
    86   91 A C  S    S+     0   0   78 1884   38  C C CCCCC CC     C       CC CCC  C C  C C  CC   C  C   C     C  CC  CC
    87   92 A T     >  -     0   0    9 1884   26  T T TTTTT TT     T       TT TTT  T T  T T  TT   T  T   T     T  TT  TT
    88   93 A G  H  >  -     0   0   56 1883    4  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
    89   94 A K  H  > S+     0   0  100 1884   77  M M MMMMM MM     M       MM MMM  M M  M M  MM   M  M   M     M  MM  MM
    90   95 A R  H  > S+     0   0  137 1884   52  K K KKKKK KK     K       KK QKK  K R  Q K  QK   K  K   K     K  KK  KK
    91   96 A G  H  X S+     0   0    0 1884    5  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
    92   97 A L  H  X S+     0   0   26 1883   55  L L LLLLL LL     L       LL LLL  L L  L L  LL   L  L   L     L  LL  LL
    93   98 A D  H  X S+     0   0   83 1884   76  Q Q QQQQQ QQ     Q       QQ QQQ  Q Q  Q Q  QQ   Q  Q   Q     Q  QQ  QQ
    94   99 A D  H  X S+     0   0   18 1884   41  D D DDDDD DD     D       DD DDD  D D  D D  DD   D  D   D     D  DD  DD
    95  100 A A  H  X S+     0   0    0 1884   21  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
    96  101 A Y  H  X S+     0   0   64 1884   90  Y Y YYYYY YY     Y       YY YYY  Y Y  Y Y  YY   Y  Y   Y     Y  YY  YY
    97  102 A T  H  X S+     0   0   59 1884   74  E E EEEEE EE     E       EE EEE  E E  E E  EE   E  E   E     E  EE  EE
    98  103 A X  H  X S+     0   0    1 1883   59  M M MMMMM MM     M       MI MII  M M  M M  MM   M  M   M     M  MM  II
    99  104 A R  H  X S+     0   0   32 1884   72  R R RRRRR RR     R       RR RRR  R R  R R  RR   R  R   R     R  RR  RR
   100  105 A A  H  X S+     0   0   21 1714   75  A A AAAAA AA     A       AT ATT  A A  A A  AA   A  A   A     A  AA  TT
   101  106 A V  H  X S+     0   0    9 1759   75  L L LLLLL LL     L       LL LLL  L L  L L  LL   L  L   L     L  LL  LL
   102  107 A G  H  X S+     0   0    0 1762   69  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
   103  108 A A  H  X>S+     0   0    7 1763   27  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
   104  109 A E  H  <5S+     0   0  111 1864   59  E E EEEEE EE     E       EE EEE  E E  E E  EE   E  E   E     E  EE  EE
   105  110 A T  H  <5S+     0   0   39 1871   76  H H HHHHH HH     H       HH HHH  H H  H H  HH   H  H   H     H  HH  HH
   106  111 A F  H  <5S-     0   0   41 1882   16  F F FFFFF FF     F       FF FFF  F F  F F  FF   F  F   F     F  FF  FF
   107  112 A H  T  <5 +     0   0  175 1884   67  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
   108  113 A I  S      -     0   0   58 1863   72  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
   110  115 A E  G >  S+     0   0   94 1870   74  E E EEEEE EE     E       EE EEE  E E  E E  EE   E  E   E     E  EE  EE
   111  116 A H  G 3  S+     0   0   45 1878   61  N K KKKKK KK     K       KN NNN  N H  N K  NK   K  K   K     K  KK  NN
   112  117 A Y  G <  S+     0   0   25 1878   90  Y Y YYYYY YY     Y       YY YYY  Y Y  Y Y  YY   Y  Y   Y     Y  YY  YY
   113  118 A V  E <   -f   75   0A   0 1884   12  V V VVVVV VV     V       VV VVV  V V  V V  VV   V  V   V     V  VV  VV
   114  119 A A  E     -f   76   0A   0 1884   66  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
   115  120 A V  E     +f   77   0A   0 1884    7  V V VVVVV VV     V       VV VVV  V V  V V  VV   V  V   V     V  VV  VV
   116  121 A T  E     -f   78   0A   0 1884   34  A A AAAAA AA     A       AG AGG  A A  A A  AA   A  A   A     A  AA  GG
   117  122 A S  E     -f   79   0A   0 1884    0  S S SSSSS SS     S       SS SSS  S S  S S  SS   S  S   S     S  SS  SS
   118  123 A T  E     +fG  80  82A   1 1884    0  T T TTTTT TT     T       TT TTT  T T  T T  TT   T  T   T     T  TT  TT
   119  124 A G  E    S+f   81   0A  23 1884    0  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
   120  125 A V  E     -f   82   0A  80 1884   10  V V VVVVV VV     V       VV VVV  V V  V V  VV   V  V   V     V  VV  VV
   121  126 A I  S    S+     0   0   69 1884    0  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
   122  127 A G  S    S+     0   0   35 1884    0  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
   123  128 A E        -     0   0   93 1884   72  V V VVVVV VV     V       VV VVV  V V  V V  VV   V  V   V     V  VV  VV
   124  129 A F        -     0   0   83 1884   98  P P PPPPP PP     P       PP PPP  L Q  P P  PP   P  P   P     P  PP  PP
   125  130 A L        -     0   0    5 1884    3  L L LLLLL LL     L       LL LLL  L L  L L  LL   L  L   L     L  LL  LL
   126  131 A P     >  -     0   0   50 1884   38  P P PPPPP PP     P       PP PPP  P P  P P  PP   P  P   P     P  PP  PP
   127  132 A X  H  > S+     0   0   32 1883   28  M M MMMMM MM     M       MM MMM  M M  M M  MM   M  M   M     M  MM  MM
   128  133 A D  H  > S+     0   0  130 1884   28  E D DDDDD DD     D       DD DDD  D D  D D  DD   D  D   D     D  DD  DD
   129  134 A V  H  > S+     0   0   59 1884   74  I I IIIII II     I       IS ISS  S I  I I  II   I  I   I     I  II  SS
   130  135 A I  H  X S+     0   0    1 1884   20  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
   131  136 A T  H  X S+     0   0   19 1884   80  R R RRRRR RR     R       RR RRR  R R  R R  RR   R  R   R     R  RR  RR
   132  137 A N  H  X S+     0   0   96 1884   74  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
   133  138 A G  H >X S+     0   0    6 1884   27  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
   134  139 A I  H >< S+     0   0    0 1881   58  I I IIIII II     I       IV IVV  V V  I I  II   I  I   I     I  II  VV
   135  140 A R  H 3< S+     0   0  110 1884   72  V V VVVVV VV     V       VT ATT  T V  A V  VV   V  V   V     V  VV  TT
   136  141 A Q  H << S+     0   0  115 1884   83  T T TTTTT TT     T       TS TSS  S T  T T  TT   T  T   T     T  TT  SS
   137  142 A L    <<  -     0   0    4 1884   30  L L LLLLL LL     L       LL LLL  L L  L L  LL   L  L   L     L  LL  LL
   138  143 A K        -     0   0  131 1883   86  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
   139  144 A P        -     0   0   33 1884   80  P P PPPPP PP     P       PP PPP  P P  P P  PP   P  P   P     P  PP  PP
   140  145 A E  B     -C   21   0A 111 1884   74  A A AAAAA AA     A       AT TTT  T T  T A  AA   A  A   A     A  AA  TT
   141  146 A A  S    S+     0   0   71 1884   85  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
   142  147 A T  S  > S-     0   0   44 1884   95  E E EEEEE EE     E       EE EEE  E E  E E  EE   E  E   E     E  EE  EE
   143  148 A I  H  > S+     0   0   61 1883   79  E E EEEEE EE     E       EV EVV  V V  E E  EE   E  E   E     E  EE  VV
   144  149 A E  H  > S+     0   0  136  606   66  N N NNNNN NN     N       NS SSS  S S  S N  NN   N  N   N     N  NN  SS
   145  150 A G  H  > S+     0   0    5 1067   73  E G GGGGG GG     G       GE GEE  E E  G G  EG   G  G   G     G  GG  EE
   146  151 A A  H  X S+     0   0    0 1305   72  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
   147  152 A H  H  X S+     0   0   73 1573   83  H H HHHHH HH     H       HH YHH  H H  Y H  HH   H  H   H     H  HH  HH
   148  153 A A  H  X S+     0   0   18 1878   68  S S SSSSS SS     S       SS SSS  S S  S S  SS   S  S   S     S  SS  SS
   149  154 A F  H  X S+     0   0    0 1883   72  F F FFFFF FF     F       FF FFF  F F  F F  FF   F  F   F     F  FF  FF
   150  155 A N  H >X S+     0   0    0 1883   75  S S SSSSS SS     S       SC SCC  C A  S S  SS   S  S   S     S  SS  CC
   151  156 A E  H >< S+     0   0   49 1884   54  E E EEEEE EE     E       EE EEE  E E  E E  EE   E  E   E     E  EE  EE
   152  157 A A  H 3< S+     0   0    0 1884    2  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
   153  158 A I  H << S+     0   0    0 1884    1  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
   154  159 A L    <<  +     0   0    3 1884   20  L L LLLLL LL     L       LL LLL  L L  L L  LL   L  L   L     L  LL  LL
   155  160 A T  S    S-     0   0   39 1884    0  T T TTTTT TT     T       TT TTT  T T  T T  TT   T  T   T     T  TT  TT
   156  161 A T  S    S+     0   0   67 1884    0  T T TTTTT TT     T       TT TTT  T T  T T  TT   T  T   T     T  TT  TT
   157  162 A D        -     0   0    2 1884    0  D D DDDDD DD     D       DD DDD  D D  D D  DD   D  D   D     D  DD  DD
   158  163 A T  S    S+     0   0   94 1884   47  L L LLLLL LL     L       LL LLL  L L  L L  LL   L  L   L     L  LL  LL
   159  164 A V  S    S-     0   0   80 1883   83  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
   160  165 A E        -     0   0   46 1883   74  T T TTTTT TT     T       TT TTT  T T  T T  TT   T  T   T     T  TT  TT
   161  166 A K        +     0   0    0 1883    0  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
   162  167 A H  E     + H   0 179A  28 1778   69  E E EEEEE EE     E       EE EEE  E E  E E  EE   E  E   E     E  EE  EE
   163  168 A T  E     + H   0 178A   2 1781   59  T T TTTTT TT     T       TT TTT  T T  T T  TT   T  T   T     T  TT  TT
   164  169 A C  E     + H   0 177A   0 1797   54  C C CCCCC CC     C       CC CCC  C C  C C  CC   C  C   C     C  CC  CC
   165  170 A Y  E     -AH   7 176A  26 1810   53  Y Y YYYYY YY     Y       YY YYY  Y Y  Y Y  YY   Y  Y   Y     Y  YY  YY
   166  171 A Q  E     +AH   6 175A  61 1819   75  E E EEEEE EE     E       EE EEE  E E  E E  EE   E  E   E     E  EE  EE
   167  172 A T  E     - H   0 174A   5 1821   74  M M MMMMM MM     M       MM MMM  M M  M M  MM   M  M   M     M  MM  MM
   168  173 A I  E     + H   0 173A  62 1828   84  I I IIIII II     I       II III  I M  I I  II   I  I   I     I  II  II
   169  174 A V  E >  S- H   0 172A   0 1798   44  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
   170  175 A N  T 3  S-     0   0   64 1810   43  D D DDDDD DD     D       DD DDD  D D  D D  DD   D  D   D     D  DD  DD
   171  176 A G  T 3  S+     0   0   66 1833   39  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
   172  177 A K  E <  S-H  169   0A 100 1857   49  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
   173  178 A T  E     -H  168   0A  62 1870   69  K K KKKKK KK     K       KE KEE  E K  K K  KK   K  K   K     K  KK  EE
   174  179 A V  E     -H  167   0A   0 1855   31  V V VVVVV VV     V       VV VVV  V V  V V  VV   V  V   V     V  VV  VV
   175  180 A T  E     -H  166   0A   4 1868   38  T M MMMMM MM     M       MT ATT  T T  A M  MM   M  M   M     M  MM  TT
   176  181 A V  E     +HI 165 200A   0 1880   28  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
   177  182 A G  E     +HI 164 199A   0 1880   37  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
   178  183 A G  E     -HI 163 198A   0 1880    3  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
   179  184 A V  E     +HI 162 197A   0 1880   73  V V VVVVV VV     V       VV VVV  V V  V V  VV   V  V   V     V  VV  VV
   180  185 A A  E     - I   0 196A   0 1880   23  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
   181  186 A K  E     + I   0 195A   0 1880    0  K K KKKKK KK     K       KK KKK  K K  K K  KK   K  K   K     K  KK  KK
   182  187 A G        +     0   0    0 1880    0  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
   183  188 A S  S    S+     0   0    2 1880   15  S S SSSSS SS     S       SS SSS  S S  S S  SS   S  S   S     S  SS  SS
   184  189 A G  S    S+     0   0    8 1880    0  G G GGGGG GG     G       GG GGG  G G  G G  GG   G  G   G     G  GG  GG
   185  190 A X  S    S+     0   0   73 1878    0  M M MMMMM MM     M       MM MMM  M M  M M  MM   M  M   M     M  MM  MM
   186  191 A I        +     0   0    0 1879    4  I I IIIII II     I       II III  I I  I I  II   I  I   I     I  II  II
   187  192 A H        -     0   0   47 1879   23  H H HHHHH HH     H       HH HHH  H H  H H  HH   H  H   H     H  HH  HH
   188  193 A P        +     0   0    0 1879    0  P P PPPPP PP     P       PP PPP  P P  P P  PP   P  P   P     P  PP  PP
   189  194 A N        +     0   0   80 1878   12  N N NNNNN NN     N       NN NNN  N N  N N  NN   N  N   N     N  NN  NN
   190  195 A X  B      K   51   0B   2 1877    2  M M MMMMM MM     M       MM MMM  M M  M M  MM   M  M   M     M  MM  MM
   191  196 A A              0   0   68 1794    3  A A AAAAA AA     A       AA AAA  A A  A A  AA   A  A   A     A  AA  AA
   192      ! !              0   0    0   0     0  
   193  197 B T              0   0   13 2458    0   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT TTT TTTTT TT  TT  
   194  198 B X        -     0   0    0 2459   13   M M     M  MMMMM MMMMMMM  M   MM M MM M MM  MMM MM MMM MMMMM MM  MM  
   195  199 B L  E     -Ij 181 235A   0 2460    1   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LLL LLLLL LL  LL  
   196  200 B S  E     -Ij 180 236A   0 2460   54   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS GGS GSSSG GS  SS  
   197  201 B F  E     -Ij 179 237A   4 2460   22   F F     F  FFFFF FFFFFFF  F   FF F FF F FF  FFF FF FFF FFFFF FF  FF  
   198  202 B V  E     -Ij 178 238A   2 2460   22   I I     I  IIIII IIIIIII  I   II I II I II  III II VMI IIIIV VI  II  
   199  203 B T  E     +Ij 177 239A   1 2460   61   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT TTT TTTTT TT  TT  
   200  204 B T  E     -Ij 176 240A   0 2460   23   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT TTT TTTTT TT  TT  
   201  205 B D        +     0   0    1 2460    0   D D     D  DDDDD DDDDDDD  D   DD D DD D DD  DDD DD DDD DDDDD DD  DD  
   202  206 B A        -     0   0    0 2460   23   A A     A  AAAAA AAAAAAA  A   AA A AA A AA  AAA AA AAA AAAAA AA  AA  
   203  207 B N        +     0   0   56 2461   79   H R     R  HHHHR HHHHHHH  H   HH H HH H HH  RHH RR AVR NHHHA CH  RH  
   204  208 B I        -     0   0    1 2461   20   I I     I  IIIII IIIIIII  I   II I II I II  III II III IIIII II  II  
   205  209 B D     >  -     0   0   69 2461   67   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE GGE AEEEE EE  EE  
   206  210 B H  H  > S+     0   0   90 2461   75   H H     H  HHHHH HHHHHRH  H   HH H HH H HH  HHH HH SQH SHHHR EH  HH  
   207  211 B G  H  > S+     0   0   44 2461   69   D D     D  DDDDD DDDDDDN  D   DD D DD D DD  DDD DD VED EDDDS SD  DD  
   208  212 B H  H  > S+     0   0   63 2452   75   V V     V  VVVVV VVVVIVV  V   VV V VV V VV  VVV VV AAV EVVVA AV  VV  
   209  213 B L  H  X S+     0   0    0 2459   19   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LLL LLLLL LL  LL  
   210  214 B Q  H  X S+     0   0   55 2461   45   Q Q     Q  QQQQQ QQQQQQQ  Q   QQ Q QQ Q QQ  QQQ QQ QQQ QQQQE QQ  QQ  
   211  215 B G  H  X S+     0   0   45 2461   78   T T     T  TTTTT TTTITTT  T   TT T TT T TT  TTT TT TLT KTTTR RT  TT  
   212  216 B A  H  X S+     0   0    3 2461   61   A A     A  AAAAA AAAAAAA  A   AA V AA A AA  AAA AA LLA AAAAL AA  AA  
   213  217 B L  H  X S+     0   0    0 2461   19   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LLL LLLLL LL  LL  
   214  218 B S  H  X S+     0   0   44 2461   66   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS RRS SSSSR RS  SS  
   215  219 B A  H  X S+     0   0   43 2461   81   Q Q     Q  QQQEQ QQQQQQQ  Q   QQ Q QQ Q QQ  QQE QQ EQQ SQQQQ EE  QQ  
   216  220 B I  H >X S+     0   0    0 2462   71   I I     I  IIIII IIIIIII  I   II I II I II  III II ATI VIIIT II  II  
   217  221 B T  H ><>S+     0   0    1 2464   57   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT TTT TTTTT TT  TT  
   218  222 B N  H 3<5S+     0   0   93 2464   50   N N     N  NNNNN NNNNNNN  N   NN N NN N NN  NNN NN NNN DNNND DN  NN  
   219  223 B E  H <<5S+     0   0   67 2464   80   H H     H  HHHHH HHHHHHH  H   HH H HH H HH  HHH HH YLH CHHHV VH  HH  
   220  224 B T  T X<5S+     0   0    1 2464   41   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT TTT TTTTT ST  TT  
   221  225 B F  G > 5S+     0   0    0 2498    1   F F     F  FFFFF FFFFFFF  F   FF F FF F FF  FFF FF FFF FFFFF FF  FF  
   222  226 B N  G 3    +     0   0    9 2501   19   G G     G  GGGGG GGGGGGG  G   GG A GG G GG  GGG GG GGG GGGGG GG  GG  
