Complet list of 1fdh hssp fileClick here to see the 3D structure Complete list of 1fdh.hssp file
HSSP       HOMOLOGY DERIVED SECONDARY STRUCTURE OF PROTEINS , VERSION 2.0 2011
PDBID      1FDH
THRESHOLD  according to: t(L)=(290.15 * L ** -0.562) + 5
REFERENCE  Sander C., Schneider R. : Database of homology-derived protein structures. Proteins, 9:56-68 (1991).
CONTACT    Maintained at http://www.cmbi.ru.nl/ by Maarten L. Hekkelman 
DATE       file generated on 2013-08-23
HEADER     OXYGEN TRANSPORT                        1976-08-19 1FDH
COMPND     HEMOGLOBIN F (DEOXY) (ALPHA CHAIN); HEMOGLOBIN F (DEOXY) (GAMMA CHAIN)
SOURCE     Homo sapiens; Homo sapiens
AUTHOR     Frierjunior, J.A.
SEQLENGTH   287
NCHAIN        4 chain(s) in 1FDH data set
KCHAIN        2 chain(s) used here ; chains(s) : A, B
NALIGN     3992
NOTATION : ID: EMBL/SWISSPROT identifier of the aligned (homologous) protein
NOTATION : STRID: if the 3-D structure of the aligned protein is known, then STRID is the Protein Data Bank identifier as taken
NOTATION : from the database reference or DR-line of the EMBL/SWISSPROT entry
NOTATION : %IDE: percentage of residue identity of the alignment
NOTATION : %SIM (%WSIM):  (weighted) similarity of the alignment
NOTATION : IFIR/ILAS: first and last residue of the alignment in the test sequence
NOTATION : JFIR/JLAS: first and last residue of the alignment in the alignend protein
NOTATION : LALI: length of the alignment excluding insertions and deletions
NOTATION : NGAP: number of insertions and deletions in the alignment
NOTATION : LGAP: total length of all insertions and deletions
NOTATION : LSEQ2: length of the entire sequence of the aligned protein
NOTATION : ACCNUM: SwissProt accession number
NOTATION : PROTEIN: one-line description of aligned protein
NOTATION : SeqNo,PDBNo,AA,STRUCTURE,BP1,BP2,ACC: sequential and PDB residue numbers, amino acid (lower case = Cys), secondary
NOTATION : structure, bridge partners, solvent exposure as in DSSP (Kabsch and Sander, Biopolymers 22, 2577-2637(1983)
NOTATION : VAR: sequence variability on a scale of 0-100 as derived from the NALIGN alignments
NOTATION : pair of lower case characters (AvaK) in the alignend sequence bracket a point of insertion in this sequence
NOTATION : dots (....) in the alignend sequence indicate points of deletion in this sequence
NOTATION : SEQUENCE PROFILE: relative frequency of an amino acid type at each position. Asx and Glx are in their
NOTATION : acid/amide form in proportion to their database frequencies
NOTATION : NOCC: number of aligned sequences spanning this position (including the test sequence)
NOTATION : NDEL: number of sequences with a deletion in the test protein at this position
NOTATION : NINS: number of sequences with an insertion in the test protein at this position
NOTATION : ENTROPY: entropy measure of sequence variability at this position
NOTATION : RELENT: relative entropy, i.e.  entropy normalized to the range 0-100
NOTATION : WEIGHT: conservation weight

## PROTEINS : identifier and alignment statistics
  NR.    ID         STRID   %IDE %WSIM IFIR ILAS JFIR JLAS LALI NGAP LGAP LSEQ2 ACCNUM     PROTEIN
    1 : D1MGQ2_HUMAN        1.00  1.00    1  141    2  142  141    0    0  142  D1MGQ2     Alpha-2 globin chain OS=Homo sapiens GN=HBA2 PE=2 SV=1
    2 : D9YZU9_HUMAN        1.00  1.00  143  288    2  147  146    0    0  147  D9YZU9     Hemoglobin, gamma G OS=Homo sapiens GN=HBG2 PE=2 SV=1
    3 : E9PBW4_HUMAN        1.00  1.00  175  288   24  137  114    0    0  137  E9PBW4     Hemoglobin subunit gamma-2 OS=Homo sapiens GN=HBG2 PE=2 SV=1
    4 : HBA_HUMAN   1Z8U    1.00  1.00    1  141    2  142  141    0    0  142  P69905     Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2
    5 : HBA_PANPA           1.00  1.00    1  141    2  142  141    0    0  142  P69906     Hemoglobin subunit alpha OS=Pan paniscus GN=HBA1 PE=1 SV=2
    6 : HBA_PANTR           1.00  1.00    1  141    2  142  141    0    0  142  P69907     Hemoglobin subunit alpha OS=Pan troglodytes GN=HBA1 PE=1 SV=2
    7 : HBG2_GORGO          1.00  1.00  143  288    2  147  146    0    0  147  P62742     Hemoglobin subunit gamma-2 OS=Gorilla gorilla gorilla GN=HBG2 PE=2 SV=2
    8 : HBG2_HUMAN  1FDH    1.00  1.00  143  288    2  147  146    0    0  147  P69892     Hemoglobin subunit gamma-2 OS=Homo sapiens GN=HBG2 PE=1 SV=2
    9 : HBG2_PANTR          1.00  1.00  143  288    2  147  146    0    0  147  P61921     Hemoglobin subunit gamma-2 OS=Pan troglodytes GN=HBG2 PE=1 SV=2
   10 : Q14474_HUMAN        1.00  1.00  143  264    2  123  122    0    0  123  Q14474     A-gamma-hemoglobin gene from Greek HPFH mutant, . (Fragment) OS=Homo sapiens PE=2 SV=1
   11 : Q5R9M5_PONAB        1.00  1.00    1  141    2  142  141    0    0  142  Q5R9M5     Putative uncharacterized protein DKFZp468J1717 OS=Pongo abelii GN=DKFZp468J1717 PE=2 SV=1
   12 : Q9UNL6_HUMAN        1.00  1.00  160  288    1  129  129    0    0  129  Q9UNL6     Hemoglobin gamma-G (Fragment) OS=Homo sapiens GN=HBG2 PE=2 SV=1
   13 : D3GKD8_HUMAN        0.99  1.00  143  288    2  147  146    0    0  147  D3GKD8     A-gamma globin Osilo variant OS=Homo sapiens GN=HBG1 PE=3 SV=1
   14 : D3GKD9_HUMAN        0.99  0.99  143  288    2  147  146    0    0  147  D3GKD9     G-gamma globin Paulinia variant OS=Homo sapiens GN=HBG2 PE=3 SV=1
   15 : D9YZU8_HUMAN        0.99  0.99  143  288    2  147  146    0    0  147  D9YZU8     Hemoglobin, gamma A OS=Homo sapiens GN=HBG1 PE=2 SV=1
   16 : E7CYP2_HUMAN        0.99  0.99  143  288    2  147  146    0    0  147  E7CYP2     G gamma globin chain OS=Homo sapiens GN=HBG2 PE=3 SV=1
   17 : H2NPI7_PONAB        0.99  1.00    1  141    2  142  141    0    0  142  H2NPI7     Uncharacterized protein OS=Pongo abelii GN=HBA2 PE=3 SV=1
   18 : H2R5L8_PANTR        0.99  1.00  143  288    2  147  146    0    0  147  H2R5L8     Hemoglobin subunit gamma-2 OS=Pan troglodytes GN=HBG2 PE=3 SV=1
   19 : H2R5L9_PANTR        0.99  1.00  143  288    2  147  146    0    0  147  H2R5L9     Hemoglobin subunit gamma-2 OS=Pan troglodytes GN=HBG2 PE=3 SV=1
   20 : HBA1_HYLLA          0.99  0.99    1  141    2  142  141    0    0  142  Q9TS35     Hemoglobin subunit alpha-1 OS=Hylobates lar GN=HBA1 PE=2 SV=2
   21 : HBA_GORGO           0.99  1.00    1  141    1  141  141    0    0  141  P01923     Hemoglobin subunit alpha OS=Gorilla gorilla gorilla GN=HBA PE=1 SV=1
   22 : HBG1_HUMAN  1I3D    0.99  1.00  143  288    2  147  146    0    0  147  P69891     Hemoglobin subunit gamma-1 OS=Homo sapiens GN=HBG1 PE=1 SV=2
   23 : HBG1_PANPA          0.99  1.00  143  288    2  147  146    0    0  147  Q28779     Hemoglobin subunit gamma-1 OS=Pan paniscus GN=HBG1 PE=2 SV=3
   24 : HBG1_PANTR          0.99  1.00  143  288    2  147  146    0    0  147  P61920     Hemoglobin subunit gamma-1 OS=Pan troglodytes GN=HBG1 PE=1 SV=2
   25 : HBG1_PONPY          0.99  1.00  143  288    2  147  146    0    0  147  P18995     Hemoglobin subunit gamma-1 OS=Pongo pygmaeus GN=HBG1 PE=2 SV=2
   26 : I1VZV6_HUMAN        0.99  1.00    1  141    2  142  141    0    0  142  I1VZV6     Hemoglobin alpha 1 OS=Homo sapiens GN=HBA1 PE=3 SV=1
   27 : A9L8Y0_PAPAN        0.98  1.00  143  288    2  147  146    0    0  147  A9L8Y0     Hemoglobin subunit gamma (Predicted) OS=Papio anubis GN=HBG2_2 PE=3 SV=1
   28 : F7HAW8_MACMU        0.98  0.99  143  276    2  135  134    0    0  158  F7HAW8     Uncharacterized protein OS=Macaca mulatta GN=HBG2 PE=2 SV=1
   29 : G1R963_NOMLE        0.98  0.99    1  141    2  142  141    0    0  142  G1R963     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100583507 PE=3 SV=1
   30 : H2NED8_PONAB        0.98  1.00  143  288    2  147  146    0    0  147  H2NED8     Uncharacterized protein OS=Pongo abelii GN=LOC100438895 PE=3 SV=1
   31 : HBA_PONPY           0.98  1.00    1  141    2  142  141    0    0  142  P06635     Hemoglobin subunit alpha OS=Pongo pygmaeus GN=HBA1 PE=2 SV=2
   32 : HBA_SEMEN           0.98  1.00    1  141    1  141  141    0    0  141  P01924     Hemoglobin subunit alpha OS=Semnopithecus entellus GN=HBA PE=1 SV=1
   33 : HBG1_GORGO          0.98  1.00  143  288    2  147  146    0    0  147  P62741     Hemoglobin subunit gamma-1 OS=Gorilla gorilla gorilla GN=HBG1 PE=2 SV=2
   34 : HBG_MACFU           0.98  1.00  143  288    2  147  146    0    0  147  P68078     Hemoglobin subunit gamma OS=Macaca fuscata fuscata GN=HBG PE=1 SV=2
   35 : HBG_MACMU           0.98  1.00  143  288    2  147  146    0    0  147  P68077     Hemoglobin subunit gamma OS=Macaca mulatta GN=HBG PE=1 SV=2
   36 : HBG_PAPCY           0.98  1.00  143  288    2  147  146    0    0  147  P68079     Hemoglobin subunit gamma OS=Papio cynocephalus GN=HBG PE=1 SV=2
   37 : Q14403_HUMAN        0.98  0.98  149  278    1  130  130    0    0  155  Q14403     Gamma-G globin (Fragment) OS=Homo sapiens PE=2 SV=1
   38 : A9L8X9_PAPAN        0.97  1.00  143  288    2  147  146    0    0  147  A9L8X9     Hemoglobin subunit gamma-1 (Predicted) OS=Papio anubis GN=HBG2_1 PE=3 SV=1
   39 : B0VX78_CALJA        0.97  0.99    1  141    2  142  141    0    0  142  B0VX78     Theta 1 globin (Predicted) OS=Callithrix jacchus GN=HBQ1_1 PE=3 SV=1
   40 : G1S6C7_NOMLE        0.97  1.00  143  288    2  147  146    0    0  147  G1S6C7     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100581638 PE=3 SV=1
   41 : G7PQY2_MACFA        0.97  0.99  143  288    2  147  146    0    0  147  G7PQY2     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_05959 PE=3 SV=1
   42 : G7Q017_MACFA        0.97  0.99    1  141    2  142  141    0    0  142  G7Q017     Hemoglobin alpha chain OS=Macaca fascicularis GN=EGM_11265 PE=3 SV=1
   43 : H2NED9_PONAB        0.97  1.00  143  288    2  147  146    0    0  147  H2NED9     Uncharacterized protein OS=Pongo abelii GN=LOC100439631 PE=3 SV=1
   44 : H2RB13_PANTR        0.97  0.99  175  288    1  114  114    0    0  114  H2RB13     Hemoglobin subunit gamma-2 (Fragment) OS=Pan troglodytes GN=HBG2 PE=3 SV=1
   45 : HBA_CALAR           0.97  0.99    1  141    1  141  141    0    0  141  P18972     Hemoglobin subunit alpha OS=Callithrix argentata GN=HBA PE=1 SV=1
   46 : HBA_MACAS           0.97  0.99    1  141    1  141  141    0    0  141  P21766     Hemoglobin subunit alpha-1/2/3 OS=Macaca assamensis PE=1 SV=1
   47 : HBA_MACFA           0.97  0.99    1  141    1  141  141    0    0  141  P21767     Hemoglobin subunit alpha-A/Q/R/T OS=Macaca fascicularis PE=1 SV=1
   48 : HBA_MACFU           0.97  0.99    1  141    2  142  141    0    0  142  P63107     Hemoglobin subunit alpha OS=Macaca fuscata fuscata GN=HBA PE=1 SV=2
   49 : HBA_MACMU           0.97  0.99    1  141    2  142  141    0    0  142  P63108     Hemoglobin subunit alpha OS=Macaca mulatta GN=HBA PE=1 SV=2
   50 : HBG1_HYLLA          0.97  1.00  143  288    2  147  146    0    0  147  P61947     Hemoglobin subunit gamma-1 OS=Hylobates lar GN=HBG1 PE=2 SV=2
   51 : HBG2_HYLLA          0.97  0.99  143  288    2  147  146    0    0  147  P61948     Hemoglobin subunit gamma-2 OS=Hylobates lar GN=HBG2 PE=2 SV=2
   52 : HBG2_PONPY          0.97  1.00  143  288    2  147  146    0    0  147  P18996     Hemoglobin subunit gamma-2 OS=Pongo pygmaeus GN=HBG2 PE=2 SV=3
   53 : HBG_MACNE           0.97  1.00  143  288    1  146  146    0    0  146  P02097     Hemoglobin subunit gamma OS=Macaca nemestrina GN=HBG PE=1 SV=1
   54 : I2CVH9_MACMU        0.97  0.99    1  141    2  142  141    0    0  142  I2CVH9     Hemoglobin subunit alpha OS=Macaca mulatta GN=HBA1 PE=2 SV=1
   55 : Q03903_MACMU        0.97  0.99  143  288    2  147  146    0    0  147  Q03903     Gamma-globin OS=Macaca mulatta GN=HBG2 PE=2 SV=1
   56 : B1MT35_CALMO        0.96  0.99    1  141    2  142  141    0    0  142  B1MT35     Alpha 2 globin variant (Predicted) OS=Callicebus moloch GN=HBQ1_1 PE=3 SV=1
   57 : G7NQC3_MACMU        0.96  0.99    1  141    2  142  141    0    0  142  G7NQC3     Hemoglobin alpha chain OS=Macaca mulatta GN=HBA2 PE=2 SV=1
   58 : HBA2_HYLLA          0.96  0.99    1  141    2  142  141    0    0  142  Q9TS34     Hemoglobin subunit alpha-2 OS=Hylobates lar GN=HBA2 PE=2 SV=2
   59 : HBA_ATEGE           0.96  0.99    1  141    2  142  141    0    0  142  P67817     Hemoglobin subunit alpha OS=Ateles geoffroyi GN=HBA PE=1 SV=2
   60 : HBA_CEBAP           0.96  0.99    1  141    2  142  141    0    0  142  P01928     Hemoglobin subunit alpha OS=Cebus apella GN=HBA PE=1 SV=2
   61 : HBA_CEBCA           0.96  0.99    1  141    1  141  141    0    0  141  P07421     Hemoglobin subunit alpha OS=Cebus capucinus GN=HBA PE=1 SV=1
   62 : HBA_CHLAE           0.96  0.99    1  141    2  142  141    0    0  142  P01926     Hemoglobin subunit alpha OS=Chlorocebus aethiops GN=HBA PE=1 SV=2
   63 : HBA_MACNE           0.96  0.99    1  141    1  141  141    0    0  141  P19002     Hemoglobin subunit alpha-1/2/3 OS=Macaca nemestrina PE=1 SV=1
   64 : HBA_MACSI           0.96  0.99    1  141    1  141  141    0    0  141  P21768     Hemoglobin subunit alpha-1/2 OS=Macaca sinica PE=1 SV=1
   65 : HBA_MACSP           0.96  0.99    1  141    1  141  141    0    0  141  P07402     Hemoglobin subunit alpha-1/2 OS=Macaca speciosa PE=1 SV=1
   66 : HBA_SAGFU           0.96  0.99    1  141    1  141  141    0    0  141  P01929     Hemoglobin subunit alpha OS=Saguinus fuscicollis GN=HBA PE=1 SV=1
   67 : HBA_SAGMY           0.96  0.99    1  141    1  141  141    0    0  141  Q7M3B6     Hemoglobin subunit alpha OS=Saguinus mystax GN=HBA PE=1 SV=1
   68 : HBA_SAGOE           0.96  0.99    1  141    1  141  141    0    0  141  P67818     Hemoglobin subunit alpha OS=Saguinus oedipus GN=HBA PE=1 SV=1
   69 : Q3LRX5_PONPY        0.96  0.97    1  141    2  142  141    0    0  142  Q3LRX5     Alpha globin a3 OS=Pongo pygmaeus PE=3 SV=1
   70 : HBA_PILBA           0.95  0.98    1  141    2  142  141    0    0  142  P01930     Hemoglobin subunit alpha OS=Piliocolobus badius GN=HBA PE=1 SV=2
   71 : HBA_MANSP           0.94  0.97    1  141    1  141  141    0    0  141  P08258     Hemoglobin subunit alpha-1/2 OS=Mandrillus sphinx PE=1 SV=1
   72 : HBA_NYCCO           0.94  0.98    1  141    1  141  141    0    0  141  P01937     Hemoglobin subunit alpha OS=Nycticebus coucang GN=HBA PE=1 SV=1
   73 : HBA_CERAT           0.93  0.96    1  141    1  141  141    0    0  141  P01933     Hemoglobin subunit alpha OS=Cercocebus atys GN=HBA PE=1 SV=1
   74 : HBA_LORTA           0.93  0.97    1  141    1  141  141    0    0  141  P01938     Hemoglobin subunit alpha OS=Loris tardigradus GN=HBA PE=1 SV=2
   75 : A9L8T9_PAPAN        0.92  0.95    1  141    2  142  141    0    0  142  A9L8T9     Hemoglobin, alpha 1 (Predicted) OS=Papio anubis GN=HBA1 PE=3 SV=1
   76 : HBA1_OTOCR          0.92  0.96    1  141    2  142  141    0    0  142  P14259     Hemoglobin subunit alpha-A OS=Otolemur crassicaudatus GN=HBAA PE=2 SV=2
   77 : HBA2_OTOCR          0.92  0.96    1  141    2  142  141    0    0  142  P01939     Hemoglobin subunit alpha-B OS=Otolemur crassicaudatus GN=HBAB PE=1 SV=3
   78 : HBA_PAPAN           0.92  0.95    1  141    2  142  141    0    0  142  P63111     Hemoglobin subunit alpha OS=Papio anubis GN=HBA PE=2 SV=2
   79 : HBA_PAPCY           0.92  0.95    1  141    2  142  141    0    0  142  P63112     Hemoglobin subunit alpha OS=Papio cynocephalus GN=HBA PE=1 SV=2
   80 : B4USK2_OTOGA        0.91  0.98    1  141    2  142  141    0    0  142  B4USK2     Theta 1 globin (Predicted) OS=Otolemur garnettii GN=HBQ1 PE=3 SV=1
   81 : HBA_MARMA           0.91  0.97    1  141    1  141  141    0    0  141  P08852     Hemoglobin subunit alpha OS=Marmota marmota marmota GN=HBA PE=1 SV=1
   82 : HBA_MYOVE           0.91  0.96    1  141    1  141  141    0    0  141  P11757     Hemoglobin subunit alpha OS=Myotis velifer GN=HBA PE=1 SV=1
   83 : HBA_SPEPA           0.91  0.96    1  141    1  141  141    0    0  141  P11750     Hemoglobin subunit alpha OS=Spermophilus parryii GN=HBA PE=1 SV=2
   84 : HBA_TARBA           0.91  0.98    1  141    1  141  141    0    0  141  P01940     Hemoglobin subunit alpha OS=Tarsius bancanus GN=HBA PE=1 SV=1
   85 : HBA_THEGE           0.91  0.94    1  141    1  141  141    0    0  141  P01932     Hemoglobin subunit alpha OS=Theropithecus gelada GN=HBA PE=1 SV=1
   86 : B1MT80_CALMO        0.90  0.97  143  288    2  147  146    0    0  147  B1MT80     G-gamma globin (Predicted) OS=Callicebus moloch GN=HBG2_1 PE=3 SV=1
   87 : B6CWH8_ROULE        0.90  0.98    1  141    2  142  141    0    0  142  B6CWH8     Hemoglobin alpha chain OS=Rousettus leschenaultii GN=HBA PE=2 SV=1
   88 : B6CWH9_TAPME        0.90  0.96    1  141    2  142  141    0    0  142  B6CWH9     Hemoglobin alpha chain OS=Taphozous melanopogon GN=HBA PE=2 SV=1
   89 : G1Q6N1_MYOLU        0.90  0.95    1  141    2  142  141    0    0  142  G1Q6N1     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
   90 : G3S489_GORGO        0.90  0.95    1  141    2  142  141    0    0  142  G3S489     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
   91 : G3SF30_GORGO        0.90  0.93    1  141    2  145  144    1    3  145  G3SF30     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
   92 : HBA_ANTPA           0.90  0.96    1  141    2  142  141    0    0  142  P14387     Hemoglobin subunit alpha OS=Antrozous pallidus GN=HBA PE=1 SV=2
   93 : HBA_CYNSP           0.90  0.98    1  141    1  141  141    0    0  141  P11753     Hemoglobin subunit alpha OS=Cynopterus sphinx GN=HBA PE=1 SV=1
   94 : HBA_ROUAE           0.90  0.98    1  141    1  141  141    0    0  141  P01956     Hemoglobin subunit alpha OS=Rousettus aegyptiacus GN=HBA PE=1 SV=1
   95 : HBA_SPEBE           0.90  0.97    1  141    1  141  141    0    0  141  B3EWC9     Hemoglobin subunit alpha OS=Spermophilus beecheyi PE=1 SV=1
   96 : HBA_SPECI           0.90  0.95    1  141    1  141  141    0    0  141  P09420     Hemoglobin subunit alpha OS=Spermophilus citellus GN=HBA PE=1 SV=1
   97 : HBA_SPETO           0.90  0.96    1  141    1  141  141    0    0  141  P07403     Hemoglobin subunit alpha OS=Spermophilus townsendii GN=HBA PE=1 SV=1
   98 : HBA_TAMMR           0.90  0.97    1  141    1  141  141    0    0  141  B3EWC7     Hemoglobin subunit alpha OS=Tamias merriami PE=1 SV=1
   99 : HBA_TAPGE           0.90  0.96    1  141    1  141  141    0    0  141  P28780     Hemoglobin subunit alpha OS=Taphozous georgianus GN=HBA PE=1 SV=1
  100 : HBG2_CEBAL          0.90  0.98  143  288    2  147  146    0    0  147  P68258     Hemoglobin subunit gamma-2 OS=Cebus albifrons GN=HBG2 PE=2 SV=2
  101 : HBG2_CEBAP          0.90  0.98  143  288    2  147  146    0    0  147  P68257     Hemoglobin subunit gamma-2 OS=Cebus apella GN=HBG2 PE=2 SV=2
  102 : HBG_ATEGE           0.90  0.97  143  288    2  147  146    0    0  147  P68068     Hemoglobin subunit gamma OS=Ateles geoffroyi GN=HBG PE=2 SV=2
  103 : HBG_ATEPA           0.90  0.97  143  288    2  147  146    0    0  147  P68069     Hemoglobin subunit gamma OS=Ateles paniscus GN=HBG PE=2 SV=2
  104 : HBG_BRAAR           0.90  0.97  143  288    2  147  146    0    0  147  P68071     Hemoglobin subunit gamma OS=Brachyteles arachnoides GN=HBG PE=2 SV=2
  105 : HBG_LAGLA           0.90  0.97  143  288    2  147  146    0    0  147  P68070     Hemoglobin subunit gamma OS=Lagothrix lagotricha GN=HBG PE=2 SV=2
  106 : B0VXB5_CALJA        0.89  0.98  143  288    2  147  146    0    0  147  B0VXB5     G-gamma globin (Predicted) OS=Callithrix jacchus GN=HBG2_1 PE=3 SV=1
  107 : B6CWH3_CYNSP        0.89  0.98    1  141    2  142  141    0    0  142  B6CWH3     Hemoglobin alpha chain OS=Cynopterus sphinx GN=HBA PE=2 SV=1
  108 : B6CWH5_9CHIR        0.89  0.98    1  141    2  142  141    0    0  142  B6CWH5     Hemoglobin alpha chain OS=Hipposideros armiger GN=HBA PE=2 SV=1
  109 : B6CWH6_MYOAD        0.89  0.96    1  141    2  142  141    0    0  142  B6CWH6     Hemoglobin alpha chain OS=Myotis adversus GN=HBA PE=2 SV=1
  110 : B6CWH7_9CHIR        0.89  0.97    1  141    2  142  141    0    0  142  B6CWH7     Hemoglobin alpha chain OS=Rhinolophus pusillus GN=HBA PE=2 SV=1
  111 : F6TTF3_CALJA        0.89  0.98  143  275    2  134  133    0    0  158  F6TTF3     Uncharacterized protein OS=Callithrix jacchus GN=LOC100389093 PE=3 SV=1
  112 : F6WIM6_CALJA        0.89  0.98  143  288    7  152  146    0    0  152  F6WIM6     Uncharacterized protein (Fragment) OS=Callithrix jacchus GN=LOC100389093 PE=3 SV=1
  113 : G3RNU8_GORGO        0.89  0.92    1  141    2  145  144    1    3  145  G3RNU8     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
  114 : HBA3_GORGO          0.89  0.96    1  141    1  141  141    0    0  141  P01934     Hemoglobin subunit alpha-3 OS=Gorilla gorilla gorilla PE=1 SV=1
  115 : HBA3_PANTR          0.89  0.96    1  141    1  141  141    0    0  141  P01935     Hemoglobin subunit alpha-3 OS=Pan troglodytes PE=1 SV=1
  116 : HBA_CTEGU           0.89  0.98    1  141    1  141  141    0    0  141  P20854     Hemoglobin subunit alpha OS=Ctenodactylus gundi GN=HBA PE=1 SV=1
  117 : HBA_EULFU           0.89  0.96    1  141    1  141  141    0    0  141  P01936     Hemoglobin subunit alpha OS=Eulemur fulvus fulvus GN=HBA PE=1 SV=1
  118 : HBA_MACCA           0.89  0.97    1  141    1  141  141    0    0  141  P09839     Hemoglobin subunit alpha OS=Macrotus californicus GN=HBA PE=1 SV=1
  119 : HBA_MELME           0.89  0.96    1  141    1  141  141    0    0  141  P01953     Hemoglobin subunit alpha OS=Meles meles GN=HBA PE=1 SV=1
  120 : HBA_PIPAB           0.89  0.95    1  141    2  143  142    1    1  143  Q862A7     Hemoglobin subunit alpha OS=Pipistrellus abramus GN=HBA PE=2 SV=3
  121 : HBG1_CALMO          0.89  0.97  143  288    2  147  146    0    0  147  Q9GLX4     Hemoglobin subunit gamma-1 OS=Callicebus moloch GN=HBG1 PE=2 SV=3
  122 : HBG1_CEBAL          0.89  0.98  143  288    2  147  146    0    0  147  Q28221     Hemoglobin subunit gamma-1 OS=Cebus albifrons GN=HBG1 PE=2 SV=3
  123 : HBG1_CEBAP          0.89  0.98  143  288    2  147  146    0    0  147  P68256     Hemoglobin subunit gamma-1 OS=Cebus apella GN=HBG1 PE=2 SV=2
  124 : HBG_ALOBE           0.89  0.97  143  288    2  147  146    0    0  147  P68030     Hemoglobin subunit gamma OS=Alouatta belzebul GN=HBG PE=2 SV=2
  125 : HBG_ALOCA           0.89  0.97  143  288    2  147  146    0    0  147  P68031     Hemoglobin subunit gamma OS=Alouatta caraya GN=HBG PE=2 SV=2
  126 : HBG_CALJA           0.89  0.98  143  288    2  147  146    0    0  147  Q9GJS7     Hemoglobin subunit gamma OS=Callithrix jacchus GN=HBG1 PE=2 SV=3
  127 : I3MFW7_SPETR        0.89  0.95    1  141    2  142  141    0    0  142  I3MFW7     Uncharacterized protein OS=Spermophilus tridecemlineatus PE=3 SV=1
  128 : I7B0Y9_EOSBA        0.89  0.95    1  141    2  142  141    0    0  142  I7B0Y9     Hemoglobin alpha chain OS=Eospalax baileyi PE=2 SV=1
  129 : K7WG06_OCHER        0.89  0.96    1  141    2  142  141    0    0  142  K7WG06     Hemoglobin alpha chain OS=Ochotona erythrotis PE=2 SV=1
  130 : K7X7N0_MICOE        0.89  0.96    1  141    2  142  141    0    0  142  K7X7N0     Hemoglobin alpha chain OS=Microtus oeconomus PE=2 SV=1
  131 : L7N1N1_MYOLU        0.89  0.95    1  141    2  142  141    0    0  142  L7N1N1     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
  132 : A4GTS5_OCHCU        0.88  0.96    1  141    2  142  141    0    0  142  A4GTS5     Hemoglobin alpha chain OS=Ochotona curzoniae PE=2 SV=1
  133 : B6CWH2_9CHIR        0.88  0.96    1  141    2  142  141    0    0  142  B6CWH2     Hemoglobin alpha chain OS=Chaerephon plicatus GN=HBA PE=2 SV=1
  134 : B6CWH4_EONSP        0.88  0.97    1  141    2  142  141    0    0  142  B6CWH4     Hemoglobin alpha chain OS=Eonycteris spelaea GN=HBA PE=2 SV=1
  135 : HBA1_VARVI          0.88  0.94    1  141    1  141  141    0    0  141  P20018     Hemoglobin subunit alpha-1 OS=Varecia variegata PE=1 SV=1
  136 : HBA2_BOSMU          0.88  0.96    1  141    1  141  141    0    0  141  P01968     Hemoglobin subunit alpha-2 OS=Bos mutus grunniens PE=1 SV=1
  137 : HBA2_VARVI          0.88  0.94    1  141    1  141  141    0    0  141  P20019     Hemoglobin subunit alpha-2 OS=Varecia variegata PE=1 SV=1
  138 : HBA4_BUBBU          0.88  0.96    1  141    2  142  141    0    0  142  Q9XSK1     Hemoglobin subunit alpha-4 OS=Bubalus bubalis PE=2 SV=3
  139 : HBA_BISBO           0.88  0.95    1  141    2  142  141    0    0  142  P09423     Hemoglobin subunit alpha-I/II OS=Bison bonasus PE=1 SV=2
  140 : HBA_BOSGF           0.88  0.94    1  141    2  142  141    0    0  142  P01969     Hemoglobin subunit alpha OS=Bos gaurus frontalis GN=HBA PE=1 SV=2
  141 : HBA_BOVIN   2QSS    0.88  0.95    1  141    2  142  141    0    0  142  P01966     Hemoglobin subunit alpha OS=Bos taurus GN=HBA PE=1 SV=2
  142 : HBA_CHAMP           0.88  0.95    1  141    1  141  141    0    0  141  Q7M2Y4     Hemoglobin subunit alpha OS=Chalinolobus morio GN=HBA PE=1 SV=1
  143 : HBA_HORSE   2ZLU    0.88  0.96    1  141    2  142  141    0    0  142  P01958     Hemoglobin subunit alpha OS=Equus caballus GN=HBA PE=1 SV=2
  144 : HBA_MUSPF           0.88  0.96    1  141    1  141  141    0    0  141  P20243     Hemoglobin subunit alpha-1/2 OS=Mustela putorius furo PE=1 SV=1
  145 : HBG_ALOSE           0.88  0.96  143  288    2  147  146    0    0  147  P56285     Hemoglobin subunit gamma OS=Alouatta seniculus GN=HBG PE=2 SV=2
  146 : HBG_AOTAZ           0.88  0.97  143  288    2  147  146    0    0  147  Q27940     Hemoglobin subunit gamma OS=Aotus azarae GN=HBG PE=2 SV=3
  147 : Q9GLX5_AOTNA        0.88  0.97  143  288    2  147  146    0    0  147  Q9GLX5     Hybrid gamma1/gamma2-globin OS=Aotus nancymaae PE=3 SV=1
  148 : Q9GLX7_SAISC        0.88  0.97  143  288    2  147  146    0    0  147  Q9GLX7     Hybrid gamma1/gamma2-globin OS=Saimiri sciureus PE=3 SV=1
  149 : A4ZQG1_PERLE        0.87  0.95    1  141    2  142  141    0    0  142  A4ZQG1     Hemoglobin alpha subunit 2 OS=Peromyscus leucopus PE=3 SV=1
  150 : B2KHV8_RHIFE        0.87  0.97    1  141    2  142  141    0    0  142  B2KHV8     Hemoglobin subunit alpha (Predicted) OS=Rhinolophus ferrumequinum GN=HBQ1_1 PE=3 SV=1
  151 : C6ZP43_CAPHI        0.87  0.94    1  141    2  142  141    0    0  142  C6ZP43     I alpha globin OS=Capra hircus GN=HBAI PE=3 SV=1
  152 : C6ZP44_SHEEP        0.87  0.94    1  141    2  142  141    0    0  142  C6ZP44     I alpha globin OS=Ovis aries ophion GN=HBAI PE=3 SV=1
  153 : C6ZP47_OVIMU        0.87  0.94    1  141    2  142  141    0    0  142  C6ZP47     I alpha globin OS=Ovis orientalis musimon GN=HBAI PE=3 SV=1
  154 : C7S3D2_PERMA        0.87  0.95    1  141    2  142  141    0    0  142  C7S3D2     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  155 : C7S3H0_PERMA        0.87  0.95    1  141    2  142  141    0    0  142  C7S3H0     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  156 : C7S3J9_PERMA        0.87  0.95    1  141    2  142  141    0    0  142  C7S3J9     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  157 : D2HDV4_AILME        0.87  0.96    1  141    2  142  141    0    0  142  D2HDV4     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_008911 PE=3 SV=1
  158 : D9I2E6_SCAOR        0.87  0.97   16  135    2  121  120    0    0  121  D9I2E6     Hemoglobin subunit alpha (Fragment) OS=Scapanus orarius GN=HBA PE=2 SV=1
  159 : F6MFG2_PANHO        0.87  0.94    1  141    2  142  141    0    0  142  F6MFG2     Hemoglobin alpha chain OS=Pantholops hodgsonii PE=2 SV=1
  160 : G5BXY1_HETGA        0.87  0.96    1  141    2  142  141    0    0  142  G5BXY1     Hemoglobin subunit alpha OS=Heterocephalus glaber GN=GW7_12998 PE=3 SV=1
  161 : G9FTH8_NEUGI        0.87  0.95    1  141    2  142  141    0    0  142  G9FTH8     Hemoglobin subunit alpha OS=Neurotrichus gibbsii GN=HBA PE=2 SV=1
  162 : HBA1_BOSMU          0.87  0.95    1  141    1  141  141    0    0  141  P01967     Hemoglobin subunit alpha-1 OS=Bos mutus grunniens PE=1 SV=1
  163 : HBA1_BUBBU          0.87  0.96    1  141    2  142  141    0    0  142  Q9TSN7     Hemoglobin subunit alpha-1 OS=Bubalus bubalis PE=2 SV=3
  164 : HBA1_CAPHI  2RI4    0.87  0.94    1  141    2  142  141    0    0  142  P0CH25     Hemoglobin subunit alpha-1 OS=Capra hircus GN=HBA1 PE=1 SV=1
  165 : HBA1_TADBR          0.87  0.94    1  141    1  141  141    0    0  141  P11755     Hemoglobin subunit alpha-1 OS=Tadarida brasiliensis PE=1 SV=1
  166 : HBA2_BUBBU  3CY5    0.87  0.96    1  141    2  142  141    0    0  142  Q9TSN8     Hemoglobin subunit alpha-2 OS=Bubalus bubalis PE=1 SV=3
  167 : HBA2_EQUBU          0.87  0.96    1  141    2  142  141    0    0  142  Q9TVA3     Hemoglobin subunit alpha-2 OS=Equus burchelli GN=HBA2 PE=2 SV=3
  168 : HBA_AILME           0.87  0.96    1  141    2  142  141    0    0  142  P18970     Hemoglobin subunit alpha OS=Ailuropoda melanoleuca GN=HBA PE=1 SV=2
  169 : HBA_AMMLE           0.87  0.94    1  141    2  142  141    0    0  142  P68239     Hemoglobin subunit alpha-1/2 OS=Ammotragus lervia PE=1 SV=2
  170 : HBA_CERSI           0.87  0.96    1  141    2  142  141    0    0  142  P01963     Hemoglobin subunit alpha OS=Ceratotherium simum GN=HBA PE=1 SV=2
  171 : HBA_EQUPR           0.87  0.96    1  141    2  142  141    0    0  142  Q9XSE9     Hemoglobin subunit alpha OS=Equus caballus przewalskii GN=HBA PE=2 SV=3
  172 : HBA_HIPAM           0.87  0.95    1  141    1  141  141    0    0  141  P19015     Hemoglobin subunit alpha OS=Hippopotamus amphibius GN=HBA PE=1 SV=1
  173 : HBA_LUTLU           0.87  0.96    1  141    1  141  141    0    0  141  P10892     Hemoglobin subunit alpha OS=Lutra lutra GN=HBA PE=1 SV=1
  174 : HBA_MACGG           0.87  0.97    1  141    1  141  141    0    0  141  P24659     Hemoglobin subunit alpha-1/2 OS=Macroderma gigas PE=1 SV=1
  175 : HBA_MESAU           0.87  0.95    1  141    1  141  141    0    0  141  P01945     Hemoglobin subunit alpha OS=Mesocricetus auratus GN=HBA PE=1 SV=1
  176 : HBA_MICPE           0.87  0.96    1  141    1  141  141    0    0  141  B3EWE3     Hemoglobin subunit alpha OS=Microtus pennsylvanicus PE=1 SV=1
  177 : HBA_MUSLU           0.87  0.96    1  141    1  141  141    0    0  141  P23600     Hemoglobin subunit alpha-1/2 OS=Mustela lutreola PE=1 SV=1
  178 : HBA_MUSPU           0.87  0.96    1  141    1  141  141    0    0  141  P23601     Hemoglobin subunit alpha-1/2 OS=Mustela putorius PE=1 SV=1
  179 : HBA_PANHO           0.87  0.94    1  141    2  142  141    0    0  142  Q0ZA50     Hemoglobin subunit alpha OS=Pantholops hodgsonii GN=HBA PE=2 SV=3
  180 : HBA_PERCA           0.87  0.94    1  141    1  141  141    0    0  141  B3EWD5     Hemoglobin subunit alpha OS=Peromyscus californicus PE=1 SV=1
  181 : HBA_PHOVI           0.87  0.96    1  141    1  141  141    0    0  141  P09908     Hemoglobin subunit alpha OS=Phoca vitulina GN=HBA PE=1 SV=1
  182 : HBA_PTEAL           0.87  0.98    1  141    1  141  141    0    0  141  P14389     Hemoglobin subunit alpha OS=Pteropus alecto GN=HBA PE=1 SV=1
  183 : HBA_PTEBR           0.87  0.95    1  141    1  141  141    0    0  141  P10885     Hemoglobin subunit alpha OS=Pteronura brasiliensis GN=HBA PE=1 SV=1
  184 : HBA_PTEGI   3FH9    0.87  0.98    1  141    1  141  141    0    0  141  D0VX09     Hemoglobin subunit alpha OS=Pteropus giganteus GN=HBA PE=1 SV=1
  185 : HBA_PTEPO           0.87  0.96    1  141    1  141  141    0    0  141  P14390     Hemoglobin subunit alpha OS=Pteropus poliocephalus GN=HBA PE=1 SV=1
  186 : HBA_RHIUN           0.87  0.96    1  141    1  141  141    0    0  141  P09906     Hemoglobin subunit alpha OS=Rhinoceros unicornis GN=HBA PE=1 SV=1
  187 : HBA_SHEEP   2QU0    0.87  0.94    1  141    2  142  141    0    0  142  P68240     Hemoglobin subunit alpha-1/2 OS=Ovis aries PE=1 SV=2
  188 : HBA_TALEU           0.87  0.95    1  141    1  141  141    0    0  141  P01951     Hemoglobin subunit alpha OS=Talpa europaea GN=HBA PE=1 SV=1
  189 : HBA_TAMST           0.87  0.96    1  141    1  141  141    0    0  141  B3EWD9     Hemoglobin subunit alpha OS=Tamias striatus PE=1 SV=1
  190 : HBA_TRAST           0.87  0.95    2  141    1  140  140    0    0  140  P04237     Hemoglobin subunit alpha OS=Tragelaphus strepsiceros GN=HBA PE=1 SV=1
  191 : I0B043_EPIFU        0.87  0.94   12  137    1  126  126    0    0  126  I0B043     Hemoglobin subunit alpha (Fragment) OS=Episoriculus fumidus GN=HBA PE=3 SV=1
  192 : I7B4Z6_OCHLA        0.87  0.95    1  141    2  142  141    0    0  142  I7B4Z6     Hemoglobin alpha chain OS=Ochotona ladacensis PE=2 SV=1
  193 : L5KHX1_PTEAL        0.87  0.98    1  141   21  161  141    0    0  161  L5KHX1     Hemoglobin subunit alpha OS=Pteropus alecto GN=PAL_GLEAN10011811 PE=3 SV=1
  194 : M3YX78_MUSPF        0.87  0.94    1  141    2  143  142    1    1  143  M3YX78     Uncharacterized protein OS=Mustela putorius furo PE=3 SV=1
  195 : Q28383_HORSE        0.87  0.96    1  141    2  142  141    0    0  142  Q28383     Horse BII alpha-2 globin OS=Equus caballus PE=3 SV=1
  196 : Q28745_SHEEP        0.87  0.94    1  141    2  142  141    0    0  142  Q28745     Alpha globin chain OS=Ovis aries PE=3 SV=1
  197 : Q8BPF4_MOUSE        0.87  0.95    1  141    2  142  141    0    0  142  Q8BPF4     Putative uncharacterized protein OS=Mus musculus GN=Hba-a2 PE=2 SV=1
  198 : Q91VB8_MOUSE        0.87  0.96    1  141    2  142  141    0    0  142  Q91VB8     Alpha globin 1 OS=Mus musculus GN=Hba-a1 PE=2 SV=1
  199 : Q9GJY8_CALMO        0.87  0.96  143  280    2  139  138    0    0  145  Q9GJY8     Gamma2-globin OS=Callicebus moloch GN=gamma2-globin PE=3 SV=1
  200 : Q9GLX6_SAIUS        0.87  0.97  143  288    2  147  146    0    0  147  Q9GLX6     Hybrid gamma1/gamma2-globin OS=Saimiri ustus PE=3 SV=1
  201 : A4ZQ93_PERMA        0.86  0.94    1  141    2  142  141    0    0  142  A4ZQ93     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  202 : A4ZQD9_PERMA        0.86  0.95    1  141    2  142  141    0    0  142  A4ZQD9     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  203 : A8DUV3_MOUSE        0.86  0.96    1  141    2  142  141    0    0  142  A8DUV3     Alpha-globin OS=Mus musculus GN=Hba-a1 PE=3 SV=1
  204 : B3EX31_SORAR        0.86  0.95    1  141    2  142  141    0    0  142  B3EX31     Alpha 1 globin (Predicted) OS=Sorex araneus GN=HBA1 PE=3 SV=1
  205 : B5SXW7_PERMA        0.86  0.95    1  141    2  142  141    0    0  142  B5SXW7     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  206 : B6CVB6_PERMA        0.86  0.96    1  141    2  142  141    0    0  142  B6CVB6     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  207 : C6ZP46_AMMLE        0.86  0.94    1  141    2  142  141    0    0  142  C6ZP46     I alpha globin OS=Ammotragus lervia GN=HBAI PE=3 SV=1
  208 : C6ZP48_CAPHI        0.86  0.94    1  141    2  142  141    0    0  142  C6ZP48     I alpha globin OS=Capra hircus GN=HBAI PE=3 SV=1
  209 : C6ZP49_CAPHI        0.86  0.94    1  141    2  142  141    0    0  142  C6ZP49     II alpha globin OS=Capra hircus GN=HBAII PE=3 SV=1
  210 : C7S3C4_PERMA        0.86  0.95    1  141    2  142  141    0    0  142  C7S3C4     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  211 : C7S3H1_PERMA        0.86  0.95    1  141    2  142  141    0    0  142  C7S3H1     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  212 : E2EM18_PERMA        0.86  0.96    1  141    2  142  141    0    0  142  E2EM18     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
  213 : F6VYQ1_CALJA        0.86  0.96  143  283    2  142  141    0    0  156  F6VYQ1     Uncharacterized protein OS=Callithrix jacchus PE=3 SV=1
  214 : G3SBL4_GORGO        0.86  0.96  143  282    2  141  140    0    0  141  G3SBL4     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
  215 : G8ZF42_RABIT        0.86  0.95    1  141    2  142  141    0    0  142  G8ZF42     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  216 : HBA2_ARCGA          0.86  0.95    1  141    2  142  141    0    0  142  P41330     Hemoglobin subunit alpha-2 OS=Arctocephalus galapagoensis PE=1 SV=2
  217 : HBA2_CAPHI          0.86  0.94    1  141    2  142  141    0    0  142  P0CH26     Hemoglobin subunit alpha-2 OS=Capra hircus GN=HBA2 PE=1 SV=1
  218 : HBA2_EQUGR          0.86  0.96    1  141    2  142  141    0    0  142  Q7JFN6     Hemoglobin subunit alpha-2 OS=Equus grevyi GN=HBA2 PE=2 SV=3
  219 : HBA3_BUBBU          0.86  0.96    1  141    2  142  141    0    0  142  Q9TSN9     Hemoglobin subunit alpha-3 OS=Bubalus bubalis PE=2 SV=3
  220 : HBA_AILFU           0.86  0.95    1  141    2  142  141    0    0  142  P18969     Hemoglobin subunit alpha OS=Ailurus fulgens GN=HBA PE=1 SV=2
  221 : HBA_EQUAS   1S0H    0.86  0.96    1  141    2  142  141    0    0  142  P01959     Hemoglobin subunit alpha OS=Equus asinus GN=HBA1 PE=1 SV=3
  222 : HBA_EQUZE           0.86  0.96    1  141    2  142  141    0    0  142  P01960     Hemoglobin subunit alpha OS=Equus zebra GN=HBA PE=1 SV=2
  223 : HBA_MOUSE   3HRW    0.86  0.96    1  141    2  142  141    0    0  142  P01942     Hemoglobin subunit alpha OS=Mus musculus GN=Hba PE=1 SV=2
  224 : HBA_ODORO           0.86  0.95    1  141    1  141  141    0    0  141  P10778     Hemoglobin subunit alpha OS=Odobenus rosmarus divergens GN=HBA PE=1 SV=1
  225 : HBA_PROCR           0.86  0.95    1  141    1  141  141    0    0  141  P23019     Hemoglobin subunit alpha OS=Proteles cristata GN=HBA PE=1 SV=1
  226 : HBA_TAPTE           0.86  0.96    1  141    1  141  141    0    0  141  P01962     Hemoglobin subunit alpha-1/2 OS=Tapirus terrestris PE=1 SV=1
  227 : HBG_CHEME           0.86  0.95  144  288    3  147  145    0    0  147  P08224     Hemoglobin subunit gamma OS=Cheirogaleus medius GN=HBG PE=2 SV=2
  228 : HBG_EULFU           0.86  0.94  144  288    3  147  145    0    0  147  P08225     Hemoglobin subunit gamma OS=Eulemur fulvus fulvus GN=HBG PE=2 SV=2
  229 : Q28743_SHEEP        0.86  0.94    1  141    2  142  141    0    0  142  Q28743     Alpha globin chain OS=Ovis aries PE=3 SV=1
  230 : Q28744_SHEEP        0.86  0.94    1  141    2  142  141    0    0  142  Q28744     Alpha globin chain OS=Ovis aries PE=3 SV=1
  231 : Q9CWS5_MOUSE        0.86  0.96    1  141    2  142  141    0    0  142  Q9CWS5     Putative uncharacterized protein OS=Mus musculus GN=Hba-a2 PE=2 SV=1
  232 : Q9CY06_MOUSE        0.86  0.96    1  141    2  142  141    0    0  142  Q9CY06     Putative uncharacterized protein OS=Mus musculus GN=Hba-a1 PE=2 SV=1
  233 : A4ZQ87_PERMA        0.85  0.94    1  141    2  142  141    0    0  142  A4ZQ87     Alpha-globin OS=Peromyscus maniculatus GN=HBA PE=2 SV=1
  234 : A4ZQ95_PERMA4H2L    0.85  0.96    1  141    2  142  141    0    0  142  A4ZQ95     Alpha-globin OS=Peromyscus maniculatus GN=HBA PE=1 SV=1
  235 : A4ZQ96_PERMA        0.85  0.95    1  141    2  142  141    0    0  142  A4ZQ96     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
  236 : A4ZQA9_PERMA        0.85  0.94    1  141    2  142  141    0    0  142  A4ZQA9     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  237 : A4ZQB7_PERMA        0.85  0.96    1  141    2  142  141    0    0  142  A4ZQB7     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  238 : A4ZQC9_PERMA        0.85  0.94    1  141    2  142  141    0    0  142  A4ZQC9     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  239 : A4ZQD3_PERMA        0.85  0.95    1  141    2  142  141    0    0  142  A4ZQD3     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
  240 : A4ZQD6_PERMA        0.85  0.95    1  141    2  142  141    0    0  142  A4ZQD6     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  241 : B5SXZ1_PERMA        0.85  0.96    1  141    2  142  141    0    0  142  B5SXZ1     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  242 : C6ZP50_AMMLE        0.85  0.94    1  141    2  142  141    0    0  142  C6ZP50     II alpha globin OS=Ammotragus lervia GN=HBAII PE=3 SV=1
  243 : C6ZP52_CAPHI        0.85  0.94    1  141    2  142  141    0    0  142  C6ZP52     II alpha globin OS=Capra hircus GN=HBAII PE=3 SV=1
  244 : C7S3C9_PERMA        0.85  0.95    1  141    2  142  141    0    0  142  C7S3C9     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  245 : C7S3F2_PERMA        0.85  0.94    1  141    2  142  141    0    0  142  C7S3F2     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  246 : C7S3I0_PERMA        0.85  0.96    1  141    2  142  141    0    0  142  C7S3I0     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  247 : C7S3I2_PERMA        0.85  0.95    1  141    2  142  141    0    0  142  C7S3I2     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  248 : E2ELZ8_PERMA        0.85  0.94    1  141    2  142  141    0    0  142  E2ELZ8     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
  249 : E2EM05_PERMA        0.85  0.96    1  141    2  142  141    0    0  142  E2EM05     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
  250 : E2EM07_PERMA        0.85  0.94    1  141    2  142  141    0    0  142  E2EM07     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
  251 : E2EM16_PERMA        0.85  0.96    1  141    2  142  141    0    0  142  E2EM16     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
  252 : F7GY95_CALJA        0.85  0.95    2  141    3  142  140    0    0  142  F7GY95     Uncharacterized protein OS=Callithrix jacchus GN=HBQ1_1 PE=3 SV=1
  253 : G1M478_AILME        0.85  0.96  144  278    3  137  135    0    0  154  G1M478     Uncharacterized protein OS=Ailuropoda melanoleuca GN=LOC100482027 PE=3 SV=1
  254 : G3RLZ6_GORGO        0.85  0.92    1  141    2  145  144    1    3  145  G3RLZ6     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
  255 : G8ZF24_RABIT        0.85  0.95    1  141    2  142  141    0    0  142  G8ZF24     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  256 : G8ZF61_SYLFL        0.85  0.94    1  141    2  142  141    0    0  142  G8ZF61     Alpha-globin OS=Sylvilagus floridanus GN=HBA PE=3 SV=1
  257 : G9FTH5_CONCR        0.85  0.94    1  141    2  142  141    0    0  142  G9FTH5     Hemoglobin subunit alpha 1 OS=Condylura cristata GN=HBA1 PE=2 SV=1
  258 : HBA1_ARCGA          0.85  0.96    1  141    2  142  141    0    0  142  P41329     Hemoglobin subunit alpha-1 OS=Arctocephalus galapagoensis PE=1 SV=2
  259 : HBA1_EQUBU          0.85  0.95    1  141    2  142  141    0    0  142  Q9XSN3     Hemoglobin subunit alpha-1 OS=Equus burchelli GN=HBA1 PE=1 SV=3
  260 : HBA1_HAPGR          0.85  0.96    1  141    1  140  141    1    1  140  Q7M3B8     Hemoglobin subunit alpha-1 OS=Hapalemur griseus GN=HBA1 PE=1 SV=1
  261 : HBA_ALCAA           0.85  0.96    1  141    2  142  141    0    0  142  P01971     Hemoglobin subunit alpha OS=Alces alces alces GN=HBA PE=1 SV=2
  262 : HBA_EQUHE           0.85  0.96    1  141    2  142  141    0    0  142  P01961     Hemoglobin subunit alpha-1/2 OS=Equus hemionus kulan PE=1 SV=3
  263 : HBA_FELCA   3GYS    0.85  0.95    1  141    1  141  141    0    0  141  P07405     Hemoglobin subunit alpha OS=Felis catus GN=HBA PE=1 SV=1
  264 : HBA_LYNLY           0.85  0.96    1  141    1  141  141    0    0  141  P41327     Hemoglobin subunit alpha OS=Lynx lynx GN=HBA PE=1 SV=1
  265 : HBA_MARFO           0.85  0.96    1  141    1  141  141    0    0  141  P17689     Hemoglobin subunit alpha OS=Martes foina GN=HBA PE=1 SV=1
  266 : HBA_MELCA           0.85  0.94    1  141    1  141  141    0    0  141  P15448     Hemoglobin subunit alpha OS=Mellivora capensis GN=HBA PE=1 SV=1
  267 : HBA_PHYCD           0.85  0.97    1  141    1  141  141    0    0  141  P09904     Hemoglobin subunit alpha OS=Physeter catodon GN=HBA PE=1 SV=1
  268 : HBA_PROHA           0.85  0.95    1  141    1  142  142    1    1  142  P01957     Hemoglobin subunit alpha OS=Procavia capensis habessinica GN=HBA PE=1 SV=1
  269 : HBA_PROLO           0.85  0.94    1  141    1  141  141    0    0  141  P18977     Hemoglobin subunit alpha OS=Procyon lotor GN=HBA PE=1 SV=1
  270 : HBA_RANTA           0.85  0.96    1  141    1  141  141    0    0  141  P21379     Hemoglobin subunit alpha OS=Rangifer tarandus GN=HBA PE=1 SV=1
  271 : HBA_SUNMU           0.85  0.95    1  141    1  141  141    0    0  141  P01950     Hemoglobin subunit alpha OS=Suncus murinus GN=HBA PE=1 SV=1
  272 : HBA_TAMHU           0.85  0.95    1  141    1  141  141    0    0  141  B3EWD7     Hemoglobin subunit alpha OS=Tamiasciurus hudsonicus PE=1 SV=1
  273 : I0B042_EPIFU        0.85  0.94    1  141    2  142  141    0    0  142  I0B042     Hemoglobin subunit alpha OS=Episoriculus fumidus GN=HBA PE=3 SV=1
  274 : O13072_9PRIM        0.85  0.97  144  266    3  125  123    0    0  125  O13072     Epsilon-globin (Fragment) OS=Callithrix mauesi PE=3 SV=1
  275 : Q61287_MOUSE        0.85  0.95    1  141    2  142  141    0    0  142  Q61287     Alpha-globin OS=Mus musculus GN=Hba-a1 PE=2 SV=1
  276 : A4ZQ88_PERMA        0.84  0.95    1  141    2  142  141    0    0  142  A4ZQ88     Alpha-globin OS=Peromyscus maniculatus GN=HBA PE=2 SV=1
  277 : A4ZQ90_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  A4ZQ90     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  278 : A4ZQ92_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  A4ZQ92     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  279 : A4ZQB2_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  A4ZQB2     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  280 : A4ZQB9_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  A4ZQB9     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  281 : A4ZQC3_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  A4ZQC3     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  282 : A4ZQD0_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  A4ZQD0     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  283 : A4ZQD4_PERMA        0.84  0.95    1  141    2  142  141    0    0  142  A4ZQD4     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  284 : A4ZQE9_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  A4ZQE9     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  285 : A4ZQF0_PERMA        0.84  0.96    1  141    2  142  141    0    0  142  A4ZQF0     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  286 : A4ZQF6_PERMA        0.84  0.95    1  141    2  142  141    0    0  142  A4ZQF6     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  287 : A8DUV1_MOUSE        0.84  0.95    1  141    2  142  141    0    0  142  A8DUV1     Alpha-globin OS=Mus musculus GN=Hba-a1 PE=3 SV=1
  288 : B5SXU4_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  B5SXU4     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  289 : B5SXV1_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  B5SXV1     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  290 : B6CV73_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  B6CV73     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  291 : B6CVB8_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  B6CVB8     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  292 : C7S3A7_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  C7S3A7     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  293 : C7S3D4_PERMA        0.84  0.95    1  141    2  142  141    0    0  142  C7S3D4     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  294 : C7S3D6_PERMA        0.84  0.95    1  141    2  142  141    0    0  142  C7S3D6     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  295 : C7S3D7_PERMA        0.84  0.94    1  141    2  141  141    1    1  141  C7S3D7     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  296 : C7S3G0_PERMA        0.84  0.94    1  141    2  141  141    1    1  141  C7S3G0     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  297 : C7S3G3_PERMA        0.84  0.95    1  141    2  142  141    0    0  142  C7S3G3     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  298 : C7S3G8_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  C7S3G8     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  299 : C7S3I4_PERMA        0.84  0.95    1  141    2  142  141    0    0  142  C7S3I4     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  300 : C7S3I5_PERMA        0.84  0.95    1  141    2  142  141    0    0  142  C7S3I5     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  301 : C7S3J3_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  C7S3J3     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  302 : C7S3J4_PERMA        0.84  0.95    1  141    2  142  141    0    0  142  C7S3J4     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  303 : C7S3K0_PERMA        0.84  0.94    1  141    2  142  141    0    0  142  C7S3K0     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  304 : D3TTJ8_DELDE        0.84  0.98    1  141    2  142  141    0    0  142  D3TTJ8     Hemoglobin alpha2 chain OS=Delphinus delphis PE=2 SV=1
  305 : D9I2E7_SCAOR        0.84  0.95    1  141    2  142  141    0    0  142  D9I2E7     Hemoglobin subunit alpha OS=Scapanus orarius GN=HBA PE=2 SV=1
  306 : F1RGX4_PIG          0.84  0.95    1  141    2  142  141    0    0  142  F1RGX4     Uncharacterized protein OS=Sus scrofa GN=LOC100737768 PE=3 SV=1
  307 : G3TM42_LOXAF        0.84  0.97  144  288    3  147  145    0    0  147  G3TM42     Uncharacterized protein OS=Loxodonta africana GN=LOC100677510 PE=3 SV=1
  308 : G8ZF16_RABIT        0.84  0.96    1  141    2  142  141    0    0  142  G8ZF16     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  309 : G8ZF18_RABIT        0.84  0.96    1  141    2  142  141    0    0  142  G8ZF18     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  310 : G8ZF19_RABIT        0.84  0.95    1  141    2  142  141    0    0  142  G8ZF19     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  311 : G8ZF20_RABIT        0.84  0.96    1  141    2  142  141    0    0  142  G8ZF20     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  312 : G8ZF22_RABIT        0.84  0.96    1  141    2  142  141    0    0  142  G8ZF22     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  313 : G8ZF25_RABIT        0.84  0.96    1  141    2  142  141    0    0  142  G8ZF25     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  314 : G8ZF27_RABIT        0.84  0.96    1  141    2  142  141    0    0  142  G8ZF27     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  315 : G8ZF28_RABIT        0.84  0.96    1  141    2  142  141    0    0  142  G8ZF28     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  316 : G8ZF32_RABIT        0.84  0.94    1  141    2  142  141    0    0  142  G8ZF32     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  317 : G8ZF34_RABIT        0.84  0.94    1  141    2  142  141    0    0  142  G8ZF34     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  318 : G8ZF35_RABIT        0.84  0.93    1  141    2  142  141    0    0  142  G8ZF35     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  319 : G8ZF41_RABIT        0.84  0.94    1  141    2  142  141    0    0  142  G8ZF41     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  320 : G8ZF50_RABIT        0.84  0.96    1  141    2  142  141    0    0  142  G8ZF50     Alpha-globin 2 OS=Oryctolagus cuniculus GN=HBA2 PE=3 SV=1