   243  247 B L  T 3   +     0   0   43 2466   86   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LLL LLLLL CL  LL  
   244  248 B A  T 3  S-     0   0    7 2499   54   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS AAS ASSSA AS  SS  
   245  249 B E    <   +     0   0  122 2500   62   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE GGE GEEEG GE  EE  
   246  250 B N        -     0   0    3 2500   80   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT NHT NTTTN NT  TT  
   247  251 B E  S    S-     0   0   78 1841   73   K K     K  RKSRK KRRKKSR  S   KR R KR R RK  KRR KK SDK DKRKE ER  KK  
   248  252 B T        -     0   0   66 1873   86   P P     P  PPPPP PPPPPPP  P   PP P PP P PP  PPP PP EVP PPPPP RP  PP  
   249  253 B L        +     0   0    0 2304   26   I I     I  IIIII IIIIIII  I   II I II I II  III II LLI LIIIL LI  II  
   250  254 B T    >   -     0   0   30 2310   71   D D     D  NDNND DNNNDNN  N   DN N DN N NG  DNN DD TTD SDNDH HN  DD  
   251  255 B P  T 3  S+     0   0   66 2323   74   M M     M  MMMMM MMMMMMM  M   MM M MM M MM  MMM MM SPM PMMME EM  MM  
   252  256 B E  T 3  S+     0   0  153 2007   67   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE EEE AEEEG EE  EE  
   253  257 B H  S X  S-     0   0   20 2163   66   H H     H  HHHHH HHHHHHH  H   HH H HH H HH  HHH HH HHH HHHHH HH  HH  
   254  258 B P  T 3  S+     0   0   96 2215   68   A A     A  TATTA ATTAVTT  T   AT T AT T TA  ATT AA EPA SATAP ET  AA  
   255  259 B D  T >> S+     0   0   24 2226   74   D D     D  DDDDD DDDDDDD  D   DD D DD D DD  DDD DD GDD DDDDD DD  DD  
   256  260 B W  H <> S+     0   0   37 2250   59   W W     W  WWWWW WWWWWWW  W   WW W WW W WW  WWW WW WWW WWWWW WW  WW  
   257  261 B A  H 3> S+     0   0   30 2350   67   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE ADE EEEEA PE  EE  
   258  262 B N  H <> S+     0   0    0 2364   79   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT AAT NTTTA VT  TT  
   259  263 B F  H  X S+     0   0    0 2473   18   F F     F  FFFFF FFFFFFF  F   FF F FF F FF  FFF FF FFF FFFFF FF  FF  
   260  264 B Y  H  X S+     0   0   49 2473   88   V V     V  VIVVV VVVVVVV  V   VV V VV V VV  VVV VV SAV YVVIA KV  VI  
   261  265 B K  H  X S+     0   0   51 2476   72   F F     F  CFCCF SCCFFCG  C   FC C FC C CS  FGC FF AAF TFCFA KC  FF  
   262  266 B A  H  X S+     0   0    0 2493   51   A A     A  AATAA AAAAATA  T   AA A AA A AA  ATA AA GGA AAAAA GA  AA  
   263  267 B L  H  X S+     0   0    0 2499   19   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LFL LLLLF LL  LL  
   264  268 B Q  H  X S+     0   0   43 2499   87   Q Q     Q  QQQQQ QQQQQQQ  Q   QQ Q QQ Q QQ  QQQ QQ RHQ RQQQR QQ  QQ  
   265  269 B L  H  X S+     0   0   44 2499   93   K K     K  KKKQK KKKKKKK  K   KK K KQ K QK  KKQ KK YYK LKKKY LQ  KK  
   266  270 B A  H  X S+     0   0    0 2499   31   V V     V  VVVVV VVVVVVV  V   VV V VV V VV  VVV VV VVV VVVVI AV  VV  
   267  271 B C  H  X S+     0   0    0 2499   81   C C     C  CCCCC CCCCCCC  C   CC C CC C CC  CCC CC CCC SCCCC CC  CC  
   268  272 B E  H  X S+     0   0   38 2499   85   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE EQE EEEEG TE  EE  
   269  273 B D  H  X S+     0   0   25 2499   79   D D     D  DDDDD DDDDDDD  D   DD D DD D DD  DDD DD VQD DDDDQ DD  DD  
   270  274 B L  H  X S+     0   0    0 2499    5   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LLL LLLLL LL  LL  
   271  275 B A  H  X S+     0   0    0 2499   16   A A     A  AAAAA AAAAAAA  A   AA A AA A AA  AAA AA AAA AAAAA AA  AA  
   272  276 B K  H  X S+     0   0   61 2500   62   K K     K  KKKKK KKKKKKK  K   KK K KK K KK  KKK KK KKK KKKKQ KK  KK  
   273  277 B Q  H  X S+     0   0   51 2500   79   K K     K  KKKKK KKKKKKK  K   KK K KK K KK  KKK KK AAK SKKKA QK  KK  
   274  278 B I  H  < S+     0   0    0 2501   20   I I     I  IIIII IIIIIII  I   II I II I II  III II III IIIII II  II  
   275  279 B A  H >< S+     0   0    0 2501   51   A A     A  AAAAA AAAAAAA  A   AA A AA A AA  AAA AA AAA AAAAA AA  AA  
   276  280 B R  H 3< S+     0   0   92 2501   58   Q Q     Q  QQQQQ QQQQQQQ  Q   QQ Q QQ Q QQ  QQQ QQ RRQ RQQQR RQ  QQ  
   277  281 B D  T 3< S+     0   0   13 2501    0   D D     D  DDDDD DDDDDDD  D   DD D DD D DD  DDD DD DDD DDDDD DD  DD  
   278  282 B G  S X  S-     0   0    2 2501    8   G G     G  GGGGG GGGGGGG  G   GG G GG G GG  GGG GG GGG GGGGG GG  GG  
   279  283 B E  T 3  S-     0   0    9 2501    0   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE EEE EEEEE EE  EE  
   280  284 B G  T 3  S+     0   0   17 2501    0   G G     G  GGGGG GGGGGGG  G   GG G GG G GG  GGG GG GGG GGGGG GG  GG  
   281  285 B A    <   +     0   0   17 2501   19   A A     A  AAAAA AAAAAAA  A   AA A AA A AA  AAA AA AAA AAAAA AA  AA  
   282  286 B T  S    S+     0   0   65 2500   38   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT TST TTTTT TT  TT  
   283  287 B K        -     0   0   26 2500   28   K K     K  KKKKK KKKKKKK  K   KK K KK K KK  KKK KK KRK KKKKK KK  KK  
   284  288 B L  E     -M  392   0C  13 2500   40   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LLL LLLLL LL  LL  
   285  289 B I  E     -Mn 391 374C   0 2501   23   I I     I  IIIII IIIIIII  I   II I II I II  III II VII IIIII II  II  
   286  290 B E  E     -Mn 390 375C  15 2501   61   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE EEE EEEEE EE  EE  
   287  291 B V  E     -Mn 389 376C   0 2501   30   V V     V  VVVVV VVVVVVV  V   VV V VV V VV  VVV VV VVV VVVVV VV  VV  
   288  292 B E  E     -Mn 388 377C  71 2500   80   N N     N  NNNNN NNNNNNN  N   NN N NN N NN  NNN NN QRN ENNNN EN  NN  
   289  293 B V  E     +Mn 387 378C   0 2500    8   V V     V  VVVVV VVVVVVV  V   VV V VV V VV  VVV VV VVV VVVVV VV  VV  
   290  294 B T  E     + n   0 379C  43 2500   81   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL HDL DLLLT NL  LL  
   291  295 B G  E    S+     0   0C   9 2500   27   G G     G  GGGGG GGEGGGG  G   GG G GG G GG  GGG GG GGG GGGGG GG  GG  
   292  296 B A  E     -M  385   0C   0 2500   22   A V     V  AAAAV VAAAAAA  A   VA A AA A AV  VAA VV AAV AVAAA AA  VA  
   293  297 B A  S    S-     0   0   35 2499   79   Q Q     Q  QQQQQ QQQRQQQ  Q   QQ Q QQ Q QQ  QQQ QQ VEQ VQQRA KQ  QR  
   294  298 B N  S  > S-     0   0   67 2499   59   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT NST STTTT ST  TT  
   295  299 B D  H  > S+     0   0   90 2500   82   N N     N  NNNNN NNNNNNN  N   NN N NN N NN  NNN NN DDN DNNNE NN  NN  
   296  300 B Q  H  > S+     0   0  138 2501   71   E E     E  EEEEE EEEEEEE  K   EE E EE E EE  EEE EE EDE EEEED LE  EE  
   297  301 B E  H  > S+     0   0   42 2501   56   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE ADE EEEEA EE  EE  
   298  302 B A  H  X S+     0   0    0 2501   24   A A     A  AAAAA AAAAAAA  A   AA A AA A AA  AAA AA AAA AAAAA AA  AA  
   299  303 B G  H  X S+     0   0    1 2501   78   K K     K  KKKKK KKKKKKK  K   KK K KK K KK  KKK KK NQK RKKKR QK  KK  
   300  304 B X  H  X S+     0   0   87 2501   77   K K     K  KKKKK KKKKKKK  K   KK K KK K KK  KKK KK AAK KKKKA IK  KK  
   301  305 B V  H  X S+     0   0    0 2501   41   I I     I  IIIII IIIIIII  I   II I II I II  III II III IIIII II  II  
   302  306 B A  H  X S+     0   0    0 2501   24   A A     A  AAAAA AAAAAAA  A   AA A AA A AA  AAA AA AAA AAAAA AA  AA  
   303  307 B K  H  X S+     0   0   43 2501   80   K K     K  KKKKK KKKKKKK  K   KK K KK K KK  KKK KK KKK KKKKK KK  KK  
   304  308 B Q  H  < S+     0   0   68 2501   62   Q Q     Q  QQQQQ QQQQQQQ  Q   QQ Q QQ Q QQ  QQQ QQ TTQ TQQQS KQ  QQ  
   305  309 B I  H >< S+     0   0    0 2501   16   I I     I  IIIII IIIIIII  I   II I II I II  III II VII VIIII II  II  
   306  310 B V  H 3< S+     0   0    0 2501   58   V V     V  VVVVV VVVVVVV  V   VV V VV V VV  VVV VV IIV VVVVI VV  VV  
   307  311 B G  T 3< S+     0   0   30 2501   76   G G     G  GGGGG GGGGGGG  G   GG G GG G GG  GGG GG GGG GGGGG GG  GG  
   308  312 B S    <>  -     0   0    7 2501    6   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS SSS SSSSS SS  SS  
   309  313 B D  H  > S+     0   0   97 2501   61   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS SSS PSSSS NS  SS  
   310  314 B L  H  > S+     0   0   98 2501    0   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LLL LLLLL LL  LL  
   311  315 B V  H  > S+     0   0    3 2501   20   V V     V  VVVVV VVVVVVV  V   VV V VV V VV  VVV VV VVV VVVVV VV  VV  
   312  316 B K  H  X S+     0   0    5 2501    0   K K     K  KKKKK KKKKKKK  K   KK K KK K KK  KKK KK KKK KKKKK KK  KK  
   313  317 B T  H  X S+     0   0   50 2501   33   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT SST TTTTS TT  TT  
   314  318 B A  H  <>S+     0   0    4 2501    1   A A     A  AAAAA AAAAAAA  A   AA A AA A AA  AAA AA AAA AAAAA AA  AA  
   315  319 B I  H ><5S+     0   0    8 2501   37   I I     I  IIIII IIIIIII  I   II I II I II  III II VVI VIIIA VI  II  
   316  320 B Y  H 3<5S+     0   0   94 2501   52   H H     H  HHHHH HHHHHYH  H   HH H HH H HH  HHH HH FFH FHHHF YH  HH  
   317  321 B G  T 3<5S-     0   0   56 2501   19   G G     G  GGGGG GGGGGGG  G   GG G GG G GG  GGG GG GGG GGGGG GG  GG  
   318  322 B A  T < 5 +     0   0    8 2501   67   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE AAE CEEEA TE  EE  
   319  323 B D      < -     0   0   59 2501    0   D D     D  DDDDD DDDDDDD  D   DD D DD D DD  DDD DD DDD DDDDD DD  DD  
   320  324 B A        +     0   0    4 2501   36   P P     P  PPPPP PPPPPPP  P   PP P PP P PP  PPP PP AAP APPPA AP  PP  
   321  325 B N    >>  +     0   0   43 2501    0   N N     N  NNNNN NNNNNNN  N   NN N NN N NN  NNN NN NNN NNNNN NN  NN  
   322  326 B W  H 3> S+     0   0   68 2501   12   W W     W  WWWWW WWWWWWW  W   WW W WW W WW  WWW WW WWW WWWWW WW  WW  
   323  327 B G  H 3> S+     0   0   30 2501    0   G G     G  GGGGG GGGGGGG  G   GG G GG G GG  GGG GG GGG GGGGG GG  GG  
   324  328 B R  H <> S+     0   0   74 2501    0   R R     R  RRRRR RRRRRRR  R   RR R RR R RR  RRR RR RRR RRRRR RR  RR  
   325  329 B I  H  X S+     0   0    3 2501   15   I I     I  IIIII IIIIIII  I   II I II I II  III II III IIIII II  II  
   326  330 B I  H  X S+     0   0   41 2501   36   I I     I  IIIII IIIIIII  I   II I II I II  III II III IIIII II  II  
   327  331 B C  H  X S+     0   0   73 2501   70   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS AAS ASSSA VS  SS  
   328  332 B A  H  X S+     0   0    0 2501   14   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS AAS ASSSA AS  SS  
   329  333 B I  H >< S+     0   0    0 2501   36   I I     I  IIIII IIIMIII  I   II I II I II  III II VVI VIIIV II  II  
   330  334 B G  H 3< S+     0   0   56 2501    0   G G     G  GGGGG GGGGGGG  G   GG G GG G GG  GGG GG GGG GGGGG GG  GG  
   331  335 B Y  H 3< S+     0   0  121 2501   84   Q Q     Q  QQQQQ QQQQQQQ  Q   QQ Q QQ Q QQ  QQQ QQ RRQ YQQQY DQ  QQ  
   332  336 B S  S << S-     0   0    8 2501   51   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS AAS SSSSS SS  SS  
   333  337 B G  S    S+     0   0   71 2501   46   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE GGE GEEEG ME  EE  
   334  338 B C  S    S-     0   0   17 2074   74   V V     V  VVVVV VVVVVVV  V   VV V VV V VV  VVV VV QRV AVVVQ AV  VV  
   335  339 B E        +     0   0  112 2101   68   A A     A  VAAAA AAAAAAA  V   AA V AA A AA  AAA AA PPA VAATP AA  AT  
   336  340 B V        -     0   0   47 2136   41   I I     I  IIIII IIIIIII  I   II I II I II  III II VVI IIIIV VI  II  
   337  341 B N    >   -     0   0   75 2400   40   N N     N  NNNHN NNNNNNN  N   NS N NH S HN  NNH NN NNN DNNNN TH  NN  
   338  342 B Q  T 3  S+     0   0  139 2402   67   P P     P  PPPPP PPPPPPP  P   PP P PP P PP  PPP PP PPP PPPPV PP  PP  
   339  343 B E  T 3  S+     0   0  117 2406   66   N N     N  NNNNN NNNNNNN  N   NN N NN N NN  NNN NN DEN DNNND EN  NN  
   340  344 B T  S <  S+     0   0   30 2408   80   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT TTT KTTTT KT  TT  
   341  345 B I        -     0   0    2 2413   57   I I     I  IIIII IIIIIII  I   II I II I II  III II VVI IIIIV VI  II  
   342  346 B D  E     -O  379   0C  36 2486   61   D D     D  DDDDD DDDDDDD  D   DD D DD D DD  DDD DD DDD TDDDD ED  DD  
   343  347 B I  E     -OP 378 351C   1 2256   47   I I     I  IIIII IIIIIII  I   II I II I II  III II VII IIIII II  II  
   344  348 B A  E     -OP 377 349C  15 2256   92   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT RAT KTTTH YT  TT  
   345  349 B I  E >  S-OP 376 348C   1 2271   51   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL IIL ILLLI LL  LL  
   346  350 B G  T 3  S-     0   0   18 2279   46   Q Q     Q  QQQQQ QQQQQQQ  Q   QQ Q QQ Q QQ  QQQ QQ GGQ GQQQG GQ  QQ  
   347  351 B P  T 3  S+     0   0  112 2284   63   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS DPS GSSSP GS  SS  
   348  352 B I  E <   -P  345   0C  13 2298   37   I I     I  IIIII IIIIIII  I   II I II I II  III II III AIIII QI  II  
   349  353 B V  E     +P  344   0C  70 2306   91   V S     S  SVSSS SLLAVSS  S   SL S VS L SS  SSS SS VSS TSLAE CS  SA  
   350  354 B T  E     +     0   0C   0 2320   24   V V     V  VVVVV VVVVVVV  V   VV V VV V VV  VVV VV TVV MVVVV LV  VV  
   351  355 B L  E     -PQ 343 356C   1 2322   77   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LLL VLLLL FL  LL  
   352  356 B K  E >  S- Q   0 355C  57 2323   76   K K     K  KKKKK KKKKKKK  K   KK K KK K KK  KKK KK EEK EKKKK KK  KK  
   353  357 B Q  T 3  S-     0   0   80 2333   67   N N     N  NNNNN NNNNNNN  N   NN N NN N NN  NNN NN GQN NNNNQ NN  NN  
   354  358 B S  T 3  S+     0   0   23 2333   23   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS SSS GSSSS NS  SS  
   355  359 B E  E <  S-Q  352   0C 139 2407   80   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE RRE EEEET EE  EE  
   356  360 B P  E     -Q  351   0C  86 2408   77   P P     P  PPPPP PPPPPPP  P   PP P PP P PP  PPP PP PPP PPPPP PP  PP  
   357  361 B T        -     0   0   62 2178   77   Q Q     Q  QQQQQ QQQQQQQ  Q   QQ Q QQ Q QQ  QQQ QQ VVQ IQQQV QQ  QQ  
   358  362 B G        +     0   0   75 2233   81   M T     T  IMIIT ITTMMTT  I   IT I MI T II  ITI TT AAI QITMP PI  TM  
   359  363 B F        -     0   0   34 2259    8   F F     F  FFFFF FFFFFFF  F   FF F FF F FF  FFF FF FFF FFFFF FF  FF  
   360  364 B S     >  -     0   0   55 2389   69   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS DDS SSSSD SS  SS  
   361  365 B E  H  > S+     0   0  119 2413   38   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE EEE EEEEE EE  EE  
   362  366 B E  H  > S+     0   0   78 2369   54   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE DDE EEEEE EE  EE  
   363  367 B E  H  > S+     0   0  116 2371   73   E E     E  EEKEE EEEEEEK  E   EE E EE E EE  EEE EE AAE AEEEA LE  EE  
   364  368 B A  H  X S+     0   0    0 2398   72   M M     M  MMMMM MMMMMMM  M   MM M MM M MM  MMM MM AAM LMMMA AM  MM  
   365  369 B T  H  X S+     0   0   43 2457   74   K K     K  KKKKK KKKKKKK  K   KK K KK K KK  KKK KK LLK IKKKL KK  KK  
   366  370 B A  H  X S+     0   0   53 2477   75   M E     E  EEEEE EEEKMEE  E   EE E ME E EE  EEE EE EAE EEEMD TE  EM  
   367  371 B Y  H  X S+     0   0   49 2483   78   R R     R  RRRRR RRRKRRR  R   RR R RR R RR  RRR RR YYR IRRRY YR  RR  
   368  372 B L  H  < S+     0   0    1 2488   12   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LLL LLLLL LL  LL  
   369  373 B K  H  < S+     0   0  123 2501   76   Q Q     Q  QQQQQ QQQIQQQ  Q   QQ Q QQ Q QQ  QQQ QQ KQQ KQQQK EQ  QQ  
   370  374 B E  H  < S+     0   0  159 1983   71   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE ..E QEEE. NE  EE  
   371  375 B A     <  -     0   0   15 2403   73   H D     D  DDDDD DDDHHDD  D   DD D HD D DD  DDD DD GGD HDDHG SD  DH  
   372  376 B D  S    S+     0   0   81 2487   20   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE DDE EEEED EE  EE  
   373  377 B P  S    S-     0   0   36  690   82   . .     .  ..... .......  .   .. . .. . ..  ... .. TT. ....T ..  ..  