  321 : G9FTH6_CONCR        0.84  0.94    1  141    2  142  141    0    0  142  G9FTH6     Hemoglobin subunit alpha 2 OS=Condylura cristata GN=HBA2 PE=2 SV=1
  322 : HBA_BLABR           0.84  0.96    1  141    1  141  141    0    0  141  B3EWE1     Hemoglobin subunit alpha OS=Blarina brevicauda PE=1 SV=1
  323 : HBA_CAMBA           0.84  0.96    1  141    1  141  141    0    0  141  P63105     Hemoglobin subunit alpha OS=Camelus bactrianus GN=HBA PE=1 SV=1
  324 : HBA_CAMDR   3GDJ    0.84  0.96    1  141    1  141  141    0    0  141  P63106     Hemoglobin subunit alpha OS=Camelus dromedarius GN=HBA PE=1 SV=1
  325 : HBA_CANFA   2QLS    0.84  0.94    1  141    1  141  141    0    0  141  P60529     Hemoglobin subunit alpha OS=Canis familiaris GN=HBA PE=1 SV=1
  326 : HBA_CROCR           0.84  0.95    1  141    1  141  141    0    0  141  P18973     Hemoglobin subunit alpha OS=Crocuta crocuta GN=HBA PE=1 SV=1
  327 : HBA_HELMA           0.84  0.95    1  141    2  142  141    0    0  142  P68237     Hemoglobin subunit alpha OS=Helarctos malayanus GN=HBA PE=1 SV=2
  328 : HBA_LEPWE           0.84  0.94    1  141    1  141  141    0    0  141  P15163     Hemoglobin subunit alpha-1/2 OS=Leptonychotes weddelli PE=1 SV=1
  329 : HBA_MEGLY           0.84  0.94    1  141    1  141  141    0    0  141  P11751     Hemoglobin subunit alpha OS=Megaderma lyra GN=HBA PE=1 SV=1
  330 : HBA_NASNA           0.84  0.95    1  141    1  141  141    0    0  141  P26915     Hemoglobin subunit alpha OS=Nasua nasua GN=HBA PE=1 SV=1
  331 : HBA_ONDZI           0.84  0.95    1  141    1  141  141    0    0  141  P01944     Hemoglobin subunit alpha OS=Ondatra zibethicus GN=HBA PE=1 SV=1
  332 : HBA_PAGLA           0.84  0.96    1  141    1  141  141    0    0  141  P19645     Hemoglobin subunit alpha OS=Paguma larvata GN=HBA PE=1 SV=1
  333 : HBA_PANON           0.84  0.94    1  141    2  142  141    0    0  142  P63109     Hemoglobin subunit alpha OS=Panthera onca GN=HBA PE=1 SV=2
  334 : HBA_PANPO           0.84  0.94    1  141    1  141  141    0    0  141  P63110     Hemoglobin subunit alpha OS=Panthera pardus orientalis GN=HBA PE=1 SV=1
  335 : HBA_PANPS           0.84  0.93    1  141    1  141  141    0    0  141  P18976     Hemoglobin subunit alpha OS=Panthera pardus saxicolor GN=HBA PE=1 SV=1
  336 : HBA_PIG     1QPW    0.84  0.95    1  141    1  141  141    0    0  141  P01965     Hemoglobin subunit alpha OS=Sus scrofa GN=HBA PE=1 SV=1
  337 : HBA_SPAEH           0.84  0.95    1  141    1  141  141    0    0  141  P01943     Hemoglobin subunit alpha OS=Spalax ehrenbergi GN=HBA PE=1 SV=1
  338 : HBA_TURTR           0.84  0.98    1  141    1  141  141    0    0  141  P18978     Hemoglobin subunit alpha OS=Tursiops truncatus GN=HBA PE=1 SV=1
  339 : HBA_URSMA           0.84  0.95    1  141    2  142  141    0    0  142  P68235     Hemoglobin subunit alpha OS=Ursus maritimus GN=HBA PE=1 SV=2
  340 : HBA_URSTH           0.84  0.95    1  141    2  142  141    0    0  142  P68236     Hemoglobin subunit alpha OS=Ursus thibetanus GN=HBA PE=1 SV=2
  341 : HBE_BRATR           0.84  0.96  144  288    3  147  145    0    0  147  Q45XH3     Hemoglobin subunit epsilon OS=Bradypus tridactylus GN=HBE1 PE=2 SV=3
  342 : HBG_ELEMA           0.84  0.97  144  288    3  147  145    0    0  147  Q45XH7     Hemoglobin subunit gamma OS=Elephas maximus GN=HBG PE=2 SV=3
  343 : J9NXL3_CANFA        0.84  0.94    1  141    2  142  141    0    0  142  J9NXL3     Uncharacterized protein OS=Canis familiaris GN=LOC100855558 PE=3 SV=1
  344 : K9IQG0_DESRO        0.84  0.96    1  141    1  141  141    0    0  141  K9IQG0     Putative hemoglobin subunit alpha (Fragment) OS=Desmodus rotundus PE=2 SV=1
  345 : M3ZBQ3_NOMLE        0.84  0.92  143  264    2  122  122    1    1  138  M3ZBQ3     Uncharacterized protein OS=Nomascus leucogenys PE=3 SV=1
  346 : Q4TU70_CEREL        0.84  0.95    1  141    2  142  141    0    0  142  Q4TU70     Alpha hemoglobin chain OS=Cervus elaphus canadensis PE=3 SV=1
  347 : Q9GLX3_CHISA        0.84  0.91  143  288    2  138  146    1    9  138  Q9GLX3     Gamma1-globin OS=Chiropotes satanas PE=3 SV=1
  348 : Q9QWJ3_MOUSE        0.84  0.95    1  121    2  122  121    0    0  122  Q9QWJ3     Alpha-1-globin (Fragment) OS=Mus musculus GN=Hba-a2 PE=2 SV=1
  349 : A4ZQC5_PERMA        0.83  0.95    1  141    2  142  141    0    0  142  A4ZQC5     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  350 : A4ZQE7_PERMA        0.83  0.94    1  141    2  142  141    0    0  142  A4ZQE7     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
  351 : C7S3C6_PERMA        0.83  0.92    1  141    2  142  141    0    0  142  C7S3C6     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  352 : C7S3I8_PERMA        0.83  0.94    1  141    2  142  141    0    0  142  C7S3I8     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  353 : C7S3J1_PERMA        0.83  0.92    1  141    2  141  141    1    1  141  C7S3J1     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  354 : D3TTK0_DELDE        0.83  0.97    1  141    2  142  141    0    0  142  D3TTK0     Hemoglobin alpha4 chain OS=Delphinus delphis PE=2 SV=1
  355 : D3U1G4_ELEMA        0.83  0.96    1  141    2  142  141    0    0  142  D3U1G4     Hemoglobin subunit alpha OS=Elephas maximus GN=HBA-T2 PE=2 SV=1
  356 : D3U1H8_MAMPR3VRE    0.83  0.96    1  141    2  142  141    0    0  142  D3U1H8     Hemoglobin subunit alpha OS=Mammuthus primigenius GN=HBA-T2 PE=1 SV=1
  357 : F2Z285_LEPEU3LQD    0.83  0.96    1  141    1  141  141    0    0  141  F2Z285     Hemoglobin subunit alpha OS=Lepus europaeus PE=1 SV=1
  358 : G3ICM8_CRIGR        0.83  0.95  144  288    3  147  145    0    0  147  G3ICM8     Hemoglobin subunit epsilon-Y2 OS=Cricetulus griseus GN=I79_021426 PE=3 SV=1
  359 : G5BS34_HETGA        0.83  0.94  144  288    3  147  145    0    0  147  G5BS34     Hemoglobin subunit gamma OS=Heterocephalus glaber GN=GW7_03825 PE=3 SV=1
  360 : G8ZF31_RABIT        0.83  0.95    1  141    2  142  141    0    0  142  G8ZF31     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  361 : G8ZF38_RABIT        0.83  0.96    1  141    2  142  141    0    0  142  G8ZF38     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  362 : HBA_BALAC           0.83  0.96    1  141    2  142  141    0    0  142  P18971     Hemoglobin subunit alpha OS=Balaenoptera acutorostrata GN=HBA PE=1 SV=2
  363 : HBA_CANLA           0.83  0.94    1  141    2  142  141    0    0  142  P60530     Hemoglobin subunit alpha OS=Canis latrans GN=HBA PE=1 SV=2
  364 : HBA_CHRBR   1FHJ    0.83  0.94    1  141    1  141  141    0    0  141  P60523     Hemoglobin subunit alpha OS=Chrysocyon brachyurus GN=HBA PE=1 SV=1
  365 : HBA_ELEMA           0.83  0.96    1  141    1  141  141    0    0  141  P01954     Hemoglobin subunit alpha OS=Elephas maximus GN=HBA PE=1 SV=1
  366 : HBA_LAMGU           0.83  0.96    1  141    1  141  141    0    0  141  P67815     Hemoglobin subunit alpha OS=Lama guanicoe GN=HBA PE=1 SV=1
  367 : HBA_LAMPA           0.83  0.96    1  141    1  141  141    0    0  141  P67816     Hemoglobin subunit alpha OS=Lama guanicoe pacos GN=HBA PE=1 SV=1
  368 : HBA_LAMVI           0.83  0.96    1  141    1  141  141    0    0  141  P07425     Hemoglobin subunit alpha OS=Lama vicugna GN=HBA PE=1 SV=1
  369 : HBA_PANLE           0.83  0.93    1  141    2  142  141    0    0  142  P18975     Hemoglobin subunit alpha OS=Panthera leo GN=HBA PE=1 SV=2
  370 : HBA_PANTS           0.83  0.93    1  141    1  141  141    0    0  141  P10883     Hemoglobin subunit alpha OS=Panthera tigris sumatrae GN=HBA PE=1 SV=1
  371 : HBA_PERCR           0.83  0.91    1  141    1  141  141    0    0  141  B3EWD3     Hemoglobin subunit alpha OS=Peromyscus crinitus PE=1 SV=1
  372 : HBA_VULVU           0.83  0.94    1  141    1  141  141    0    0  141  P21200     Hemoglobin subunit alpha OS=Vulpes vulpes GN=HBA PE=1 SV=1
  373 : HBG_LOXAF           0.83  0.97  144  288    3  147  145    0    0  147  Q45XH8     Hemoglobin subunit gamma OS=Loxodonta africana GN=HBG PE=2 SV=2
  374 : I3N129_SPETR        0.83  0.97  144  288    3  147  145    0    0  147  I3N129     Uncharacterized protein OS=Spermophilus tridecemlineatus PE=3 SV=1
  375 : J9JHF7_CANFA        0.83  0.94    1  141    2  142  141    0    0  142  J9JHF7     Uncharacterized protein OS=Canis familiaris GN=LOC100855540 PE=3 SV=1
  376 : J9P643_CANFA        0.83  0.97  144  288    3  147  145    0    0  147  J9P643     Uncharacterized protein OS=Canis familiaris GN=LOC480784 PE=3 SV=1
  377 : L5KD12_PTEAL        0.83  0.97  144  288    3  147  145    0    0  147  L5KD12     Hemoglobin subunit epsilon OS=Pteropus alecto GN=PAL_GLEAN10003332 PE=3 SV=1
  378 : A4ZQG5_PERMA        0.82  0.91    1  141    2  141  141    1    1  141  A4ZQG5     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  379 : A4ZQH7_PERMA        0.82  0.91    1  141    2  141  141    1    1  141  A4ZQH7     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  380 : A4ZQI9_PERMA        0.82  0.92    1  141    2  141  141    1    1  141  A4ZQI9     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  381 : A4ZQJ3_PERMA        0.82  0.91    1  141    2  142  141    0    0  142  A4ZQJ3     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  382 : A4ZQK9_PERMA        0.82  0.93    1  141    2  142  141    0    0  142  A4ZQK9     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  383 : A4ZQM1_PERMA        0.82  0.92    1  141    2  142  141    0    0  142  A4ZQM1     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  384 : B3RFA9_SORAR        0.82  0.95  144  285    3  144  142    0    0  301  B3RFA9     Putative uncharacterized protein SH_m009_jsmB0827r OS=Sorex araneus GN=SH_m009_jsmB0827r PE=3 SV=1
  385 : B4USM6_OTOGA        0.82  0.95  144  288    3  147  145    0    0  147  B4USM6     Hemoglobin subunit gamma (Predicted) OS=Otolemur garnettii GN=HBG PE=3 SV=1
  386 : B8K132_RABIT        0.82  0.96    1  141    2  142  141    0    0  142  B8K132     Alpha-hemoglobin (Predicted) OS=Oryctolagus cuniculus GN=HBA PE=3 SV=1
  387 : C7S347_PERMA        0.82  0.92    1  141    2  141  141    1    1  141  C7S347     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  388 : C7S362_PERMA        0.82  0.92    1  141    2  141  141    1    1  141  C7S362     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  389 : C7S368_PERMA        0.82  0.92    1  141    2  141  141    1    1  141  C7S368     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  390 : C7S386_PERMA        0.82  0.91    1  141    2  141  141    1    1  141  C7S386     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  391 : C7S392_PERMA        0.82  0.91    1  141    2  141  141    1    1  141  C7S392     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  392 : C7S395_PERMA        0.82  0.91    1  141    2  141  141    1    1  141  C7S395     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  393 : C7S3A1_PERMA        0.82  0.91    1  141    2  141  141    1    1  141  C7S3A1     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  394 : C7S3B8_PERMA        0.82  0.91    1  141    2  141  141    1    1  141  C7S3B8     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  395 : C7S3J6_PERMA        0.82  0.91    1  141    2  141  141    1    1  141  C7S3J6     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  396 : D3TTJ9_DELDE        0.82  0.96    1  141    2  142  141    0    0  142  D3TTJ9     Hemoglobin alpha3 chain OS=Delphinus delphis PE=2 SV=1
  397 : D3U1H2_LOXAF        0.82  0.96    1  141    2  142  141    0    0  142  D3U1H2     Hemoglobin subunit alpha OS=Loxodonta africana GN=HBA-T2 PE=2 SV=1
  398 : E1BEL8_BOVIN        0.82  0.97  144  288    3  147  145    0    0  147  E1BEL8     Uncharacterized protein OS=Bos taurus GN=LOC100850173 PE=3 SV=1
  399 : F6X4Z3_CALJA        0.82  0.96  144  288    3  147  145    0    0  147  F6X4Z3     Hemoglobin subunit epsilon OS=Callithrix jacchus GN=HBE1 PE=3 SV=1
  400 : G5BS35_HETGA        0.82  0.94  144  288    3  147  145    0    0  147  G5BS35     Hemoglobin subunit epsilon-1 OS=Heterocephalus glaber GN=GW7_03826 PE=3 SV=1
  401 : G8ZF10_RABIT        0.82  0.96    1  141    2  142  141    0    0  142  G8ZF10     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  402 : G8ZF12_RABIT        0.82  0.96    1  141    2  142  141    0    0  142  G8ZF12     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  403 : G8ZF33_RABIT        0.82  0.96    1  141    2  142  141    0    0  142  G8ZF33     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  404 : G8ZF55_RABIT        0.82  0.94    1  141    2  142  141    0    0  142  G8ZF55     Alpha-globin 2 OS=Oryctolagus cuniculus GN=HBA2 PE=3 SV=1
  405 : HBA1_EQUGR          0.82  0.93    1  141    2  142  141    0    0  142  Q9XSN2     Hemoglobin subunit alpha-1 OS=Equus grevyi GN=HBA1 PE=2 SV=3
  406 : HBA_CRIGA           0.82  0.94    1  141    2  142  141    0    0  142  P19014     Hemoglobin subunit alpha OS=Cricetomys gambianus GN=HBA PE=1 SV=2
  407 : HBA_DASNO           0.82  0.94    1  141    1  141  141    0    0  141  P01964     Hemoglobin subunit alpha OS=Dasypus novemcinctus GN=HBA PE=1 SV=1
  408 : HBA_ERIEU           0.82  0.94    1  141    1  141  141    0    0  141  P01949     Hemoglobin subunit alpha OS=Erinaceus europaeus GN=HBA PE=1 SV=1
  409 : HBA_LAMGL           0.82  0.96    1  141    1  141  141    0    0  141  P01973     Hemoglobin subunit alpha OS=Lama glama GN=HBA PE=1 SV=1
  410 : HBA_LOXAF           0.82  0.96    1  141    1  141  141    0    0  141  P01955     Hemoglobin subunit alpha OS=Loxodonta africana GN=HBA PE=1 SV=1
  411 : HBA_RABIT   2RAO    0.82  0.96    1  141    2  142  141    0    0  142  P01948     Hemoglobin subunit alpha-1/2 OS=Oryctolagus cuniculus PE=1 SV=2
  412 : HBA_SCICA           0.82  0.95    1  141    1  141  141    0    0  141  B3EWD1     Hemoglobin subunit alpha OS=Sciurus carolinensis PE=1 SV=1
  413 : HBE1_CAPHI          0.82  0.97  144  288    3  147  145    0    0  147  P02102     Hemoglobin subunit epsilon-1 OS=Capra hircus GN=HBE1 PE=2 SV=2
  414 : HBE_CALGE           0.82  0.96  144  283    3  142  140    0    0  142  O13071     Hemoglobin subunit epsilon (Fragment) OS=Callithrix geoffroyi GN=HBE1 PE=2 SV=3
  415 : HBE_CHEME           0.82  0.97  144  288    3  147  145    0    0  147  Q28338     Hemoglobin subunit epsilon OS=Cheirogaleus medius GN=HBE1 PE=2 SV=3
  416 : HBE_DAUMA           0.82  0.97  144  288    3  147  145    0    0  147  Q28356     Hemoglobin subunit epsilon OS=Daubentonia madagascariensis GN=HBE1 PE=2 SV=3
  417 : HBE_MACEU           0.82  0.98  144  288    3  147  145    0    0  147  P81042     Hemoglobin subunit epsilon OS=Macropus eugenii GN=HBE1 PE=1 SV=3
  418 : HBE_MICMU           0.82  0.96  144  288    3  147  145    0    0  147  Q28496     Hemoglobin subunit epsilon OS=Microcebus murinus GN=HBE1 PE=2 SV=3
  419 : HBG_OTOCR           0.82  0.95  144  288    3  147  145    0    0  147  P19760     Hemoglobin subunit gamma OS=Otolemur crassicaudatus GN=HBG PE=2 SV=3
  420 : L8HUG2_BOSMU        0.82  0.97  144  288    7  151  145    0    0  151  L8HUG2     Hemoglobin subunit epsilon-1 (Fragment) OS=Bos grunniens mutus GN=M91_21166 PE=3 SV=1
  421 : L9KL50_TUPCH        0.82  0.95  144  288    3  147  145    0    0  147  L9KL50     Hemoglobin subunit epsilon OS=Tupaia chinensis GN=TREES_T100005451 PE=3 SV=1
  422 : A4ZQL1_PERMA        0.81  0.91    1  141    2  142  141    0    0  142  A4ZQL1     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  423 : A4ZQL9_PERMA        0.81  0.92    1  141    2  141  141    1    1  141  A4ZQL9     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  424 : A4ZQM2_PERMA        0.81  0.91    1  141    2  141  141    1    1  141  A4ZQM2     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  425 : B0VXB7_CALJA        0.81  0.96  144  288    3  147  145    0    0  147  B0VXB7     A-gamma globin (Predicted) OS=Callithrix jacchus GN=HBG1 PE=3 SV=1
  426 : B1MT82_CALMO        0.81  0.96  144  288    3  147  145    0    0  147  B1MT82     A-gamma globin (Predicted) OS=Callicebus moloch GN=HBG1 PE=3 SV=1
  427 : B2KHZ7_RHIFE        0.81  0.97  144  288    3  147  145    0    0  147  B2KHZ7     Hemoglobin, epsilon 1 (Predicted) OS=Rhinolophus ferrumequinum GN=HBE1 PE=3 SV=1
  428 : B4USM7_OTOGA        0.81  0.96  144  288    3  147  145    0    0  147  B4USM7     A-gamma globin (Predicted) OS=Otolemur garnettii GN=HBG1 PE=3 SV=1
  429 : B7SBL1_PERMA        0.81  0.95  144  288    3  147  145    0    0  147  B7SBL1     Epsilon-globin OS=Peromyscus maniculatus GN=HBE-T1 PE=3 SV=1
  430 : B7SPR7_PERLE        0.81  0.95  144  288    3  147  145    0    0  147  B7SPR7     Epsilon globin OS=Peromyscus leucopus PE=3 SV=1
  431 : C7S343_PERMA        0.81  0.92    1  141    2  141  141    1    1  141  C7S343     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  432 : C7S352_PERMA        0.81  0.91    1  141    2  141  141    1    1  141  C7S352     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  433 : C7S356_PERMA        0.81  0.91    1  141    2  142  141    0    0  142  C7S356     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  434 : C7S357_PERMA        0.81  0.92    1  141    2  141  141    1    1  141  C7S357     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  435 : C7S359_PERMA        0.81  0.92    1  141    2  142  141    0    0  142  C7S359     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  436 : C7S361_PERMA        0.81  0.91    1  141    2  141  141    1    1  141  C7S361     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  437 : C7S364_PERMA        0.81  0.90    1  141    2  141  141    1    1  141  C7S364     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  438 : C7S371_PERMA        0.81  0.91    1  141    2  142  141    0    0  142  C7S371     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  439 : C7S377_PERMA        0.81  0.90    1  141    2  141  141    1    1  141  C7S377     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  440 : C7S387_PERMA        0.81  0.92    1  140    2  141  140    0    0  142  C7S387     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  441 : C7S3A9_PERMA        0.81  0.91    1  141    2  142  141    0    0  142  C7S3A9     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  442 : C7S3B6_PERMA        0.81  0.91    1  141    2  141  141    1    1  141  C7S3B6     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  443 : D9I2F5_SCAAQ        0.81  0.93    5  141    1  137  137    0    0  137  D9I2F5     Hemoglobin subunit alpha 1 (Fragment) OS=Scalopus aquaticus GN=HBA1 PE=2 SV=1
  444 : D9I2F7_SCAAQ        0.81  0.93    1  141    2  142  141    0    0  142  D9I2F7     Hemoglobin subunit alpha 2 OS=Scalopus aquaticus GN=HBA2 PE=2 SV=1
  445 : G1M482_AILME        0.81  0.97  144  288    3  147  145    0    0  147  G1M482     Uncharacterized protein OS=Ailuropoda melanoleuca GN=LOC100482027 PE=3 SV=1
  446 : G1S6D0_NOMLE        0.81  0.95  144  288   48  192  145    0    0  192  G1S6D0     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100582195 PE=3 SV=2
  447 : G5E759_LOXAF        0.81  0.97  144  288    3  147  145    0    0  147  G5E759     Uncharacterized protein OS=Loxodonta africana GN=LOC100677792 PE=3 SV=1
  448 : G8ZF40_RABIT        0.81  0.95    1  141    2  142  141    0    0  142  G8ZF40     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
  449 : G8ZF59_RABIT        0.81  0.94    1  141    2  142  141    0    0  142  G8ZF59     Alpha-globin 2 OS=Oryctolagus cuniculus GN=HBA2 PE=3 SV=1
  450 : H0VVL2_CAVPO        0.81  0.95  144  288    3  147  145    0    0  147  H0VVL2     Uncharacterized protein OS=Cavia porcellus GN=LOC100720679 PE=3 SV=1
  451 : H2NED5_PONAB        0.81  0.96  144  288    3  147  145    0    0  147  H2NED5     Uncharacterized protein OS=Pongo abelii GN=HBE1 PE=3 SV=1
  452 : HBA_BRATR           0.81  0.92    1  141    1  141  141    0    0  141  P14525     Hemoglobin subunit alpha OS=Bradypus tridactylus GN=HBA PE=1 SV=1
  453 : HBA_DASVI           0.81  0.93    1  141    2  142  141    0    0  142  P07419     Hemoglobin subunit alpha OS=Dasyurus viverrinus GN=HBA PE=2 SV=2
  454 : HBA_MACGI           0.81  0.91    1  141    1  141  141    0    0  141  P01975     Hemoglobin subunit alpha OS=Macropus giganteus GN=HBA PE=1 SV=1
  455 : HBA_TRIIN           0.81  0.94    1  141    1  141  141    0    0  141  P07414     Hemoglobin subunit alpha OS=Trichechus inunguis GN=HBA PE=1 SV=1
  456 : HBA_TUPGL           0.81  0.95    1  141    1  141  141    0    0  141  P01941     Hemoglobin subunit alpha OS=Tupaia glis GN=HBA PE=1 SV=1
  457 : HBE_ALOBE           0.81  0.96  144  288    3  147  145    0    0  147  P68017     Hemoglobin subunit epsilon OS=Alouatta belzebul GN=HBE1 PE=2 SV=2
  458 : HBE_ALOSE           0.81  0.96  144  288    3  147  145    0    0  147  P68018     Hemoglobin subunit epsilon OS=Alouatta seniculus GN=HBE1 PE=2 SV=2
  459 : HBE_AOTAZ           0.81  0.96  144  288    3  147  145    0    0  147  P68016     Hemoglobin subunit epsilon OS=Aotus azarae GN=HBE1 PE=2 SV=2
  460 : HBE_ATEGE           0.81  0.96  144  288    3  147  145    0    0  147  P68019     Hemoglobin subunit epsilon OS=Ateles geoffroyi GN=HBE1 PE=2 SV=2
  461 : HBE_BRAAR           0.81  0.96  144  288    3  147  145    0    0  147  P68020     Hemoglobin subunit epsilon OS=Brachyteles arachnoides GN=HBE1 PE=2 SV=2
  462 : HBE_CACCA           0.81  0.96  144  288    3  147  145    0    0  147  P68021     Hemoglobin subunit epsilon OS=Cacajao calvus GN=HBE1 PE=2 SV=2
  463 : HBE_CALGO           0.81  0.96  144  288    3  147  145    0    0  147  P68024     Hemoglobin subunit epsilon OS=Callimico goeldii GN=HBE1 PE=2 SV=2
  464 : HBE_CALJA           0.81  0.96  144  288    3  147  145    0    0  147  P68026     Hemoglobin subunit epsilon OS=Callithrix jacchus GN=HBE1 PE=2 SV=2
  465 : HBE_CALMO           0.81  0.96  144  288    3  147  145    0    0  147  P68022     Hemoglobin subunit epsilon OS=Callicebus moloch GN=HBE1 PE=2 SV=2
  466 : HBE_CALPY           0.81  0.96  144  288    3  147  145    0    0  147  P68027     Hemoglobin subunit epsilon OS=Callithrix pygmaea GN=HBE1 PE=2 SV=2
  467 : HBE_CALTO           0.81  0.96  144  288    3  147  145    0    0  147  P68023     Hemoglobin subunit epsilon OS=Callicebus torquatus GN=HBE1 PE=2 SV=2
  468 : HBE_CHISA           0.81  0.96  144  288    3  147  145    0    0  147  P68025     Hemoglobin subunit epsilon OS=Chiropotes satanas GN=HBE1 PE=2 SV=2
  469 : HBE_EULFU           0.81  0.97  144  288    3  147  145    0    0  147  P08223     Hemoglobin subunit epsilon OS=Eulemur fulvus fulvus GN=HBE1 PE=2 SV=2
  470 : HBE_HYLSY           0.81  0.95  144  288    3  147  145    0    0  147  Q95190     Hemoglobin subunit epsilon OS=Hylobates syndactylus GN=HBE1 PE=2 SV=3
  471 : HBE_LEORO           0.81  0.96  144  288    3  147  145    0    0  147  P51441     Hemoglobin subunit epsilon OS=Leontopithecus rosalia GN=HBE1 PE=2 SV=2
  472 : HBE_PONPY           0.81  0.96  144  288    3  147  145    0    0  147  P18994     Hemoglobin subunit epsilon OS=Pongo pygmaeus GN=HBE1 PE=2 SV=2
  473 : HBE_SAGMI           0.81  0.95  144  288    3  147  145    0    0  147  P51443     Hemoglobin subunit epsilon OS=Saguinus midas GN=HBE1 PE=2 SV=2
  474 : HBE_SMICR           0.81  0.95  144  288    3  147  145    0    0  147  Q28931     Hemoglobin subunit epsilon OS=Sminthopsis crassicaudata GN=HBE1 PE=2 SV=3
  475 : HBG_DUGDU           0.81  0.93  145  288    4  147  144    0    0  147  Q45XH5     Hemoglobin subunit gamma OS=Dugong dugon GN=HBG PE=2 SV=3
  476 : L8YGS9_TUPCH        0.81  0.95    1  141    2  142  141    0    0  142  L8YGS9     Hemoglobin subunit alpha OS=Tupaia chinensis GN=TREES_T100001160 PE=3 SV=1
  477 : L9KLQ0_TUPCH        0.81  0.97  144  288    3  147  145    0    0  147  L9KLQ0     Hemoglobin subunit epsilon-1 OS=Tupaia chinensis GN=TREES_T100005452 PE=3 SV=1
  478 : M3VYK8_FELCA        0.81  0.96  144  288    3  148  146    1    1  148  M3VYK8     Uncharacterized protein OS=Felis catus GN=HBE1 PE=3 SV=1
  479 : Q95233_9PRIM        0.81  0.96  144  283    3  142  140    0    0  142  Q95233     Epsilon globin (Fragment) OS=Perodicticus potto PE=3 SV=1
  480 : Q9CY10_MOUSE        0.81  0.91    2  141    4  142  140    1    1  142  Q9CY10     Putative uncharacterized protein OS=Mus musculus GN=Hba-a1 PE=2 SV=1
  481 : A4ZQI1_PERMA        0.80  0.89    1  141    2  141  141    1    1  141  A4ZQI1     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  482 : A4ZQI8_PERMA        0.80  0.89   12  141    9  137  130    1    1  137  A4ZQI8     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  483 : C7S342_PERMA        0.80  0.91    1  141    2  141  141    1    1  141  C7S342     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  484 : C7S344_PERMA        0.80  0.91    1  141    2  141  141    1    1  141  C7S344     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  485 : C7S348_PERMA        0.80  0.91    1  141    2  141  141    1    1  141  C7S348     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  486 : C7S350_PERMA        0.80  0.91    1  141    2  141  141    1    1  141  C7S350     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  487 : C7S384_PERMA        0.80  0.91    1  141    2  141  141    1    1  141  C7S384     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  488 : C7S398_PERMA        0.80  0.91    1  141    2  141  141    1    1  141  C7S398     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  489 : D9I2F2_SCAAQ        0.80  0.92    1  141    2  142  141    0    0  142  D9I2F2     Hemoglobin subunit alpha 1 OS=Scalopus aquaticus GN=HBA1 PE=2 SV=1
  490 : D9YZU7_HUMAN        0.80  0.96  144  288    3  147  145    0    0  147  D9YZU7     Hemoglobin, epsilon 1 OS=Homo sapiens GN=HBE1 PE=2 SV=1
  491 : F6RF57_HORSE        0.80  0.97  144  288    3  147  145    0    0  147  F6RF57     Uncharacterized protein OS=Equus caballus GN=HBE1 PE=3 SV=1
  492 : F6WII6_MONDO        0.80  0.95  144  288    3  147  145    0    0  147  F6WII6     Uncharacterized protein OS=Monodelphis domestica GN=LOC100019461 PE=3 SV=2
  493 : G3HBR8_CRIGR        0.80  0.94    1  141    2  142  141    0    0  142  G3HBR8     Hemoglobin subunit alpha OS=Cricetulus griseus GN=I79_007867 PE=3 SV=1
  494 : G3SDD4_GORGO        0.80  0.96  144  288    7  151  145    0    0  151  G3SDD4     Hemoglobin subunit epsilon (Fragment) OS=Gorilla gorilla gorilla GN=HBE1 PE=3 SV=1
  495 : G3VJC1_SARHA        0.80  0.96  144  288    3  147  145    0    0  147  G3VJC1     Uncharacterized protein OS=Sarcophilus harrisii PE=3 SV=1
  496 : G7NE40_MACMU        0.80  0.96  144  288    3  147  145    0    0  147  G7NE40     Hemoglobin epsilon chain OS=Macaca mulatta GN=EGK_06583 PE=2 SV=1
  497 : G8F3D2_MACFA        0.80  0.96  144  288    3  147  145    0    0  147  G8F3D2     Hemoglobin epsilon chain OS=Macaca fascicularis GN=EGM_19916 PE=3 SV=1
  498 : H6UZ35_PERMA        0.80  0.94  144  288    3  147  145    0    0  147  H6UZ35     Epsilon-globin OS=Peromyscus maniculatus GN=HBE-T1 PE=3 SV=1
  499 : HBA_MACEU           0.80  0.91    1  141    2  142  141    0    0  142  P81043     Hemoglobin subunit alpha OS=Macropus eugenii GN=HBA PE=1 SV=3
  500 : HBE_ATEBE           0.80  0.96  144  288    3  147  145    0    0  147  P51438     Hemoglobin subunit epsilon OS=Ateles belzebuth GN=HBE1 PE=2 SV=2
  501 : HBE_DIDVI           0.80  0.95  144  288    3  147  145    0    0  147  P11025     Hemoglobin subunit epsilon-M OS=Didelphis virginiana GN=HBE1 PE=2 SV=2
  502 : HBE_GORGO           0.80  0.96  144  288    3  147  145    0    0  147  Q6LDH0     Hemoglobin subunit epsilon OS=Gorilla gorilla gorilla GN=HBE1 PE=2 SV=3
  503 : HBE_HUMAN   1A9W    0.80  0.96  144  288    3  147  145    0    0  147  P02100     Hemoglobin subunit epsilon OS=Homo sapiens GN=HBE1 PE=1 SV=2
  504 : HBE_LAGLA           0.80  0.95  144  288    3  147  145    0    0  147  P51440     Hemoglobin subunit epsilon OS=Lagothrix lagotricha GN=HBE1 PE=2 SV=2
  505 : HBE_MACMU           0.80  0.96  144  288    3  147  145    0    0  147  Q28507     Hemoglobin subunit epsilon OS=Macaca mulatta GN=HBE1 PE=2 SV=3
  506 : HBE_OTOCR           0.80  0.96  144  288    3  147  145    0    0  147  P19759     Hemoglobin subunit epsilon OS=Otolemur crassicaudatus GN=HBE1 PE=2 SV=2
  507 : HBE_PANTR           0.80  0.96  144  288    3  147  145    0    0  147  Q6LDH1     Hemoglobin subunit epsilon OS=Pan troglodytes GN=HBE1 PE=2 SV=3
  508 : HBE_PITIR           0.80  0.95  144  288    3  147  145    0    0  147  P51442     Hemoglobin subunit epsilon OS=Pithecia irrorata GN=HBE1 PE=2 SV=2
  509 : HBE_SAIBB           0.80  0.96  144  288    3  147  145    0    0  147  P68029     Hemoglobin subunit epsilon OS=Saimiri boliviensis boliviensis GN=HBE1 PE=2 SV=2
  510 : HBE_SAISC           0.80  0.96  144  288    3  147  145    0    0  147  P68028     Hemoglobin subunit epsilon OS=Saimiri sciureus GN=HBE1 PE=2 SV=2
  511 : A4ZQG6_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  A4ZQG6     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  512 : A4ZQG8_PERMA        0.79  0.89    1  141    2  142  141    0    0  142  A4ZQG8     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  513 : A4ZQG9_PERMA        0.79  0.91    1  141    2  141  141    1    1  141  A4ZQG9     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  514 : A4ZQH0_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  A4ZQH0     Alpha globin OS=Peromyscus maniculatus PE=3 SV=1
  515 : A4ZQH1_PERMA        0.79  0.91    1  141    2  142  141    0    0  142  A4ZQH1     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  516 : A4ZQH2_PERMA        0.79  0.89    1  140    2  140  140    1    1  141  A4ZQH2     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  517 : A4ZQH3_PERMA        0.79  0.89    1  140    2  140  140    1    1  141  A4ZQH3     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  518 : A4ZQI0_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  A4ZQI0     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  519 : A4ZQJ0_PERMA        0.79  0.91    1  141    2  141  141    1    1  141  A4ZQJ0     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  520 : A4ZQJ1_PERMA        0.79  0.90    1  141    2  141  141    1    1  141  A4ZQJ1     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  521 : A4ZQJ8_PERMA        0.79  0.88    1  141    2  141  141    1    1  141  A4ZQJ8     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  522 : A4ZQK0_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  A4ZQK0     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  523 : A4ZQK2_PERMA        0.79  0.91    1  141    2  141  141    1    1  141  A4ZQK2     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  524 : A4ZQK3_PERMA        0.79  0.91    1  141    2  142  141    0    0  142  A4ZQK3     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  525 : A4ZQK5_PERMA        0.79  0.88    1  141    2  141  141    1    1  141  A4ZQK5     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  526 : A4ZQK6_PERMA        0.79  0.91    1  141    2  141  141    1    1  141  A4ZQK6     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  527 : A4ZQK8_PERMA        0.79  0.91    1  141    2  141  141    1    1  141  A4ZQK8     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  528 : A4ZQL3_PERMA        0.79  0.91    1  141    2  141  141    1    1  141  A4ZQL3     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  529 : A4ZQL4_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  A4ZQL4     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  530 : A4ZQL5_PERMA        0.79  0.91    1  141    2  141  141    1    1  141  A4ZQL5     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  531 : A4ZQL6_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  A4ZQL6     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  532 : A4ZQL8_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  A4ZQL8     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  533 : A4ZQM3_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  A4ZQM3     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  534 : A4ZQM7_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  A4ZQM7     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  535 : A4ZQM9_PERLE        0.79  0.91    1  141    2  142  141    0    0  142  A4ZQM9     Hemoglobin alpha subunit 1 OS=Peromyscus leucopus PE=3 SV=1
  536 : A9L8Y1_PAPAN        0.79  0.96  144  288    3  147  145    0    0  147  A9L8Y1     Hemoglobin, gamma A (Predicted) OS=Papio anubis GN=HBG1 PE=3 SV=1
  537 : B6CVB2_PERMA        0.79  0.89    1  140    2  140  140    1    1  141  B6CVB2     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  538 : B6CVB7_PERMA        0.79  0.90    1  141    2  141  141    1    1  141  B6CVB7     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  539 : B8K175_RABIT        0.79  0.94  144  288    3  147  145    0    0  147  B8K175     G-gamma globin (Predicted) OS=Oryctolagus cuniculus GN=HBG2 PE=3 SV=1
  540 : B8K176_RABIT        0.79  0.94  144  288    3  147  145    0    0  147  B8K176     A-gamma globin (Predicted) OS=Oryctolagus cuniculus GN=HBG1 PE=3 SV=1
  541 : C1FY21_DASNO        0.79  0.97  144  288    3  147  145    0    0  147  C1FY21     Hemoglobin, epsilon 1 (Predicted) OS=Dasypus novemcinctus GN=HBE1 PE=3 SV=1
  542 : C7S341_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  C7S341     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  543 : C7S351_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  C7S351     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  544 : C7S358_PERMA        0.79  0.90    1  141    2  141  141    1    1  141  C7S358     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  545 : C7S365_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  C7S365     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  546 : C7S370_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  C7S370     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  547 : C7S373_PERMA        0.79  0.91    1  141    2  141  141    1    1  141  C7S373     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  548 : C7S374_PERMA        0.79  0.90    1  141    2  141  141    1    1  141  C7S374     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  549 : C7S379_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  C7S379     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  550 : C7S380_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  C7S380     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  551 : C7S383_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  C7S383     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  552 : C7S389_PERMA        0.79  0.90    1  141    2  142  141    0    0  142  C7S389     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  553 : C7S396_PERMA        0.79  0.91    1  141    2  142  141    0    0  142  C7S396     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  554 : C7S399_PERMA        0.79  0.91    1  141    2  141  141    1    1  141  C7S399     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  555 : C7S3A8_PERMA        0.79  0.90    1  141    2  142  141    0    0  142  C7S3A8     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  556 : C7S3B1_PERMA        0.79  0.90    1  141    2  141  141    1    1  141  C7S3B1     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  557 : C7S3B9_PERMA        0.79  0.89    1  141    2  141  141    1    1  141  C7S3B9     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  558 : F1RII6_PIG          0.79  0.96  144  288    3  147  145    0    0  147  F1RII6     Hemoglobin subunit epsilon OS=Sus scrofa GN=HBE1 PE=2 SV=1
  559 : F7AI41_ORNAN        0.79  0.96  144  288    7  151  145    0    0  151  F7AI41     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus GN=LOC100088690 PE=3 SV=1
  560 : G1Q4K6_MYOLU        0.79  0.97  144  288    3  147  145    0    0  147  G1Q4K6     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
  561 : G1TPE2_RABIT        0.79  0.94  144  288    8  152  145    0    0  152  G1TPE2     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus GN=HBG1 PE=3 SV=1
  562 : G3N1Y3_BOVIN        0.79  0.91  172  288    1  117  117    0    0  117  G3N1Y3     Uncharacterized protein (Fragment) OS=Bos taurus PE=3 SV=1
  563 : G8ZF57_RABIT        0.79  0.92    1  141    2  142  141    0    0  142  G8ZF57     Alpha-globin 2 OS=Oryctolagus cuniculus GN=HBA2 PE=3 SV=1
  564 : H0WQ67_OTOGA        0.79  0.91    1  141    2  142  141    0    0  142  H0WQ67     Uncharacterized protein OS=Otolemur garnettii GN=HBQ1 PE=3 SV=1
  565 : HBE_CEBAL           0.79  0.95  144  288    3  147  145    0    0  147  Q28220     Hemoglobin subunit epsilon OS=Cebus albifrons GN=HBE1 PE=2 SV=3
  566 : HBE_CEBKA           0.79  0.95  144  288    3  147  145    0    0  147  Q7JFR7     Hemoglobin subunit epsilon OS=Cebus kaapori GN=HBE1 PE=2 SV=3
  567 : HBE_CEBOL           0.79  0.95  144  288    3  147  145    0    0  147  Q29415     Hemoglobin subunit epsilon OS=Cebus olivaceus GN=HBE1 PE=2 SV=3
  568 : HBE_PANPA           0.79  0.96  144  288    3  147  145    0    0  147  Q28775     Hemoglobin subunit epsilon OS=Pan paniscus GN=HBE1 PE=2 SV=3
  569 : HBE_PROVE           0.79  0.96  144  288    3  147  145    0    0  147  Q95238     Hemoglobin subunit epsilon OS=Propithecus verreauxi GN=HBE1 PE=2 SV=3
  570 : HBE_RABIT           0.79  0.94  144  288    3  147  145    0    0  147  P02103     Hemoglobin subunit epsilon OS=Oryctolagus cuniculus GN=HBE1 PE=2 SV=2
  571 : HBG_RABIT           0.79  0.94  144  288    3  147  145    0    0  147  P02099     Hemoglobin subunit gamma OS=Oryctolagus cuniculus GN=HBG PE=2 SV=2
  572 : HBG_TRIMA           0.79  0.93  144  288    3  147  145    0    0  147  Q45XH6     Hemoglobin subunit gamma OS=Trichechus manatus GN=HBG PE=2 SV=3
  573 : HBT_PIG             0.79  0.96  144  288    2  146  145    0    0  146  P04246     Hemoglobin subunit theta OS=Sus scrofa PE=1 SV=1
  574 : I3MVJ8_SPETR        0.79  0.96  144  288    3  147  145    0    0  147  I3MVJ8     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=HBE1 PE=3 SV=1
  575 : A4ZQG4_PERMA        0.78  0.89    1  137    2  137  137    1    1  140  A4ZQG4     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  576 : A4ZQI5_PERMA        0.78  0.89    1  137    2  137  137    1    1  140  A4ZQI5     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  577 : A4ZQJ4_PERMA        0.78  0.90    1  141    2  141  141    1    1  141  A4ZQJ4     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  578 : A4ZQK4_PERMA        0.78  0.88    1  141    2  141  141    1    1  141  A4ZQK4     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  579 : A4ZQM0_PERMA        0.78  0.90    1  141    2  141  141    1    1  141  A4ZQM0     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  580 : B1H216_RAT          0.78  0.92    1  141    2  142  141    0    0  142  B1H216     Hemoglobin alpha, adult chain 2 OS=Rattus norvegicus GN=Hba1 PE=2 SV=1
  581 : B2BSP2_PERMA        0.78  0.89    1  141    2  142  141    0    0  142  B2BSP2     Hemoglobin alpha chain OS=Peromyscus maniculatus GN=HBAT3 PE=3 SV=1
  582 : B5SXU5_PERMA        0.78  0.88    1  141    2  141  141    1    1  141  B5SXU5     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
  583 : C7S345_PERMA        0.78  0.89    1  141    2  141  141    1    1  141  C7S345     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  584 : C7S372_PERMA        0.78  0.89    1  141    2  142  141    0    0  142  C7S372     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  585 : C7S388_PERMA        0.78  0.88    1  141    2  141  141    1    1  141  C7S388     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  586 : C7S391_PERMA        0.78  0.88    1  141    2  141  141    1    1  141  C7S391     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  587 : C7S3B3_PERMA        0.78  0.89    1  141    2  141  141    1    1  141  C7S3B3     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  588 : C7S3C0_PERMA        0.78  0.91    1  141    2  141  141    1    1  141  C7S3C0     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  589 : D9I2F0_SCAOR        0.78  0.93  153  283    1  131  131    0    0  131  D9I2F0     Hemoglobin subunit delta (Fragment) OS=Scapanus orarius GN=HBD PE=2 SV=1
  590 : F6PNA4_CANFA        0.78  0.95  144  288    3  147  145    0    0  147  F6PNA4     Uncharacterized protein OS=Canis familiaris GN=LOC480784 PE=3 SV=1
  591 : G1M487_AILME        0.78  0.92  144  288    3  147  145    0    0  147  G1M487     Uncharacterized protein OS=Ailuropoda melanoleuca GN=LOC100482027 PE=3 SV=1
  592 : G9K3W2_MUSPF        0.78  0.97  144  287    6  149  144    0    0  149  G9K3W2     Hemoglobin, gamma A (Fragment) OS=Mustela putorius furo PE=2 SV=1
  593 : H6UZ66_PERMA        0.78  0.92  144  288    3  147  145    0    0  147  H6UZ66     Gamma-globin subunit OS=Peromyscus maniculatus GN=HBG-T1 PE=3 SV=1
  594 : HBA_RAT     3HF4    0.78  0.92    1  141    2  142  141    0    0  142  P01946     Hemoglobin subunit alpha-1/2 OS=Rattus norvegicus GN=Hba1 PE=1 SV=3
  595 : HBB_BLABR           0.78  0.94  144  287    2  145  144    0    0  146  B3EWE2     Hemoglobin subunit beta OS=Blarina brevicauda PE=1 SV=1
  596 : HBB_MACGG           0.78  0.95  144  288    2  146  145    0    0  146  P24660     Hemoglobin subunit beta OS=Macroderma gigas GN=HBB PE=1 SV=1
  597 : HBB_PHOVI           0.78  0.94  144  288    2  146  145    0    0  146  P09909     Hemoglobin subunit beta OS=Phoca vitulina GN=HBB PE=1 SV=1
  598 : HBE_TARSY           0.78  0.96  144  288    3  147  145    0    0  147  P18435     Hemoglobin subunit epsilon OS=Tarsius syrichta GN=HBE1 PE=2 SV=2
  599 : HBG_TARBA           0.78  0.95  144  288    3  147  145    0    0  147  O77655     Hemoglobin subunit gamma OS=Tarsius bancanus GN=HBG PE=2 SV=3
  600 : L5MBE6_MYODS        0.78  0.97  144  288    3  147  145    0    0  147  L5MBE6     Hemoglobin subunit epsilon OS=Myotis davidii GN=MDA_GLEAN10001458 PE=3 SV=1
  601 : M3YFF9_MUSPF        0.78  0.96  144  287    6  149  144    0    0  149  M3YFF9     Uncharacterized protein (Fragment) OS=Mustela putorius furo GN=Hbb-bh1 PE=3 SV=1
  602 : O88752_RAT          0.78  0.95  144  288    3  147  145    0    0  147  O88752     Epsilon 1 globin OS=Rattus norvegicus GN=Hbe1 PE=2 SV=1
  603 : A4ZQG2_PERMA        0.77  0.89    1  137    2  137  137    1    1  140  A4ZQG2     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  604 : A4ZQJ7_PERMA        0.77  0.87    1  141    2  141  141    1    1  141  A4ZQJ7     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
  605 : B7SBL2_PERMA        0.77  0.93  144  288    3  147  145    0    0  147  B7SBL2     Gamma/epsilon-globin fusion protein OS=Peromyscus maniculatus GN=HBG/E fusion PE=3 SV=1
  606 : B7SBL3_PERMA        0.77  0.92  144  288    3  147  145    0    0  147  B7SBL3     HBG-T2 OS=Peromyscus maniculatus PE=3 SV=1
  607 : B7SPR8_PERLE        0.77  0.92  144  288    3  147  145    0    0  147  B7SPR8     Gamma globin OS=Peromyscus leucopus PE=3 SV=1
  608 : C6KGT1_MACMU        0.77  0.94  144  288    3  147  145    0    0  147  C6KGT1     Beta hemoglobin OS=Macaca mulatta PE=2 SV=1
  609 : C7S367_PERMA        0.77  0.88    1  141    2  142  141    0    0  142  C7S367     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
  610 : E1BIF9_BOVIN        0.77  0.94  144  288    3  147  145    0    0  147  E1BIF9     Uncharacterized protein OS=Bos taurus PE=3 SV=1
  611 : F1PYZ1_CANFA        0.77  0.92  144  287    6  149  144    0    0  149  F1PYZ1     Uncharacterized protein (Fragment) OS=Canis familiaris GN=HBG2 PE=3 SV=2
  612 : G9K3W0_MUSPF        0.77  0.94  144  287    9  152  144    0    0  152  G9K3W0     Hemoglobin, delta (Fragment) OS=Mustela putorius furo PE=2 SV=1
  613 : H6UZ47_PERMA        0.77  0.92  144  288    3  147  145    0    0  147  H6UZ47     Gamma/epsilon-globin fusion protein OS=Peromyscus maniculatus GN=HBG/E fusion PE=3 SV=1
  614 : H6UZ53_PERMA        0.77  0.92  144  288    3  147  145    0    0  147  H6UZ53     Gamma/epsilon-globin fusion protein OS=Peromyscus maniculatus GN=HBG/E fusion PE=3 SV=1
  615 : H6UZ56_PERMA        0.77  0.92  144  282    3  141  139    0    0  141  H6UZ56     Gamma/epsilon-globin fusion protein (Fragment) OS=Peromyscus maniculatus GN=HBG/E fusion PE=3 SV=1
  616 : H6UZ57_PERMA        0.77  0.92  144  281    3  140  138    0    0  140  H6UZ57     Gamma/epsilon-globin fusion protein (Fragment) OS=Peromyscus maniculatus GN=HBG/E fusion PE=3 SV=1
  617 : H6UZ59_PERMA        0.77  0.92  144  281    3  140  138    0    0  140  H6UZ59     Gamma/epsilon-globin fusion protein (Fragment) OS=Peromyscus maniculatus GN=HBG/E fusion PE=3 SV=1
  618 : H6UZ62_PERMA        0.77  0.92  144  288    3  147  145    0    0  147  H6UZ62     Gamma-globin subunit OS=Peromyscus maniculatus GN=HBG-T1 PE=3 SV=1
  619 : H6UZ83_PERMA        0.77  0.91  144  288    3  147  145    0    0  147  H6UZ83     Gamma-globin subunit OS=Peromyscus maniculatus GN=HBG-T1 PE=3 SV=1
  620 : H6UZ84_PERMA        0.77  0.91  144  288    3  147  145    0    0  147  H6UZ84     Gamma-globin subunit OS=Peromyscus maniculatus GN=HBG-T1 PE=3 SV=1
  621 : H6UZ92_PERMA        0.77  0.92  144  288    3  147  145    0    0  147  H6UZ92     Gamma-globin subunit OS=Peromyscus maniculatus GN=HBG-T1 PE=3 SV=1
  622 : HBA_ECHTE           0.77  0.89    1  141    1  141  141    0    0  141  P24291     Hemoglobin subunit alpha OS=Echinops telfairi GN=HBA PE=1 SV=1
  623 : HBA_ODOVI   1HDS    0.77  0.89    1  141    1  141  141    0    0  141  P01972     Hemoglobin subunit alpha-1/2 OS=Odocoileus virginianus virginianus PE=1 SV=1
  624 : HBBZ_MOUSE          0.77  0.92  144  288    3  147  145    0    0  147  P04444     Hemoglobin subunit beta-H1 OS=Mus musculus GN=Hbb-bh1 PE=2 SV=3
  625 : HBB_ARCGA           0.77  0.94  144  288    2  146  145    0    0  146  P68047     Hemoglobin subunit beta OS=Arctocephalus galapagoensis GN=HBB PE=1 SV=1
  626 : HBB_HELMA           0.77  0.93  144  288    2  146  145    0    0  146  P68013     Hemoglobin subunit beta OS=Helarctos malayanus GN=HBB PE=1 SV=1
  627 : HBB_LUTLU           0.77  0.94  144  288    2  146  145    0    0  146  P10893     Hemoglobin subunit beta OS=Lutra lutra GN=HBB PE=1 SV=1
  628 : HBB_MANSP           0.77  0.94  144  288    2  146  145    0    0  146  P08259     Hemoglobin subunit beta OS=Mandrillus sphinx GN=HBB PE=1 SV=1
  629 : HBB_MARFO           0.77  0.94  144  288    2  146  145    0    0  146  P68053     Hemoglobin subunit beta OS=Martes foina GN=HBB PE=1 SV=1
  630 : HBB_MELCA           0.77  0.94  144  288    2  146  145    0    0  146  P15449     Hemoglobin subunit beta OS=Mellivora capensis GN=HBB PE=1 SV=1
  631 : HBB_MUSLU           0.77  0.94  144  288    2  146  145    0    0  146  P23602     Hemoglobin subunit beta OS=Mustela lutreola GN=HBB PE=1 SV=1
  632 : HBB_MUSPF           0.77  0.94  144  288    2  146  145    0    0  146  P68044     Hemoglobin subunit beta OS=Mustela putorius furo GN=HBB PE=1 SV=1
  633 : HBB_MUSPU           0.77  0.94  144  288    2  146  145    0    0  146  P68045     Hemoglobin subunit beta OS=Mustela putorius GN=HBB PE=1 SV=1
  634 : HBB_ODORO           0.77  0.94  144  288    2  146  145    0    0  146  P68046     Hemoglobin subunit beta OS=Odobenus rosmarus divergens GN=HBB PE=1 SV=1
  635 : HBB_PAGLA           0.77  0.92  143  288    1  146  146    0    0  146  P19646     Hemoglobin subunit beta OS=Paguma larvata GN=HBB PE=1 SV=1
  636 : HBB_PAPAN           0.77  0.94  144  288    3  147  145    0    0  147  Q9TSP1     Hemoglobin subunit beta OS=Papio anubis GN=HBB PE=2 SV=2
  637 : HBB_PAPCY           0.77  0.94  144  288    2  146  145    0    0  146  P02030     Hemoglobin subunit beta OS=Papio cynocephalus GN=HBB PE=1 SV=1
  638 : HBB_PTEBR           0.77  0.94  144  288    2  146  145    0    0  146  P68052     Hemoglobin subunit beta OS=Pteronura brasiliensis GN=HBB PE=1 SV=1
  639 : HBB_THEGE           0.77  0.94  144  288    2  146  145    0    0  146  P02029     Hemoglobin subunit beta OS=Theropithecus gelada GN=HBB PE=1 SV=1
  640 : HBB_URSMA           0.77  0.93  144  288    2  146  145    0    0  146  P68011     Hemoglobin subunit beta OS=Ursus maritimus GN=HBB PE=1 SV=1
  641 : HBB_URSTH           0.77  0.93  144  288    2  146  145    0    0  146  P68012     Hemoglobin subunit beta OS=Ursus thibetanus GN=HBB PE=1 SV=1
  642 : HBE_MOUSE           0.77  0.95  144  288    3  147  145    0    0  147  P02104     Hemoglobin subunit epsilon-Y2 OS=Mus musculus GN=Hbb-y PE=1 SV=2
  643 : HBE_PIG             0.77  0.96  144  288    3  147  145    0    0  147  P02101     Hemoglobin subunit epsilon OS=Sus scrofa GN=HBE1 PE=1 SV=3
  644 : I0B041_EPIFU        0.77  0.94  144  288    3  147  145    0    0  147  I0B041     Hemoglobin subunit delta-A OS=Episoriculus fumidus GN=HBD-B PE=3 SV=1
  645 : M3WVZ4_FELCA        0.77  0.93  144  287    6  149  144    0    0  149  M3WVZ4     Uncharacterized protein (Fragment) OS=Felis catus GN=LOC101091558 PE=3 SV=1
  646 : M3YFG8_MUSPF        0.77  0.94  144  288    3  147  145    0    0  147  M3YFG8     Uncharacterized protein OS=Mustela putorius furo PE=3 SV=1
  647 : Q5EBL1_MOUSE        0.77  0.92  144  288    3  147  145    0    0  147  Q5EBL1     Hemoglobin Z, beta-like embryonic chain OS=Mus musculus GN=Hbb-bh1 PE=2 SV=1
  648 : Q9CR49_MOUSE        0.77  0.95  144  288    3  147  145    0    0  147  Q9CR49     Hemoglobin Y, beta-like embryonic chain OS=Mus musculus GN=Hbb-y PE=2 SV=1
  649 : Q9D0B2_MOUSE        0.77  0.95  144  288    3  147  145    0    0  147  Q9D0B2     Putative uncharacterized protein OS=Mus musculus GN=Hbb-y PE=2 SV=1
  650 : A8E197_BUBBU        0.76  0.92  145  288    2  145  144    0    0  145  A8E197     Adult beta-globin OS=Bubalus bubalis GN=hbb PE=3 SV=1
  651 : B1MT79_CALMO        0.76  0.94  144  288    3  147  145    0    0  147  B1MT79     Hemoglobin subunit delta (Predicted) OS=Callicebus moloch GN=HBD PE=3 SV=1
  652 : C6KGT2_CERAT        0.76  0.94  144  288    3  147  145    0    0  147  C6KGT2     Beta hemoglobin OS=Cercocebus atys PE=2 SV=1
  653 : D3TTK3_DELDE        0.76  0.93  144  288    3  147  145    0    0  147  D3TTK3     Hemoglobin beta4 chain OS=Delphinus delphis PE=2 SV=1
  654 : D4QBF4_BOSMU        0.76  0.91  145  288    2  145  144    0    0  145  D4QBF4     Hemoglobin beta OS=Bos mutus grunniens GN=HBB PE=3 SV=1
  655 : F6U239_ORNAN        0.76  0.89   28  141    7  121  115    1    1  121  F6U239     Hemoglobin subunit alpha OS=Ornithorhynchus anatinus GN=HBA PE=3 SV=2