   374  378 B V  E     -n  285   0C   0 2498   21   I I     I  IIIII IIIIIII  I   II I II I II  III II VVI VIIIV VI  II  
   375  379 B K  E     -n  286   0C 101 2499   81   M V     V  VVVVV VVVMMVV  V   VV V MV V VV  VVV VV VDV KVVMH KV  VM  
   376  380 B I  E     -nO 287 345C   1 2500   19   I I     I  IIIII IIIIIII  I   II I II I II  III II III IIIII II  II  
   377  381 B S  E     -nO 288 344C  52 2500   85   D N     N  NDNNN DNNDDNN  N   NN N DN N NN  NNN NN RDN FDNDK EN  ND  
   378  382 B V  E     -nO 289 343C   2 2501   25   V V     V  VVVVV VVVVVVV  V   VV V VV V VV  VVV VV VVV VVVVV VV  VV  
   379  383 B N  E     -nO 290 342C  45 2501   58   Y Y     Y  YYYYY YYYYYYY  Y   YY Y YY Y YY  YYY YY DKY SYYYD FY  YY  
   380  384 B L        -     0   0    2 2501   11   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LLL LLLLL ML  LL  
   381  385 B H        +     0   0   85 2501   63   H H     H  HHHHH HHHHHHH  H   HH H HH H HH  HHH HH HHH EHHHH QH  HH  
   382  386 B I  S    S-     0   0   50 2495   86   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL MIL VLLLM EL  LL  
   383  387 B G  S    S-     0   0   29 2501    2   G G     G  GGGGG GGGGGGG  G   GG G GG G GG  GGG GG DGG GGGGG GG  GG  
   384  388 B N  S    S+     0   0  156 2493   71   E K     K  EEEEK EEEEEEE  E   EE E EE E EE  EEE KK NSE KEEES EE  KE  
   385  389 B G  E     + M   0 292C   1 2500   64   E E     E  EEEEE EEEEEEE  E   EE E EE E EE  EEE EE GGE GEEEG GE  EE  
   386  390 B T  E     +     0   0C  63 2501   77   T T     T  TTTTT TTTTTTT  T   TT T TT T TT  TTT TT TST HTTTE KT  TT  
   387  391 B G  E     - M   0 289C   8 2501   51   G G     G  GGGGG GGGGGGG  G   GG G GG G GG  GGG GG AAG GGGGA GG  GG  
   388  392 B K  E     - M   0 288C  68 2501   61   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS TTS FSSST TS  SS  
   389  393 B A  E     - M   0 287C   0 2501   61   A A     A  AAAAA AAAAAAA  A   AA A AA A AA  AAA AA AAA AAAAA AA  AA  
   390  394 B W  E     +lM 224 286C   4 2501   15   W W     W  WWWWW WWWWWWW  W   WW W WW W WW  WWW WW WWW WWWWW WW  WW  
   391  395 B G  E     - M   0 285C   0 2501   43   G G     G  GGGGG GGGGGGG  G   GG G GG G GG  GGG GG GGG GGGGG GG  GG  
   392  396 B C  E     - M   0 284C   1 2501   32   C C     C  CCCCC CCCCCCC  C   CC C CC C CC  CCC CC CCC CCCCC CC  CC  
   393  397 B D        -     0   0    2 2501    0   D D     D  DDDDD DDDDDDD  D   DD D DD D DD  DDD DD DDD DDDDD DD  DD  
   394  398 B L        +     0   0   32 2501    5   L L     L  LLLLL LLLLLLL  L   LL L LL L LL  LLL LL LLL LLLLL LL  LL  
   395  399 B T    >>  -     0   0    9 2501   40   S S     S  SSSSS SSSSSSS  S   SS S SS S SS  SSS SS TTS TSSST TS  SS  
   396  400 B Y  H 3> S+     0   0  182 2501   65   Y Y     Y  YYYYY YYYYYYY  Y   YY Y YY Y YY  YYY YY YYY YYYYY YY  YY  
   397  401 B D  H 3> S+     0   0   75 2501   36   E E     E  EEEEE EEEEEGE  E   EE E EE E EE  EEE EE DDE DEEED EE  EE  
   398  402 B Y  H <> S+     0   0   46 2501    0   Y Y     Y  YYYYY YYYYYYY  Y   YY Y YY Y YY  YYY YY YYY YYYYY YY  YY  
   399  403 B V  H  X S+     0   0   88 2500    5   V V     V  VVVVV VVVVVVV  V   VV V VV V VV  VVV VV VVV VVVVV VV  VV  
   400  404 B R  H  <>S+     0   0  120 2499   65   K K     K  KKKKK KKKKKKK  K   KK K KK K KK  KKK KK RRK QKKKR KK  KK  
   401  405 B I  H  <5S+     0   0   59 2499   22   I I     I  IIIII IIIIIII  I   II I II I II  III II III IIIII II  II  
   402  406 B N  H  <5S+     0   0   83 2499    0   N N     N  NNNNN NNNNNNN  N   NN N NN N NN  NNN NN NNN NNNNN NN  NN  
   403  407 B A  T  <5S-     0   0   55 2494   31   A A     A  AAAAA AAAAAAA  A   AA A AA A AA  AAA AA AAA AAAAA AA  AA  
   404  408 B G  T   5       0   0   71 2493   69   C C     C  CCCCC CCCCCCC  C   CC C CC C CC  CCC CC AAC SCCCA SC  CC  
   405  409 B Y      <       0   0  219 2487    0   Y Y     Y  YYYYY YYYYYYY  Y   YY Y YY Y YY  YYY YY YYY YYYYY YY  YY  
## ALIGNMENTS  141 -  210
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....5....:....6....:....7....:....8....:....9....:....0....:....1
     1    6 A E              0   0  185  269   47   K K   KKKK   KKKKK  KK          KKK     K K  Q  K  K   KK  K K KK QKK
     2    7 A T        +     0   0   77  323   57   I V   VVVV   VVEVV  VV          VVV     V V  T  V  V   VV  V V VV TVV
     3    8 A A  S    S-     0   0   31  329   73   A A   AAAA   AAKAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
     4    9 A N        -     0   0  108  343   71   S S   SSSS   SSQSS  SS          SSS     S S  Q  S  S   SS  S S SS QSS
     5   10 A V        -     0   0   30  395   54   I I   IIII   IIIII  II          III     I I  V  I  I   II  I I II VII
     6   11 A L  E     -A  166   0A  98  402   65   T T   TTTT   TTITT  TT          TTT     T T  T  T  T   TT  T T TT TTT
     7   12 A K  E     -A  165   0A  71 1080   60   K K   KKKK   KKEKK  KK          KKK     K K  A  K  K   KK  K K KK AKK
     8   13 A L    >   -     0   0   50 1295   43   V L   LLLL   LLKLL  LL          LLL     L L  V  V  V   VV  V V VV VLV
     9   14 A E  T 3  S+     0   0  146 1310   73   E E   EEEE   EEIEE  EE          EEE     E E  A  E  E   EE  E E EE AEE
    10   15 A T  T 3  S+     0   0  126 1623   74   N S   NSSN   SNESS  SS          SSS     S S  D  D  D   DD  D D DN DND
    11   16 A G    <   +     0   0    5 1724   15   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
    12   17 A S    >   -     0   0    0 1771   60   S S   SSSS   SSSSS  SS          SSS     S S  T  S  S   SS  S S SS TSS
    13   18 A V  G >  S+     0   0    1 1816   22   I I   IIII   IIIII  II          III     I I  V  I  I   II  I I II VII
    14   19 A T  G 3  S+     0   0   18 1819   70   V V   VVVV   VVLVV  VV          VVV     V V  V  V  V   VV  V V VV VVV
    15   20 A S  G <  S+     0   0   47 1827   71   T T   TTTT   TTTTT  TT          TTT     T T  T  T  T   TT  T T TT TTT
    16   21 A A  S X  S-     0   0    2 1861   32   P P   PPPP   PPPPP  PP          PPP     P P  P  P  P   PP  P P PP PPP
    17   22 A K  T 3  S+     0   0  118 1867   72   K K   KKKK   KKEKK  KK          KKK     K K  K  K  K   KK  K K KK KKK
    18   23 A G  T 3  S+     0   0   11 1876    1   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
    19   24 A F  E <   +B   40   0A   3 1879    2   F F   FFFF   FFFFF  FF          FFF     F F  F  F  F   FF  F F FF FFF
    20   25 A S  E     -B   39   0A  27 1879   93   S S   SSSS   SSKSS  SS          SSS     S S  Q  S  S   SS  S S SS QSS
    21   26 A A  E     +BC  38 140A   0 1879   15   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
    22   27 A V  E     -B   37   0A  14 1879   71   I I   IIII   IISII  II          III     I I  A  I  I   II  I I II AII
    23   28 A G  E     -B   36   0A   5 1880   10   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
    24   29 A I  E     -B   35   0A  42 1881   62   T T   TTTT   TTVTT  TT          TTT     T T  V  T  T   TT  T T TT VTT
    25   30 A H        +     0   0   90 1881   50   T S   VSSV   SAYSS  SS          SSS     S S  H  A  A   AA  A A AA HVA
    26   31 A T        -     0   0   32 1881   71   I N   NNNN   NNSNN  NN          NNN     N N  A  I  I   II  I I II ANI
    27   32 A G  S    S+     0   0   47 1883    6   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
    28   33 A V  S    S+     0   0   44 1883   24   L L   LLLL   LLVLL  LL          LLL     L L  L  L  L   LL  L L LL LLL
    29   34 A K  S    S-     0   0   29 1883   26   K K   KKKK   KKKKK  KK          KKK     K K  R  K  K   KK  K K KK RKK
    30   35 A R  S    S-     0   0  100 1883   79   K K   KKKK   KKRKK  KK          KKK     K K  Y  K  K   KK  K K KK YKK
    31   36 A K  S    S+     0   0  111 1865   68   E E   EEEE   EEKEE  EE          EEE     E E  A  G  G   GG  G G GE SEG
    32   37 A R  S    S-     0   0   83 1846   32   K K   KKKK   KKRKK  KK          KKK     K K  K  K  K   KK  K K KK KKK
    33   38 A K        +     0   0   69 1851   64   K K   KKKK   KKLKK  KK          KKK     K K  K  K  K   KK  K K KK KKK
    34   39 A D        +     0   0    1 1866    0   D D   DDDD   DDDDD  DD          DDD     D D  D  D  D   DD  D D DD DDD
    35   40 A L  E     +BD  24  79A   0 1883   24   L L   LLLL   LLLLL  LL          LLL     L L  L  L  L   LL  L L LL LLL
    36   41 A G  E     -BD  23  78A   0 1883   31   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
    37   42 A A  E     -BD  22  77A   0 1862   72   A A   AAAA   AAAAA  AA          AAA     A A  V  A  A   AA  A A AA VAA
    38   43 A I  E     -BD  21  76A   2 1877   15   I I   IIII   IIIII  II          III     I I  I  I  I   II  I I II III
    39   44 A V  E     -BD  20  75A  22 1877   61   V V   VVVV   VVVVV  VV          VVV     V V  V  V  V   VV  V V VV LVV
    40   45 A C  E     -B   19   0A   5 1878   27   C C   CCCC   CCCCC  CC          CCC     C C  C  C  C   CC  C C CC CCC
    41   46 A E  E    S+     0   0A 145 1878   53   D D   DDDD   DDEDD  DD          DDD     D D  D  D  D   DD  D D DD DDD
    42   47 A V  E    S-     0   0A  44 1882   71   V V   VVVV   VVVVV  VV          VVV     V V  V  V  V   VV  V V TT VVT
    43   48 A P  E     -     0   0A  54 1883   66   P P   PPPP   PPPPP  PP          PPP     P P  P  P  P   PP  P P PP PPP
    44   49 A A  E     - D   0  73A   0 1883   43   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
    45   50 A S  E     -ED 240  72A   8 1883   69   S S   SSSS   SSNSS  SS          SSS     S S  S  S  S   SS  S S SS SSS
    46   51 A S  E     +E  239   0A   2 1884   62   C C   CCCC   CCTCC  CC          CCC     C C  A  C  C   CC  C C CC ACC
    47   52 A A  E     -E  238   0A   0 1881    2   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
    48   53 A A  E     -E  237   0A   5 1882   26   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
    49   54 A V  E     -E  236   0A   1 1884   15   V V   VVVV   VVVVV  VV          VVV     V V  V  V  V   VV  V V VV VVV
    50   55 A Y  E     -E  235   0A  25 1884   26   Y Y   YYYY   YYYYY  YY          YYY     Y Y  Y  Y  Y   YY  Y Y YY YYY
    51   56 A T  B     -K  190   0B   2 1884    0   T T   TTTT   TTTTT  TT          TTT     T T  T  T  T   TT  T T TT TTT
    52   57 A L        +     0   0   97 1884   80   T T   TTTT   TTLTT  TT          TTT     T T  Q  T  T   TT  T T TT QTT
    53   58 A N        -     0   0   51 1884    8   N N   NNNN   NNNNN  NN          NNN     N N  S  N  N   NN  N N NN SNN
    54   59 A K  S    S+     0   0  207 1884   65   Q Q   QQQQ   QQKQQ  QQ          QQQ     Q Q  H  Q  Q   QQ  Q Q QQ HQQ
    55   60 A V  S    S+     0   0   76 1884   48   I I   IIII   IIIII  II          III     I I  F  I  I   II  I I II FII
    56   61 A Q        -     0   0   72 1884   65   Q Q   QQQQ   QQQQQ  QQ          QQQ     Q Q  Q  Q  Q   QQ  Q Q QQ QQQ
    57   62 A A    >>  -     0   0    1 1884   16   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
    58   63 A A  H >> S+     0   0   17 1883   22   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
    59   64 A P  H 3> S+     0   0    1 1884    3   P P   PPPP   PPPPP  PP          PPP     P P  P  P  P   PP  P P PP PPP
    60   65 A L  H <> S+     0   0    0 1884   31   L L   LLLL   LLLLL  LL          LLL     L L  L  L  L   LL  L L LL LLL
    61   66 A K  H X S+     0   0    0 1884   84   S S   SSSS   SSSSS  SS          SSS     S S  S  S  S   SS  S S SS SSS
    67   72 A I  H 3X S+     0   0   19 1884   32   I I   IIII   IIIII  II          III     I I  L  I  I   II  I I II LII
    68   73 A A  H 3< S+     0   0   84 1884   72   T A   TAAT   AAAAA  AA          AAA     A A  A  T  T   TT  T T TA ATT
    69   74 A V  H << S-     0   0   89 1884   71   T T   ATTA   TAKTT  TT          TTT     T T  V  T  T   TT  T T TT VAT
    70   75 A E  H  < S-     0   0   85 1882   64   E E   EEEE   EEEEE  EE          EEE     E E  E  E  E   EE  E E EE EEE
    71   76 A G  S  < S+     0   0    3 1263   50   G G   GGGG   GGGGG  GG          GGG     G G  Q  G  G   GG  G G GG QGG
    72   77 A K  E     -D   45   0A  59 1702   41   K K   KKKK   KKKKK  KK          KKK     K K  K  K  K   KK  K K KK KKK
    73   78 A L  E     -D   44   0A   0 1748   52   L L   LLLL   LLILL  LL          LLL     L L  L  L  L   LL  L L LL LLL
    74   79 A Q  E    S+     0   0A  29 1850   30   Q Q   QQQQ   QQKQQ  QQ          QQQ     Q Q  Q  Q  Q   QQ  Q Q QQ QQQ
    75   80 A A  E     -Df  39 113A   0 1880   17   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
    76   81 A X  E     -Df  38 114A   2 1883   28   I I   IIII   IILII  II          III     I I  V  I  I   II  I I II VII
    77   82 A I  E     -Df  37 115A   0 1884   17   I I   IIII   IIVII  II          III     I I  I  I  I   II  I I II III
    78   83 A V  E     -Df  36 116A   0 1884   21   V V   VVVV   VVVVV  VV          VVV     V V  V  V  V   VV  V V VV VVV
    79   84 A N  E     -Df  35 117A   1 1884    0   N N   NNNN   NNNNN  NN          NNN     N N  N  N  N   NN  N N NN NNN
    80   85 A S  E     + f   0 118A   0 1884    6   S S   SSSS   SSSSS  SS          SSS     S S  S  S  S   SS  S S SS SSS
    81   86 A G  E    S+ f   0 119A  21 1884   29   G G   GGGG   GGGGG  GG          GGG     G G  A  G  G   GG  G G GG AGG
    82   87 A I  E     -Gf 118 120A   3 1884   63   N N   NNNN   NNNNN  NN          NNN     N N  C  N  N   NN  N N NN CNN
    83   88 A A        -     0   0    0 1884    0   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
    84   89 A N        +     0   0    0 1884    0   N N   NNNN   NNNNN  NN          NNN     N N  N  N  N   NN  N N NN NNN
    85   90 A A        +     0   0    0 1884   50   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
    86   91 A C  S    S+     0   0   78 1884   38   C C   CCCC   CCCCC  CC          CCC     C C  C  C  C   CC  C C CC CCC
    87   92 A T     >  -     0   0    9 1884   26   T T   TTTT   TTTTT  TT          TTT     T T  T  T  T   TT  T T TT TTT
    88   93 A G  H  >  -     0   0   56 1883    4   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
    89   94 A K  H  > S+     0   0  100 1884   77   M M   MMMM   MMEMM  MM          MMM     M M  E  M  M   MM  M M MM EMM
    90   95 A R  H  > S+     0   0  137 1884   52   K K   QKKQ   KQQKK  KK          KKK     K K  Q  K  K   KK  K K KK QQK