  656 : F7AV81_MACMU        0.76  0.94  144  288    3  147  145    0    0  147  F7AV81     Hemoglobin beta chain OS=Macaca mulatta GN=HBB PE=2 SV=1
  657 : G3RYX7_GORGO        0.76  0.93  172  288    1  117  117    0    0  117  G3RYX7     Hemoglobin subunit delta (Fragment) OS=Gorilla gorilla gorilla GN=HBD PE=3 SV=1
  658 : G7PQY3_MACFA        0.76  0.94  144  288    3  147  145    0    0  147  G7PQY3     Hemoglobin beta chain OS=Macaca fascicularis GN=EGM_05960 PE=3 SV=1
  659 : H6UZ49_PERMA        0.76  0.92  144  288    3  147  145    0    0  147  H6UZ49     Gamma/epsilon-globin fusion protein OS=Peromyscus maniculatus GN=HBG/E fusion PE=3 SV=1
  660 : HBA_CAVPO   3HYU    0.76  0.94    1  141    2  142  141    0    0  142  P01947     Hemoglobin subunit alpha OS=Cavia porcellus GN=HBA PE=1 SV=2
  661 : HBB0_MOUSE          0.76  0.90  144  288    3  147  145    0    0  147  P04443     Hemoglobin subunit beta-H0 OS=Mus musculus GN=Hbb-bh0 PE=2 SV=5
  662 : HBB_AILFU           0.76  0.94  144  288    2  146  145    0    0  146  P18982     Hemoglobin subunit beta OS=Ailurus fulgens GN=HBB PE=1 SV=1
  663 : HBB_AOTTR           0.76  0.93  144  288    2  146  145    0    0  146  P02035     Hemoglobin subunit beta OS=Aotus trivirgatus GN=HBB PE=1 SV=1
  664 : HBB_BISBO           0.76  0.92  145  288    2  145  144    0    0  145  P09422     Hemoglobin subunit beta OS=Bison bonasus GN=HBB PE=1 SV=1
  665 : HBB_BOSMU           0.76  0.91  145  288    2  145  144    0    0  145  P02072     Hemoglobin subunit beta OS=Bos mutus grunniens GN=HBB PE=1 SV=1
  666 : HBB_CHLAE           0.76  0.94  144  288    2  146  145    0    0  146  P02028     Hemoglobin subunit beta OS=Chlorocebus aethiops GN=HBB PE=1 SV=1
  667 : HBB_COLPO           0.76  0.94  144  288    3  147  145    0    0  147  P19885     Hemoglobin subunit beta OS=Colobus polykomos GN=HBB PE=2 SV=2
  668 : HBB_ERIEU           0.76  0.92  144  288    2  146  145    0    0  146  P02059     Hemoglobin subunit beta OS=Erinaceus europaeus GN=HBB PE=1 SV=1
  669 : HBB_LEPWE           0.76  0.95  144  288    2  146  145    0    0  146  P15166     Hemoglobin subunit beta OS=Leptonychotes weddelli GN=HBB PE=1 SV=1
  670 : HBB_MACFA           0.76  0.94  144  288    3  147  145    0    0  147  P68223     Hemoglobin subunit beta OS=Macaca fascicularis GN=HBB PE=1 SV=2
  671 : HBB_MACFU           0.76  0.94  144  288    3  147  145    0    0  147  P68222     Hemoglobin subunit beta OS=Macaca fuscata fuscata GN=HBB PE=1 SV=2
  672 : HBB_MACNE           0.76  0.94  144  288    3  147  145    0    0  147  P68225     Hemoglobin subunit beta OS=Macaca nemestrina GN=HBB PE=1 SV=2
  673 : HBB_MACSP           0.76  0.94  144  288    3  147  145    0    0  147  P68224     Hemoglobin subunit beta OS=Macaca speciosa GN=HBB PE=1 SV=2
  674 : HBB_PILBA           0.76  0.93  144  288    2  146  145    0    0  146  P02033     Hemoglobin subunit beta OS=Piliocolobus badius GN=HBB PE=1 SV=1
  675 : HBB_PROLO           0.76  0.94  144  288    2  146  145    0    0  146  P18989     Hemoglobin subunit beta OS=Procyon lotor GN=HBB PE=1 SV=1
  676 : HBB_PTEAL           0.76  0.95  144  288    2  146  145    0    0  146  P14391     Hemoglobin subunit beta OS=Pteropus alecto GN=HBB PE=1 SV=1
  677 : HBB_PTEGI   3FH9    0.76  0.95  144  288    2  146  145    0    0  146  D0VX08     Hemoglobin subunit beta OS=Pteropus giganteus GN=HBB PE=1 SV=1
  678 : HBB_ROUAE           0.76  0.94  144  288    2  146  145    0    0  146  P02058     Hemoglobin subunit beta OS=Rousettus aegyptiacus GN=HBB PE=1 SV=1
  679 : HBB_SAGMY           0.76  0.93  144  288    2  146  145    0    0  146  P02038     Hemoglobin subunit beta OS=Saguinus mystax GN=HBB PE=1 SV=1
  680 : HBB_SEMEN           0.76  0.94  144  288    2  146  145    0    0  146  P02032     Hemoglobin subunit beta OS=Semnopithecus entellus GN=HBB PE=1 SV=1
  681 : HBB_TAPGE           0.76  0.95  144  288    2  146  145    0    0  146  P28781     Hemoglobin subunit beta OS=Taphozous georgianus GN=HBB PE=1 SV=1
  682 : HBB_TRAST           0.76  0.92  145  288    2  145  144    0    0  145  P04245     Hemoglobin subunit beta OS=Tragelaphus strepsiceros GN=HBB PE=1 SV=1
  683 : L8HT60_BOSMU        0.76  0.91  145  288   19  162  144    0    0  162  L8HT60     Hemoglobin subunit beta (Fragment) OS=Bos grunniens mutus GN=M91_21164 PE=3 SV=1
  684 : Q28552_SHEEP        0.76  0.91  173  288   18  133  116    0    0  133  Q28552     Fetal globin OS=Ovis aries PE=3 SV=1
  685 : Q61600_MOUSE        0.76  0.93  149  288    1  140  140    0    0  140  Q61600     Beta-H1-globin (Fragment) OS=Mus musculus GN=Hbb-bh1 PE=2 SV=1
  686 : Q9CZK5_MOUSE        0.76  0.92  144  288    3  147  145    0    0  147  Q9CZK5     Putative uncharacterized protein OS=Mus musculus GN=Hbb-bh1 PE=2 SV=1
  687 : A8E196_BUBBU        0.75  0.92  145  288    2  145  144    0    0  145  A8E196     Adult beta-globin OS=Bubalus bubalis GN=hbb PE=3 SV=1
  688 : B2KHZ6_RHIFE        0.75  0.93  144  288    3  147  145    0    0  147  B2KHZ6     Hemoglobin, beta, epsilon 4 (Predicted) OS=Rhinolophus ferrumequinum GN=HBE4 PE=3 SV=1
  689 : D3TTK1_DELDE        0.75  0.93  144  288    3  147  145    0    0  147  D3TTK1     Hemoglobin beta1 chain OS=Delphinus delphis PE=2 SV=1
  690 : D4QBB5_BOSIN        0.75  0.92  145  288    2  145  144    0    0  145  D4QBB5     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
  691 : D4QBF0_BOSGF        0.75  0.92  145  288    2  145  144    0    0  145  D4QBF0     Hemoglobin beta OS=Bos frontalis frontalis GN=HBB PE=3 SV=1
  692 : D4QBF7_BISBI        0.75  0.92  145  288    2  145  144    0    0  145  D4QBF7     Hemoglobin beta OS=Bison bison GN=HBB PE=3 SV=1
  693 : F7AP85_MACMU        0.75  0.93  144  288    3  147  145    0    0  147  F7AP85     Hemoglobin subunit beta OS=Macaca mulatta GN=HBB PE=2 SV=1
  694 : G1Q9N4_MYOLU        0.75  0.94  144  288    3  147  145    0    0  147  G1Q9N4     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
  695 : G3WE91_SARHA        0.75  0.89    1  141    2  143  142    1    1  143  G3WE91     Uncharacterized protein OS=Sarcophilus harrisii PE=3 SV=1
  696 : HBB1_CHAMP          0.75  0.93  144  288    3  147  145    0    0  147  P68087     Hemoglobin subunit beta-1 OS=Chalinolobus morio GN=HBB1 PE=1 SV=2
  697 : HBBA_BOSJA          0.75  0.92  145  288    2  145  144    0    0  145  P04346     Hemoglobin subunit beta-A OS=Bos javanicus PE=1 SV=1
  698 : HBB_AOTAZ           0.75  0.92  144  288    3  147  145    0    0  147  Q6WN26     Hemoglobin subunit beta OS=Aotus azarae GN=HBB PE=2 SV=3
  699 : HBB_BALAC           0.75  0.94  144  288    2  146  145    0    0  146  P18984     Hemoglobin subunit beta OS=Balaenoptera acutorostrata GN=HBB PE=1 SV=1
  700 : HBB_BOSGF           0.75  0.92  145  288    2  145  144    0    0  145  P67819     Hemoglobin subunit beta OS=Bos gaurus frontalis GN=HBB PE=1 SV=1
  701 : HBB_BUBBU   3CY5    0.75  0.92  145  288    2  145  144    0    0  145  P67820     Hemoglobin subunit beta OS=Bubalus bubalis GN=HBB PE=1 SV=1
  702 : HBB_CERAT           0.75  0.94  144  288    2  146  145    0    0  146  P02031     Hemoglobin subunit beta OS=Cercocebus atys GN=HBB PE=1 SV=1
  703 : HBB_CROCR           0.75  0.91  143  288    1  146  146    0    0  146  P18986     Hemoglobin subunit beta OS=Crocuta crocuta GN=HBB PE=1 SV=1
  704 : HBB_LAGLA           0.75  0.94  144  288    3  147  145    0    0  147  Q6WN25     Hemoglobin subunit beta OS=Lagothrix lagotricha GN=HBB PE=2 SV=3
  705 : HBB_LORTA           0.75  0.96  144  288    2  146  145    0    0  146  P02048     Hemoglobin subunit beta OS=Loris tardigradus GN=HBB PE=1 SV=1
  706 : HBB_MACMU           0.75  0.94  144  288    2  146  145    0    0  146  P02026     Hemoglobin subunit beta OS=Macaca mulatta GN=HBB PE=1 SV=1
  707 : HBB_MELME           0.75  0.94  144  288    2  146  145    0    0  146  P02055     Hemoglobin subunit beta OS=Meles meles GN=HBB PE=1 SV=1
  708 : HBB_PITPI           0.75  0.93  144  288    3  147  145    0    0  147  Q6WN27     Hemoglobin subunit beta OS=Pithecia pithecia GN=HBB PE=2 SV=3
  709 : HBB_PROCR           0.75  0.90  143  288    1  146  146    0    0  146  P23020     Hemoglobin subunit beta OS=Proteles cristata GN=HBB PE=1 SV=1
  710 : HBB_PTEPO           0.75  0.95  144  288    2  146  145    0    0  146  P14392     Hemoglobin subunit beta OS=Pteropus poliocephalus GN=HBB PE=1 SV=1
  711 : HBB_SAGFU           0.75  0.94  144  288    2  146  145    0    0  146  P02039     Hemoglobin subunit beta OS=Saguinus fuscicollis GN=HBB PE=1 SV=1
  712 : HBB_SAGNI           0.75  0.93  144  288    2  146  145    0    0  146  P68054     Hemoglobin subunit beta OS=Saguinus nigricollis GN=HBB PE=1 SV=1
  713 : HBB_SAGOE           0.75  0.93  144  288    2  146  145    0    0  146  P68055     Hemoglobin subunit beta OS=Saguinus oedipus GN=HBB PE=1 SV=1
  714 : HBB_SAISC           0.75  0.93  144  288    3  147  145    0    0  147  P02036     Hemoglobin subunit beta OS=Saimiri sciureus GN=HBB PE=1 SV=2
  715 : HBB_SUNMU           0.75  0.92  144  288    2  146  145    0    0  146  P02060     Hemoglobin subunit beta OS=Suncus murinus GN=HBB PE=1 SV=1
  716 : I7A6X1_OCHLA        0.75  0.93  144  288    3  147  145    0    0  147  I7A6X1     Hemoglobin beta OS=Ochotona ladacensis PE=2 SV=1
  717 : O88753_RAT          0.75  0.90  144  288    3  147  145    0    0  147  O88753     Epsilon 2 globin OS=Rattus norvegicus GN=Hbe2 PE=3 SV=1
  718 : O88754_RAT          0.75  0.90  144  288    3  147  145    0    0  147  O88754     Epsilon 3 globin OS=Rattus norvegicus GN=Hbg1 PE=2 SV=1
  719 : Q63066_RAT          0.75  0.91  144  276    3  135  133    0    0  135  Q63066     Beta-globin chain (Fragment) OS=Rattus norvegicus GN=Hbg1 PE=3 SV=1
  720 : Q63067_RAT          0.75  0.89  144  288    3  147  145    0    0  147  Q63067     Beta-globin chain OS=Rattus norvegicus GN=Hbe2 PE=3 SV=1
  721 : Q9UK54_HUMAN        0.75  0.91  161  288    1  128  128    0    0  128  Q9UK54     Hemoglobin beta subunit variant (Fragment) OS=Homo sapiens GN=HBB PE=2 SV=1
  722 : B1MT78_CALMO        0.74  0.93  144  288    3  147  145    0    0  147  B1MT78     Beta globin (Predicted) OS=Callicebus moloch GN=HBB PE=3 SV=1
  723 : B2KHZ5_RHIFE        0.74  0.94  144  288    3  147  145    0    0  147  B2KHZ5     Delta globin (Predicted) OS=Rhinolophus ferrumequinum GN=HBD PE=3 SV=1
  724 : B4USM4_OTOGA        0.74  0.94  144  288    3  147  145    0    0  147  B4USM4     Beta-globin protein (Predicted) OS=Otolemur garnettii GN=HBB PE=3 SV=1
  725 : B4USM5_OTOGA        0.74  0.94  144  288    3  147  145    0    0  147  B4USM5     Hemoglobin, beta adult major chain (Predicted) OS=Otolemur garnettii GN=HBB-B1 PE=3 SV=1
  726 : C8C504_HUMAN        0.74  0.92  144  288    3  147  145    0    0  147  C8C504     Beta-globin OS=Homo sapiens GN=HBB PE=3 SV=1
  727 : D2HU49_AILME        0.74  0.94  144  288  114  258  145    0    0  258  D2HU49     Putative uncharacterized protein OS=Ailuropoda melanoleuca GN=PANDA_015769 PE=3 SV=1
  728 : D3TTK2_DELDE        0.74  0.93  144  288    3  147  145    0    0  147  D3TTK2     Hemoglobin beta2 chain OS=Delphinus delphis PE=2 SV=1
  729 : D3TTK4_DELDE        0.74  0.93  144  288    3  147  145    0    0  147  D3TTK4     Hemoglobin beta5 chain OS=Delphinus delphis PE=2 SV=1
  730 : D4QBB4_BOVIN        0.74  0.92  145  288    2  145  144    0    0  145  D4QBB4     Hemoglobin beta OS=Bos taurus GN=HBB PE=2 SV=1
  731 : D4QBB8_BOSIN        0.74  0.92  145  288    2  145  144    0    0  145  D4QBB8     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
  732 : D4QBD0_BOSIN        0.74  0.92  145  288    2  145  144    0    0  145  D4QBD0     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
  733 : D4QBD1_BOSIN        0.74  0.92  145  288    2  145  144    0    0  145  D4QBD1     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
  734 : D4QBD2_BOSIN        0.74  0.92  145  288    2  145  144    0    0  145  D4QBD2     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
  735 : D4QBD6_BOSJA        0.74  0.92  145  288    2  145  144    0    0  145  D4QBD6     Hemoglobin beta OS=Bos javanicus GN=HBB PE=3 SV=1
  736 : D4QBD7_BOSJA        0.74  0.92  145  288    2  145  144    0    0  145  D4QBD7     Hemoglobin beta OS=Bos javanicus javanicus GN=HBB PE=3 SV=1
  737 : D4QBE2_BOSJA        0.74  0.92  145  288    2  145  144    0    0  145  D4QBE2     Hemoglobin beta OS=Bos javanicus javanicus GN=HBB PE=3 SV=1
  738 : D4QBE6_9CETA        0.74  0.92  145  288    2  145  144    0    0  145  D4QBE6     Hemoglobin beta OS=Bos javanicus birmanicus x Bos indicus GN=HBB PE=3 SV=1
  739 : D4QBE7_9CETA        0.74  0.92  145  288    2  145  144    0    0  145  D4QBE7     Hemoglobin beta OS=Bos javanicus birmanicus x Bos indicus GN=HBB PE=3 SV=1
  740 : D4QBF1_BOSGF        0.74  0.92  145  288    2  145  144    0    0  145  D4QBF1     Hemoglobin beta OS=Bos frontalis frontalis GN=HBB PE=3 SV=1
  741 : D4QBF3_BOSMU        0.74  0.92  145  288    2  145  144    0    0  145  D4QBF3     Hemoglobin beta OS=Bos mutus grunniens GN=HBB PE=3 SV=1
  742 : D9I2E9_SCAOR        0.74  0.92  144  288    3  147  145    0    0  147  D9I2E9     Hemoglobin subunit delta OS=Scapanus orarius GN=HBD PE=2 SV=1
  743 : D9YZU5_HUMAN        0.74  0.92  144  288    3  147  145    0    0  147  D9YZU5     Hemoglobin, beta OS=Homo sapiens GN=HBB PE=2 SV=1
  744 : F1DSD0_PANHO        0.74  0.92  149  288    3  142  140    0    0  142  F1DSD0     Hemoglobin subunit beta-C OS=Pantholops hodgsonii PE=2 SV=1
  745 : F6WP15_CALJA        0.74  0.93  144  266    3  125  123    0    0  171  F6WP15     Uncharacterized protein OS=Callithrix jacchus GN=HBD PE=3 SV=1
  746 : F6YMF4_MONDO        0.74  0.90    1  141    2  142  141    0    0  142  F6YMF4     Uncharacterized protein OS=Monodelphis domestica GN=LOC100618857 PE=4 SV=1
  747 : F6YMH9_MONDO        0.74  0.90    1  141   43  183  141    0    0  183  F6YMH9     Uncharacterized protein OS=Monodelphis domestica GN=LOC100618857 PE=3 SV=1
  748 : G1S6C3_NOMLE        0.74  0.94  144  288    3  147  145    0    0  147  G1S6C3     Uncharacterized protein OS=Nomascus leucogenys PE=3 SV=1
  749 : G3S2S3_GORGO        0.74  0.91  144  288    3  147  145    0    0  147  G3S2S3     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
  750 : G9FTH3_CONCR        0.74  0.92  144  288    3  147  145    0    0  147  G9FTH3     Hemoglobin subunit delta 1 OS=Condylura cristata GN=HBD1 PE=2 SV=1
  751 : H2NEE2_PONAB        0.74  0.94  144  288    3  147  145    0    0  147  H2NEE2     Uncharacterized protein OS=Pongo abelii GN=HBB PE=3 SV=1
  752 : HBA1_TACAC          0.74  0.88    1  141    1  141  141    0    0  141  P01977     Hemoglobin subunit alpha-1 OS=Tachyglossus aculeatus aculeatus PE=1 SV=1
  753 : HBB2_CHAMP          0.74  0.93  144  288    3  147  145    0    0  147  Q7M2Y5     Hemoglobin subunit beta-2 OS=Chalinolobus morio GN=HBB2 PE=1 SV=2
  754 : HBBC_AMMLE          0.74  0.93  149  288    2  141  140    0    0  141  P68058     Hemoglobin subunit beta-C OS=Ammotragus lervia PE=1 SV=1
  755 : HBBC_CAPHI          0.74  0.93  149  288    3  142  140    0    0  142  P02078     Hemoglobin subunit beta-C OS=Capra hircus GN=HBBC PE=2 SV=2
  756 : HBBC_OVIMU          0.74  0.93  149  288    2  141  140    0    0  141  P68057     Hemoglobin subunit beta-C OS=Ovis orientalis musimon GN=HBBC PE=1 SV=1
  757 : HBBC_SHEEP          0.74  0.93  149  288    3  142  140    0    0  142  P68056     Hemoglobin subunit beta-C OS=Ovis aries GN=HBBC PE=1 SV=2
  758 : HBBF_BOVIN          0.74  0.92  145  288    2  145  144    0    0  145  P02081     Hemoglobin fetal subunit beta OS=Bos taurus PE=1 SV=1
  759 : HBBF_SHEEP          0.74  0.91  145  288    2  145  144    0    0  145  P02083     Hemoglobin fetal subunit beta OS=Ovis aries PE=1 SV=1
  760 : HBBY_MESAU          0.74  0.94  144  288    3  147  145    0    0  147  P29626     Hemoglobin subunit beta-Y OS=Mesocricetus auratus GN=HBBY PE=2 SV=2
  761 : HBB_AILME           0.74  0.94  144  288    3  147  145    0    0  147  P18983     Hemoglobin subunit beta OS=Ailuropoda melanoleuca GN=HBB PE=1 SV=2
  762 : HBB_ALOBE           0.74  0.93  144  288    3  147  145    0    0  147  Q6WN29     Hemoglobin subunit beta OS=Alouatta belzebul GN=HBB PE=2 SV=3
  763 : HBB_ATEBE           0.74  0.94  144  288    3  147  145    0    0  147  P68234     Hemoglobin subunit beta OS=Ateles belzebuth GN=HBB PE=1 SV=2
  764 : HBB_ATEGE           0.74  0.94  144  288    3  147  145    0    0  147  P68232     Hemoglobin subunit beta OS=Ateles geoffroyi GN=HBB PE=1 SV=2
  765 : HBB_ATEPA           0.74  0.94  144  288    3  147  145    0    0  147  Q6WN22     Hemoglobin subunit beta OS=Ateles paniscus GN=HBB PE=1 SV=3
  766 : HBB_BOVIN   2QSS    0.74  0.92  145  288    2  145  144    0    0  145  P02070     Hemoglobin subunit beta OS=Bos taurus GN=HBB PE=1 SV=1
  767 : HBB_CALGO           0.74  0.92  144  288    3  147  145    0    0  147  Q6WN21     Hemoglobin subunit beta OS=Callimico goeldii GN=HBB PE=2 SV=3
  768 : HBB_CALTO           0.74  0.92  144  288    3  147  145    0    0  147  Q6WN20     Hemoglobin subunit beta OS=Callicebus torquatus GN=HBB PE=2 SV=3
  769 : HBB_CEBAL           0.74  0.93  144  288    2  146  145    0    0  146  P02040     Hemoglobin subunit beta OS=Cebus albifrons GN=HBB PE=1 SV=1
  770 : HBB_CEBAP           0.74  0.93  144  288    3  147  145    0    0  147  P67821     Hemoglobin subunit beta OS=Cebus apella GN=HBB PE=1 SV=3
  771 : HBB_CEBCA           0.74  0.93  144  288    2  146  145    0    0  146  P67822     Hemoglobin subunit beta OS=Cebus capucinus GN=HBB PE=1 SV=1
  772 : HBB_COLLI   2R80    0.74  0.90  144  288    2  146  145    0    0  146  P11342     Hemoglobin subunit beta OS=Columba livia GN=HBB PE=1 SV=1
  773 : HBB_CYNSP           0.74  0.94  144  288    2  146  145    0    0  146  P11754     Hemoglobin subunit beta OS=Cynopterus sphinx GN=HBB PE=1 SV=1
  774 : HBB_EQUHE           0.74  0.93  144  288    2  146  145    0    0  146  P67823     Hemoglobin subunit beta OS=Equus hemionus kulan GN=HBB PE=1 SV=1
  775 : HBB_EQUZE           0.74  0.93  144  288    2  146  145    0    0  146  P67824     Hemoglobin subunit beta OS=Equus zebra GN=HBB PE=1 SV=1
  776 : HBB_GORGO           0.74  0.92  144  288    3  147  145    0    0  147  P02024     Hemoglobin subunit beta OS=Gorilla gorilla gorilla GN=HBB PE=1 SV=2
  777 : HBB_HIPAM           0.74  0.90  144  288    2  146  145    0    0  146  P19016     Hemoglobin subunit beta OS=Hippopotamus amphibius GN=HBB PE=1 SV=1
  778 : HBB_HUMAN   1YZI    0.74  0.92  144  288    3  147  145    0    0  147  P68871     Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2
  779 : HBB_HYLLA           0.74  0.94  144  288    2  146  145    0    0  146  P02025     Hemoglobin subunit beta OS=Hylobates lar GN=HBB PE=1 SV=1
  780 : HBB_LEPEU   3LQD    0.74  0.95  144  288    3  147  145    0    0  147  P08535     Hemoglobin subunit beta OS=Lepus europaeus GN=HBB PE=1 SV=2
  781 : HBB_MACCA           0.74  0.94  144  288    2  146  145    0    0  146  P09840     Hemoglobin subunit beta OS=Macrotus californicus GN=HBB PE=1 SV=1
  782 : HBB_MEGLY           0.74  0.94  144  288    2  146  145    0    0  146  P11752     Hemoglobin subunit beta OS=Megaderma lyra GN=HBB PE=1 SV=1
  783 : HBB_NASNA           0.74  0.94  144  288    2  146  145    0    0  146  P26916     Hemoglobin subunit beta OS=Nasua nasua GN=HBB PE=1 SV=1
  784 : HBB_NYCCO           0.74  0.96  144  288    2  146  145    0    0  146  P02049     Hemoglobin subunit beta OS=Nycticebus coucang GN=HBB PE=1 SV=1
  785 : HBB_PANPA           0.74  0.92  144  288    3  147  145    0    0  147  P68872     Hemoglobin subunit beta OS=Pan paniscus GN=HBB PE=1 SV=2
  786 : HBB_PANTR           0.74  0.92  144  288    3  147  145    0    0  147  P68873     Hemoglobin subunit beta OS=Pan troglodytes GN=HBB PE=1 SV=2
  787 : HBB_PROHA           0.74  0.92  144  288    2  146  145    0    0  146  P02086     Hemoglobin subunit beta OS=Procavia capensis habessinica GN=HBB PE=1 SV=1
  788 : HBB_RHIFE           0.74  0.94  144  288    3  147  145    0    0  147  B2KHZ4     Hemoglobin subunit beta OS=Rhinolophus ferrumequinum GN=HBB PE=2 SV=1
  789 : HBB_SCAOR           0.74  0.92  144  288    3  147  145    0    0  147  Q2KPA3     Hemoglobin subunit beta OS=Scapanus orarius GN=HBB PE=2 SV=3
  790 : HBB_STROE           0.74  0.90  144  288    2  146  145    0    0  146  Q7LZB9     Hemoglobin subunit beta OS=Streptopelia orientalis GN=HBB PE=1 SV=1
  791 : HBB_TADBR           0.74  0.92  144  288    2  146  145    0    0  146  P11756     Hemoglobin subunit beta OS=Tadarida brasiliensis GN=HBB PE=1 SV=1
  792 : HBB_TAMMR           0.74  0.94  144  288    2  146  145    0    0  146  B3EWC8     Hemoglobin subunit beta OS=Tamias merriami PE=1 SV=1
  793 : HBB_TARBA           0.74  0.94  144  288    2  146  145    0    0  146  P02051     Hemoglobin subunit beta OS=Tarsius bancanus GN=HBB PE=1 SV=1
  794 : HBB_TARSY           0.74  0.94  144  288    3  147  145    0    0  147  P13557     Hemoglobin subunit beta OS=Tarsius syrichta GN=HBB PE=2 SV=2
  795 : HBB_TRIIN           0.74  0.91  144  288    2  146  145    0    0  146  P07415     Hemoglobin subunit beta OS=Trichechus inunguis GN=HBB PE=1 SV=1
  796 : HBB_TURTR           0.74  0.93  144  288    2  146  145    0    0  146  P18990     Hemoglobin subunit beta OS=Tursiops truncatus GN=HBB PE=1 SV=1
  797 : HBB_VARVI           0.74  0.92  145  288    3  146  144    0    0  146  P21667     Hemoglobin subunit beta OS=Varecia variegata GN=HBB PE=1 SV=1
  798 : HBB_VULVU           0.74  0.94  144  288    2  146  145    0    0  146  P21201     Hemoglobin subunit beta OS=Vulpes vulpes GN=HBB PE=1 SV=1
  799 : HBD_AILME           0.74  0.93  144  288    3  147  145    0    0  147  Q5XLE5     Hemoglobin subunit delta OS=Ailuropoda melanoleuca GN=HBD PE=2 SV=3
  800 : HBD_ATEGE           0.74  0.94  144  288    3  147  145    0    0  147  P02044     Hemoglobin subunit delta OS=Ateles geoffroyi GN=HBD PE=1 SV=3
  801 : HBD_OTOCR           0.74  0.94  144  288    3  147  145    0    0  147  Q03902     Hemoglobin subunit delta OS=Otolemur crassicaudatus GN=HBD PE=2 SV=2
  802 : HBD_TRIMA           0.74  0.91  144  288    3  147  145    0    0  147  Q45XI8     Hemoglobin subunit delta OS=Trichechus manatus GN=HBD PE=2 SV=3
  803 : HBE2_CAPHI          0.74  0.92  144  288    3  147  145    0    0  147  P02105     Hemoglobin subunit epsilon-2 OS=Capra hircus GN=HBE2 PE=2 SV=2
  804 : HBE4_BOVIN          0.74  0.92  144  288    3  147  145    0    0  147  P06643     Hemoglobin subunit epsilon-4 OS=Bos taurus GN=HBE4 PE=2 SV=2
  805 : I6ZW92_EOSBA        0.74  0.91  144  288    3  147  145    0    0  147  I6ZW92     Hemoglobin beta OS=Eospalax baileyi PE=2 SV=1
  806 : K9J1D9_DESRO        0.74  0.94  144  288    2  146  145    0    0  146  K9J1D9     Putative hemoglobin subunit beta (Fragment) OS=Desmodus rotundus PE=2 SV=1
  807 : L5KF78_PTEAL        0.74  0.93  144  288    3  147  145    0    0  147  L5KF78     Hemoglobin subunit epsilon-2 OS=Pteropus alecto GN=PAL_GLEAN10003333 PE=3 SV=1
  808 : Q03901_OTOCR        0.74  0.94  144  288    3  147  145    0    0  147  Q03901     Beta-globin OS=Otolemur crassicaudatus GN=beta-globin PE=3 SV=1
  809 : Q28460_MIRAN        0.74  0.95  144  288    2  146  145    0    0  146  Q28460     MRNA, . (Fragment) OS=Mirounga angustirostris PE=2 SV=1
  810 : Q63910_RAT          0.74  0.90    1  141    2  142  141    0    0  142  Q63910     Alpha globin OS=Rattus norvegicus GN=LOC287167 PE=3 SV=2
  811 : A8E199_BUBBU        0.73  0.91  145  288    2  145  144    0    0  145  A8E199     Putative epsilon-globin OS=Bubalus bubalis GN=hbb PE=3 SV=1
  812 : A8E1A0_BUBBU        0.73  0.91  145  288    2  145  144    0    0  145  A8E1A0     Putative gamma-globin OS=Bubalus bubalis GN=hbb PE=3 SV=1
  813 : B8K174_RABIT        0.73  0.94  144  288    3  147  145    0    0  147  B8K174     Hemoglobin, beta (Predicted) OS=Oryctolagus cuniculus GN=HBB PE=3 SV=1
  814 : C7ELS9_ANAFV        0.73  0.88  144  288    3  147  145    0    0  147  C7ELS9     Hemoglobin beta A subunit OS=Anas flavirostris oxyptera GN=HBB PE=3 SV=1
  815 : D1MPT0_EQUAS1S0H    0.73  0.92  144  288    2  146  145    0    0  146  D1MPT0     Hemoglobin beta chain OS=Equus asinus PE=1 SV=1
  816 : D4QBB3_BOVIN        0.73  0.92  145  288    2  145  144    0    0  145  D4QBB3     Hemoglobin beta OS=Bos taurus GN=HBB PE=3 SV=1
  817 : D4QBC5_BOSIN        0.73  0.92  145  288    2  145  144    0    0  145  D4QBC5     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
  818 : D4QBD5_BOSJA        0.73  0.92  145  288    2  145  144    0    0  145  D4QBD5     Hemoglobin beta OS=Bos javanicus GN=HBB PE=3 SV=1
  819 : D4QBD8_BOSJA        0.73  0.92  145  288    2  145  144    0    0  145  D4QBD8     Hemoglobin beta OS=Bos javanicus javanicus GN=HBB PE=3 SV=1
  820 : D4QBE8_9CETA        0.73  0.92  145  288    2  145  144    0    0  145  D4QBE8     Hemoglobin beta OS=Bos javanicus birmanicus x Bos indicus GN=HBB PE=3 SV=1
  821 : E2RLH6_CANFA        0.73  0.94  144  287    9  152  144    0    0  152  E2RLH6     Uncharacterized protein (Fragment) OS=Canis familiaris GN=LOC480784 PE=3 SV=2
  822 : F6RDD3_HORSE        0.73  0.92  144  288    3  147  145    0    0  147  F6RDD3     Hemoglobin subunit beta OS=Equus caballus GN=HBB PE=3 SV=1
  823 : G1S6C6_NOMLE        0.73  0.92  144  288    3  147  145    0    0  147  G1S6C6     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100580435 PE=3 SV=1
  824 : G3RW33_GORGO        0.73  0.92  144  282    3  141  139    0    0  141  G3RW33     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
  825 : G3RZQ0_GORGO        0.73  0.92  144  273    3  132  130    0    0  177  G3RZQ0     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
  826 : G9FTI0_NEUGI        0.73  0.92  144  288    3  147  145    0    0  147  G9FTI0     Hemoglobin subunit delta 1 OS=Neurotrichus gibbsii GN=HBD1 PE=2 SV=1
  827 : HBB1_RAT    3HF4    0.73  0.92  144  288    3  147  145    0    0  147  P02091     Hemoglobin subunit beta-1 OS=Rattus norvegicus GN=Hbb PE=1 SV=3
  828 : HBB1_TAPTE          0.73  0.91  144  288    2  146  145    0    0  146  P02064     Hemoglobin subunit beta-1 OS=Tapirus terrestris GN=HBB1 PE=1 SV=1
  829 : HBB2_TAPTE          0.73  0.90  144  288    2  146  145    0    0  146  P02065     Hemoglobin subunit beta-2 OS=Tapirus terrestris GN=HBB2 PE=1 SV=1
  830 : HBBA_CAPHI  2RI4    0.73  0.90  145  288    2  145  144    0    0  145  P02077     Hemoglobin subunit beta-A OS=Capra hircus PE=1 SV=1
  831 : HBBF_CAPHI          0.73  0.91  145  288    2  145  144    0    0  145  P02082     Hemoglobin fetal subunit beta OS=Capra hircus PE=1 SV=1
  832 : HBB_CALAR           0.73  0.92  144  288    2  146  145    0    0  146  P18985     Hemoglobin subunit beta OS=Callithrix argentata GN=HBB PE=1 SV=1
  833 : HBB_CALJA           0.73  0.92  144  288    3  147  145    0    0  147  Q6WN28     Hemoglobin subunit beta OS=Callithrix jacchus GN=HBB PE=2 SV=3
  834 : HBB_CANFA   2QLS    0.73  0.94  144  288    2  146  145    0    0  146  P60524     Hemoglobin subunit beta OS=Canis familiaris GN=HBB PE=1 SV=1
  835 : HBB_CANLA           0.73  0.94  144  288    2  146  145    0    0  146  P60525     Hemoglobin subunit beta OS=Canis latrans GN=HBB PE=1 SV=1
  836 : HBB_CHRBR   1FHJ    0.73  0.94  144  288    2  146  145    0    0  146  P60526     Hemoglobin subunit beta OS=Chrysocyon brachyurus GN=HBB PE=1 SV=1
  837 : HBB_HAPGR           0.73  0.92  145  288    3  146  144    0    0  146  Q7M3C2     Hemoglobin subunit beta OS=Hapalemur griseus GN=HBB PE=1 SV=1
  838 : HBB_HORSE   2ZLU    0.73  0.92  144  288    2  146  145    0    0  146  P02062     Hemoglobin subunit beta OS=Equus caballus GN=HBB PE=1 SV=1
  839 : HBB_LEMCA           0.73  0.91  145  288    3  146  144    0    0  146  P02054     Hemoglobin subunit beta OS=Lemur catta GN=HBB PE=1 SV=1
  840 : HBB_LYNLY           0.73  0.91  143  288    1  146  146    0    0  146  P41328     Hemoglobin subunit beta OS=Lynx lynx GN=HBB PE=1 SV=1
  841 : HBB_ORNAN           0.73  0.94  144  288    2  146  145    0    0  146  P02111     Hemoglobin subunit beta OS=Ornithorhynchus anatinus GN=HBB PE=1 SV=1
  842 : HBB_OTOCR           0.73  0.94  144  288    2  146  145    0    0  146  P02050     Hemoglobin subunit beta-1/2 OS=Otolemur crassicaudatus GN=HBB PE=1 SV=1
  843 : HBB_PANPO           0.73  0.92  145  288    4  147  144    0    0  147  P04244     Hemoglobin subunit beta OS=Panthera pardus orientalis GN=HBB PE=1 SV=2
  844 : HBB_RABIT   2RAO    0.73  0.94  144  288    3  147  145    0    0  147  P02057     Hemoglobin subunit beta-1/2 OS=Oryctolagus cuniculus GN=HBB1 PE=1 SV=2
  845 : HBB_SPEBE           0.73  0.92  144  288    2  146  145    0    0  146  B3EWD0     Hemoglobin subunit beta OS=Spermophilus beecheyi PE=1 SV=1
  846 : HBB_TACAC           0.73  0.92  144  288    3  147  145    0    0  147  P02110     Hemoglobin subunit beta OS=Tachyglossus aculeatus aculeatus GN=HBB PE=1 SV=2
  847 : HBB_TAMST           0.73  0.92  144  288    2  146  145    0    0  146  B3EWE0     Hemoglobin subunit beta OS=Tamias striatus PE=1 SV=1
  848 : HBD_AOTTR           0.73  0.92  144  288    2  146  145    0    0  146  P02046     Hemoglobin subunit delta OS=Aotus trivirgatus GN=HBD PE=1 SV=1
  849 : HBD_ATEFU           0.73  0.93  144  288    2  146  145    0    0  146  P33499     Hemoglobin subunit delta OS=Ateles fusciceps GN=HBD PE=1 SV=1
  850 : HBD_COLPO           0.73  0.92  144  288    3  147  145    0    0  147  P19886     Hemoglobin subunit delta OS=Colobus polykomos GN=HBD PE=2 SV=2
  851 : HBD_GORGO           0.73  0.92  144  288    3  147  145    0    0  147  P61773     Hemoglobin subunit delta OS=Gorilla gorilla gorilla GN=HBD PE=1 SV=2
  852 : HBD_HYLLA           0.73  0.92  144  288    3  147  145    0    0  147  P61774     Hemoglobin subunit delta OS=Hylobates lar GN=HBD PE=1 SV=2
  853 : HBD_PANTR           0.73  0.92  144  288    3  147  145    0    0  147  P61772     Hemoglobin subunit delta OS=Pan troglodytes GN=HBD PE=1 SV=2
  854 : HBD_PONPY           0.73  0.92  144  288    3  147  145    0    0  147  P61775     Hemoglobin subunit delta OS=Pongo pygmaeus GN=HBD PE=2 SV=2
  855 : HBD_SAGNI           0.73  0.92  144  288    2  146  145    0    0  146  P68015     Hemoglobin subunit delta OS=Saguinus nigricollis GN=HBD PE=1 SV=1
  856 : HBD_SAISC           0.73  0.93  144  288    2  146  145    0    0  146  P02047     Hemoglobin subunit delta OS=Saimiri sciureus GN=HBD PE=1 SV=1
  857 : HBG_TARSY           0.73  0.90  144  288    3  148  146    1    1  148  P18436     Hemoglobin subunit gamma OS=Tarsius syrichta GN=HBG PE=2 SV=2
  858 : J7LGZ1_PANHO        0.73  0.91  145  288    2  145  144    0    0  145  J7LGZ1     Hemoglobin gamma OS=Pantholops hodgsonii PE=2 SV=1
  859 : K7W903_MICOE        0.73  0.93  144  288    3  147  145    0    0  147  K7W903     Hemoglobin beta chain OS=Microtus oeconomus PE=2 SV=1
  860 : L5M3D0_MYODS        0.73  0.92  144  288    3  147  145    0    0  147  L5M3D0     Hemoglobin subunit beta OS=Myotis davidii GN=MDA_GLEAN10001522 PE=3 SV=1
  861 : Q14473_HUMAN        0.73  0.89  144  275    3  131  132    1    3  175  Q14473     Beta-globin gene from a thalassemia patient,  OS=Homo sapiens PE=3 SV=1
  862 : Q1KYZ5_AMMLE        0.73  0.90  145  288    2  145  144    0    0  145  Q1KYZ5     Beta globin chain OS=Ammotragus lervia GN=HBB PE=3 SV=1
  863 : Q1KZF3_CAPHI        0.73  0.90  145  288    2  145  144    0    0  145  Q1KZF3     Beta A globin chain OS=Capra hircus GN=HBBA PE=3 SV=1
  864 : R0J848_ANAPL        0.73  0.90  169  288    1  120  120    0    0  120  R0J848     Hemoglobin subunit beta (Fragment) OS=Anas platyrhynchos GN=Anapl_16677 PE=4 SV=1
  865 : A0N071_HUMAN        0.72  0.92  144  288    3  147  145    0    0  147  A0N071     Delta globin OS=Homo sapiens GN=HBD PE=2 SV=1
  866 : A4ZR26_PERMA        0.72  0.91  144  288    3  147  145    0    0  147  A4ZR26     Beta globin OS=Peromyscus maniculatus PE=3 SV=1
  867 : B7SBL4_PERMA        0.72  0.91  144  288    3  147  145    0    0  147  B7SBL4     Beta globin OS=Peromyscus maniculatus GN=HBB-T2 PE=3 SV=1
  868 : B7SPR9_PERLE        0.72  0.91  144  288    3  147  145    0    0  147  B7SPR9     Beta-globin paralog 1 OS=Peromyscus leucopus GN=HBB-T1 PE=3 SV=1
  869 : B9VYB7_ANAGE        0.72  0.88  144  288    3  147  145    0    0  147  B9VYB7     Hemoglobin beta A subunit OS=Anas georgica GN=HBB PE=3 SV=1
  870 : B9VYC3_ANAGE        0.72  0.88  144  288    3  147  145    0    0  147  B9VYC3     Hemoglobin beta A subunit OS=Anas georgica GN=HBB PE=3 SV=1
  871 : B9VYD0_ANAGE        0.72  0.88  144  288    3  147  145    0    0  147  B9VYD0     Hemoglobin beta A subunit OS=Anas georgica GN=HBB PE=3 SV=1
  872 : B9VYE4_ANAGE        0.72  0.88  144  288    3  147  145    0    0  147  B9VYE4     Hemoglobin beta A subunit OS=Anas georgica GN=HBB PE=3 SV=1
  873 : B9VYG1_ANAGE        0.72  0.88  144  288    3  147  145    0    0  147  B9VYG1     Hemoglobin beta A subunit OS=Anas georgica GN=HBB PE=3 SV=1
  874 : B9VYK0_ANAGE        0.72  0.87  144  288    3  147  145    0    0  147  B9VYK0     Hemoglobin beta A subunit OS=Anas georgica GN=HBB PE=3 SV=1
  875 : C5MQQ9_PERMA        0.72  0.91  144  288    3  147  145    0    0  147  C5MQQ9     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
  876 : C5MQR7_PERMA        0.72  0.91  144  288    3  147  145    0    0  147  C5MQR7     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
  877 : C5MQS0_PERMA        0.72  0.90  144  288    3  147  145    0    0  147  C5MQS0     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
  878 : C7EIZ1_ANACN        0.72  0.89    1  141    2  142  141    0    0  142  C7EIZ1     Hemoglobin alpha A subunit OS=Anas cyanoptera cyanoptera GN=HBA2 PE=3 SV=1
  879 : C7EJY8_CYGBU        0.72  0.89    1  141    2  142  141    0    0  142  C7EJY8     Hemoglobin alpha A subunit OS=Cygnus buccinator GN=HBA2 PE=3 SV=1
  880 : C7EJY9_CYGCO        0.72  0.89    1  141    2  142  141    0    0  142  C7EJY9     Hemoglobin alpha A subunit OS=Cygnus columbianus GN=HBA2 PE=3 SV=1
  881 : C7EJZ0_CYGCY        0.72  0.89    1  141    2  142  141    0    0  142  C7EJZ0     Hemoglobin alpha A subunit OS=Cygnus cygnus GN=HBA2 PE=3 SV=1
  882 : C7EKB5_ANAPA        0.72  0.89    1  141    2  142  141    0    0  142  C7EKB5     Hemoglobin alpha A subunit OS=Anas platalea GN=HBA2 PE=3 SV=1
  883 : C7EKB8_ANACL        0.72  0.89    1  141    2  142  141    0    0  142  C7EKB8     Hemoglobin alpha A subunit OS=Anas clypeata GN=HBA2 PE=3 SV=1
  884 : C7EKC0_ANARH        0.72  0.89    1  141    2  142  141    0    0  142  C7EKC0     Hemoglobin alpha A subunit OS=Anas rhynchotis GN=HBA2 PE=3 SV=1
  885 : C7EKC1_ANACN        0.72  0.89    1  141    2  142  141    0    0  142  C7EKC1     Hemoglobin alpha A subunit OS=Anas cyanoptera septentrionalium GN=HBA2 PE=3 SV=1
  886 : C7EKP3_ANSIN        0.72  0.89  144  288    3  147  145    0    0  147  C7EKP3     Hemoglobin beta A subunit OS=Anser indicus GN=HBB PE=3 SV=1
  887 : C7EL29_ANACN        0.72  0.88  144  288    3  147  145    0    0  147  C7EL29     Hemoglobin beta A subunit OS=Anas cyanoptera cyanoptera GN=HBB PE=3 SV=1
  888 : C7EL81_ANACN        0.72  0.88  144  288    3  147  145    0    0  147  C7EL81     Hemoglobin beta A subunit OS=Anas cyanoptera orinomus GN=HBB PE=3 SV=1
  889 : C7ELD1_ANAVE        0.72  0.88  144  288    3  147  145    0    0  147  C7ELD1     Hemoglobin beta A subunit OS=Anas versicolor versicolor GN=HBB PE=3 SV=1
  890 : C7ELD6_ANAVE        0.72  0.87  144  288    3  147  145    0    0  147  C7ELD6     Hemoglobin beta A subunit OS=Anas versicolor versicolor GN=HBB PE=3 SV=1
  891 : C7ELF4_ANAVE        0.72  0.88  144  288    3  147  145    0    0  147  C7ELF4     Hemoglobin beta A subunit OS=Anas versicolor fretensis GN=HBB PE=3 SV=1
  892 : C7ELG5_ANAPN        0.72  0.88  144  288    3  147  145    0    0  147  C7ELG5     Hemoglobin beta A subunit OS=Anas puna GN=HBB PE=3 SV=1
  893 : C7ELK8_ANAFV        0.72  0.88  144  288    3  147  145    0    0  147  C7ELK8     Hemoglobin beta A subunit OS=Anas flavirostris flavirostris GN=HBB PE=3 SV=1
  894 : C7ELK9_ANAFV        0.72  0.87  144  288    3  147  145    0    0  147  C7ELK9     Hemoglobin beta A subunit OS=Anas flavirostris flavirostris GN=HBB PE=3 SV=1
  895 : C7ELR5_ANAFV        0.72  0.88  144  288    3  147  145    0    0  147  C7ELR5     Hemoglobin beta A subunit OS=Anas flavirostris flavirostris GN=HBB PE=3 SV=1
  896 : C7ELS8_ANAFV        0.72  0.88  144  288    3  147  145    0    0  147  C7ELS8     Hemoglobin beta A subunit OS=Anas flavirostris oxyptera GN=HBB PE=3 SV=1
  897 : C7ELT2_ANAFV        0.72  0.88  144  288    3  147  145    0    0  147  C7ELT2     Hemoglobin beta A subunit OS=Anas flavirostris oxyptera GN=HBB PE=3 SV=1
  898 : C7ELT4_ANAFV        0.72  0.88  144  288    3  147  145    0    0  147  C7ELT4     Hemoglobin beta A subunit OS=Anas flavirostris oxyptera GN=HBB PE=3 SV=1
  899 : C7ELU6_ANAFV        0.72  0.87  144  288    3  147  145    0    0  147  C7ELU6     Hemoglobin beta A subunit OS=Anas flavirostris oxyptera GN=HBB PE=3 SV=1
  900 : C7ELV0_ANAFV        0.72  0.88  144  288    3  147  145    0    0  147  C7ELV0     Hemoglobin beta A subunit OS=Anas flavirostris oxyptera GN=HBB PE=3 SV=1
  901 : C7EM11_ANSCY        0.72  0.89  144  288    3  147  145    0    0  147  C7EM11     Hemoglobin beta A subunit OS=Anser cygnoides GN=HBB PE=3 SV=1
  902 : C7EM12_9AVES        0.72  0.89  144  288    3  147  145    0    0  147  C7EM12     Hemoglobin beta A subunit OS=Anser fabalis GN=HBB PE=3 SV=1
  903 : C7EM14_9AVES        0.72  0.89  144  288    3  147  145    0    0  147  C7EM14     Hemoglobin beta A subunit OS=Anser anser GN=HBB PE=3 SV=1
  904 : C7EM15_ANSAL        0.72  0.89  144  288    3  147  145    0    0  147  C7EM15     Hemoglobin beta A subunit OS=Anser albifrons GN=HBB PE=3 SV=1
  905 : C7EM16_CHECA        0.72  0.89  144  288    3  147  145    0    0  147  C7EM16     Hemoglobin beta A subunit OS=Chen canagica GN=HBB PE=3 SV=1
  906 : C7EM17_ANSCE        0.72  0.89  144  288    3  147  145    0    0  147  C7EM17     Hemoglobin beta A subunit OS=Anser caerulescens GN=HBB PE=3 SV=1
  907 : C7EM18_ANSRO        0.72  0.89  144  288    3  147  145    0    0  147  C7EM18     Hemoglobin beta A subunit OS=Anser rossii GN=HBB PE=3 SV=1
  908 : C7EM59_CLAHY        0.72  0.89  144  288    3  147  145    0    0  147  C7EM59     Hemoglobin beta A subunit OS=Clangula hyemalis GN=HBB PE=3 SV=1
  909 : C7EM67_9AVES        0.72  0.88  144  288    3  147  145    0    0  147  C7EM67     Hemoglobin beta A subunit OS=Tachyeres patachonicus GN=HBB PE=3 SV=1
  910 : C7EM68_9AVES        0.72  0.88  144  288    3  147  145    0    0  147  C7EM68     Hemoglobin beta A subunit OS=Tachyeres leucocephalus GN=HBB PE=3 SV=1
  911 : C7EM69_9AVES        0.72  0.88  144  288    3  147  145    0    0  147  C7EM69     Hemoglobin beta A subunit OS=Tachyeres brachypterus GN=HBB PE=3 SV=1
  912 : C7EM72_9AVES        0.72  0.88  144  288    3  147  145    0    0  147  C7EM72     Hemoglobin beta A subunit OS=Speculanas specularis GN=HBB PE=3 SV=1
  913 : C7EM74_AMABR        0.72  0.88  144  288    3  147  145    0    0  147  C7EM74     Hemoglobin beta A subunit OS=Amazonetta brasiliensis GN=HBB PE=3 SV=1
  914 : C7EM76_ANAPA        0.72  0.88  144  288    3  147  145    0    0  147  C7EM76     Hemoglobin beta A subunit OS=Anas platalea GN=HBB PE=3 SV=1
  915 : C7EM78_ANACL        0.72  0.88  144  288    3  147  145    0    0  147  C7EM78     Hemoglobin beta A subunit OS=Anas clypeata GN=HBB PE=3 SV=1
  916 : C7EM79_ANACN        0.72  0.88  144  288    3  147  145    0    0  147  C7EM79     Hemoglobin beta A subunit OS=Anas cyanoptera septentrionalium GN=HBB PE=3 SV=1
  917 : C7EM89_ANADI        0.72  0.88  144  288    3  147  145    0    0  147  C7EM89     Hemoglobin beta A subunit OS=Anas discors GN=HBB PE=3 SV=1
  918 : C7EM93_ANAQU        0.72  0.88  144  288    3  147  145    0    0  147  C7EM93     Hemoglobin beta A subunit OS=Anas querquedula GN=HBB PE=3 SV=1
  919 : C7EM94_ANAFO        0.72  0.88  144  288    3  147  145    0    0  147  C7EM94     Hemoglobin beta A subunit OS=Anas formosa GN=HBB PE=3 SV=1
  920 : C7EMA0_ANASI        0.72  0.88  144  288    3  147  145    0    0  147  C7EMA0     Hemoglobin beta A subunit OS=Anas sibilatrix GN=HBB PE=3 SV=1
  921 : C7EMA5_ANAAM        0.72  0.88  144  288    3  147  145    0    0  147  C7EMA5     Hemoglobin beta A subunit OS=Anas americana GN=HBB PE=3 SV=1
  922 : C7EMA6_ANAPE        0.72  0.88  144  288    3  147  145    0    0  147  C7EMA6     Hemoglobin beta A subunit OS=Anas penelope GN=HBB PE=3 SV=1
  923 : C7EMA7_ANAAC        0.72  0.88  144  288    3  147  145    0    0  147  C7EMA7     Hemoglobin beta A subunit OS=Anas acuta GN=HBB PE=3 SV=1
  924 : C7EMA8_ANABA        0.72  0.88  144  288    3  147  145    0    0  147  C7EMA8     Hemoglobin beta A subunit OS=Anas bahamensis GN=HBB PE=3 SV=1
  925 : C7EMB3_ANACR        0.72  0.88  144  288    3  147  145    0    0  147  C7EMB3     Hemoglobin beta A subunit OS=Anas crecca crecca GN=HBB PE=3 SV=1
  926 : C7EMB4_9AVES        0.72  0.88  144  288    3  147  145    0    0  147  C7EMB4     Hemoglobin beta A subunit OS=Anas carolinensis GN=HBB PE=3 SV=1
  927 : C7EMB5_ANAFV        0.72  0.88  144  288    3  147  145    0    0  147  C7EMB5     Hemoglobin beta A subunit OS=Anas flavirostris andium GN=HBB PE=3 SV=1
  928 : C7EMB6_ANAPL        0.72  0.88  144  288    3  147  145    0    0  147  C7EMB6     Hemoglobin beta A subunit OS=Anas platyrhynchos GN=HBB PE=3 SV=1
  929 : C7EMB7_9AVES        0.72  0.88  144  288    3  147  145    0    0  147  C7EMB7     Hemoglobin beta A subunit OS=Anas zonorhyncha GN=HBB PE=3 SV=1
  930 : C8AUN8_PERMA        0.72  0.90  144  288    3  147  145    0    0  147  C8AUN8     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T2 PE=3 SV=1
  931 : D0U295_MUSSA        0.72  0.92  144  288    3  147  145    0    0  147  D0U295     Beta-globin OS=Mus saxicola GN=Hbbt2 PE=3 SV=1
  932 : D9I2F4_SCAAQ        0.72  0.91  144  288    3  147  145    0    0  147  D9I2F4     Hemoglobin subunit delta OS=Scalopus aquaticus GN=HBD PE=2 SV=1
  933 : F6VEZ4_CALJA        0.72  0.92  144  288    3  147  145    0    0  147  F6VEZ4     Uncharacterized protein OS=Callithrix jacchus GN=HBD PE=3 SV=1
  934 : G1QEL0_MYOLU        0.72  0.92  144  288    3  147  145    0    0  147  G1QEL0     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
  935 : G1QF83_MYOLU        0.72  0.89   31  141    1  111  111    0    0  111  G1QF83     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=3 SV=1
  936 : G3SIN5_GORGO        0.72  0.91  144  288    3  147  145    0    0  147  G3SIN5     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
  937 : G5BS33_HETGA        0.72  0.93  144  288    3  147  145    0    0  147  G5BS33     Hemoglobin subunit beta OS=Heterocephalus glaber GN=GW7_03824 PE=3 SV=1
  938 : G5BYJ8_HETGA        0.72  0.90  144  288    3  147  145    0    0  147  G5BYJ8     Hemoglobin subunit beta OS=Heterocephalus glaber GN=GW7_14163 PE=3 SV=1
  939 : G9FTH2_CONCR        0.72  0.92  144  288    3  147  145    0    0  147  G9FTH2     Hemoglobin subunit delta 2 OS=Condylura cristata GN=HBD2 PE=2 SV=1
  940 : G9FTH9_NEUGI        0.72  0.92  144  288    3  147  145    0    0  147  G9FTH9     Hemoglobin subunit delta 2 OS=Neurotrichus gibbsii GN=HBD2 PE=2 SV=1
  941 : G9FTI1_NEUGI        0.72  0.92  144  287    3  146  144    0    0  146  G9FTI1     Hemoglobin subunit delta 2 (Fragment) OS=Neurotrichus gibbsii GN=HBD2 PE=3 SV=1
  942 : HBA_ANAPE           0.72  0.89    1  141    2  142  141    0    0  142  P22740     Hemoglobin subunit alpha-A OS=Anas penelope GN=HBAA PE=1 SV=2
  943 : HBA_ANAPL   3EOK    0.72  0.89    1  141    2  142  141    0    0  142  P01986     Hemoglobin subunit alpha-A OS=Anas platyrhynchos GN=HBAA PE=1 SV=2
  944 : HBA_DIDVI           0.72  0.89    1  141    1  141  141    0    0  141  P01976     Hemoglobin subunit alpha OS=Didelphis virginiana GN=HBA PE=1 SV=1
  945 : HBA_MONDO           0.72  0.90    1  141    2  142  141    0    0  142  Q8HY34     Hemoglobin subunit alpha OS=Monodelphis domestica GN=HBA PE=2 SV=3
  946 : HBA_ORNAN           0.72  0.89    1  141    1  141  141    0    0  141  P01979     Hemoglobin subunit alpha OS=Ornithorhynchus anatinus GN=HBA PE=1 SV=1
  947 : HBB1_PANLE          0.72  0.92  145  288    3  146  144    0    0  146  P68050     Hemoglobin subunit beta-1 OS=Panthera leo GN=HBB1 PE=1 SV=1
  948 : HBB1_PANON          0.72  0.92  145  288    4  147  144    0    0  147  P68049     Hemoglobin subunit beta-1 OS=Panthera onca GN=HBB1 PE=1 SV=2
  949 : HBB1_PANPS          0.72  0.92  145  288    4  147  144    0    0  147  P68051     Hemoglobin subunit beta-1 OS=Panthera pardus saxicolor GN=HBB1 PE=1 SV=2
  950 : HBB1_PANTS          0.72  0.92  145  288    4  147  144    0    0  147  P68048     Hemoglobin subunit beta-1 OS=Panthera tigris sumatrae GN=HBB1 PE=1 SV=2
  951 : HBB2_PANPS          0.72  0.91  143  288    1  146  146    0    0  146  P68065     Hemoglobin subunit beta-2 OS=Panthera pardus saxicolor GN=HBB2 PE=1 SV=1
  952 : HBB2_PANTS          0.72  0.91  143  288    1  146  146    0    0  146  P68194     Hemoglobin subunit beta-2 OS=Panthera tigris sumatrae GN=HBB2 PE=1 SV=1
  953 : HBB_ALCAA           0.72  0.92  145  288    2  145  144    0    0  145  P02073     Hemoglobin subunit beta OS=Alces alces alces GN=HBB PE=1 SV=1
  954 : HBB_ANAPL   3EOK    0.72  0.88  144  288    3  147  145    0    0  147  P02114     Hemoglobin subunit beta OS=Anas platyrhynchos GN=HBB PE=1 SV=2
  955 : HBB_ANAPP           0.72  0.88  144  288    2  146  145    0    0  146  P02115     Hemoglobin subunit beta OS=Anas platyrhynchos platyrhynchos GN=HBB PE=1 SV=1
  956 : HBB_ANSAN   1FAW    0.72  0.89  144  288    2  146  145    0    0  146  P02117     Hemoglobin subunit beta OS=Anser anser anser GN=HBB PE=1 SV=1
  957 : HBB_ANTPA           0.72  0.92  144  288    2  146  145    0    0  146  P14388     Hemoglobin subunit beta OS=Antrozous pallidus GN=HBB PE=1 SV=1
  958 : HBB_AYTFU           0.72  0.89  144  288    3  147  145    0    0  147  P84792     Hemoglobin subunit beta OS=Aythya fuligula PE=1 SV=2
  959 : HBB_BRATR           0.72  0.93  144  288    3  147  145    0    0  147  P14526     Hemoglobin subunit beta OS=Bradypus tridactylus GN=HBB PE=1 SV=3
  960 : HBB_CERSI           0.72  0.92  144  288    2  146  145    0    0  146  P02066     Hemoglobin subunit beta OS=Ceratotherium simum GN=HBB PE=1 SV=1
  961 : HBB_CHENI           0.72  0.87  144  288    3  147  145    0    0  147  P83123     Hemoglobin subunit beta OS=Chelonoidis nigra GN=HBB PE=1 SV=3
  962 : HBB_CTEGU           0.72  0.92  144  288    2  146  145    0    0  146  P20855     Hemoglobin subunit beta OS=Ctenodactylus gundi GN=HBB PE=1 SV=1
  963 : HBB_EULFU           0.72  0.92  145  288    4  147  144    0    0  147  P02053     Hemoglobin subunit beta OS=Eulemur fulvus fulvus GN=HBB PE=1 SV=2
  964 : HBB_MACRU           0.72  0.89  144  288    2  146  145    0    0  146  P02107     Hemoglobin subunit beta OS=Macropus rufus GN=HBB PE=1 SV=1
  965 : HBB_MYOVE           0.72  0.92  144  288    2  146  145    0    0  146  P11758     Hemoglobin subunit beta OS=Myotis velifer GN=HBB PE=1 SV=1
  966 : HBB_ODOVI   1HDS    0.72  0.92  145  288    2  145  144    0    0  145  P02074     Hemoglobin subunit beta-3 OS=Odocoileus virginianus virginianus GN=HBB PE=1 SV=1
  967 : HBB_PERCA           0.72  0.90  144  288    2  146  145    0    0  146  B3EWD6     Hemoglobin subunit beta OS=Peromyscus californicus PE=1 SV=1
  968 : HBB_PHYCD           0.72  0.92  144  288    2  146  145    0    0  146  P09905     Hemoglobin subunit beta-1/2 OS=Physeter catodon GN=HBB PE=1 SV=1
  969 : HBB_RANTA           0.72  0.91  145  288    2  145  144    0    0  145  P21380     Hemoglobin subunit beta OS=Rangifer tarandus GN=HBB PE=1 SV=1
  970 : HBB_SCAAQ           0.72  0.91  144  288    3  147  145    0    0  147  Q2KPA4     Hemoglobin subunit beta OS=Scalopus aquaticus GN=HBB PE=2 SV=3
  971 : HBB_SCICA           0.72  0.93  144  288    2  146  145    0    0  146  B3EWD2     Hemoglobin subunit beta OS=Sciurus carolinensis PE=1 SV=1
  972 : HBB_SHEEP   2QU0    0.72  0.91  145  288    2  145  144    0    0  145  P02075     Hemoglobin subunit beta OS=Ovis aries GN=HBB PE=1 SV=2
  973 : HBB_SPAEH           0.72  0.93  144  288    2  146  145    0    0  146  P02090     Hemoglobin subunit beta OS=Spalax ehrenbergi GN=HBB PE=1 SV=1
  974 : HBB_TALEU           0.72  0.92  144  288    2  146  145    0    0  146  P02061     Hemoglobin subunit beta OS=Talpa europaea GN=HBB PE=1 SV=1
  975 : HBB_TUPGL           0.72  0.94  144  288    2  146  145    0    0  146  P02052     Hemoglobin subunit beta OS=Tupaia glis GN=HBB PE=1 SV=1
  976 : HBB_TURME           0.72  0.90  144  288    2  146  145    0    0  146  P14524     Hemoglobin subunit beta OS=Turdus merula GN=HBB PE=1 SV=1
  977 : HBD_HUMAN   1SI4    0.72  0.92  144  288    3  147  145    0    0  147  P02042     Hemoglobin subunit delta OS=Homo sapiens GN=HBD PE=1 SV=2
  978 : HBD_SAGMY           0.72  0.92  144  288    2  146  145    0    0  146  P68014     Hemoglobin subunit delta OS=Saguinus mystax GN=HBD PE=1 SV=1
  979 : HBD_TARSY           0.72  0.94  144  288    3  147  145    0    0  147  P13558     Hemoglobin subunit delta OS=Tarsius syrichta GN=HBD PE=2 SV=2
  980 : I1Y907_COEVI        0.72  0.87    1  141    2  142  141    0    0  142  I1Y907     Hemoglobin subunit alpha-A OS=Coeligena violifer PE=2 SV=1
  981 : I3MW48_SPETR        0.72  0.92  148  288    1  141  141    0    0  141  I3MW48     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=3 SV=1
  982 : J9JHZ3_CANFA        0.72  0.92  144  287    9  152  144    0    0  152  J9JHZ3     Uncharacterized protein (Fragment) OS=Canis familiaris GN=HBD PE=3 SV=1
  983 : L8HWL4_BOSMU        0.72  0.90  144  288   14  158  145    0    0  158  L8HWL4     Hemoglobin subunit epsilon-2 (Fragment) OS=Bos grunniens mutus GN=M91_21161 PE=3 SV=1
  984 : L9KR86_TUPCH        0.72  0.94  144  288    3  147  145    0    0  147  L9KR86     Hemoglobin subunit beta OS=Tupaia chinensis GN=TREES_T100005453 PE=3 SV=1
  985 : M3YFH4_MUSPF        0.72  0.91  144  288    3  147  145    0    0  147  M3YFH4     Uncharacterized protein OS=Mustela putorius furo PE=3 SV=1
  986 : Q0PG38_OCHCU        0.72  0.92  144  288    3  147  145    0    0  147  Q0PG38     Hemoglobin beta chain OS=Ochotona curzoniae PE=2 SV=1
  987 : Q1A2D1_SHEEP        0.72  0.91  145  288    2  145  144    0    0  145  Q1A2D1     Beta-K globin chain OS=Ovis aries GN=HBBK PE=3 SV=1
  988 : Q1KYZ6_SHEEP        0.72  0.91  145  288    2  145  144    0    0  145  Q1KYZ6     Beta-B globin chain OS=Ovis aries GN=HBBB PE=3 SV=1