    91   96 A G  H  X S+     0   0    0 1884    5   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
    92   97 A L  H  X S+     0   0   26 1883   55   L L   LLLL   LILLL  LL          LLL     L L  L  L  L   LL  L L LL LLL
    93   98 A D  H  X S+     0   0   83 1884   76   Q Q   QQQE   QQKQQ  QQ          QQQ     Q Q  K  Q  Q   QQ  Q Q QQ KQQ
    94   99 A D  H  X S+     0   0   18 1884   41   D D   DDDD   DDDDD  DD          DDD     D D  D  D  D   DD  D D DD DDD
    95  100 A A  H  X S+     0   0    0 1884   21   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
    96  101 A Y  H  X S+     0   0   64 1884   90   Y Y   YYYY   YYYYY  YY          YYY     Y Y  Y  Y  Y   YY  Y Y YY YYY
    97  102 A T  H  X S+     0   0   59 1884   74   E E   EEEE   EEEEE  EE          EEE     E E  E  E  E   EE  E E EE EEE
    98  103 A X  H  X S+     0   0    1 1883   59   M I   MIIM   IIMII  IM          MII     I I  M  M  M   MM  M M MM MMM
    99  104 A R  H  X S+     0   0   32 1884   72   R R   RRRR   RRRRR  RR          RRR     R R  R  R  R   RR  R R RR RRR
   100  105 A A  H  X S+     0   0   21 1714   75   A T   AATA   TTATT  TA          ATT     T T  E  A  A   AA  A A AA EAA
   101  106 A V  H  X S+     0   0    9 1759   75   L L   LLLL   LLLLL  LL          LLL     L L  L  L  L   LL  L L LL LLL
   102  107 A G  H  X S+     0   0    0 1762   69   G G   GGGG   GGSGG  GG          GGG     G G  C  G  G   GG  G G GG CGG
   103  108 A A  H  X>S+     0   0    7 1763   27   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
   104  109 A E  H  <5S+     0   0  111 1864   59   E E   EEEE   EETEE  EE          EEE     E E  K  E  E   EE  E E EE KEE
   105  110 A T  H  <5S+     0   0   39 1871   76   H H   HHHH   HHKHH  HH          HHH     H H  Q  H  H   HH  H H HH QHH
   106  111 A F  H  <5S-     0   0   41 1882   16   F F   FFFF   FFFFF  FF          FFF     F F  F  F  F   FF  F F FF FFF
   107  112 A H  T  <5 +     0   0  175 1884   67   G G   GGGG   GDNGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
   108  113 A I  S      -     0   0   58 1863   72   K K   KKKK   KKEKK  KK          KKK     K K  A  K  K   KK  K K KK AKK
   110  115 A E  G >  S+     0   0   94 1870   74   E E   EEEE   EEEEE  EE          EEE     E E  L  E  E   EE  E E EE LEE
   111  116 A H  G 3  S+     0   0   45 1878   61   K N   NNNN   NNHNN  NN          NNN     N N  H  K  K   KK  K K KN HNK
   112  117 A Y  G <  S+     0   0   25 1878   90   Y Y   YYYY   YYLYY  YY          YYY     Y Y  H  Y  Y   YY  Y Y YY HYY
   113  118 A V  E <   -f   75   0A   0 1884   12   V V   VVVV   VVVVV  VV          VVV     V V  V  V  V   VV  V V VV VVV
   114  119 A A  E     -f   76   0A   0 1884   66   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
   115  120 A V  E     +f   77   0A   0 1884    7   V V   VVVV   VVVVV  VV          VVV     V V  V  V  V   VV  V V VV VVV
   116  121 A T  E     -f   78   0A   0 1884   34   A G   AAGA   GATGG  GG          AGG     G G  A  A  A   AA  A A AA AAA
   117  122 A S  E     -f   79   0A   0 1884    0   S S   SSSS   SSSSS  SS          SSS     S S  S  S  S   SS  S S SS SSS
   118  123 A T  E     +fG  80  82A   1 1884    0   T T   TTTT   TTTTT  TT          TTT     T T  T  T  T   TT  T T TT TTT
   119  124 A G  E    S+f   81   0A  23 1884    0   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
   120  125 A V  E     -f   82   0A  80 1884   10   V V   VVVV   VVVVV  VV          VVV     V V  V  V  V   VV  V V VV VVV
   121  126 A I  S    S+     0   0   69 1884    0   I I   IIII   IIIII  II          III     I I  I  I  I   II  I I II III
   122  127 A G  S    S+     0   0   35 1884    0   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
   123  128 A E        -     0   0   93 1884   72   V V   VVVV   VVEVV  VV          VVV     V V  E  V  V   VV  V V VV EVV
   124  129 A F        -     0   0   83 1884   98   P P   PPPP   PPYPP  PP          LPP     P P  Y  P  P   PP  P P PP YPP
   125  130 A L        -     0   0    5 1884    3   L L   LLLL   LLLLL  LL          LLL     L L  L  L  L   LL  L L LL LLL
   126  131 A P     >  -     0   0   50 1884   38   P P   PPPP   PPQPP  PP          PPP     P P  P  P  P   PP  P P PP PPP
   127  132 A X  H  > S+     0   0   32 1883   28   M M   MMMM   MMMMM  MM          MMM     M M  M  M  M   MM  M M MM MMM
   128  133 A D  H  > S+     0   0  130 1884   28   D D   DDDD   DDDDD  DD          DDD     D D  E  D  D   DD  D D DD EDD
   129  134 A V  H  > S+     0   0   59 1884   74   I S   IISI   SIKSS  SS          SSS     S S  K  I  I   II  I I II KII
   130  135 A I  H  X S+     0   0    1 1884   20   I I   IIII   IIIII  II          III     I I  I  I  I   II  I I II III
   131  136 A T  H  X S+     0   0   19 1884   80   R R   RRRR   RRRRR  RR          RRR     R R  R  R  R   RR  R R RR RRR
   132  137 A N  H  X S+     0   0   96 1884   74   K K   KKKK   KKNKK  KK          KKK     K K  A  K  K   KK  K K KN AKK
   133  138 A G  H >X S+     0   0    6 1884   27   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
   134  139 A I  H >< S+     0   0    0 1881   58   I V   IVVI   VVIVV  VV          VVV     V V  I  I  I   II  I I II III
   135  140 A R  H 3< S+     0   0  110 1884   72   V T   AVTA   TAETT  TT          TTT     T T  E  V  V   VV  V V VA KAV
   136  141 A Q  H << S+     0   0  115 1884   83   T S   TSST   SSLSS  SS          SSS     S S  K  T  T   TT  T T TT QTT
   137  142 A L    <<  -     0   0    4 1884   30   L L   LLLL   LLFLL  LL          LLL     L L  L  L  L   LL  L L LL LLL
   138  143 A K        -     0   0  131 1883   86   I I   IIII   IIEII  II          III     I I  V  I  I   II  I I II VII
   139  144 A P        -     0   0   33 1884   80   P P   PPPP   PPLPP  PP          PPP     P P  P  P  P   PP  P P PP PPP
   140  145 A E  B     -C   21   0A 111 1884   74   A T   TTTT   TTDTT  TT          TTT     T T  G  A  A   AA  A A AA GTA
   141  146 A A  S    S+     0   0   71 1884   85   K K   KKKK   KKSKK  KK          KKK     K K  A  K  K   KK  K K KK VKK
   142  147 A T  S  > S-     0   0   44 1884   95   E E   EEEE   EESEE  EE          EEE     E E  T  E  E   EE  E E EE TEE
   143  148 A I  H  > S+     0   0   61 1883   79   E V   EVVE   VIFVV  VV          VVV     V V  M  E  E   EE  E E EE MEE
   144  149 A E  H  > S+     0   0  136  606   66   N S   SSSS   SGESS  SS          SSS     S S  A  N  N   NN  N N NR ASN
   145  150 A G  H  > S+     0   0    5 1067   73   G E   GEEG   EEAEE  EE          EEE     E E  D  G  G   GG  G G EE DEE
   146  151 A A  H  X S+     0   0    0 1305   72   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
   147  152 A H  H  X S+     0   0   73 1573   83   H H   YHHY   HHEHH  HH          HHH     H H  E  H  H   HH  H H HH EYH
   148  153 A A  H  X S+     0   0   18 1878   68   S S   SSSS   SSNSS  SS          SSS     S S  A  S  S   SS  S S SS ASS
   149  154 A F  H  X S+     0   0    0 1883   72   F F   FFFF   FFFFF  FF          FFF     F F  F  F  F   FF  F F FF FFF
   150  155 A N  H >X S+     0   0    0 1883   75   S C   SCCS   CSNCC  CC          CCC     C C  Q  S  S   SS  S S SS QSS
   151  156 A E  H >< S+     0   0   49 1884   54   E E   EEEE   EEQEE  EE          EEE     E E  T  E  E   EE  E E EE TEE
   152  157 A A  H 3< S+     0   0    0 1884    2   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
   153  158 A I  H << S+     0   0    0 1884    1   I I   IIII   IIIII  II          III     I I  I  I  I   II  I I II III
   154  159 A L    <<  +     0   0    3 1884   20   L L   LLLL   LLLLL  LL          LLL     L L  L  L  L   LL  L L LL LLL
   155  160 A T  S    S-     0   0   39 1884    0   T T   TTTT   TTTTT  TT          TTT     T T  T  T  T   TT  T T TT TTT
   156  161 A T  S    S+     0   0   67 1884    0   T T   TTTT   TTTTT  TT          TTT     T T  T  T  T   TT  T T TT TTT
   157  162 A D        -     0   0    2 1884    0   D D   DDDD   DDDDD  DD          DDD     D D  D  D  D   DD  D D DD DDD
   158  163 A T  S    S+     0   0   94 1884   47   L L   LLLL   LLTLL  LL          LLL     L L  T  L  L   LL  L L LL TLL
   159  164 A V  S    S-     0   0   80 1883   83   I I   IIII   ITIII  II          III     I I  V  I  I   II  I I II VII
   160  165 A E        -     0   0   46 1883   74   T T   TTTT   TTNTT  TT          TTT     T T  M  T  T   TT  T T TT MTT
   161  166 A K        +     0   0    0 1883    0   K K   KKKK   KKKKK  KK          KKK     K K  K  K  K   KK  K K KK KKK
   162  167 A H  E     + H   0 179A  28 1778   69   E E   EEEE   EEREE  EE          EEE     E E  R  E  E   EE  E E EE REE
   163  168 A T  E     + H   0 178A   2 1781   59   T T   TTTT   TTATT  TT          TTT     T T  A  T  T   TT  T T TT ATT
   164  169 A C  E     + H   0 177A   0 1797   54   C C   CCCC   CCCCC  CC          CCC     C C  C  C  C   CC  C C CC CCC
   165  170 A Y  E     -AH   7 176A  26 1810   53   Y Y   YYYY   YYYYY  YY          YYY     Y Y  Y  Y  Y   YY  Y Y YY YYY
   166  171 A Q  E     +AH   6 175A  61 1819   75   E E   EEEE   EEQEE  EE          EEE     E E  Q  E  E   EE  E E EE QEE
   167  172 A T  E     - H   0 174A   5 1821   74   M M   MMMM   MMTMM  MM          MMM     M M  T  M  M   MM  M M MM TMM
   168  173 A I  E     + H   0 173A  62 1828   84   I I   IIII   IITII  II          III     I I  T  I  I   II  I I IV TII
   169  174 A V  E >  S- H   0 172A   0 1798   44   I I   IIII   IIVII  II          III     I I  V  I  I   II  I I II VII
   170  175 A N  T 3  S-     0   0   64 1810   43   D D   DDDD   DDDDD  DD          DDD     D D  D  D  D   DD  D D DD DDD
   171  176 A G  T 3  S+     0   0   66 1833   39   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
   172  177 A K  E <  S-H  169   0A 100 1857   49   K K   KKKK   KKVKK  KK          KKK     K K  K  K  K   KK  K K KE KKK
   173  178 A T  E     -H  168   0A  62 1870   69   K E   KEEK   EETEE  EE          EEE     E E  T  K  K   KK  K K KK TKK
   174  179 A V  E     -H  167   0A   0 1855   31   V V   VVVV   VVVVV  VV          VVV     V V  V  V  V   VV  V V VV VVV
   175  180 A T  E     -H  166   0A   4 1868   38   M T   ATTA   TTSTT  TT          TTT     T T  T  M  M   MM  M M ML TAM
   176  181 A V  E     +HI 165 200A   0 1880   28   I I   IIII   IIIII  II          III     I I  V  I  I   II  I I II VII
   177  182 A G  E     +HI 164 199A   0 1880   37   A A   AAAA   AAGAA  AA          AAA     A A  G  A  A   AA  A A AA GAA
   178  183 A G  E     -HI 163 198A   0 1880    3   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
   179  184 A V  E     +HI 162 197A   0 1880   73   V V   VVVV   VVVVV  VV          VVV     V V  A  V  V   VV  V V VV AVV
   180  185 A A  E     - I   0 196A   0 1880   23   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
   181  186 A K  E     + I   0 195A   0 1880    0   K K   KKKK   KKKKK  KK          KKK     K K  K  K  K   KK  K K KK KKK
   182  187 A G        +     0   0    0 1880    0   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
   183  188 A S  S    S+     0   0    2 1880   15   S S   SSSS   SSSSS  SS          SSS     S S  S  S  S   SS  S S SS SSS
   184  189 A G  S    S+     0   0    8 1880    0   G G   GGGG   GGGGG  GG          GGG     G G  G  G  G   GG  G G GG GGG
   185  190 A X  S    S+     0   0   73 1878    0   M M   MMMM   MMMMM  MM          MMM     M M  M  M  M   MM  M M MM MMM
   186  191 A I        +     0   0    0 1879    4   I I   IIII   IIIII  II          III     I I  I  I  I   II  I I II III
   187  192 A H        -     0   0   47 1879   23   H H   HHHH   HHHHH  HH          HHH     H H  H  H  H   HH  H H HH HHH
   188  193 A P        +     0   0    0 1879    0   P P   PPPP   PPPPP  PP          PPP     P P  P  P  P   PP  P P PP PPP
   189  194 A N        +     0   0   80 1878   12   N N   NNNN   NNNNN  NN          NNN     N N  N  N  N   NN  N N NN NNN
   190  195 A X  B      K   51   0B   2 1877    2   M M   MMMM   MMMMM  MM          MMM     M M  M  M  M   MM  M M MM MMM
   191  196 A A              0   0   68 1794    3   A A   AAAA   AAAAA  AA          AAA     A A  A  A  A   AA  A A AA AAA
   192      ! !              0   0    0   0     0  
   193  197 B T              0   0   13 2458    0  T T TTT    TTT     TT  TTTTTTTTTT   TTTTT T TT TT TT TTT  TT T T  T   
   194  198 B X        -     0   0    0 2459   13  M M MMM    MMM     MM  MMMMMMMMMM   MMMMM M MM MM MM MMM  MM M M  M   
   195  199 B L  E     -Ij 181 235A   0 2460    1  L L LLL    LLL     LL  LLLLLLLLLL   LLLLL L LL LL LL LLL  LL L L  L   
   196  200 B S  E     -Ij 180 236A   0 2460   54  S S SSS    SSS     SS  GSSSSSSSSS   SSSGS G SA SG SS GAS  SS A S  G   
   197  201 B F  E     -Ij 179 237A   4 2460   22  F F FFF    FFF     FF  FFFFFFFFFF   FFFFF F FF FF FF FFF  FF F F  F   
   198  202 B V  E     -Ij 178 238A   2 2460   22  I I III    III     II  IIIIIIIIII   IIIVI V IL IM II MLI  II I L  V   
   199  203 B T  E     +Ij 177 239A   1 2460   61  T T TTT    TTT     TT  TTTTTTTTTT   TTTTT T TT TT TT TTT  TT T V  T   
   200  204 B T  E     -Ij 176 240A   0 2460   23  T T TTT    TTT     TT  TTTTTTTTTT   TTTTT T TT TT TT TTT  TT T T  T   
   201  205 B D        +     0   0    1 2460    0  D D DDD    DDD     DD  DDDDDDDDDD   DDDDD D DD DD DD DDD  DD D D  D   
   202  206 B A        -     0   0    0 2460   23  A A AAA    AAA     AA  AAAAAAAAAA   AAAAA A AA AA AA AAA  AA A A  A   
   203  207 B N        +     0   0   56 2461   79  H H HHN    HHH     HH  NHHHHHHHHH   HHHCH S HN HV RR VNR  RR N T  C   
   204  208 B I        -     0   0    1 2461   20  I I III    III     II  IIIIIIIIII   IIIII I II II II III  II I I  I   
   205  209 B D     >  -     0   0   69 2461   67  E E EEE    EEE     EE  EEEEEEEEEE   EEEEE G ES ER EE GSE  EE D Q  E   
   206  210 B H  H  > S+     0   0   90 2461   75  H H RHH    HHH     HH  SHHHHHHHHH   HHHEH Q HS HH HH QSH  HH C G  E   
   207  211 B G  H  > S+     0   0   44 2461   69  D D DDD    DDD     DD  EDDDDDDDDD   DDDSD E DE DD DD EED  DD S N  S   
   208  212 B H  H  > S+     0   0   63 2452   75  V V VVV    VVV     VV  EVVVVVVVVV   VVVAV A VH VA VV AHV  VV D E  A   
   209  213 B L  H  X S+     0   0    0 2459   19  L L LLL    LLL     LL  LLLLLLLLLL   LLLLL L LL LL LL LLL  LL L L  L   