  989 : Q1KYZ7_SHEEP        0.72  0.90  145  288    2  145  144    0    0  145  Q1KYZ7     Beta-A globin chain OS=Ovis aries GN=HBBA PE=3 SV=1
  990 : Q1KYZ8_OVIMU        0.72  0.91  145  288    2  145  144    0    0  145  Q1KYZ8     Beta globin chain OS=Ovis orientalis musimon GN=HBB PE=3 SV=1
  991 : Q1KYZ9_OVIMU        0.72  0.90  145  288    2  145  144    0    0  145  Q1KYZ9     Beta globin chain OS=Ovis orientalis musimon GN=HBB PE=3 SV=1
  992 : Q7T1F0_9SAUR        0.72  0.87  144  288    2  146  145    0    0  146  Q7T1F0     Hemoglobin beta-globin (Fragment) OS=Chelonoidis chilensis PE=3 SV=1
  993 : A7YB43_PIG          0.71  0.92  144  267    3  126  124    0    0  126  A7YB43     Beta-globin (Fragment) OS=Sus scrofa PE=2 SV=1
  994 : B0VXB4_CALJA        0.71  0.92  144  288    3  147  145    0    0  147  B0VXB4     Delta globin (Predicted) OS=Callithrix jacchus GN=HBD PE=3 SV=1
  995 : B9VY01_ANAGE        0.71  0.89    1  141    2  142  141    0    0  142  B9VY01     Hemoglobin alpha A subunit OS=Anas georgica GN=HBA2 PE=3 SV=1
  996 : C5HYH7_ORYAF        0.71  0.91  145  283    3  141  139    0    0  141  C5HYH7     Beta-globin (Fragment) OS=Orycteropus afer GN=HBB-A PE=3 SV=1
  997 : C5HYH8_ORYAF        0.71  0.91  145  288    3  146  144    0    0  146  C5HYH8     Beta-globin OS=Orycteropus afer GN=HBB-B PE=3 SV=1
  998 : C5MQR4_PERMA        0.71  0.91  144  288    3  147  145    0    0  147  C5MQR4     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
  999 : C5MQS2_PERMA        0.71  0.91  144  288    3  147  145    0    0  147  C5MQS2     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 1000 : C5MQS3_PERMA        0.71  0.91  144  288    3  147  145    0    0  147  C5MQS3     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 1001 : C5MQS7_PERMA        0.71  0.90  144  288    3  147  145    0    0  147  C5MQS7     Beta globin OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 1002 : C5MQT2_PERMA        0.71  0.91  144  288    3  147  145    0    0  147  C5MQT2     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 1003 : C5MQT6_PERMA        0.71  0.91  144  287    3  146  144    0    0  147  C5MQT6     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 1004 : C5MQT7_PERMA4H2L    0.71  0.91  144  288    3  147  145    0    0  147  C5MQT7     Beta globin OS=Peromyscus maniculatus GN=HBB-T1 PE=1 SV=1
 1005 : C5MQU8_PERMA        0.71  0.90  144  288    3  147  145    0    0  147  C5MQU8     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 1006 : C7EIZ0_ANACN        0.71  0.89    1  141    2  142  141    0    0  142  C7EIZ0     Hemoglobin alpha A subunit OS=Anas cyanoptera cyanoptera GN=HBA2 PE=3 SV=1
 1007 : C7EJ12_ANACN        0.71  0.89    1  141    2  142  141    0    0  142  C7EJ12     Hemoglobin alpha A subunit OS=Anas cyanoptera cyanoptera GN=HBA2 PE=3 SV=1
 1008 : C7EJ42_ANACN        0.71  0.89    1  141    2  142  141    0    0  142  C7EJ42     Hemoglobin alpha A subunit OS=Anas cyanoptera orinomus GN=HBA2 PE=3 SV=1
 1009 : C7EJ54_ANACN        0.71  0.89    1  141    2  142  141    0    0  142  C7EJ54     Hemoglobin alpha A subunit OS=Anas cyanoptera orinomus GN=HBA2 PE=3 SV=1
 1010 : C7EJ92_ANAVE        0.71  0.89    1  141    2  142  141    0    0  142  C7EJ92     Hemoglobin alpha A subunit OS=Anas versicolor versicolor GN=HBA2 PE=3 SV=1
 1011 : C7EJB6_ANAVE        0.71  0.89    1  141    2  142  141    0    0  142  C7EJB6     Hemoglobin alpha A subunit OS=Anas versicolor fretensis GN=HBA2 PE=3 SV=1
 1012 : C7EJC7_ANAPN        0.71  0.89    1  141    2  142  141    0    0  142  C7EJC7     Hemoglobin alpha A subunit OS=Anas puna GN=HBA2 PE=3 SV=1
 1013 : C7EJC8_ANAPN        0.71  0.89    1  141    2  142  141    0    0  142  C7EJC8     Hemoglobin alpha A subunit OS=Anas puna GN=HBA2 PE=3 SV=1
 1014 : C7EJC9_ANAPN        0.71  0.89    1  141    2  142  141    0    0  142  C7EJC9     Hemoglobin alpha A subunit OS=Anas puna GN=HBA2 PE=3 SV=1
 1015 : C7EJD0_ANAPN        0.71  0.89    1  141    2  142  141    0    0  142  C7EJD0     Hemoglobin alpha A subunit OS=Anas puna GN=HBA2 PE=3 SV=1
 1016 : C7EJE0_ANAPN        0.71  0.89    1  141    2  142  141    0    0  142  C7EJE0     Hemoglobin alpha A subunit OS=Anas puna GN=HBA2 PE=3 SV=1
 1017 : C7EJH0_ANAFV        0.71  0.89    1  141    2  142  141    0    0  142  C7EJH0     Hemoglobin alpha A subunit OS=Anas flavirostris flavirostris GN=HBA2 PE=3 SV=1
 1018 : C7EJH2_ANAFV        0.71  0.89    1  141    2  142  141    0    0  142  C7EJH2     Hemoglobin alpha A subunit OS=Anas flavirostris flavirostris GN=HBA2 PE=3 SV=1
 1019 : C7EJP1_ANAFV        0.71  0.89    1  141    2  142  141    0    0  142  C7EJP1     Hemoglobin alpha A subunit OS=Anas flavirostris oxyptera GN=HBA2 PE=3 SV=1
 1020 : C7EJP3_ANAFV        0.71  0.89    1  141    2  142  141    0    0  142  C7EJP3     Hemoglobin alpha A subunit OS=Anas flavirostris oxyptera GN=HBA2 PE=3 SV=1
 1021 : C7EJX9_CERNO        0.71  0.89    1  141    2  142  141    0    0  142  C7EJX9     Hemoglobin alpha A subunit OS=Cereopsis novaehollandiae GN=HBA2 PE=3 SV=1
 1022 : C7EJZ1_ANSCY        0.71  0.88    1  141    2  142  141    0    0  142  C7EJZ1     Hemoglobin alpha A subunit OS=Anser cygnoides GN=HBA2 PE=3 SV=1
 1023 : C7EJZ2_9AVES        0.71  0.88    1  141    2  142  141    0    0  142  C7EJZ2     Hemoglobin alpha A subunit OS=Anser fabalis GN=HBA2 PE=3 SV=1
 1024 : C7EJZ3_9AVES        0.71  0.88    1  141    2  142  141    0    0  142  C7EJZ3     Hemoglobin alpha A subunit OS=Anser anser GN=HBA2 PE=3 SV=1
 1025 : C7EJZ5_ANSAL        0.71  0.88    1  141    2  142  141    0    0  142  C7EJZ5     Hemoglobin alpha A subunit OS=Anser albifrons GN=HBA2 PE=3 SV=1
 1026 : C7EJZ7_CHECA        0.71  0.88    1  141    2  142  141    0    0  142  C7EJZ7     Hemoglobin alpha A subunit OS=Chen canagica GN=HBA2 PE=3 SV=1
 1027 : C7EJZ9_ANSCE        0.71  0.88    1  141    2  142  141    0    0  142  C7EJZ9     Hemoglobin alpha A subunit OS=Anser caerulescens GN=HBA2 PE=3 SV=1
 1028 : C7EK00_ANSRO        0.71  0.88    1  141    2  142  141    0    0  142  C7EK00     Hemoglobin alpha A subunit OS=Anser rossii GN=HBA2 PE=3 SV=1
 1029 : C7EK02_BRACA        0.71  0.89    1  141    2  142  141    0    0  142  C7EK02     Hemoglobin alpha A subunit OS=Branta canadensis GN=HBA2 PE=3 SV=1
 1030 : C7EK03_BRASA        0.71  0.89    1  141    2  142  141    0    0  142  C7EK03     Hemoglobin alpha A subunit OS=Branta sandvicensis GN=HBA2 PE=3 SV=1
 1031 : C7EK05_BRABN        0.71  0.89    1  141    2  142  141    0    0  142  C7EK05     Hemoglobin alpha A subunit OS=Branta bernicla GN=HBA2 PE=3 SV=1
 1032 : C7EK07_BRALE        0.71  0.89    1  141    2  142  141    0    0  142  C7EK07     Hemoglobin alpha A subunit OS=Branta leucopsis GN=HBA2 PE=3 SV=1
 1033 : C7EK37_9AVES        0.71  0.89    1  141    2  142  141    0    0  142  C7EK37     Hemoglobin alpha A subunit OS=Tadorna cana GN=HBA2 PE=3 SV=1
 1034 : C7EK38_TADTA        0.71  0.89    1  141    2  142  141    0    0  142  C7EK38     Hemoglobin alpha A subunit OS=Tadorna tadornoides GN=HBA2 PE=3 SV=1
 1035 : C7EKC4_ANACN        0.71  0.89    1  141    2  142  141    0    0  142  C7EKC4     Hemoglobin alpha A subunit OS=Anas cyanoptera septentrionalium GN=HBA2 PE=3 SV=1
 1036 : C7EKF2_ANACN        0.71  0.89    1  141    2  142  141    0    0  142  C7EKF2     Hemoglobin alpha A subunit OS=Anas cyanoptera septentrionalium GN=HBA2 PE=3 SV=1
 1037 : C7EKJ1_ANADI        0.71  0.89    1  141    2  142  141    0    0  142  C7EKJ1     Hemoglobin alpha A subunit OS=Anas discors GN=HBA2 PE=3 SV=1
 1038 : C7EKJ5_ANAQU        0.71  0.89    1  141    2  142  141    0    0  142  C7EKJ5     Hemoglobin alpha A subunit OS=Anas querquedula GN=HBA2 PE=3 SV=1
 1039 : C7EKJ6_ANAFO        0.71  0.89    1  141    2  142  141    0    0  142  C7EKJ6     Hemoglobin alpha A subunit OS=Anas formosa GN=HBA2 PE=3 SV=1
 1040 : C7EKJ9_ANAST        0.71  0.89    1  141    2  142  141    0    0  142  C7EKJ9     Hemoglobin alpha A subunit OS=Anas strepera GN=HBA2 PE=3 SV=1
 1041 : C7EKK0_ANAFA        0.71  0.89    1  141    2  142  141    0    0  142  C7EKK0     Hemoglobin alpha A subunit OS=Anas falcata GN=HBA2 PE=3 SV=1
 1042 : C7EKK1_ANASI        0.71  0.89    1  141    2  142  141    0    0  142  C7EKK1     Hemoglobin alpha A subunit OS=Anas sibilatrix GN=HBA2 PE=3 SV=1
 1043 : C7EKK6_ANAAM        0.71  0.89    1  141    2  142  141    0    0  142  C7EKK6     Hemoglobin alpha A subunit OS=Anas americana GN=HBA2 PE=3 SV=1
 1044 : C7EKK7_ANAPE        0.71  0.89    1  141    2  142  141    0    0  142  C7EKK7     Hemoglobin alpha A subunit OS=Anas penelope GN=HBA2 PE=3 SV=1
 1045 : C7EKK8_ANAAC        0.71  0.89    1  141    2  142  141    0    0  142  C7EKK8     Hemoglobin alpha A subunit OS=Anas acuta GN=HBA2 PE=3 SV=1
 1046 : C7EKN4_ANACR        0.71  0.89    1  141    2  142  141    0    0  142  C7EKN4     Hemoglobin alpha A subunit OS=Anas crecca crecca GN=HBA2 PE=3 SV=1
 1047 : C7EKN6_9AVES        0.71  0.89    1  141    2  142  141    0    0  142  C7EKN6     Hemoglobin alpha A subunit OS=Anas carolinensis GN=HBA2 PE=3 SV=1
 1048 : C7EKN7_ANAFV        0.71  0.89    1  141    2  142  141    0    0  142  C7EKN7     Hemoglobin alpha A subunit OS=Anas flavirostris andium GN=HBA2 PE=3 SV=1
 1049 : C7EKN8_ANAFV        0.71  0.89    1  141    2  142  141    0    0  142  C7EKN8     Hemoglobin alpha A subunit OS=Anas flavirostris andium GN=HBA2 PE=3 SV=1
 1050 : C7EKN9_ANAPL        0.71  0.89    1  141    2  142  141    0    0  142  C7EKN9     Hemoglobin alpha A subunit OS=Anas platyrhynchos GN=HBA2 PE=3 SV=1
 1051 : C7EKP0_9AVES        0.71  0.89    1  141    2  142  141    0    0  142  C7EKP0     Hemoglobin alpha A subunit OS=Anas zonorhyncha GN=HBA2 PE=3 SV=1
 1052 : C7EKP1_ANASE        0.71  0.89    1  141    2  142  141    0    0  142  C7EKP1     Hemoglobin alpha A subunit OS=Anas superciliosa GN=HBA2 PE=3 SV=1
 1053 : C7EKP2_ANAME        0.71  0.89    1  141    2  142  141    0    0  142  C7EKP2     Hemoglobin alpha A subunit OS=Anas melleri GN=HBA2 PE=3 SV=1
 1054 : C7EKR3_NEOJU        0.71  0.88  144  288    3  147  145    0    0  147  C7EKR3     Hemoglobin beta A subunit OS=Neochen jubata GN=HBB PE=3 SV=1
 1055 : C7EKR4_CHLPI        0.71  0.88  144  288    3  147  145    0    0  147  C7EKR4     Hemoglobin beta A subunit OS=Chloephaga picta picta GN=HBB PE=3 SV=1
 1056 : C7EKR5_CHLPI        0.71  0.88  144  288    3  147  145    0    0  147  C7EKR5     Hemoglobin beta A subunit OS=Chloephaga picta leucoptera GN=HBB PE=3 SV=1
 1057 : C7EKR6_9AVES        0.71  0.88  144  288    3  147  145    0    0  147  C7EKR6     Hemoglobin beta A subunit OS=Chloephaga hybrida malvinarum GN=HBB PE=3 SV=1
 1058 : C7EKR7_9AVES        0.71  0.88  144  288    3  147  145    0    0  147  C7EKR7     Hemoglobin beta A subunit OS=Chloephaga poliocephala GN=HBB PE=3 SV=1
 1059 : C7EKR8_9AVES        0.71  0.88  144  288    3  147  145    0    0  147  C7EKR8     Hemoglobin beta A subunit OS=Chloephaga rubidiceps GN=HBB PE=3 SV=1
 1060 : C7EKT8_CYACY        0.71  0.88  144  288    3  147  145    0    0  147  C7EKT8     Hemoglobin beta A subunit OS=Cyanochen cyanoptera GN=HBB PE=3 SV=1
 1061 : C7EKT9_9AVES        0.71  0.89  144  288    3  147  145    0    0  147  C7EKT9     Hemoglobin beta A subunit OS=Merganetta armata GN=HBB PE=3 SV=1
 1062 : C7EKU9_LOPSP        0.71  0.88  144  288    3  147  145    0    0  147  C7EKU9     Hemoglobin beta A subunit OS=Lophonetta specularioides specularioides GN=HBB PE=3 SV=1
 1063 : C7EL18_LOPSP        0.71  0.88  144  288    3  147  145    0    0  147  C7EL18     Hemoglobin beta A subunit OS=Lophonetta specularioides alticola GN=HBB PE=3 SV=1
 1064 : C7ELZ8_DENVD        0.71  0.88  144  288    3  147  145    0    0  147  C7ELZ8     Hemoglobin beta A subunit OS=Dendrocygna viduata GN=HBB PE=3 SV=1
 1065 : C7EM01_BIZLO        0.71  0.89  144  288    3  147  145    0    0  147  C7EM01     Hemoglobin beta A subunit OS=Biziura lobata GN=HBB PE=3 SV=1
 1066 : C7EM02_COSCO        0.71  0.88  144  288    3  147  145    0    0  147  C7EM02     Hemoglobin beta A subunit OS=Coscoroba coscoroba GN=HBB PE=3 SV=1
 1067 : C7EM04_CERNO        0.71  0.89  144  288    3  147  145    0    0  147  C7EM04     Hemoglobin beta A subunit OS=Cereopsis novaehollandiae GN=HBB PE=3 SV=1
 1068 : C7EM05_9AVES        0.71  0.89  144  288    3  147  145    0    0  147  C7EM05     Hemoglobin beta A subunit OS=Cygnus melancoryphus GN=HBB PE=3 SV=1
 1069 : C7EM07_CYGAT        0.71  0.89  144  288    3  147  145    0    0  147  C7EM07     Hemoglobin beta A subunit OS=Cygnus atratus GN=HBB PE=3 SV=1
 1070 : C7EM08_CYGOL        0.71  0.89  144  288    3  147  145    0    0  147  C7EM08     Hemoglobin beta A subunit OS=Cygnus olor GN=HBB PE=3 SV=1
 1071 : C7EM09_CYGBU        0.71  0.89  144  288    3  147  145    0    0  147  C7EM09     Hemoglobin beta A subunit OS=Cygnus buccinator GN=HBB PE=3 SV=1
 1072 : C7EM10_CYGCO        0.71  0.89  144  288    3  147  145    0    0  147  C7EM10     Hemoglobin beta A subunit OS=Cygnus columbianus GN=HBB PE=3 SV=1
 1073 : C7EM13_9AVES        0.71  0.89  144  288    3  147  145    0    0  147  C7EM13     Hemoglobin beta A subunit OS=Anser anser GN=HBB PE=3 SV=1
 1074 : C7EM19_BRACA        0.71  0.89  144  288    3  147  145    0    0  147  C7EM19     Hemoglobin beta A subunit OS=Branta canadensis GN=HBB PE=3 SV=1
 1075 : C7EM20_BRASA        0.71  0.89  144  288    3  147  145    0    0  147  C7EM20     Hemoglobin beta A subunit OS=Branta sandvicensis GN=HBB PE=3 SV=1
 1076 : C7EM21_BRABN        0.71  0.89  144  288    3  147  145    0    0  147  C7EM21     Hemoglobin beta A subunit OS=Branta bernicla GN=HBB PE=3 SV=1
 1077 : C7EM22_BRALE        0.71  0.89  144  288    3  147  145    0    0  147  C7EM22     Hemoglobin beta A subunit OS=Branta leucopsis GN=HBB PE=3 SV=1
 1078 : C7EM23_9AVES        0.71  0.88  144  288    3  147  145    0    0  147  C7EM23     Hemoglobin beta A subunit OS=Malacorhynchus membranaceus GN=HBB PE=3 SV=1
 1079 : C7EM24_9AVES        0.71  0.88  144  288    3  147  145    0    0  147  C7EM24     Hemoglobin beta A subunit OS=Stictonetta naevosa GN=HBB PE=3 SV=1
 1080 : C7EM26_NOMDO        0.71  0.89  144  288    3  147  145    0    0  147  C7EM26     Hemoglobin beta A subunit OS=Nomonyx dominicus GN=HBB PE=3 SV=1
 1081 : C7EM27_OXYVI        0.71  0.89  144  288    3  147  145    0    0  147  C7EM27     Hemoglobin beta A subunit OS=Oxyura vittata GN=HBB PE=3 SV=1
 1082 : C7EM28_OXYJA        0.71  0.89  144  288    3  147  145    0    0  147  C7EM28     Hemoglobin beta A subunit OS=Oxyura jamaicensis jamaicensis GN=HBB PE=3 SV=1
 1083 : C7EM29_OXYLE        0.71  0.89  144  288    3  147  145    0    0  147  C7EM29     Hemoglobin beta A subunit OS=Oxyura leucocephala GN=HBB PE=3 SV=1
 1084 : C7EM30_9AVES        0.71  0.89  144  288    3  147  145    0    0  147  C7EM30     Hemoglobin beta A subunit OS=Oxyura australis GN=HBB PE=3 SV=1
 1085 : C7EM31_9AVES        0.71  0.89  144  288    3  147  145    0    0  147  C7EM31     Hemoglobin beta A subunit OS=Oxyura maccoa GN=HBB PE=3 SV=1
 1086 : C7EM32_9AVES        0.71  0.88  144  288    3  147  145    0    0  147  C7EM32     Hemoglobin beta A subunit OS=Tadorna tadorna GN=HBB PE=3 SV=1
 1087 : C7EM35_CHEJU        0.71  0.88  144  288    3  147  145    0    0  147  C7EM35     Hemoglobin beta A subunit OS=Chenonetta jubata GN=HBB PE=3 SV=1
 1088 : C7EM36_9AVES        0.71  0.88  144  288    3  147  145    0    0  147  C7EM36     Hemoglobin beta A subunit OS=Callonetta leucophrys GN=HBB PE=3 SV=1
 1089 : C7EM37_9AVES        0.71  0.88  144  288    3  147  145    0    0  147  C7EM37     Hemoglobin beta A subunit OS=Netta peposaca GN=HBB PE=3 SV=1
 1090 : C7EM38_AYTVA        0.71  0.88  144  288    3  147  145    0    0  147  C7EM38     Hemoglobin beta A subunit OS=Aythya valisineria GN=HBB PE=3 SV=1
 1091 : C7EM41_9AVES        0.71  0.88  144  288    3  147  145    0    0  147  C7EM41     Hemoglobin beta A subunit OS=Aythya ferina GN=HBB PE=3 SV=1
 1092 : C7EM42_AYTCO        0.71  0.88  144  288    3  147  145    0    0  147  C7EM42     Hemoglobin beta A subunit OS=Aythya collaris GN=HBB PE=3 SV=1
 1093 : C7EM45_AYTMA        0.71  0.88  144  288    3  147  145    0    0  147  C7EM45     Hemoglobin beta A subunit OS=Aythya marila GN=HBB PE=3 SV=1
 1094 : C7EM47_AYTAF        0.71  0.88  144  288    3  147  145    0    0  147  C7EM47     Hemoglobin beta A subunit OS=Aythya affinis GN=HBB PE=3 SV=1
 1095 : C7EM49_POLST        0.71  0.88  144  288    3  147  145    0    0  147  C7EM49     Hemoglobin beta A subunit OS=Polysticta stelleri GN=HBB PE=3 SV=1
 1096 : C7EM50_SOMFI        0.71  0.88  144  288    3  147  145    0    0  147  C7EM50     Hemoglobin beta A subunit OS=Somateria fischeri GN=HBB PE=3 SV=1
 1097 : C7EM51_SOMSP        0.71  0.88  144  288    3  147  145    0    0  147  C7EM51     Hemoglobin beta A subunit OS=Somateria spectabilis GN=HBB PE=3 SV=1
 1098 : C7EM52_SOMMO        0.71  0.88  144  288    3  147  145    0    0  147  C7EM52     Hemoglobin beta A subunit OS=Somateria mollissima GN=HBB PE=3 SV=1
 1099 : C7EM55_HISHI        0.71  0.88  144  288    3  147  145    0    0  147  C7EM55     Hemoglobin beta A subunit OS=Histrionicus histrionicus GN=HBB PE=3 SV=1
 1100 : C7EM56_MELPE        0.71  0.88  144  288    3  147  145    0    0  147  C7EM56     Hemoglobin beta A subunit OS=Melanitta perspicillata GN=HBB PE=3 SV=1
 1101 : C7EM57_MELFS        0.71  0.88  144  288    3  147  145    0    0  147  C7EM57     Hemoglobin beta A subunit OS=Melanitta fusca GN=HBB PE=3 SV=1
 1102 : C7EM58_MELNI        0.71  0.88  144  288    3  147  145    0    0  147  C7EM58     Hemoglobin beta A subunit OS=Melanitta nigra GN=HBB PE=3 SV=1
 1103 : C7EM62_BUCCL        0.71  0.88  144  288    3  147  145    0    0  147  C7EM62     Hemoglobin beta A subunit OS=Bucephala clangula GN=HBB PE=3 SV=1
 1104 : C7EM63_MERAL        0.71  0.88  144  288    3  147  145    0    0  147  C7EM63     Hemoglobin beta A subunit OS=Mergellus albellus GN=HBB PE=3 SV=1
 1105 : C7EM64_LOPCU        0.71  0.88  144  288    3  147  145    0    0  147  C7EM64     Hemoglobin beta A subunit OS=Lophodytes cucullatus GN=HBB PE=3 SV=1
 1106 : C7EM65_MERMG        0.71  0.88  144  288    3  147  145    0    0  147  C7EM65     Hemoglobin beta A subunit OS=Mergus merganser GN=HBB PE=3 SV=1
 1107 : C7EM66_MERSR        0.71  0.88  144  288    3  147  145    0    0  147  C7EM66     Hemoglobin beta A subunit OS=Mergus serrator GN=HBB PE=3 SV=1
 1108 : C7EM96_ANAST        0.71  0.88  144  288    3  147  145    0    0  147  C7EM96     Hemoglobin beta A subunit OS=Anas strepera GN=HBB PE=3 SV=1
 1109 : C8AUM4_PERMA        0.71  0.90  144  288    3  147  145    0    0  147  C8AUM4     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T2 PE=3 SV=1
 1110 : C8AUN2_PERMA        0.71  0.91  144  288    3  147  145    0    0  147  C8AUN2     Beta globin OS=Peromyscus maniculatus GN=HBB-T2 PE=3 SV=1
 1111 : D0U290_MUSMI        0.71  0.92  144  288    3  147  145    0    0  147  D0U290     Beta-globin OS=Mus minutoides GN=Hbbt2 PE=3 SV=1
 1112 : F6WYU4_MONDO        0.71  0.91  144  288    3  147  145    0    0  147  F6WYU4     Uncharacterized protein OS=Monodelphis domestica GN=LOC100019389 PE=3 SV=1
 1113 : G1N9H8_MELGA        0.71  0.87    1  141    2  142  141    0    0  142  G1N9H8     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100539006 PE=3 SV=1
 1114 : HBA2_TACAC          0.71  0.87    1  141    1  141  141    0    0  141  P01978     Hemoglobin subunit alpha-2 OS=Tachyglossus aculeatus aculeatus PE=1 SV=1
 1115 : HBA_ANAPP           0.71  0.89    1  141    2  142  141    0    0  142  P01988     Hemoglobin subunit alpha-A OS=Anas platyrhynchos platyrhynchos GN=HBAA PE=1 SV=2
 1116 : HBA_ANSAN   1FAW    0.71  0.88    1  141    2  142  141    0    0  142  P01989     Hemoglobin subunit alpha-A OS=Anser anser anser GN=HBAA PE=1 SV=2
 1117 : HBA_BRACA           0.71  0.89    1  141    1  141  141    0    0  141  P01991     Hemoglobin subunit alpha-A OS=Branta canadensis GN=HBAA PE=1 SV=1
 1118 : HBA_PHACO           0.71  0.87    1  141    1  141  141    0    0  141  P01995     Hemoglobin subunit alpha-A OS=Phasianus colchicus colchicus GN=HBAA PE=1 SV=1
 1119 : HBA_STROE           0.71  0.91    1  141    1  141  141    0    0  141  Q7LZC3     Hemoglobin subunit alpha-A OS=Streptopelia orientalis GN=HBAA PE=1 SV=1
 1120 : HBA_STUVU           0.71  0.88    1  141    1  141  141    0    0  141  P01997     Hemoglobin subunit alpha-A OS=Sturnus vulgaris GN=HBAA PE=1 SV=1
 1121 : HBA_TURME           0.71  0.89    1  141    1  141  141    0    0  141  P14522     Hemoglobin subunit alpha-A OS=Turdus merula GN=HBAA PE=1 SV=1
 1122 : HBB2_PANLE          0.71  0.91  143  288    1  146  146    0    0  146  P18988     Hemoglobin subunit beta-2 OS=Panthera leo GN=HBB2 PE=1 SV=2
 1123 : HBB2_PANON          0.71  0.90  143  288    2  147  146    0    0  147  P68064     Hemoglobin subunit beta-2 OS=Panthera onca GN=HBB2 PE=1 SV=2
 1124 : HBB_ANSIN   1HV4    0.71  0.89  144  288    2  146  145    0    0  146  P02118     Hemoglobin subunit beta OS=Anser indicus GN=HBB PE=1 SV=1
 1125 : HBB_ARAAR           0.71  0.88  144  288    2  146  145    0    0  146  P02116     Hemoglobin subunit beta OS=Ara ararauna GN=HBB PE=1 SV=1
 1126 : HBB_BRACA           0.71  0.89  144  288    2  146  145    0    0  146  P68944     Hemoglobin subunit beta OS=Branta canadensis GN=HBB PE=1 SV=1
 1127 : HBB_CAIMO           0.71  0.88  144  288    3  147  145    0    0  147  P14260     Hemoglobin subunit beta OS=Cairina moschata GN=HBB PE=2 SV=2
 1128 : HBB_CYGOL           0.71  0.89  144  288    2  146  145    0    0  146  P68945     Hemoglobin subunit beta OS=Cygnus olor GN=HBB PE=1 SV=1
 1129 : HBB_FELCA   3GYS    0.71  0.91  143  288    1  146  146    0    0  146  P07412     Hemoglobin subunit beta-A/B OS=Felis catus GN=HBB PE=1 SV=1
 1130 : HBB_MACEU           0.71  0.89  144  288    3  147  145    0    0  147  Q6H1U7     Hemoglobin subunit beta OS=Macropus eugenii GN=HBB PE=2 SV=3
 1131 : HBB_MACGI           0.71  0.89  144  288    2  146  145    0    0  146  P02106     Hemoglobin subunit beta OS=Macropus giganteus GN=HBB PE=1 SV=1
 1132 : HBB_PERCR           0.71  0.91  144  288    2  146  145    0    0  146  B3EWD4     Hemoglobin subunit beta OS=Peromyscus crinitus PE=1 SV=1
 1133 : HBB_PHACA           0.71  0.90  144  288    2  146  145    0    0  146  P10782     Hemoglobin subunit beta OS=Phalacrocorax carbo GN=HBB PE=1 SV=1
 1134 : HBB_PHORU           0.71  0.89  144  288    2  146  145    0    0  146  P02121     Hemoglobin subunit beta OS=Phoenicopterus ruber ruber GN=HBB PE=1 SV=1
 1135 : HBB_POTTR           0.71  0.90  144  288    2  146  145    0    0  146  P02108     Hemoglobin subunit beta OS=Potorous tridactylus GN=HBB PE=1 SV=1
 1136 : HBB_RHEAM           0.71  0.89  144  288    2  146  145    0    0  146  P02124     Hemoglobin subunit beta OS=Rhea americana GN=HBB PE=1 SV=1
 1137 : HBB_RHIUN           0.71  0.92  144  288    2  146  145    0    0  146  P09907     Hemoglobin subunit beta OS=Rhinoceros unicornis GN=HBB PE=1 SV=1
 1138 : HBB_SPETO           0.71  0.91  144  288    2  146  145    0    0  146  P07410     Hemoglobin subunit beta-S/F OS=Spermophilus townsendii PE=1 SV=1
 1139 : HBE2_BOVIN          0.71  0.90  144  288    3  147  145    0    0  147  P06642     Hemoglobin subunit epsilon-2 OS=Bos taurus GN=HBE2 PE=2 SV=2
 1140 : I1Y903_9AVES        0.71  0.88    1  141    2  142  141    0    0  142  I1Y903     Hemoglobin subunit alpha-A OS=Aglaeactis castelnaudii PE=2 SV=1
 1141 : I1Y906_COECO        0.71  0.87    1  141    2  142  141    0    0  142  I1Y906     Hemoglobin subunit alpha-A OS=Coeligena coeligena PE=2 SV=1
 1142 : I1Y912_9CORV        0.71  0.87    1  141    2  142  141    0    0  142  I1Y912     Hemoglobin subunit alpha-A OS=Corvus cornix PE=2 SV=1
 1143 : K7FA97_PELSI        0.71  0.89  144  288    3  147  145    0    0  147  K7FA97     Uncharacterized protein OS=Pelodiscus sinensis PE=3 SV=1
 1144 : K7WTF0_OCHER        0.71  0.92  144  288    3  147  145    0    0  147  K7WTF0     Hemoglobin beta chain OS=Ochotona erythrotis PE=2 SV=1
 1145 : M3WND9_FELCA        0.71  0.91  143  288    2  147  146    0    0  147  M3WND9     Uncharacterized protein OS=Felis catus GN=LOC101091307 PE=3 SV=1
 1146 : M3YX76_MUSPF        0.71  0.86    2  141    3  142  140    0    0  162  M3YX76     Uncharacterized protein OS=Mustela putorius furo GN=HBQ1 PE=3 SV=1
 1147 : M7AK85_CHEMY        0.71  0.88  144  288    3  147  145    0    0  147  M7AK85     Hemoglobin subunit beta OS=Chelonia mydas GN=UY3_18160 PE=4 SV=1
 1148 : Q6H1L9_MACEU        0.71  0.87    2  141    3  142  140    0    0  142  Q6H1L9     Theta globin OS=Macropus eugenii PE=3 SV=1
 1149 : A8DUK0_MOUSE        0.70  0.91  144  288    3  147  145    0    0  147  A8DUK0     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1150 : A8DUK4_MOUSE        0.70  0.92  144  288    3  147  145    0    0  147  A8DUK4     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=2 SV=1