   210  214 B Q  H  X S+     0   0   55 2461   45  Q Q QQQ    QQQ     QQ  QQQQQQQQQQ   QQQQQ A QT QQ QQ QTQ  QQ Q Q  Q   
   211  215 B G  H  X S+     0   0   45 2461   78  T T TTT    TTI     TT  KTTTTTTTTT   TTTRT G TA TL TT LAT  TT F Q  R   
   212  216 B A  H  X S+     0   0    3 2461   61  A A AAA    AAA     AA  AAAAAAAAAA   AAAAA L AA AL AA LAA  AA A L  A   
   213  217 B L  H  X S+     0   0    0 2461   19  L L LLL    LLL     LL  LLLLLLLLLL   LLLLL L LL LL LL LLL  LL L L  L   
   214  218 B S  H  X S+     0   0   44 2461   66  S S SSS    SSS     SS  SSSSSSSSSS   SSSRS R SK SR SS RKS  SS K K  R   
   215  219 B A  H  X S+     0   0   43 2461   81  Q Q QQQ    QQQ     QQ  SQQQQQQQQQ   QQQEQ S QD QR QQ QDQ  QQ Q D  E   
   216  220 B I  H >X S+     0   0    0 2462   71  I I III    III     II  VIIIIIIIII   IIIII T IV IT II TVI  II V V  I   
   217  221 B T  H ><>S+     0   0    1 2464   57  T T TTT    TTT     TT  TTTTTTTTTT   TTTTT T TT TT TT TTT  TT T T  T   
   218  222 B N  H 3<5S+     0   0   93 2464   50  N N NNN    NNN     NN  DNNNNNNNNN   NNNDN N NN NN NN NNN  NN D N  D   
   219  223 B E  H <<5S+     0   0   67 2464   80  H H HHH    HHH     HH  CHHHHHHHHH   HHHVH K HT HL HH LTH  HH R K  V   
   220  224 B T  T X<5S+     0   0    1 2464   41  T T TTT    TTT     TT  TTTTTTTTTT   TTTST T TT TT TT TTT  TT T T  S   
   221  225 B F  G > 5S+     0   0    0 2498    1  F F FFF    FFF     FF  FFFFFFFFFF   FFFFF F FF FF FF FFF  FF F F  F   
   222  226 B N  G 3    +     0   0    9 2501   19  G G GGG    GGG     GG  GGGGGGGGGG   GGGGG G GG GG GG GGG  GG G N  G   
   243  247 B L  T 3   +     0   0   43 2466   86  L L LLL    LLL     LL  LLLLLLLLLL   LLLCL M LS LL LL LSL  LL T K  C   
   244  248 B A  T 3  S-     0   0    7 2499   54  S S SSS    SSS     SS  ASSSSSSSSS   SSSAS A SA SA SS AAS  SS S V  A   
   245  249 B E    <   +     0   0  122 2500   62  E E EEE    EEE     EE  GEEEEEEEEE   EEEGE G EE ED EE GEE  EE G Q  G   
   246  250 B N        -     0   0    3 2500   80  T T TTT    TTT     TT  NTTTTTTTTT   TTTNT N TN TN TT HNT  TT I H  N   
   247  251 B E  S    S-     0   0   78 1841   73  K K SKK    RSK     RR  DRRRKRRRKR   RRRER E RQ RE KK DQK  KK N N  E   
   248  252 B T        -     0   0   66 1873   86  P P PPP    PPP     PP  PPPPPPPPPP   PPPRP P PP PE PP VPP  PP K Q  R   
   249  253 B L        +     0   0    0 2304   26  I I III    III     II  LIIIIIIIII   IIILI L IL IL II LLI  II L L  L   
   250  254 B T    >   -     0   0   30 2310   71  N D NDS    NNN     NN  SNNNDNNNDN   NNNHN H NN NS DD TND  DD S N  H   
   251  255 B P  T 3  S+     0   0   66 2323   74  M M MMM    MMM     MM  PMMMMMMMMM   MMMEM E MP MP MM PPM  MM Q Q  E   
   252  256 B E  T 3  S+     0   0  153 2007   67  E E EEE    EEE     EE  AEEEEEEEEE   EEEEE Q ED EE EE EDE  EE E D  E   
   253  257 B H  S X  S-     0   0   20 2163   66  H H HHH    HHH     HH  HHHHHHHHHH   HHHHH H HH HH HH HHH  HH H H  H   
   254  258 B P  T 3  S+     0   0   96 2215   68  T A TAK    TTA     TT  PTTTATTTAT   TTTET E TP TP AA PPA  AA P P  E   
   255  259 B D  T >> S+     0   0   24 2226   74  D D DDE    DDD     DD  DDDDDDDDDD   DDDDD A DD DD DD DDD  DD D Q  D   
   256  260 B W  H <> S+     0   0   37 2250   59  W W WWW    WWW     WW  WWWWWWWWWW   WWWWW W WW WW WW WWW  WW W W  W   
   257  261 B A  H 3> S+     0   0   30 2350   67  E E EEE    EEE     EE  EEEEEEEEEE   EEEPE Q EA EE EE DAE  EE D A  P   
   258  262 B N  H <> S+     0   0    0 2364   79  A T TTT    TTT     TT  NTTTTTTTTT   TTTVT A TV TA TT AVT  TT V V  V   
   259  263 B F  H  X S+     0   0    0 2473   18  F F FFF    FFF     FF  FFFFFFFFFF   FFFFF F FF FF FF FFF  FF F F  F   
   260  264 B Y  H  X S+     0   0   49 2473   88  V I VIV    VVV     VV  YVVVVVVVIV   VVVKV A VV VA VV AVV  VV I Q  K   
   261  265 B K  H  X S+     0   0   51 2476   72  F F CFV    GCF     GC  TCCCFCCCFC   CCCKG A CE CA FF AEF  FF Q E  K   
   262  266 B A  H  X S+     0   0    0 2493   51  A A TAA    ATA     AA  AAAAAAAAAA   AAAGA A AL AG AA GLA  AA M A  G   
   263  267 B L  H  X S+     0   0    0 2499   19  L L LLL    LLL     LL  LLLLLLLLLL   LLLLL F LL LF LL FLL  LL L F  L   
   264  268 B Q  H  X S+     0   0   43 2499   87  Q Q QQQ    QQQ     QQ  RQQQQQQQQQ   QQQQQ H QK QH QQ HKQ  QQ S Q  Q   
   265  269 B L  H  X S+     0   0   44 2499   93  K K KKK    KKK     KK  LQQKKQKQKK   KKQLK Y QE KY KK YEK  KK L L  L   
   266  270 B A  H  X S+     0   0    0 2499   31  V V VVV    VVV     VV  VVVVVVVVVV   VVVAV V VS VV VV VSV  VV T C  V   
   267  271 B C  H  X S+     0   0    0 2499   81  C C CCC    CCC     CC  SCCCCCCCCC   CCCCC C CC CC CC CCC  CC S A  C   
   268  272 B E  H  X S+     0   0   38 2499   85  E E EEE    EEE     EE  EEEEEEEEEE   EEETE E EA EQ EE QAE  EE E T  T   
   269  273 B D  H  X S+     0   0   25 2499   79  D D DDD    DDD     DD  DDDDEDDDDD   DDDDD Q DS DQ DD QSD  DD S E  D   
   270  274 B L  H  X S+     0   0    0 2499    5  L L LLL    LLL     LL  LLLLLLLLLL   LLLLL L LL LL LL LLL  LL L L  L   
   271  275 B A  H  X S+     0   0    0 2499   16  A A AAA    AAA     AA  AAAAAAAAAA   AAAAA A AA AA AA AAA  AA A A  A   
   272  276 B K  H  X S+     0   0   61 2500   62  K K KKK    KKK     KK  KKKKKKKKKK   KKKKK K KK KM KK KKK  KK K K  K   
   273  277 B Q  H  X S+     0   0   51 2500   79  K K KKK    KKK     KK  SKKKKKKKKK   KKKQK A KQ KA KK AQK  KK Q M  Q   
   274  278 B I  H  < S+     0   0    0 2501   20  I I III    III     II  IIIIIIIIII   IIIII I II II II III  II I I  I   
   275  279 B A  H >< S+     0   0    0 2501   51  A A AAA    AAA     AA  AAAAAAAAAA   AAAAA A AA AA AA AAA  AA A A  A   
   276  280 B R  H 3< S+     0   0   92 2501   58  Q Q QQQ    QQQ     QQ  RQQQQQQQQQ   QQQRQ R QR QR QQ RRQ  QQ K R  R   
   277  281 B D  T 3< S+     0   0   13 2501    0  D D DDD    DDD     DD  DDDDDDDDDD   DDDDD D DD DD DD DDD  DD D D  D   
   278  282 B G  S X  S-     0   0    2 2501    8  G G GGG    GGG     GG  GGGGGGGGGG   GGGGG G GG GG GG GGG  GG G G  G   
   279  283 B E  T 3  S-     0   0    9 2501    0  E E EEE    EEE     EE  EEEEEEEEEE   EEEEE E EE EE EE EEE  EE E E  E   
   280  284 B G  T 3  S+     0   0   17 2501    0  G G GGG    GGG     GG  GGGGGGGGGG   GGGGG G GG GG GG GGG  GG G G  G   
   281  285 B A    <   +     0   0   17 2501   19  A A AAA    AAA     AA  AAAAAAAAAA   AAAAA A AA AA AA AAA  AA A A  A   
   282  286 B T  S    S+     0   0   65 2500   38  T T TTT    TTT     TT  TTTTTTTTTT   TTTTT T TT TS TT STT  TT T T  T   
   283  287 B K        -     0   0   26 2500   28  K K KKK    KKK     KK  KKKKKKKKKK   KKKKK K KK KR KK RKK  KK K K  K   
   284  288 B L  E     -M  392   0C  13 2500   40  L L LLL    LLL     LL  LLLLLLLLLL   LLLLL L LL LL LL LLL  LL L L  L   
   285  289 B I  E     -Mn 391 374C   0 2501   23  I I III    III     II  IIIIIIIIII   IIIII I II II II III  II I I  I   
   286  290 B E  E     -Mn 390 375C  15 2501   61  E E EEE    EEE     EE  EEEEEEEEEE   EEEEE E EE EE EE EEE  EE E E  E   
   287  291 B V  E     -Mn 389 376C   0 2501   30  V V VVV    VVV     VV  VVVVVVVVVV   VVVVV V VI VV VV VIV  VV V V  V   
   288  292 B E  E     -Mn 388 377C  71 2500   80  N N NNN    NNN     NN  ENNNNNNNNN   NNNEN R NS NR NN RSN  NN V Q  E   
   289  293 B V  E     +Mn 387 378C   0 2500    8  V V VVV    VVV     VV  VVVVVVVVVV   VVVVV V VV VV VV VVV  VV V V  V   
   290  294 B T  E     + n   0 379C  43 2500   81  L L LLL    LLL     LL  DLLLLLLLLL   LLLNL T LA LH LL NAL  LL S V  N   
   291  295 B G  E    S+     0   0C   9 2500   27  G G GGG    GGG     GG  GGGGGGGGGG   GGGGG G GG GG GG GGG  GG G G  G   
   292  296 B A  E     -M  385   0C   0 2500   22  A A AAA    AAA     AA  AAAAAAAAAA   AAAAA A AA AA VV AAV  VV T A  A   
   293  297 B A  S    S-     0   0   35 2499   79  K Q QQR    QQR     QQ  VQQQQQQQRQ   QQQKQ V QM QE QQ EMQ  QQ K K  K   
   294  298 B N  S  > S-     0   0   67 2499   59  A T TTT    TTT     TT  STTTTTTTTT   TTTST S TS TC TT SST  TT T S  S   
   295  299 B D  H  > S+     0   0   90 2500   82  S N NNS    NNN     NN  DNNNNNNNNN   NNNNN D ND ND NN DDN  NN D N  N   
   296  300 B Q  H  > S+     0   0  138 2501   71  E E EEE    EKE     EE  EEEEEEEEEE   EEELE E EE ED EE DEE  EE D D  L   
   297  301 B E  H  > S+     0   0   42 2501   56  E E EEE    EEE     EE  EEEEEEEEEE   EEEEE A EE ED EE DEE  EE D E  E   
   298  302 B A  H  X S+     0   0    0 2501   24  A A AAA    AAA     AA  AAAAAAAAAA   AAAAA A AA AA AA AAA  AA A A  A   
   299  303 B G  H  X S+     0   0    1 2501   78  K K KKK    KKK     KK  RKKKKKKKKK   KKKQK T KR KQ KK QRK  KK R G  Q   
   300  304 B X  H  X S+     0   0   87 2501   77  K K KKK    KKK     KK  KKKKKKKKKK   KKKIK A KM KA KK AMK  KK M I  I   
   301  305 B V  H  X S+     0   0    0 2501   41  I I III    III     II  IIIIIIIIII   IIIII I II II II III  II I I  I   
   302  306 B A  H  X S+     0   0    0 2501   24  A A AAA    AAA     AA  AAAAAAAAAA   AAAAA A AG AA AA AGA  AA A A  A   
   303  307 B K  H  X S+     0   0   43 2501   80  K K KKK    KKK     KK  KKKKKKKKKK   KKKKK K KK KK KK KKK  KK K K  K   
   304  308 B Q  H  < S+     0   0   68 2501   62  Q Q QQQ    QQQ     QQ  TQQQQQQQQQ   QQQKQ S QQ QT QQ TQQ  QQ Q T  K   
   305  309 B I  H >< S+     0   0    0 2501   16  I I III    III     II  VIIIIIIIII   IIIII I II II II III  II I I  I   
   306  310 B V  H 3< S+     0   0    0 2501   58  I V VVV    VVV     VV  VVVVVVVVVV   VVVVV V VA VI VV IAV  VV V V  V   
   307  311 B G  T 3< S+     0   0   30 2501   76  G G GGG    GGG     GG  GGGGGGGGGG   GGGGG G GG GG GG GGG  GG G G  G   
   308  312 B S    <>  -     0   0    7 2501    6  S S SSS    SSS     SS  SSSSSSSSSS   SSSSS S SS SS SS SSS  SS S S  S   
   309  313 B D  H  > S+     0   0   97 2501   61  S S SSS    SSS     SS  PSSSSSSSSS   SSSNS S SN SS SS SNS  SS N D  N   
   310  314 B L  H  > S+     0   0   98 2501    0  L L LLL    LLL     LL  LLLLLLLLLL   LLLLL L LL LL LL LLL  LL L L  L   
   311  315 B V  H  > S+     0   0    3 2501   20  V V VVV    VVV     VV  VVVVVVVVVV   VVVVV V VV VV VV VVV  VV V V  V   
   312  316 B K  H  X S+     0   0    5 2501    0  K K KKK    KKK     KK  KKKKKKKKKK   KKKKK K KK KK KK KKK  KK K K  K   
   313  317 B T  H  X S+     0   0   50 2501   33  T T TTT    TTT     TT  TTTTTTTTTT   TTTTT S TT TS TT STT  TT T T  T   
   314  318 B A  H  <>S+     0   0    4 2501    1  A A AAA    AAA     AA  AAAAAAAAAA   AAAAA A AA AA AA AAA  AA A A  A   
   315  319 B I  H ><5S+     0   0    8 2501   37  I I III    III     II  VIIIIIIIII   IIIVI V IV IV II VVI  II I V  V   
   316  320 B Y  H 3<5S+     0   0   94 2501   52  H H HHY    HHH     HH  FHHHHHHHHH   HHHYH F HY HF HH FYH  HH Y F  Y   
   317  321 B G  T 3<5S-     0   0   56 2501   19  G G GGG    GGG     GG  GGGGGGGGGG   GGGGG G GG GG GG GGG  GG G G  G   
   318  322 B A  T < 5 +     0   0    8 2501   67  E E EEE    EEE     EE  CEEEEEEEEE   EEETE A EA EA EE AAE  EE A K  T   
   319  323 B D      < -     0   0   59 2501    0  D D DDD    DDD     DD  DDDDDDDDDD   DDDDD D DD DD DD DDD  DD D D  D   
   320  324 B A        +     0   0    4 2501   36  P P PPP    PPP     PP  APPPPPPPPP   PPPAP A PA PA PP AAP  PP A G  A   
   321  325 B N    >>  +     0   0   43 2501    0  N N NNN    NNN     NN  NNNNNNNNNN   NNNNN N NN NN NN NNN  NN N N  N   
   322  326 B W  H 3> S+     0   0   68 2501   12  W W WWW    WWW     WW  WWWWWWWWWW   WWWWW W WW WW WW WWW  WW W W  W   
   323  327 B G  H 3> S+     0   0   30 2501    0  G G GGG    GGG     GG  GGGGGGGGGG   GGGGG G GG GG GG GGG  GG G G  G   
   324  328 B R  H <> S+     0   0   74 2501    0  R R RRR    RRR     RR  RRRRRRRRRR   RRRRR R RR RR RR RRR  RR R R  R   
   325  329 B I  H  X S+     0   0    3 2501   15  I I III    III     II  IIIIIIIIII   IIIII V II II II III  II I I  I   
   326  330 B I  H  X S+     0   0   41 2501   36  I I III    III     II  IIIIIIIIII   IIIII I II II II III  II I I  V   
   327  331 B C  H  X S+     0   0   73 2501   70  S S SSS    SSS     SS  ASSSSSSSSS   SSSVS A SG SA SS AGS  SS G C  V   
   328  332 B A  H  X S+     0   0    0 2501   14  S S SSS    SSS     SS  ASSSSSSSSS   SSSAS A SA SA SS AAS  SS A A  A   
   329  333 B I  H >< S+     0   0    0 2501   36  I I III    IIM     II  VIIIIIIIII   IIIII V II IV II VII  II I I  I   
   330  334 B G  H 3< S+     0   0   56 2501    0  G G GGG    GGG     GG  GGGGGGGGGG   GGGGG G GG GG GG GGG  GG G G  G   
   331  335 B Y  H 3< S+     0   0  121 2501   84  Q Q QQQ    QQQ     QQ  YQQQQQQQQQ   QQQDQ Y QQ QR QQ RQQ  QQ Q Y  D   
   332  336 B S  S << S-     0   0    8 2501   51  S S SSS    SSS     SS  SSSSSSSSSS   SSSSS A SS SA SS ASS  SS S S  S   
   333  337 B G  S    S+     0   0   71 2501   46  E E EEE    EEE     EE  GEEEEEEEEE   EEEME G EQ EG EE GQE  EE Q G  M   
   334  338 B C  S    S-     0   0   17 2074   74  V V VVV    VVV     VV  AVVVVVVVVV   VVVAV Q VA VR VV RAV  VV P C  A   
   335  339 B E        +     0   0  112 2101   68  A A VAA    VVA     VA  VAAAAAAATA   AAAAV P AK AP AA PKA  AA A T  A   
   336  340 B V        -     0   0   47 2136   41  I I III    III     II  IIIIIIIIII   IIIVI V IV IV II VVI  II I I  V   
   337  341 B N    >   -     0   0   75 2400   40  N N NNN    NNH     NS  DHHSNHSHNS   NSHTN N HN SN NN NNN  NN D S  T   
   338  342 B Q  T 3  S+     0   0  139 2402   67  P P PPP    PPP     PP  PPPPPPPPPP   PPPPP P PP PP PP PPP  PP P P  P   
   339  343 B E  T 3  S+     0   0  117 2406   66  N N NNN    NNN     NN  DNNNNNNNNN   NNNEN D NK NE NN EKN  NN S D  E   
   340  344 B T  S <  S+     0   0   30 2408   80  T T TTT    TTT     TT  KTTTTTTTTT   TTTKT T TT TT TT TTT  TT S L  K   
   341  345 B I        -     0   0    2 2413   57  I I III    III     II  IIIIIIIIII   IIIVI V IV IV II VVI  II V I  V   
   342  346 B D  E     -O  379   0C  36 2486   61  D D DDD    DDD     DD  TDDDDDDDDD   DDDED D DD DD DD DDD  DD D D  E   
   343  347 B I  E     -OP 378 351C   1 2256   47  I I III    III     II  IIIIIIIIII   IIIII I II II II III  II I I  I   
   344  348 B A  E     -OP 377 349C  15 2256   92  T T TTT    TTT     TT  KTTTTTTTTT   TTTYT H TS TA TT AST  TT A A  R   
   345  349 B I  E >  S-OP 376 348C   1 2271   51  L L LLL    LLL     LL  ILLLLLLLLL   LLLLL M LL LI LL ILL  LL I I  L   
   346  350 B G  T 3  S-     0   0   18 2279   46  Q Q QQQ    QQQ     QQ  GQQQQQQQQQ   QQQGQ G QG QG QQ GGQ  QQ G G  G   
   347  351 B P  T 3  S+     0   0  112 2284   63  S S SSS    SSS     SS  GSSSSSSSSS   SSSSS P SE SP SS PES  SS P P  G   
   348  352 B I  E <   -P  345   0C  13 2298   37  I I III    III     II  AIIIIIIIII   IIIQI I II II II III  II I Y  Q   
   349  353 B V  E     +P  344   0C  70 2306   91  V V SVN    SSA     SL  TSSLISLSAL   LLSCS T ST LP SS STS  SS V A  C   
   350  354 B T  E     +     0   0C   0 2320   24  V V VVV    VVV     VV  MVVVVVVVVV   VVVLV V VM VV VV VMV  VV M T  L   
   351  355 B L  E     -PQ 343 356C   1 2322   77  L L LLL    LLL     LL  VLLLLLLLLL   LLLFL L LL LL LL LLL  LL L L  F   
   352  356 B K  E >  S- Q   0 355C  57 2323   76  K K KKK    KKK     KK  EKKKKKKKKK   KKKKK Q KK KE KK EKK  KK K K  K   
   353  357 B Q  T 3  S-     0   0   80 2333   67  N N NNN    NNN     NN  NNNNNNNNNN   NNNNN Q NG NQ NN QGN  NN N E  N   
   354  358 B S  T 3  S+     0   0   23 2333   23  S S SSS    SSS     SS  GSSSSSSSSS   SSSNS S SS SS SS SSS  SS S S  N   
   355  359 B E  E <  S-Q  352   0C 139 2407   80  E E EEE    EEE     EE  EEEEEEEEEE   EEEEE T ET ER EE RTE  EE V E  E   
   356  360 B P  E     -Q  351   0C  86 2408   77  P P PPP    PPP     PP  PPPPPPPPPP   PPPPP P PP PP PP PPP  PP P P  P   
   357  361 B T        -     0   0   62 2178   77  Q Q QQQ    QQQ     QQ  IQQQQQQQQQ   QQQQQ V QV QV QQ VVQ  QQ L C  Q   
   358  362 B G        +     0   0   75 2233   81  M M IMM    IIM     IT  QIITMITIMT   TTIPI A IT TV TT PTT  TT A G  P   
   359  363 B F        -     0   0   34 2259    8  F F FFF    FFF     FF  FFFFFFFFFF   FFFFF F FF FF FF FFF  FF F T  F   
   360  364 B S     >  -     0   0   55 2389   69  S S SSS    SSS     SS  SSSSSSSSSS   SSSSS D SD SD SS DDS  SS S N  S   
   361  365 B E  H  > S+     0   0  119 2413   38  E E EEA    EEE     EE  EEEEEEEEEE   EEEEE E EE EE EE EEE  EE E D  E   
   362  366 B E  H  > S+     0   0   78 2369   54  E E EEE    EEE     EE  EEEEEEEEEE   EEEEE E EN ED EE DNE  EE E K  E   
   363  367 B E  H  > S+     0   0  116 2371   73  E E EEG    EEE     EE  AEEEEEEEEE   EEELE A EQ EA EE AQE  EE E A  L   
   364  368 B A  H  X S+     0   0    0 2398   72  M M MMM    MMM     MM  LMMMMMMMMM   MMMAM A MA MA MM AAM  MM A I  A   
   365  369 B T  H  X S+     0   0   43 2457   74  K K KKK    KKK     KK  IKKKKKKKKK   KKKKK L KR KL KK LRK  KK K T  K   
   366  370 B A  H  X S+     0   0   53 2477   75  K E EEK    EEK     EE  EEEEMEEEME   EEETE A EE EV EE AEE  EE E T  T   
   367  371 B Y  H  X S+     0   0   49 2483   78  K R RRK    RRK     RR  IRRRRRRRRR   RRRYR Y RY RY RR YYR  RR Y Y  Y   
   368  372 B L  H  < S+     0   0    1 2488   12  L L LLL    LLL     LL  LLLLLLLLLL   LLLLL L LL LL LL LLL  LL L M  L   
   369  373 B K  H  < S+     0   0  123 2501   76  Q Q QQQ    QQK     QQ  KQQQQQQQQQ   QQQEQ K QM QQ QQ QMQ  QQ S T  E   
   370  374 B E  H  < S+     0   0  159 1983   71  E E EEE    EEE     EE  QEEEEEVEEE   EEENE . E. E. EE ..E  EE . D  N   
   371  375 B A     <  -     0   0   15 2403   73  H D DDH    DDH     DD  HDDDHDDDHD   DDDSD G DN DG DD GND  DD . E  S   
   372  376 B D  S    S+     0   0   81 2487   20  E E EEE    EEE     EE  EEEEEEEEEE   EEEEE D ED ED EE DDE  EE n E  E   
   373  377 B P  S    S-     0   0   36  690   82  . . ...    ...     ..  ..........   ..... T .K .T .. TK.  .. a T  .   
   374  378 B V  E     -n  285   0C   0 2498   21  I I III    III     II  VIIIIIIIII   IIIVI V IV IV II VVI  II I I  V   
   375  379 B K  E     -n  286   0C 101 2499   81  M V VVI    VVM     VV  KVVVMVVVMV   VVVKV I VE VD VV DEV  VV Q V  K   
   376  380 B I  E     -nO 287 345C   1 2500   19  I I III    III     II  IIIIIIIIII   IIIII F II II II III  II I I  I   
   377  381 B S  E     -nO 288 344C  52 2500   85  D D NDD    NND     NN  FNNNDNNNDN   NNNEN H NF ND NN DFN  NN T S  E   
   378  382 B V  E     -nO 289 343C   2 2501   25  V V VVV    VVV     VV  VVVVVVVVVV   VVVVV V VV VV VV VVV  VV V V  V   
   379  383 B N  E     -nO 290 342C  45 2501   58  Y Y YYY    YYY     YY  SYYYYYYYYY   YYYRY D YD YK YY KDY  YY D N  F   
   380  384 B L        -     0   0    2 2501   11  L L LLL    LLL     LL  LLLLLLLLLL   LLLLL L LL LL LL LLL  LL L L  M   
   381  385 B H        +     0   0   85 2501   63  H H HHH    HHH     HH  EHHHHHHHHH   HHHQH H HH HH HH HHH  HH H H  Q   
   382  386 B I  S    S-     0   0   50 2495   86  L L LLL    LLL     LL  VLLLLLLLLL   LLLEL M LV LI LL IVL  LL Q V  E   
   383  387 B G  S    S-     0   0   29 2501    2  G G GGG    GGG     GG  GGGGGGGGGG   GGGGG G GG GG GG GGG  GG G G  G   
   384  388 B N  S    S+     0   0  156 2493   71  E E EEE    EEE     EE  KEEEEEEEEE   EEEDE A EK ED KK SKK  KK A T  E   
   385  389 B G  E     + M   0 292C   1 2500   64  E E EEE    EEE     EE  GEEEEEEEEE   EEEGE G EG EG EE GGE  EE G G  G   
   386  390 B T  E     +     0   0C  63 2501   77  T T TTT    TTT     TT  HTTTTTTTTT   TTTKT E TK TS TT SKT  TT K V  K   
   387  391 B G  E     - M   0 289C   8 2501   51  G G GGG    GGG     GG  GGGGGGGGGG   GGGGG S GG GA GG AGG  GG G G  G   
   388  392 B K  E     - M   0 288C  68 2501   61  S S SSS    SSS     SS  FSSSSSSSSS   SSSTS K SM ST SS TMS  SS R K  T   
   389  393 B A  E     - M   0 287C   0 2501   61  A A AAA    AAA     AA  AAAAAAAAAA   AAAAA A AA AA AA AAA  AA A A  A   
   390  394 B W  E     +lM 224 286C   4 2501   15  W W WWW    WWW     WW  WWWWWWWWWW   WWWWW W WW WW WW WWW  WW W W  W   
   391  395 B G  E     - M   0 285C   0 2501   43  G G GGG    GGG     GG  GGGGGGGGGG   GGGGG G GG GG GG GGG  GG G G  G   
   392  396 B C  E     - M   0 284C   1 2501   32  C C CCC    CCC     CC  CCCCCCCCCC   CCCCC C CC CC CC CCC  CC C C  C   
   393  397 B D        -     0   0    2 2501    0  D D DDD    DDD     DD  DDDDDDDDDD   DDDDD D DD DD DD DDD  DD D D  D   
   394  398 B L        +     0   0   32 2501    5  L L LLL    LLL     LL  LLLLLLLLLL   LLLLL L LL LL LL LLL  LL L L  L   
   395  399 B T    >>  -     0   0    9 2501   40  S S SSS    SSS     SS  TSSSSSSSSS   SSSTS T SS ST SS TSS  SS S S  T   
   396  400 B Y  H 3> S+     0   0  182 2501   65  Y Y YYY    YYY     YY  YYYYYYYYYY   YYYYY Y YY YY YY YYY  YY Y Y  Y   
   397  401 B D  H 3> S+     0   0   75 2501   36  E E EEE    EEE     EE  DEEEEEEEEE   EEEEE D ED ED EE DDE  EE D D  E   
   398  402 B Y  H <> S+     0   0   46 2501    0  Y Y YYY    YYY     YY  YYYYYYYYYY   YYYYY Y YY YY YY YYY  YY Y Y  Y   
   399  403 B V  H  X S+     0   0   88 2500    5  V V VVV    VVV     VV  VVVVVVVVVV   VVVVV V VV VV VV VVV  VV V V  V   
   400  404 B R  H  <>S+     0   0  120 2499   65  K K KKK    KKK     KK  QKKKKKKKKK   KKKKK R KK KR KK RKK  KK K R  K   
   401  405 B I  H  <5S+     0   0   59 2499   22  I I III    III     II  IIIIIIIIII   IIIII I II II II III  II I I  I   
   402  406 B N  H  <5S+     0   0   83 2499    0  N N NNN    NNN     NN  NNNNNNNNNN   NNNNN N NN NN NN NNN  NN N N  N   
   403  407 B A  T  <5S-     0   0   55 2494   31  A A AAA    AAA     AA  AAAAAAAAAA   AAAAA A AA AA AA AAA  AA A A  A   
   404  408 B G  T   5       0   0   71 2493   69  C C CCC    CCC     CC  SCCCCCCCCC   CCCSC A CS CA CC ASC  CC S G  S   
   405  409 B Y      <       0   0  219 2487    0  Y Y YYY    YYY     YY  YYYYYYYYYY   YYYYY Y YY YY YY YYY  YY Y Y  Y   
## ALIGNMENTS  211 -  280
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....2....:....3....:....4....:....5....:....6....:....7....:....8
     1    6 A E              0   0  185  269   47  QKKKKKKKKK KKKKKKKKKKKKKKKQKQ   QK  QKK KKKKKKKKKKKKKKKKKKKKKKKKK   QK
     2    7 A T        +     0   0   77  323   57  TVVVVVVVVV VVVVVVVVVVVVVVVTVT   TV  TIV VVVVVVVVVTVVVVAVVVVVVVTVV   TV
     3    8 A A  S    S-     0   0   31  329   73  AAAAAAAAAA EAAAAAEEAAAAAAAAAA   AA  AAA AAAAEAAAASAEAASAAAAAEASAA   AA
     4    9 A N        -     0   0  108  343   71  QSSSSSSSSS SSSSSSSSSSSSSSSQSQ   QS  QSS SSSSSSSSSSSSSSSSSSSSSSSSS   QS
     5   10 A V        -     0   0   30  395   54  VIIIIIIIII IIIIIIIIIIIIIIIVIV I VI IVIIIIIIIIIIIIIIIIIIIIIIIIIIII   VI
     6   11 A L  E     -A  166   0A  98  402   65  TTTTTTTTTT TTTTTTTTTTTTTTTTTT S TT STTTSTTTTTTTTTTITTTTTTTTTTTTTT   TT
     7   12 A K  E     -A  165   0A  71 1080   60  AKKKKKKKKK KKKKKKKKKKKKKKKAKA Y AK YAKKYKKKKKKKKKKKKKKKKKKKKKKKKK K VK
     8   13 A L    >   -     0   0   50 1295   43  LLLLLVLLVL LLVLLLLLLLLLVLLVLV I VL IVVLILLLLLLLLLLVLLLLLLLLLLLLLL V VL
     9   14 A E  T 3  S+     0   0  146 1310   73  AEEEEEEEEE EEEEEEEEEEEEEEEAEA A AE AAEEAEEEEEEEEEAEEEEAEEEEEEEAEE E AE
    10   15 A T  T 3  S+     0   0  126 1623   74  GNNNNDNNDN NNDNNNNNNNNNDNNDND E DN EDNNENNNNNNNNNNNNNNNNNNNNNNNNN N DN
    11   16 A G    <   +     0   0    5 1724   15  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
    12   17 A S    >   -     0   0    0 1771   60  TSSSSSSSSS SSSSSSSSSSSSSSSTST T TS TTSSTSSSSSSSSSSSSSSSSSSSSSSSSS S TS
    13   18 A V  G >  S+     0   0    1 1816   22  VIIIIIIIII IIIIIIIIIIIIIIIVIV V VI VVIIVIIIIIIIIIIIIIIIIIIIIIIIII V VI
    14   19 A T  G 3  S+     0   0   18 1819   70  VVVVVVVVVV VVVVVVVVVVVVVVVVVV V VV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV T VV
    15   20 A S  G <  S+     0   0   47 1827   71  TTTTTTTTTT TTTTTTMMTTTTTTTTTT T TT TTTTTTTTTMTTTTTTTTTTTTTTTMTTTT S TT
    16   21 A A  S X  S-     0   0    2 1861   32  PPPPPPPPPP PPPPPPPPPPPPPPPPPP P PP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPP P PP
    17   22 A K  T 3  S+     0   0  118 1867   72  KKKKKKKKKK KKKKKKKKKKKKKKKKKK K KK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKK K KK
    18   23 A G  T 3  S+     0   0   11 1876    1  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
    19   24 A F  E <   +B   40   0A   3 1879    2  FFFFFFFFFF FFFFFFFFFFFFFFFFFF F FF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF Y FF
    20   25 A S  E     -B   39   0A  27 1879   93  QSSSSSSSSS SSSSSSSSSSSSSSSQSQ K QS KQSSKSSSSSSSSSSSSSSSSSSSSSSSSS S QS
    21   26 A A  E     +BC  38 140A   0 1879   15  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
    22   27 A V  E     -B   37   0A  14 1879   71  AIIIIIIIII IIIIIIIIIIIIIIIAIA A AI AAIIAIIIIIIIIIIIIIIIIIIIIIIIII T AI
    23   28 A G  E     -B   36   0A   5 1880   10  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
    24   29 A I  E     -B   35   0A  42 1881   62  VTTTTTTTTT TTTTTTTTTTTTTTTVTV V VT VVTTVTTTTTTTTTTTTTTTTTTTTTTTTT I VT
    25   30 A H        +     0   0   90 1881   50  HAAVAAAAAA AVAAAVAAAAAAAAAHVH H HA HHTAHAAAAAAAAAAAAAAAVAAVVAAAAA Y HA
    26   31 A T        -     0   0   32 1881   71  ANINNIININ SNINNNNNNNNNINNANA A AN AAINANNNNNNNNNNINNINNINNNNNNNN A AN
    27   32 A G  S    S+     0   0   47 1883    6  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG N GG
    28   33 A V  S    S+     0   0   44 1883   24  LLLLLLLLLL LLLLLLLLLLLLLLLLLL L LL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL L LL
    29   34 A K  S    S-     0   0   29 1883   26  HKKKKKKKKK KKKKKKKKKKKKKKKRKR R RK RRKKRKKKKKKKKKKKKKKKKKKKKKKKKK R RK
    30   35 A R  S    S-     0   0  100 1883   79  HKKKKKKKKK KKKKKKKKKKKKKKKYKY Y YK YYKKYKKKKKKKKKKKKKKKKKKKKKKKKK K YK
    31   36 A K  S    S+     0   0  111 1865   68  SEEEEGEEGE EEGEEEEEEEEEGEESES V SE VSEEVEEEEEEEEEVEEEEVEEEEEEEVEE k SE
    32   37 A R  S    S-     0   0   83 1846   32  KKKKKKKKEK KKKKKKKKKKKKKKKKKK K KK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKK k KK
    33   38 A K        +     0   0   69 1851   64  KKKKKKKKKK KKKKKKRRKKKKKKKKKK K KK KKKKKKKKKRKKKKKKKKKKKKKKKRKKKK L NK
    34   39 A D        +     0   0    1 1866    0  DDDDDDDDDD DDDDDDDDDDDDDDDDDD D DD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDD D DD
    35   40 A L  E     +BD  24  79A   0 1883   24  ILLLLLLLLL LLLLLLLLLLLLLLLLLL L LL LLLLLLLLLLLLLLVLLLLVLLLLLLLVLL L LL
    36   41 A G  E     -BD  23  78A   0 1883   31  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG A GG
    37   42 A A  E     -BD  22  77A   0 1862   72  VAAAAAAAAA AAAAAAVVAAAAAAAVAV V VA VVAAVAAAAVAAAAAAAAAAAAAAAVAAAA I VA
    38   43 A I  E     -BD  21  76A   2 1877   15  IIIIIIIIII IIIIIIIIIIIIIIIIII I II IIIIIIIIIIIIIIIIIIIIIIIIIIIIII I II
    39   44 A V  E     -BD  20  75A  22 1877   61  VVIVVVIVVV VVVVVVIIVVVVVVVLVL V LV VLVVVVVVVIVVVVVVIVIVVIVVVIVVVV L LV
    40   45 A C  E     -B   19   0A   5 1878   27  CCCCCCCCCC CCCCCCCCCCCCCCCCCC C CC CCCCCCCCCCCCCCCCCCCCCCCCCCCCCC S CC
    41   46 A E  E    S+     0   0A 145 1878   53  DDDDDDDDDD DDDDDDEEDDDDDDDDDD D DD DDDDDDDDDEDDDDEDEDDEDDDDDEDEDD E DD
    42   47 A V  E    S-     0   0A  44 1882   71  VVVVVTVVTV VVVVVVVVVVVVVVVVVV V VV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV V VV
    43   48 A P  E     -     0   0A  54 1883   66  PPPPPPPPPP PPPPPPPPPPPPPPPPPP P PP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPP P PP
    44   49 A A  E     - D   0  73A   0 1883   43  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
    45   50 A S  E     -ED 240  72A   8 1883   69  SSSSSSSSSS ASSSSSSSSSSSSSSSSS S SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS S SS
    46   51 A S  E     +E  239   0A   2 1884   62  ACCCCCCCCC SCCCCCCCCCCCCCCACA C AC CACCCCCCCCCCCCCCCCCCCCCCCCCCCC C AC
    47   52 A A  E     -E  238   0A   0 1881    2  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
    48   53 A A  E     -E  237   0A   5 1882   26  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
    49   54 A V  E     -E  236   0A   1 1884   15  VVVVVVVVVV VVVVVVVVVVVVVVVVVV V VV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV V VV
    50   55 A Y  E     -E  235   0A  25 1884   26  YYYYYYYYYY YYYYYYYYYYYYYYYYYY Y YY YYYYYYYYYYYYYYYYYYYYYYYYYYYYYY Y YY
    51   56 A T  B     -K  190   0B   2 1884    0  TTTTTTTTTT TTTTTTTTTTTTTTTTTT T TT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT T TT
    52   57 A L        +     0   0   97 1884   80  QTTTTTTTTT TTTTTTTTTTTTTTTQTQ Q QT QQTTQTTTTTTTTTTTTTTTTTTTTTTTTT L QT
    53   58 A N        -     0   0   51 1884    8  SNNNNNNNNN NNNNNNNNNNNNNNNSNS N SN NSNNNNNNNNNNNNNNNNNNNNNNNNNNNN N SN
    54   59 A K  S    S+     0   0  207 1884   65  HQQQQQQQQQ QQQQQQQQQQQQQQQHQH H HQ HHQQHQQQQQQQQQQQQQQQQQQQQQQQQQ A HQ
    55   60 A V  S    S+     0   0   76 1884   48  FIIIIIIIII IIIIIIIIIIIIIIIFIF F FI FFIIFIIIIIIIIIIIIIIIIIIIIIIIII F FI
    56   61 A Q        -     0   0   72 1884   65  QQQQQQQQQQ QQQQQQQQQQQQQQQQQQ Q QQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ Q QQ
    57   62 A A    >>  -     0   0    1 1884   16  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
    58   63 A A  H >> S+     0   0   17 1883   22  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
    59   64 A P  H 3> S+     0   0    1 1884    3  PPPPPPPPPP PPPPPPPPPPPPPPPPPP P PP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPP P PP
    60   65 A L  H <> S+     0   0    0 1884   31  LLLLLLLLLL LLLLLLLLLLLLLLLLLL L LL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL L LL
    61   66 A K  H X S+     0   0    0 1884   84  SSSSSSSSSS SSSSSSSSSSSSSSSSSS S SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS S SS
    67   72 A I  H 3X S+     0   0   19 1884   32  LIIIIIIIII IIIIIIIIIIIIIIILIL I LI ILIIIIIIIIIIIIIIIIIIIIIIIIIIII I LI
    68   73 A A  H 3< S+     0   0   84 1884   72  ATTTTTTTTT GTTTTTAATTTTTTTATA A AT AATTATTTTAATTTAAATTATTTTTAAATT A AT
    69   74 A V  H << S-     0   0   89 1884   71  VATAATTATA AATAAAAAAAAATAAVAV T VA TVTATAAAAAAAAAAAAATAATAAAAAAAA K VA
    70   75 A E  H  < S-     0   0   85 1882   64  EEEEEEEEEE EEEEEEEEEEEEEEEEEE E EE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEE E EE
    71   76 A G  S  < S+     0   0    3 1263   50  QGGGGGGGGG GGGGGGGGGGGGGGGQGQ Q QG QQGGQGGGGGGGGGGGGGGGGGGGGGGGGG G QG
    72   77 A K  E     -D   45   0A  59 1702   41  KKKKKKKKKK KKKKKKKKKKKKKKKKKK K KK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKK K KK
    73   78 A L  E     -D   44   0A   0 1748   52  LLLLLLLLLL LLLLLLLLLLLLLLLLLL L LL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL L LL
    74   79 A Q  E    S+     0   0A  29 1850   30  RQQQQQQQQQ QQQQQQQQQQQQQQQQQQ Q QQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ Q QQ
    75   80 A A  E     -Df  39 113A   0 1880   17  AAAAAAAAAA VAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
    76   81 A X  E     -Df  38 114A   2 1883   28  VIIIIIIIII IIIIIIIIIIIIIIIVIV V VI VVIIVIIIIIIIIIIIIIIIIIIIIIIIII V VI
    77   82 A I  E     -Df  37 115A   0 1884   17  IIIIIIIIII LIIIIIIIIIIIIIIIII V II VIIIVIIIIILIIIVIIIIVIIIIIIIVII I II
    78   83 A V  E     -Df  36 116A   0 1884   21  VVVVVVVVVV VVVVVVVVVVVVVVVVVV V VV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV C VV
    79   84 A N  E     -Df  35 117A   1 1884    0  NNNNNNNNNN NNNNNNNNNNNNNNNNNN N NN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN N NN
    80   85 A S  E     + f   0 118A   0 1884    6  SSSSSSSSSS SSSSSSSSSSSSSSSSSS S SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS S SS
    81   86 A G  E    S+ f   0 119A  21 1884   29  SGGGGGGGGG GGGGGGGGGGGGGGGAGA A AG AAGGAGGGGGGGGGGGGGGGGGGGGGGGGG G AG
    82   87 A I  E     -Gf 118 120A   3 1884   63  CNNNNNNNNN NNNNNNNNNNNNNNNCNC C CN CCNNCNNNNNNNNNNNNNNNNNNNNNNNNN N CN
    83   88 A A        -     0   0    0 1884    0  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
    84   89 A N        +     0   0    0 1884    0  NNNNNNNNNN NNNNNNNNNNNNNNNNNN N NN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN N NN
    85   90 A A        +     0   0    0 1884   50  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
    86   91 A C  S    S+     0   0   78 1884   38  CCCCCCCCCC CCCCCCCCCCCCCCCCCC C CC CCCCCCCCCCCCCCCCCCCCCCCCCCCCCC C CC
    87   92 A T     >  -     0   0    9 1884   26  TTTTTTTTTT TTTTTTTTTTTTTTTTTT T TT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT T TT
    88   93 A G  H  >  -     0   0   56 1883    4  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
    89   94 A K  H  > S+     0   0  100 1884   77  EMMMMMMMMM MMMMMMTTMMMMMMMEME E EM EEMMEMMMMTMMMMMMMMMMMMMMMTMMMM E EM
    90   95 A R  H  > S+     0   0  137 1884   52  QKKQKKKKKK KQKKKKKKKKKKKKKQQQ R QK RQKKRKKKKKKKKKKKKKKKQKKQQKQKKK Q QK
    91   96 A G  H  X S+     0   0    0 1884    5  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
    92   97 A L  H  X S+     0   0   26 1883   55  LLLLLLLLLL LLLLLLLLLLLLLLLLLL L LL LLLLLLLLLLLLLLLLLLLLLLLLLLILLL E LL
    93   98 A D  H  X S+     0   0   83 1884   76  RQQQQQQQQQ QQQQQQQQQQQQQQQKQK K KQ KKQQKQQQQQQQQQQQQQQQQQQQQQQQQQ K RQ
    94   99 A D  H  X S+     0   0   18 1884   41  DDDDDDDDDD DDDDDDDDDDDDDDDDDD D DD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDD D DD
    95  100 A A  H  X S+     0   0    0 1884   21  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
    96  101 A Y  H  X S+     0   0   64 1884   90  YYYYYYYYYY YYYYYYYYYYYYYYYYYY Y YY YYYYYYYYYYYYYYYYYYYYYYYYYYYYYY I YY
    97  102 A T  H  X S+     0   0   59 1884   74  EEEEEEEEEE EEEEEEEEEEEEEEEEEE E EE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEE R EE
    98  103 A X  H  X S+     0   0    1 1883   59  MMMMMMMMMM MMMMMMMMMMMMMMMMMM M MM MMMMMMMMMMMMMMMMMMMMMMMMMMIMMM I MM
    99  104 A R  H  X S+     0   0   32 1884   72  RRRRRRRRRR RRRRRRRRRRRRRRRRRR R RR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRR R RR
   100  105 A A  H  X S+     0   0   21 1714   75  DAAAAAAAAA AAATTAAAAAAAAAAEAE E EA EEAAEAAAAATATTTATAATAAAAAATTAA K EA
   101  106 A V  H  X S+     0   0    9 1759   75  LLLLLLLLLL LLLLLLLLLLLLLLLLLL L LL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL E LL
   102  107 A G  H  X S+     0   0    0 1762   69  CGGGGGGGGG GGGGGGGGGGGGGGGCGC C CG CCGGCGGGGGGGGGVGGGGGGGGGGGGGGG V CG
   103  108 A A  H  X>S+     0   0    7 1763   27  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAASAAAAAAAAAAAAAA S AA
   104  109 A E  H  <5S+     0   0  111 1864   59  KEEEEEEEEE EEEEEEEEEEEEEEEKEK R KE RKEEREEEEEEEEEEEEEEEEEEEEEEEEE E KE
   105  110 A T  H  <5S+     0   0   39 1871   76  QHHHHHHHHH HHHHHHHHHHHHHHHQHQ Q QH QQHHQHHHHHHHHHHYHHHHHHHHHHHHHH K QH
   106  111 A F  H  <5S-     0   0   41 1882   16  FFFFFFFFFF FFFFFFFFFFFFFFFFFF F FF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF F FF
   107  112 A H  T  <5 +     0   0  175 1884   67  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGDGGG S GG
   108  113 A I  S      -     0   0   58 1863   72  AKKKKKKKKK KKKKKKKKKKKKKKKAKA A AK AAKKAKKKKKKKKKKKKKKKKKKKKKKKKK K AK
   110  115 A E  G >  S+     0   0   94 1870   74  PEEEEEEEEE EEEEEEEEEEEEEEELEL P LE PLEEPEEEEEEEEEEEEEEEEEEEEEEEEE E LE
   111  116 A H  G 3  S+     0   0   45 1878   61  HNNNNKNNKN NNKNNNNNNNNNKNNHNH H HN HHKNHNNNNNKNNNKNKNNKNNNNNNNKNN H HN
   112  117 A Y  G <  S+     0   0   25 1878   90  YYYYYYYYYY YYYYYYYYYYYYYYYHYH L HY LHYYLYYYYYYYYYYYYYYYYYYYYYYYYY Y HY
   113  118 A V  E <   -f   75   0A   0 1884   12  VVVVVVVVVV VVVVVVVVVVVVVVVVVV V VV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV I VV
   114  119 A A  E     -f   76   0A   0 1884   66  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
   115  120 A V  E     +f   77   0A   0 1884    7  VVVVVVVVVV VVVVVVVVVVVVVVVVVV V VV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV V VV
   116  121 A T  E     -f   78   0A   0 1884   34  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
   117  122 A S  E     -f   79   0A   0 1884    0  SSSSSSSSSS SSSSSSSSSSSSSSSSSS S SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS S SS
   118  123 A T  E     +fG  80  82A   1 1884    0  TTTTTTTTTT TTTTTTTTTTTTTTTTTT T TT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT T TT
   119  124 A G  E    S+f   81   0A  23 1884    0  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
   120  125 A V  E     -f   82   0A  80 1884   10  VVVVVVVVVV VVVVVVVVVVVVVVVVVV V VV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV V VV
   121  126 A I  S    S+     0   0   69 1884    0  IIIIIIIIII IIIIIIIIIIIIIIIIII I II IIIIIIIIIIIIIIIIIIIIIIIIIIIIII I II
   122  127 A G  S    S+     0   0   35 1884    0  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
   123  128 A E        -     0   0   93 1884   72  EVVVVVVVVV VVVVVVVVVVVVVVVEVE E EV EEVVEVVVVVVVVVVVVVVVVVVVVVVVVV E EV
   124  129 A F        -     0   0   83 1884   98  HPPPPPPPPP PPPPPPPPPPPPPPPYPY F YP FYPPFPPPPPPPPPPPPPPPPPPPPPPPPP L YP
   125  130 A L        -     0   0    5 1884    3  LLLLLLLLLL LLLLLLLLLLLLLLLLLL M LL MLLLMLLLLLLLLLLLLLLLLLLLLLLLLL M LL
   126  131 A P     >  -     0   0   50 1884   38  PPPPPPPPPP PPPPPPPPPPPPPPPPPP P PP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPP P PP
   127  132 A X  H  > S+     0   0   32 1883   28  MMMMMMMMMM MMMMMMMMMMMMMMMMMM M MM MMMMMMMMMMMMMMMMMMMMMMMMMMMMMM M MM
   128  133 A D  H  > S+     0   0  130 1884   28  EDDDDDDDDD DDDDDDDDDDDDDDDEDE E ED EEDDEDDDDDDDDDDDDDDDDDDDDDDDDD D ED
   129  134 A V  H  > S+     0   0   59 1884   74  KIIIIIIIII IIIIIIIIIIIIIIIKIK K KI KKIIKIIIIIIIIIIIIIIIIIIIIIISII K KI
   130  135 A I  H  X S+     0   0    1 1884   20  IIIIIIIIII IIIIIIIIIIIIIIIIII I II IIIIIIIIIIIIIIIIIIIIIIIIIIIIII I II
   131  136 A T  H  X S+     0   0   19 1884   80  RRRRRRRRRR RRRRRRRRRRRRRRRRRR R RR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRR S RR
   132  137 A N  H  X S+     0   0   96 1884   74  AKKKKKKKKK KKKKKKKKKKKKKKKAKA E AK EAKKEKKKKKKKKKKKKKKKKKKKKKKKKK A AK
   133  138 A G  H >X S+     0   0    6 1884   27  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
   134  139 A I  H >< S+     0   0    0 1881   58  IVIIVIIVIV IIIVVVIIVVVVIVVIII I IV IIIVIVVVVIIVVVIVIVIIIIVIIIVIVV I IV
   135  140 A R  H 3< S+     0   0  110 1884   72  EAAAAVAAVA AAVAAASSAAAAVAAEAE K EA KEVAKAAAASEAAAEVEAAEAAAAASAEAA E EA
   136  141 A Q  H << S+     0   0  115 1884   83  KTTTTTTTTT TTTTTTTTTTTTTTTKTK K KT KKTTKTTTTTSTTTSTSTTSTTTTTTSSTT Q KT
   137  142 A L    <<  -     0   0    4 1884   30  LLLLLLLLLL LLLLLLLLLLLLLLLLLL L LL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL L LL
   138  143 A K        -     0   0  131 1883   86  AIIIIIIIII IIIIIITTIIIIIIIVIV Q VI QVIIQIIIITVIIIVIVIIVIIIIITIVII S VI
   139  144 A P        -     0   0   33 1884   80  PPPPPPPPPP PPPPPPPPPPPPPPPPPP P PP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPP P PP
   140  145 A E  B     -C   21   0A 111 1884   74  GTATTAATAT ATATTTAATTTTATTGTG G GT GGATGTTTTATTTTTTTTATTATTTATTTT V GT
   141  146 A A  S    S+     0   0   71 1884   85  AKKKKKKKKK KKKKKKKKKKKKKKKAKA V AK VAKKVKKKKKKKKKKKKKKKKKKKKKKKKK P AK
   142  147 A T  S  > S-     0   0   44 1884   95  MEEEEEEEEE GEEEEEAAEEEEEEETET L TE LTEELEEEEAEEEEEEEEEEEEEEEAEEEE S TE
   143  148 A I  H  > S+     0   0   61 1883   79  IEEEEEEEEE EEEEEEVVEEEEEEEMEM P ME PMEEPEEEEVVEEEVEIEEIEEEEEVIVEE I ME
   144  149 A E  H  > S+     0   0  136  606   66  ASNSSNNSNS SSNSSSSSSSSSNSSASA E AS EANSESSSSSSSSSSSSSNSSNSSSSGSSS E AS
   145  150 A G  H  > S+     0   0    5 1067   73  NEEEEEEEEE EEEEEEEEEEEEEEEDED N DE NDEENEEEEEEEEEEEEEEEEEEEEEEEEE G DE
   146  151 A A  H  X S+     0   0    0 1305   72  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA G AA
   147  152 A H  H  X S+     0   0   73 1573   83  EYHYYHHYHY HYHYYYHHYYYYHYYEYE E EY EEHYEYYYYHHYYYHRHYHHYHYYYHHHYY D EY
   148  153 A A  H  X S+     0   0   18 1878   68  ASSSCSSSSS SSSSSCSSCCCCSSCASA A AC AASSACCSCSSSSSSSSCSSSSCSSSSSCC L AC
   149  154 A F  H  X S+     0   0    0 1883   72  FFFFFFFFFF FFFFFFFFFFFFFFFFFF F FF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF F FF
   150  155 A N  H >X S+     0   0    0 1883   75  QSSSSSSSSS SSSSSSSSSSSSSSSQSQ Q QS QQSSQSSSSSCSSSCSCSSCSSSSSSSCSS S QS
   151  156 A E  H >< S+     0   0   49 1884   54  TEEEEEEEEE EEEEEEEEEEEEEEETET T TE TTEETEEEEEEEEEEEEEEEEEEEEEEEEE K TE
   152  157 A A  H 3< S+     0   0    0 1884    2  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
   153  158 A I  H << S+     0   0    0 1884    1  IIIIIIIIII IIIIIIIIIIIIIIIIII I II IIIIIIIIIIIIIIIIIIIIIIIIIIIIII I II
   154  159 A L    <<  +     0   0    3 1884   20  LLLLLLLLLL LLLLLLLLLLLLLLLLLL L LL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL L LL
   155  160 A T  S    S-     0   0   39 1884    0  TTTTTTTTTT TTTTTTTTTTTTTTTTTT T TT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT T TT
   156  161 A T  S    S+     0   0   67 1884    0  TTTTTTTTTT TTTTTTTTTTTTTTTTTT T TT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT T TT
   157  162 A D        -     0   0    2 1884    0  DDDDDDDDDD DDDDDDDDDDDDDDDDDD D DD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDD D DD
   158  163 A T  S    S+     0   0   94 1884   47  TLLLLLLLLL LLLLLLLLLLLLLLLTLT T TL TTLLTLLLLLLLLLLLLLLLLLLLLLLLLL L TL
   159  164 A V  S    S-     0   0   80 1883   83  VIIIIIIIII IIIIIIIIIIIIIIIVIV V VI VVIIVIIIIIIIIIIIIIIIIIIIIITIII V VI
   160  165 A E        -     0   0   46 1883   74  MTTTMTTTTT TTTTTTTTTTMTTTMMTM M MT MMTTMMMTTTTTTTTTTTTTTTTTTTTTTT A MT
   161  166 A K        +     0   0    0 1883    0  KKKKKKKKKK KKKKKKKKKKKKKKKKKK K KK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKK K KK
   162  167 A H  E     + H   0 179A  28 1778   69  HEEEEEEEEE EEEEEEEEEEEEEEERER K RE KREEKEEEEEEEEEEEEEEEEEEEEEEEEE T RE
   163  168 A T  E     + H   0 178A   2 1781   59  ATTTTTTTTT TTTTTTTTTTTTTTTATA A AT AATTATTTTTTTTTTTTTTTTTTTTTTTTT T AT
   164  169 A C  E     + H   0 177A   0 1797   54  CCCCCCCCCC CCCCCCCCCCCCCCCCCC C CC CCCCCCCCCCCCCCCCCCCCCCCCCCCCCC C CC
   165  170 A Y  E     -AH   7 176A  26 1810   53  YYYYYYYYYY YYYYYYYYYYYYYYYYYY Y YY YYYYYYYYYYYYYYYYYYYYYYYYYYYYYY Y YY
   166  171 A Q  E     +AH   6 175A  61 1819   75  EEEEEEEEEE EEEEEEEEEEEEEEEQEQ Q QE QQEEQEEEEEEEEEEEEEEEEEEEEEEEEE E QE
   167  172 A T  E     - H   0 174A   5 1821   74  TMMMMMMMMM MMMMMMMMMMMMMMMTMT T TM TTMMTMMMMMMMMMMMMMMMMMMMMMMMMM I TM
   168  173 A I  E     + H   0 173A  62 1828   84  KIMIIIMIII IIIIIIIIIIIIIIITIT T TI TTIITIIIIIIIIIIIIIMIIMIIIITIII V TI
   169  174 A V  E >  S- H   0 172A   0 1798   44  VIIIIIIIII IIIIIIIIIIIIIIIVIV I VI IVIIIIIIIIIIIIIIIIIIIIIIIIIIII V VI
   170  175 A N  T 3  S-     0   0   64 1810   43  DDDDDDDDDD DDDDDDDDDDDDDDDDDD D DD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDD N DD
   171  176 A G  T 3  S+     0   0   66 1833   39  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
   172  177 A K  E <  S-H  169   0A 100 1857   49  KKKKKKKKKK KKKKKKKKKKKKKKKKKK K KK KKKKKKKKKKEKKKKKKKKKKKKKKKKKKK K KK
   173  178 A T  E     -H  168   0A  62 1870   69  TKKKKKKKKK KKKKKKKKKKKKKKKTKT T TK TTKKTKKKKKAKKKEKEKKEKKKKKKEEKK T TK
   174  179 A V  E     -H  167   0A   0 1855   31  VVVVVVVVVV VVVVVVVVVVVVVVVVVV V VV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV V VV
   175  180 A T  E     -H  166   0A   4 1868   38  IAMAAMMAMA TAMTTATTAAAAMAATAT T TA TTTATAAAATTATTTTKAMTAMAAATTTAA T TA
   176  181 A V  E     +HI 165 200A   0 1880   28  VIIIIIIIII IIIIIIIIVVIVIIIVIV I VV IVMIIIIIIIIIIIIIIIIIIIIIIIIIIV I VV
   177  182 A G  E     +HI 164 199A   0 1880   37  GAAAAAAAAA AAAAAAAAAAAAAAAGAG G GA GGAAGAAAAAAAAAAAAAAAAAAAAAAAAA A GA
   178  183 A G  E     -HI 163 198A   0 1880    3  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
   179  184 A V  E     +HI 162 197A   0 1880   73  AVVVVVVVVV VVVVVVVVVVVVVVVAVA A AV AAVVAVVVVVVVVVVVVVVVVVVVVVVVVV A AV
   180  185 A A  E     - I   0 196A   0 1880   23  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
   181  186 A K  E     + I   0 195A   0 1880    0  KKKKKKKKKK KKKKKKKKKKKKKKKKKK K KK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKK K KK
   182  187 A G        +     0   0    0 1880    0  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
   183  188 A S  S    S+     0   0    2 1880   15  SSSSSSSSSS SSSSSSSSSSSSSSSSSS S SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS S SS
   184  189 A G  S    S+     0   0    8 1880    0  GGGGGGGGGG GGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG G GG
   185  190 A X  S    S+     0   0   73 1878    0  MMMMMMMMMM MMMMMMMMMMMMMMMMMM M MM MMMMMMMMMMMMMMMMMMMMMMMMMMMMMM M MM
   186  191 A I        +     0   0    0 1879    4  IIIIIIIIII IIIIIIIIIIIIIIIIII I II IIIIIIIIIIIIIIIIIIIIIIIIIIIIII I II
   187  192 A H        -     0   0   47 1879   23  HHHHHHHHHH HHHHHHHHHHHHHHHHHH H HH HHYHHHHHHHHHHHHHQHHHHHHHHHHHHH H HH
   188  193 A P        +     0   0    0 1879    0  PPPPPPPPPP PPPPPPPPPPPPPPPPPP P PP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPP P PP
   189  194 A N        +     0   0   80 1878   12  NNNNNNNNNN NNNNNNNNNNNNNNNNNN N NN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN N NN
   190  195 A X  B      K   51   0B   2 1877    2  MMMMMMMMMM MMMMMMMMMMMMMMMMMM M MM MMMMMMMMMMMMMMMMMMMMMMMMMMMMMM M MM
   191  196 A A              0   0   68 1794    3  AAAAAAAAAA AAAAAAAAAAAAAAAAAA A AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A AA
   192      ! !              0   0    0   0     0  
   193  197 B T              0   0   13 2458    0            T                  T T  T                              T T  
   194  198 B X        -     0   0    0 2459   13            M                  M M  M                              M M  
   195  199 B L  E     -Ij 181 235A   0 2460    1            L                  L L  L                              L L  
   196  200 B S  E     -Ij 180 236A   0 2460   54            S                  G G  G                              G G  
   197  201 B F  E     -Ij 179 237A   4 2460   22            F                  F F  F                              F F  
   198  202 B V  E     -Ij 178 238A   2 2460   22            I                  V V  V                              V I  
   199  203 B T  E     +Ij 177 239A   1 2460   61            T                  T T  T                              T T  
   200  204 B T  E     -Ij 176 240A   0 2460   23            T                  T T  T                              T T  
   201  205 B D        +     0   0    1 2460    0            D                  D D  D                              D D  
   202  206 B A        -     0   0    0 2460   23            A                  A A  A                              A A  
   203  207 B N        +     0   0   56 2461   79            Y                  A C  N                              A N  
   204  208 B I        -     0   0    1 2461   20            I                  I I  I                              L I  
   205  209 B D     >  -     0   0   69 2461   67            E                  G E  E                              E G  
   206  210 B H  H  > S+     0   0   90 2461   75            H                  S E  G                              Q G  
   207  211 B G  H  > S+     0   0   44 2461   69            D                  E S  K                              D E  
   208  212 B H  H  > S+     0   0   63 2452   75            V                  E A  H                              T A  
   209  213 B L  H  X S+     0   0    0 2459   19            L                  L L  L                              L L  
   210  214 B Q  H  X S+     0   0   55 2461   45            Q                  T Q  Q                              A Q  
   211  215 B G  H  X S+     0   0   45 2461   78            T                  Q R  Q                              G A  
   212  216 B A  H  X S+     0   0    3 2461   61            A                  L A  L                              L L  
   213  217 B L  H  X S+     0   0    0 2461   19            L                  L L  L                              L L  
   214  218 B S  H  X S+     0   0   44 2461   66            S                  R R  G                              R R  
   215  219 B A  H  X S+     0   0   43 2461   81            Q                  R E  E                              T Q  
   216  220 B I  H >X S+     0   0    0 2462   71            I                  A I  A                              V A  
   217  221 B T  H ><>S+     0   0    1 2464   57            T                  T T  T                              T T  
   218  222 B N  H 3<5S+     0   0   93 2464   50            N                  D D  D                              N D  
   219  223 B E  H <<5S+     0   0   67 2464   80            H                  L V  S                              K V  
   220  224 B T  T X<5S+     0   0    1 2464   41            T                  T S  T                              T T  
   221  225 B F  G > 5S+     0   0    0 2498    1            F                  F F  F                              F F  
   222  226 B N  G 3    +     0   0    9 2501   19            G                  G G  G                              G G  
   243  247 B L  T 3   +     0   0   43 2466   86            L                  L C  L                              M L  
   244  248 B A  T 3  S-     0   0    7 2499   54            S                  A A  A                              A A  
   245  249 B E    <   +     0   0  122 2500   62            E                  G G  G                              G G  
   246  250 B N        -     0   0    3 2500   80            T                  N N  G                              N N  
   247  251 B E  S    S-     0   0   78 1841   73            K                  K E  E                              E A  
   248  252 B T        -     0   0   66 1873   86            P                  A R  A                              P E  
   249  253 B L        +     0   0    0 2304   26            I                  L L  L                              F L  
   250  254 B T    >   -     0   0   30 2310   71            N                  T H  Q                              T A  
   251  255 B P  T 3  S+     0   0   66 2323   74            M                  P E  P                              E P  
   252  256 B E  T 3  S+     0   0  153 2007   67            E                  A E  G                              Q D  
   253  257 B H  S X  S-     0   0   20 2163   66            H                  H H  Q                              H H  
   254  258 B P  T 3  S+     0   0   96 2215   68            T                  A E  A                              E P  
   255  259 B D  T >> S+     0   0   24 2226   74            D                  G D  D                              A D  
   256  260 B W  H <> S+     0   0   37 2250   59            W                  W W  W                              W W  
   257  261 B A  H 3> S+     0   0   30 2350   67            E                  D P  E                              P S  
   258  262 B N  H <> S+     0   0    0 2364   79            T                  A V  D                              A K  
   259  263 B F  H  X S+     0   0    0 2473   18            F                  F F  F                              F F  
   260  264 B Y  H  X S+     0   0   49 2473   88            I                  A K  A                              A A  
   261  265 B K  H  X S+     0   0   51 2476   72            F                  A K  A                              A A  
   262  266 B A  H  X S+     0   0    0 2493   51            A                  G G  A                              A A  
   263  267 B L  H  X S+     0   0    0 2499   19            L                  L L  F                              F F  
   264  268 B Q  H  X S+     0   0   43 2499   87            Q                  R Q  R                              Q T  
   265  269 B L  H  X S+     0   0   44 2499   93            K                  Y L  Y                              Y H  
   266  270 B A  H  X S+     0   0    0 2499   31            V                  V V  V                              V V  
   267  271 B C  H  X S+     0   0    0 2499   81            C                  C C  S                              C C  
   268  272 B E  H  X S+     0   0   38 2499   85            E                  E T  E                              E E  
   269  273 B D  H  X S+     0   0   25 2499   79            D                  V D  H                              Q V  
   270  274 B L  H  X S+     0   0    0 2499    5            L                  L L  L                              L L  
   271  275 B A  H  X S+     0   0    0 2499   16            A                  A A  A                              A A  
   272  276 B K  H  X S+     0   0   61 2500   62            K                  K K  K                              K K  
   273  277 B Q  H  X S+     0   0   51 2500   79            K                  A Q  A                              A A  
   274  278 B I  H  < S+     0   0    0 2501   20            I                  I I  I                              I I  
   275  279 B A  H >< S+     0   0    0 2501   51            A                  A A  A                              A A  
   276  280 B R  H 3< S+     0   0   92 2501   58            Q                  R R  R                              R R  
   277  281 B D  T 3< S+     0   0   13 2501    0            D                  D D  D                              D D  
   278  282 B G  S X  S-     0   0    2 2501    8            G                  G G  G                              G G  
   279  283 B E  T 3  S-     0   0    9 2501    0            E                  E E  E                              E E  
   280  284 B G  T 3  S+     0   0   17 2501    0            G                  G G  G                              G G  
   281  285 B A    <   +     0   0   17 2501   19            A                  A A  A                              A A  
   282  286 B T  S    S+     0   0   65 2500   38            T                  T T  T                              T T  
   283  287 B K        -     0   0   26 2500   28            K                  K K  K                              K K  
   284  288 B L  E     -M  392   0C  13 2500   40            L                  L L  L                              L L  
   285  289 B I  E     -Mn 391 374C   0 2501   23            I                  V I  I                              I I  
   286  290 B E  E     -Mn 390 375C  15 2501   61            E                  E E  E                              E E  
   287  291 B V  E     -Mn 389 376C   0 2501   30            V                  V V  V                              V A  
   288  292 B E  E     -Mn 388 377C  71 2500   80            N                  Q E  N                              R C  
   289  293 B V  E     +Mn 387 378C   0 2500    8            V                  V V  V                              V I  
   290  294 B T  E     + n   0 379C  43 2500   81            Q                  R N  H                              S A  
   291  295 B G  E    S+     0   0C   9 2500   27            G                  G G  G                              G G  
   292  296 B A  E     -M  385   0C   0 2500   22            T                  A A  A                              A A  
   293  297 B A  S    S-     0   0   35 2499   79            K                  V K  A                              L A  
   294  298 B N  S  > S-     0   0   67 2499   59            T                  S S  S                              S S  
   295  299 B D  H  > S+     0   0   90 2500   82            S                  D N  Q                              D D  
   296  300 B Q  H  > S+     0   0  138 2501   71            E                  D L  E                              E D  
   297  301 B E  H  > S+     0   0   42 2501   56            E                  A E  A                              S D  
   298  302 B A  H  X S+     0   0    0 2501   24            A                  A A  A                              A A  
   299  303 B G  H  X S+     0   0    1 2501   78            K                  Q Q  R                              S R  
   300  304 B X  H  X S+     0   0   87 2501   77            R                  A I  A                              A A  
   301  305 B V  H  X S+     0   0    0 2501   41            I                  I I  I                              I I  
   302  306 B A  H  X S+     0   0    0 2501   24            A                  A A  A                              A A  
   303  307 B K  H  X S+     0   0   43 2501   80            K                  K K  K                              K K  
   304  308 B Q  H  < S+     0   0   68 2501   62            Q                  T K  T                              S T  
   305  309 B I  H >< S+     0   0    0 2501   16            I                  V I  V                              I V  
   306  310 B V  H 3< S+     0   0    0 2501   58            V                  I V  V                              V I  
   307  311 B G  T 3< S+     0   0   30 2501   76            G                  G G  G                              G G  
   308  312 B S    <>  -     0   0    7 2501    6            S                  S S  S                              S S  
   309  313