 1151 : A8DUK7_MOUSE        0.70  0.92  144  288    3  147  145    0    0  147  A8DUK7     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1152 : A8DUL0_MOUSE        0.70  0.91  144  288    3  147  145    0    0  147  A8DUL0     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1153 : A8DUL2_MOUSE        0.70  0.92  144  288    3  147  145    0    0  147  A8DUL2     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1154 : A8DUL7_MOUSE        0.70  0.91  144  288    3  147  145    0    0  147  A8DUL7     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1155 : A8DUM2_MOUSE        0.70  0.90  144  288    3  147  145    0    0  147  A8DUM2     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1156 : A8DUN2_MOUSE        0.70  0.92  144  288    3  147  145    0    0  147  A8DUN2     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1157 : A8DUP3_MOUSE        0.70  0.90  144  288    3  147  145    0    0  147  A8DUP3     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1158 : A8DUP7_MOUSE        0.70  0.91  144  288    3  147  145    0    0  147  A8DUP7     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1159 : A8DUQ1_MOUSE        0.70  0.92  144  288    3  147  145    0    0  147  A8DUQ1     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1160 : A8DV41_MOUSE        0.70  0.92  144  288    3  147  145    0    0  147  A8DV41     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1161 : B2DBE5_MUSCR        0.70  0.92  144  288    3  147  145    0    0  147  B2DBE5     Hemoglobin beta 2 OS=Mus caroli GN=Hbb1 PE=3 SV=1
 1162 : B2KHW1_RHIFE        0.70  0.87    1  141    2  142  141    0    0  142  B2KHW1     Theta 1 globin (Predicted) OS=Rhinolophus ferrumequinum GN=HBQ1_3 PE=3 SV=1
 1163 : B5G106_TAEGU        0.70  0.89  144  288    3  147  145    0    0  147  B5G106     Putative beta-globin OS=Taeniopygia guttata PE=2 SV=1
 1164 : B5G112_TAEGU        0.70  0.89  144  288    3  147  145    0    0  147  B5G112     Putative beta-globin OS=Taeniopygia guttata PE=2 SV=1
 1165 : B5G3P7_TAEGU        0.70  0.89    1  141    2  142  141    0    0  142  B5G3P7     Putative hemoglobin alpha OS=Taeniopygia guttata GN=HBA2 PE=2 SV=1
 1166 : B5G3P8_TAEGU        0.70  0.88    1  141    2  142  141    0    0  142  B5G3P8     Putative hemoglobin alpha OS=Taeniopygia guttata PE=2 SV=1
 1167 : C5HYH6_CHRAS        0.70  0.90  144  288    3  147  145    0    0  147  C5HYH6     Beta-globin OS=Chrysochloris asiatica GN=HBB PE=3 SV=1
 1168 : C5MQT4_PERMA        0.70  0.90  144  288    3  147  145    0    0  147  C5MQT4     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 1169 : C5MQU1_PERMA        0.70  0.91  144  288    3  147  145    0    0  147  C5MQU1     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 1170 : C7EIL4_NEOJU        0.70  0.89    1  141    2  142  141    0    0  142  C7EIL4     Hemoglobin alpha A subunit OS=Neochen jubata GN=HBA2 PE=3 SV=1
 1171 : C7EIL5_CHLPI        0.70  0.89    1  141    2  142  141    0    0  142  C7EIL5     Hemoglobin alpha A subunit OS=Chloephaga picta picta GN=HBA2 PE=3 SV=1
 1172 : C7EIL6_CHLPI        0.70  0.89    1  141    2  142  141    0    0  142  C7EIL6     Hemoglobin alpha A subunit OS=Chloephaga picta leucoptera GN=HBA2 PE=3 SV=1
 1173 : C7EIL9_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EIL9     Hemoglobin alpha A subunit OS=Chloephaga hybrida hybrida GN=HBA2 PE=3 SV=1
 1174 : C7EIM0_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EIM0     Hemoglobin alpha A subunit OS=Chloephaga hybrida malvinarum GN=HBA2 PE=3 SV=1
 1175 : C7EIM2_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EIM2     Hemoglobin alpha A subunit OS=Chloephaga poliocephala GN=HBA2 PE=3 SV=1
 1176 : C7EIM4_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EIM4     Hemoglobin alpha A subunit OS=Chloephaga rubidiceps GN=HBA2 PE=3 SV=1
 1177 : C7EIP6_CYACY        0.70  0.88    1  141    2  142  141    0    0  142  C7EIP6     Hemoglobin alpha A subunit OS=Cyanochen cyanoptera GN=HBA2 PE=3 SV=1
 1178 : C7EIP7_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EIP7     Hemoglobin alpha A subunit OS=Merganetta armata GN=HBA2 PE=3 SV=1
 1179 : C7EIQ1_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EIQ1     Hemoglobin alpha A subunit OS=Merganetta armata GN=HBA2 PE=3 SV=1
 1180 : C7EIQ7_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EIQ7     Hemoglobin alpha A subunit OS=Merganetta armata GN=HBA2 PE=3 SV=1
 1181 : C7EIQ9_LOPSP        0.70  0.89    1  141    2  142  141    0    0  142  C7EIQ9     Hemoglobin alpha A subunit OS=Lophonetta specularioides GN=HBA2 PE=3 SV=1
 1182 : C7EIR0_LOPSP        0.70  0.89    1  141    2  142  141    0    0  142  C7EIR0     Hemoglobin alpha A subunit OS=Lophonetta specularioides specularioides GN=HBA2 PE=3 SV=1
 1183 : C7EIT1_LOPSP        0.70  0.88    1  141    2  142  141    0    0  142  C7EIT1     Hemoglobin alpha A subunit OS=Lophonetta specularioides specularioides GN=HBA2 PE=3 SV=1
 1184 : C7EIT5_LOPSP        0.70  0.88    1  141    2  142  141    0    0  142  C7EIT5     Hemoglobin alpha A subunit OS=Lophonetta specularioides alticola GN=HBA2 PE=3 SV=1
 1185 : C7EIT6_LOPSP        0.70  0.89    1  141    2  142  141    0    0  142  C7EIT6     Hemoglobin alpha A subunit OS=Lophonetta specularioides alticola GN=HBA2 PE=3 SV=1
 1186 : C7EIU1_LOPSP        0.70  0.89    1  141    2  142  141    0    0  142  C7EIU1     Hemoglobin alpha A subunit OS=Lophonetta specularioides alticola GN=HBA2 PE=3 SV=1
 1187 : C7EIU7_LOPSP        0.70  0.88    1  141    2  142  141    0    0  142  C7EIU7     Hemoglobin alpha A subunit OS=Lophonetta specularioides alticola GN=HBA2 PE=3 SV=1
 1188 : C7EJ47_ANACN        0.70  0.88    1  141    2  142  141    0    0  142  C7EJ47     Hemoglobin alpha A subunit OS=Anas cyanoptera orinomus GN=HBA2 PE=3 SV=1
 1189 : C7EJW7_9AVES        0.70  0.88    1  141    2  142  141    0    0  142  C7EJW7     Hemoglobin alpha A subunit OS=Dendrocygna guttata GN=HBA2 PE=3 SV=1
 1190 : C7EJX0_DENEY        0.70  0.88    1  141    2  142  141    0    0  142  C7EJX0     Hemoglobin alpha A subunit OS=Dendrocygna eytoni GN=HBA2 PE=3 SV=1
 1191 : C7EJX3_9AVES        0.70  0.88    1  141    2  142  141    0    0  142  C7EJX3     Hemoglobin alpha A subunit OS=Dendrocygna javanica GN=HBA2 PE=3 SV=1
 1192 : C7EJX6_COSCO        0.70  0.89    1  141    2  142  141    0    0  142  C7EJX6     Hemoglobin alpha A subunit OS=Coscoroba coscoroba GN=HBA2 PE=3 SV=1
 1193 : C7EJY1_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EJY1     Hemoglobin alpha A subunit OS=Cygnus melancoryphus GN=HBA2 PE=3 SV=1
 1194 : C7EJY4_CYGAT        0.70  0.89    1  141    2  142  141    0    0  142  C7EJY4     Hemoglobin alpha A subunit OS=Cygnus atratus GN=HBA2 PE=3 SV=1
 1195 : C7EJY6_CYGOL        0.70  0.89    1  141    2  142  141    0    0  142  C7EJY6     Hemoglobin alpha A subunit OS=Cygnus olor GN=HBA2 PE=3 SV=1
 1196 : C7EK09_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK09     Hemoglobin alpha A subunit OS=Malacorhynchus membranaceus GN=HBA2 PE=3 SV=1
 1197 : C7EK11_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK11     Hemoglobin alpha A subunit OS=Nettapus auritus GN=HBA2 PE=3 SV=1
 1198 : C7EK12_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK12     Hemoglobin alpha A subunit OS=Nettapus coromandelianus GN=HBA2 PE=3 SV=1
 1199 : C7EK30_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK30     Hemoglobin alpha A subunit OS=Plectropterus gambensis GN=HBA2 PE=3 SV=1
 1200 : C7EK31_SARME        0.70  0.89    1  141    2  142  141    0    0  142  C7EK31     Hemoglobin alpha A subunit OS=Sarkidiornis melanotos GN=HBA2 PE=3 SV=1
 1201 : C7EK32_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK32     Hemoglobin alpha A subunit OS=Pteronetta hartlaubi GN=HBA2 PE=3 SV=1
 1202 : C7EK33_ALOAE        0.70  0.89    1  141    2  142  141    0    0  142  C7EK33     Hemoglobin alpha A subunit OS=Alopochen aegyptiaca GN=HBA2 PE=3 SV=1
 1203 : C7EK34_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK34     Hemoglobin alpha A subunit OS=Tadorna tadorna GN=HBA2 PE=3 SV=1
 1204 : C7EK36_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK36     Hemoglobin alpha A subunit OS=Tadorna ferruginea GN=HBA2 PE=3 SV=1
 1205 : C7EK39_CAIMO        0.70  0.89    1  141    2  142  141    0    0  142  C7EK39     Hemoglobin alpha A subunit OS=Cairina moschata GN=HBA2 PE=3 SV=1
 1206 : C7EK40_AIXSP        0.70  0.88    1  141    2  142  141    0    0  142  C7EK40     Hemoglobin alpha A subunit OS=Aix sponsa GN=HBA2 PE=3 SV=1
 1207 : C7EK41_AIXGA        0.70  0.89    1  141    2  142  141    0    0  142  C7EK41     Hemoglobin alpha A subunit OS=Aix galericulata GN=HBA2 PE=3 SV=1
 1208 : C7EK42_CHEJU        0.70  0.89    1  141    2  142  141    0    0  142  C7EK42     Hemoglobin alpha A subunit OS=Chenonetta jubata GN=HBA2 PE=3 SV=1
 1209 : C7EK44_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK44     Hemoglobin alpha A subunit OS=Callonetta leucophrys GN=HBA2 PE=3 SV=1
 1210 : C7EK46_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK46     Hemoglobin alpha A subunit OS=Marmaronetta angustirostris GN=HBA2 PE=3 SV=1
 1211 : C7EK47_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK47     Hemoglobin alpha A subunit OS=Asarcornis scutulata GN=HBA2 PE=3 SV=1
 1212 : C7EK48_NETRU        0.70  0.89    1  141    2  142  141    0    0  142  C7EK48     Hemoglobin alpha A subunit OS=Netta rufina GN=HBA2 PE=3 SV=1
 1213 : C7EK49_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK49     Hemoglobin alpha A subunit OS=Netta peposaca GN=HBA2 PE=3 SV=1
 1214 : C7EK51_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK51     Hemoglobin alpha A subunit OS=Netta erythrophthalma GN=HBA2 PE=3 SV=1
 1215 : C7EK52_AYTVA        0.70  0.89    1  141    2  142  141    0    0  142  C7EK52     Hemoglobin alpha A subunit OS=Aythya valisineria GN=HBA2 PE=3 SV=1
 1216 : C7EK53_AYTAM        0.70  0.89    1  141    2  142  141    0    0  142  C7EK53     Hemoglobin alpha A subunit OS=Aythya americana GN=HBA2 PE=3 SV=1
 1217 : C7EK55_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK55     Hemoglobin alpha A subunit OS=Aythya ferina GN=HBA2 PE=3 SV=1
 1218 : C7EK56_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK56     Hemoglobin alpha A subunit OS=Aythya australis GN=HBA2 PE=3 SV=1
 1219 : C7EK57_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EK57     Hemoglobin alpha A subunit OS=Aythya nyroca GN=HBA2 PE=3 SV=1
 1220 : C7EK58_AYTCO        0.70  0.89    1  141    2  142  141    0    0  142  C7EK58     Hemoglobin alpha A subunit OS=Aythya collaris GN=HBA2 PE=3 SV=1
 1221 : C7EK60_AYTFU        0.70  0.89    1  141    2  142  141    0    0  142  C7EK60     Hemoglobin alpha A subunit OS=Aythya fuligula GN=HBA2 PE=3 SV=1
 1222 : C7EK61_AYTMA        0.70  0.89    1  141    2  142  141    0    0  142  C7EK61     Hemoglobin alpha A subunit OS=Aythya marila GN=HBA2 PE=3 SV=1
 1223 : C7EK64_AYTAF        0.70  0.89    1  141    2  142  141    0    0  142  C7EK64     Hemoglobin alpha A subunit OS=Aythya affinis GN=HBA2 PE=3 SV=1
 1224 : C7EK67_POLST        0.70  0.89    1  141    2  142  141    0    0  142  C7EK67     Hemoglobin alpha A subunit OS=Polysticta stelleri GN=HBA2 PE=3 SV=1
 1225 : C7EK69_SOMFI        0.70  0.89    1  141    2  142  141    0    0  142  C7EK69     Hemoglobin alpha A subunit OS=Somateria fischeri GN=HBA2 PE=3 SV=1
 1226 : C7EK71_SOMSP        0.70  0.89    1  141    2  142  141    0    0  142  C7EK71     Hemoglobin alpha A subunit OS=Somateria spectabilis GN=HBA2 PE=3 SV=1
 1227 : C7EK73_SOMMO        0.70  0.89    1  141    2  142  141    0    0  142  C7EK73     Hemoglobin alpha A subunit OS=Somateria mollissima GN=HBA2 PE=3 SV=1
 1228 : C7EK79_HISHI        0.70  0.89    1  141    2  142  141    0    0  142  C7EK79     Hemoglobin alpha A subunit OS=Histrionicus histrionicus GN=HBA2 PE=3 SV=1
 1229 : C7EK81_MELPE        0.70  0.89    1  141    2  142  141    0    0  142  C7EK81     Hemoglobin alpha A subunit OS=Melanitta perspicillata GN=HBA2 PE=3 SV=1
 1230 : C7EK83_MELFS        0.70  0.89    1  141    2  142  141    0    0  142  C7EK83     Hemoglobin alpha A subunit OS=Melanitta fusca GN=HBA2 PE=3 SV=1
 1231 : C7EK85_MELNI        0.70  0.89    1  141    2  142  141    0    0  142  C7EK85     Hemoglobin alpha A subunit OS=Melanitta nigra GN=HBA2 PE=3 SV=1
 1232 : C7EK87_CLAHY        0.70  0.89    1  141    2  142  141    0    0  142  C7EK87     Hemoglobin alpha A subunit OS=Clangula hyemalis GN=HBA2 PE=3 SV=1
 1233 : C7EK89_BUCAL        0.70  0.89    1  141    2  142  141    0    0  142  C7EK89     Hemoglobin alpha A subunit OS=Bucephala albeola GN=HBA2 PE=3 SV=1
 1234 : C7EK91_BUCCL        0.70  0.89    1  141    2  142  141    0    0  142  C7EK91     Hemoglobin alpha A subunit OS=Bucephala clangula GN=HBA2 PE=3 SV=1
 1235 : C7EK94_MERAL        0.70  0.89    1  141    2  142  141    0    0  142  C7EK94     Hemoglobin alpha A subunit OS=Mergellus albellus GN=HBA2 PE=3 SV=1
 1236 : C7EK96_LOPCU        0.70  0.89    1  141    2  142  141    0    0  142  C7EK96     Hemoglobin alpha A subunit OS=Lophodytes cucullatus GN=HBA2 PE=3 SV=1
 1237 : C7EK98_MERMG        0.70  0.89    1  141    2  142  141    0    0  142  C7EK98     Hemoglobin alpha A subunit OS=Mergus merganser GN=HBA2 PE=3 SV=1
 1238 : C7EKA0_MERSR        0.70  0.89    1  141    2  142  141    0    0  142  C7EKA0     Hemoglobin alpha A subunit OS=Mergus serrator GN=HBA2 PE=3 SV=1
 1239 : C7EKA2_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EKA2     Hemoglobin alpha A subunit OS=Tachyeres patachonicus GN=HBA2 PE=3 SV=1
 1240 : C7EKA4_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EKA4     Hemoglobin alpha A subunit OS=Tachyeres leucocephalus GN=HBA2 PE=3 SV=1
 1241 : C7EKA5_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EKA5     Hemoglobin alpha A subunit OS=Tachyeres brachypterus GN=HBA2 PE=3 SV=1
 1242 : C7EKA8_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EKA8     Hemoglobin alpha A subunit OS=Tachyeres pteneres GN=HBA2 PE=3 SV=1
 1243 : C7EKA9_9AVES        0.70  0.89    1  141    2  142  141    0    0  142  C7EKA9     Hemoglobin alpha A subunit OS=Speculanas specularis GN=HBA2 PE=3 SV=1
 1244 : C7EKB2_AMABR        0.70  0.89    1  141    2  142  141    0    0  142  C7EKB2     Hemoglobin alpha A subunit OS=Amazonetta brasiliensis GN=HBA2 PE=3 SV=1
 1245 : C7EKL0_ANABA        0.70  0.89    1  141    2  142  141    0    0  142  C7EKL0     Hemoglobin alpha A subunit OS=Anas bahamensis GN=HBA2 PE=3 SV=1
 1246 : C7EKL3_ANABA        0.70  0.89    1  141    2  142  141    0    0  142  C7EKL3     Hemoglobin alpha A subunit OS=Anas bahamensis GN=HBA2 PE=3 SV=1
 1247 : C7EKP5_9AVES        0.70  0.89  144  288    3  147  145    0    0  147  C7EKP5     Hemoglobin beta A subunit OS=Oxyura ferruginea GN=HBB PE=3 SV=1
 1248 : C7EKQ1_9AVES        0.70  0.89  144  288    3  147  145    0    0  147  C7EKQ1     Hemoglobin beta A subunit OS=Oxyura ferruginea GN=HBB PE=3 SV=1
 1249 : C7EKR9_CHLME        0.70  0.88  144  288    3  147  145    0    0  147  C7EKR9     Hemoglobin beta A subunit OS=Chloephaga melanoptera GN=HBB PE=3 SV=1
 1250 : C7EKX2_LOPSP        0.70  0.88  144  288    3  147  145    0    0  147  C7EKX2     Hemoglobin beta A subunit OS=Lophonetta specularioides alticola GN=HBB PE=3 SV=1
 1251 : C7EL14_LOPSP        0.70  0.88  144  288    3  147  145    0    0  147  C7EL14     Hemoglobin beta A subunit OS=Lophonetta specularioides alticola GN=HBB PE=3 SV=1
 1252 : C7EM25_9AVES        0.70  0.89  144  288    3  147  145    0    0  147  C7EM25     Hemoglobin beta A subunit OS=Heteronetta atricapilla GN=HBB PE=3 SV=1
 1253 : C7EM33_9AVES        0.70  0.88  144  288    3  147  145    0    0  147  C7EM33     Hemoglobin beta A subunit OS=Tadorna ferruginea GN=HBB PE=3 SV=1
 1254 : C7EM34_TADTA        0.70  0.88  144  288    3  147  145    0    0  147  C7EM34     Hemoglobin beta A subunit OS=Tadorna tadornoides GN=HBB PE=3 SV=1
 1255 : C8AUP8_PERMA        0.70  0.90  144  288    3  147  145    0    0  147  C8AUP8     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T2 PE=3 SV=1
 1256 : C8AUQ0_PERMA        0.70  0.90  144  288    3  147  145    0    0  147  C8AUQ0     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T2 PE=3 SV=1
 1257 : D0U269_MUSMC        0.70  0.91  144  288    3  147  145    0    0  147  D0U269     Beta-globin OS=Mus musculus castaneus GN=Hbbt1 PE=3 SV=1
 1258 : D0U270_MUSMC        0.70  0.91  144  288    3  147  145    0    0  147  D0U270     Beta-globin OS=Mus musculus castaneus GN=Hbbt1 PE=3 SV=1
 1259 : D0U271_MUSCE        0.70  0.91  144  288    3  147  145    0    0  147  D0U271     Beta-globin OS=Mus cervicolor GN=Hbbt1 PE=3 SV=1
 1260 : D0U274_MUSMA        0.70  0.92  144  288    3  147  145    0    0  147  D0U274     Beta-globin OS=Mus macedonicus GN=Hbbt1 PE=3 SV=1
 1261 : D0U275_MUSMI        0.70  0.92  144  288    3  147  145    0    0  147  D0U275     Beta-globin OS=Mus minutoides GN=Hbbt1 PE=3 SV=1
 1262 : D0U279_MUSSA        0.70  0.92  144  288    3  147  145    0    0  147  D0U279     Beta-globin OS=Mus saxicola GN=Hbbt1 PE=3 SV=1
 1263 : D0U280_MUSSA        0.70  0.91  144  288    3  147  145    0    0  147  D0U280     Beta-globin OS=Mus saxicola GN=Hbbt1 PE=3 SV=1
 1264 : D0U281_MUSSP        0.70  0.92  144  288    3  147  145    0    0  147  D0U281     Beta-globin OS=Mus spretus GN=Hbbt1 PE=3 SV=1
 1265 : D0U282_MUSSI        0.70  0.90  144  288    3  147  145    0    0  147  D0U282     Beta-globin OS=Mus spicilegus GN=Hbbt1 PE=3 SV=1
 1266 : D0U283_MUSCR        0.70  0.92  144  288    3  147  145    0    0  147  D0U283     Beta-globin OS=Mus caroli GN=Hbbt2 PE=3 SV=1
 1267 : D0U289_MUSMA        0.70  0.91  144  288    3  147  145    0    0  147  D0U289     Beta-globin OS=Mus macedonicus GN=Hbbt2 PE=3 SV=1
 1268 : D0U298_MUSSI        0.70  0.91  144  288    3  147  145    0    0  147  D0U298     Beta-globin OS=Mus spicilegus GN=Hbbt2 PE=3 SV=1
 1269 : D4N6R6_MUSMC        0.70  0.91  144  288    3  147  145    0    0  147  D4N6R6     Beta-globin OS=Mus musculus castaneus GN=Hbbt1 PE=3 SV=1
 1270 : D4N6U4_MUSMC        0.70  0.91  144  288    3  147  145    0    0  147  D4N6U4     Beta-globin OS=Mus musculus castaneus GN=Hbbt1 PE=3 SV=1
 1271 : F1RII7_PIG          0.70  0.92  144  288    3  147  145    0    0  147  F1RII7     Hemoglobin subunit beta OS=Sus scrofa GN=HBB PE=2 SV=1
 1272 : G1NPZ8_MELGA        0.70  0.87  144  288    3  147  145    0    0  147  G1NPZ8     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100547404 PE=3 SV=2
 1273 : G1U9Q8_MELGA        0.70  0.89  144  288    3  147  145    0    0  147  G1U9Q8     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100547252 PE=3 SV=2
 1274 : HBA1_STEMC          0.70  0.85    1  141    1  141  141    0    0  141  P82111     Hemoglobin subunit alpha-1 OS=Stercorarius maccormicki PE=1 SV=1
 1275 : HBA_ANSSE           0.70  0.86    1  141    2  142  141    0    0  142  P01985     Hemoglobin subunit alpha-A OS=Anseranas semipalmata GN=HBAA PE=1 SV=2
 1276 : HBA_CAIMO           0.70  0.89    1  141    2  142  141    0    0  142  P01987     Hemoglobin subunit alpha-A OS=Cairina moschata GN=HBAA PE=2 SV=2
 1277 : HBA_CHICK   3BEV    0.70  0.86    1  141    2  142  141    0    0  142  P01994     Hemoglobin subunit alpha-A OS=Gallus gallus GN=HBAA PE=1 SV=2
 1278 : HBA_CHRRI           0.70  0.86    1  141    1  141  141    0    0  141  P08260     Hemoglobin subunit alpha-A OS=Chroicocephalus ridibundus GN=HBAA PE=1 SV=1
 1279 : HBA_COTJA   3MJP    0.70  0.88    1  141    2  142  141    0    0  142  P24589     Hemoglobin subunit alpha-A OS=Coturnix coturnix japonica GN=HBAA PE=1 SV=2
 1280 : HBA_CYGOL           0.70  0.89    1  141    1  141  141    0    0  141  P01992     Hemoglobin subunit alpha-A OS=Cygnus olor GN=HBAA PE=1 SV=1
 1281 : HBA_FRAPO           0.70  0.87    1  141    1  141  141    0    0  141  P22741     Hemoglobin subunit alpha-A OS=Francolinus pondicerianus GN=HBAA PE=1 SV=1
 1282 : HBA_MELGA   2QMB    0.70  0.87    1  141    2  142  141    0    0  142  P81023     Hemoglobin subunit alpha-A OS=Meleagris gallopavo GN=HBAA PE=1 SV=2
 1283 : HBA_PASMO           0.70  0.88    1  141    1  141  141    0    0  141  P07407     Hemoglobin subunit alpha-A OS=Passer montanus GN=HBAA PE=1 SV=1
 1284 : HBA_SPHPU           0.70  0.87    1  141    1  141  141    0    0  141  P10059     Hemoglobin subunit alpha-A OS=Sphenodon punctatus GN=HBAA PE=1 SV=1
 1285 : HBB1_MOUSE  1JEB    0.70  0.91  144  288    3  147  145    0    0  147  P02088     Hemoglobin subunit beta-1 OS=Mus musculus GN=Hbb-b1 PE=1 SV=2
 1286 : HBB1_VARAL          0.70  0.83  144  288    2  146  145    0    0  146  P18993     Hemoglobin subunit beta-1 OS=Varanus albigularis GN=HBB1 PE=1 SV=2
 1287 : HBB2_RAT            0.70  0.91  144  288    3  147  145    0    0  147  P11517     Hemoglobin subunit beta-2 OS=Rattus norvegicus PE=1 SV=2
 1288 : HBB_AEGMO           0.70  0.90  144  288    2  146  145    0    0  146  P68061     Hemoglobin subunit beta OS=Aegypius monachus GN=HBB PE=1 SV=1
 1289 : HBB_ALDEL   2Z6N    0.70  0.86  144  288    2  146  145    0    0  146  P83133     Hemoglobin A/D subunit beta OS=Aldabrachelys elephantina PE=1 SV=1
 1290 : HBB_AQUCH           0.70  0.89  144  288    2  146  145    0    0  146  P02122     Hemoglobin subunit beta OS=Aquila chrysaetos GN=HBB PE=1 SV=1
 1291 : HBB_CAMBA           0.70  0.92  144  288    3  147  145    0    0  147  P68230     Hemoglobin subunit beta OS=Camelus bactrianus GN=HBB PE=1 SV=2
 1292 : HBB_CAMDR   3GDJ    0.70  0.92  144  288    3  147  145    0    0  147  P68231     Hemoglobin subunit beta OS=Camelus dromedarius GN=HBB PE=1 SV=2
 1293 : HBB_CHECB           0.70  0.87  144  288    3  147  145    0    0  147  Q98905     Hemoglobin subunit beta OS=Chelonoidis carbonaria GN=HBB PE=2 SV=3
 1294 : HBB_CHICK   1HBR    0.70  0.89  144  288    3  147  145    0    0  147  P02112     Hemoglobin subunit beta OS=Gallus gallus GN=HBB PE=1 SV=2
 1295 : HBB_CHLME           0.70  0.88  144  288    2  146  145    0    0  146  P07036     Hemoglobin subunit beta OS=Chloephaga melanoptera GN=HBB PE=1 SV=1
 1296 : HBB_CHRPI           0.70  0.86  144  288    2  146  145    0    0  146  P13274     Hemoglobin subunit beta OS=Chrysemys picta bellii GN=HBB PE=1 SV=1
 1297 : HBB_CHRRI           0.70  0.88  144  288    2  146  145    0    0  146  P08261     Hemoglobin subunit beta/beta' OS=Chroicocephalus ridibundus GN=HBB PE=1 SV=1
 1298 : HBB_CICCI           0.70  0.88  144  288    2  146  145    0    0  146  P02125     Hemoglobin subunit beta OS=Ciconia ciconia GN=HBB PE=1 SV=1
 1299 : HBB_COTJA   3MJP    0.70  0.88  144  288    2  146  145    0    0  146  P30893     Hemoglobin subunit beta OS=Coturnix coturnix japonica GN=HBB PE=1 SV=1
 1300 : HBB_EUDCH           0.70  0.89  144  288    2  146  145    0    0  146  P10058     Hemoglobin subunit beta OS=Eudyptes chrysocome GN=HBB PE=1 SV=1
 1301 : HBB_FRAPO           0.70  0.89  144  288    2  146  145    0    0  146  P22742     Hemoglobin subunit beta OS=Francolinus pondicerianus GN=HBB PE=1 SV=1
 1302 : HBB_GYPRU           0.70  0.90  144  288    2  146  145    0    0  146  P68063     Hemoglobin subunit beta OS=Gyps rueppellii GN=HBB PE=1 SV=1
 1303 : HBB_MARMA           0.70  0.91  144  288    2  146  145    0    0  146  P08853     Hemoglobin subunit beta OS=Marmota marmota marmota GN=HBB PE=1 SV=1
 1304 : HBB_PASMO           0.70  0.89  144  288    2  146  145    0    0  146  P07406     Hemoglobin subunit beta OS=Passer montanus GN=HBB PE=1 SV=1
 1305 : HBB_PHACO           0.70  0.89  144  288    2  146  145    0    0  146  P02113     Hemoglobin subunit beta OS=Phasianus colchicus colchicus GN=HBB PE=1 SV=1
 1306 : HBB_PIG     1QPW    0.70  0.92  144  288    3  147  145    0    0  147  P02067     Hemoglobin subunit beta OS=Sus scrofa GN=HBB PE=1 SV=3
 1307 : HBB_PSIKR   2ZFB    0.70  0.90  144  288    2  146  145    0    0  146  P21668     Hemoglobin subunit beta OS=Psittacula krameri GN=HBB PE=1 SV=1
 1308 : HBB_STEMC           0.70  0.89  144  288    2  146  145    0    0  146  P82113     Hemoglobin subunit beta OS=Stercorarius maccormicki GN=HBB PE=1 SV=1
 1309 : HBB_STRCA   3FS4    0.70  0.88  144  288    2  146  145    0    0  146  P02123     Hemoglobin subunit beta OS=Struthio camelus GN=HBB PE=1 SV=1
 1310 : HBB_STUVU           0.70  0.89  144  288    2  146  145    0    0  146  P02126     Hemoglobin subunit beta OS=Sturnus vulgaris GN=HBB PE=1 SV=1
 1311 : HBB_TRIOC           0.70  0.90  144  288    2  146  145    0    0  146  P68062     Hemoglobin subunit beta OS=Trigonoceps occipitalis GN=HBB PE=1 SV=1
 1312 : I1VYJ2_9EMBE        0.70  0.91    1  141    2  142  141    0    0  142  I1VYJ2     Hemoglobin subunit alpha-A OS=Zonotrichia capensis PE=3 SV=1
 1313 : I1VYJ3_BUBBB        0.70  0.88    1  141    2  142  141    0    0  142  I1VYJ3     Hemoglobin subunit alpha-A OS=Bubo bubo bubo PE=2 SV=1
 1314 : I1VYJ4_TROAE        0.70  0.88    1  141    2  142  141    0    0  142  I1VYJ4     Hemoglobin subunit alpha-A OS=Troglodytes aedon PE=2 SV=1
 1315 : I1Y902_ADEME        0.70  0.87    1  141    2  142  141    0    0  142  I1Y902     Hemoglobin subunit alpha-A OS=Adelomyia melanogenys PE=2 SV=1
 1316 : I1Y904_9AVES        0.70  0.87    1  141    2  142  141    0    0  142  I1Y904     Hemoglobin subunit alpha-A OS=Amazilia amazilia PE=2 SV=1
 1317 : I1Y905_9AVES        0.70  0.87    1  141    2  142  141    0    0  142  I1Y905     Hemoglobin subunit alpha-A OS=Amazilia viridicauda PE=2 SV=1
 1318 : I1Y908_9AVES        0.70  0.87    1  141    2  142  141    0    0  142  I1Y908     Hemoglobin subunit alpha-A OS=Oreotrochilus estella PE=2 SV=1
 1319 : I1Y909_9AVES        0.70  0.87    1  141    2  142  141    0    0  142  I1Y909     Hemoglobin subunit alpha-A OS=Oreotrochilus melanogaster PE=2 SV=1
 1320 : I1Y911_9AVES        0.70  0.87    1  141    2  142  141    0    0  142  I1Y911     Hemoglobin subunit alpha-A OS=Patagona gigas PE=2 SV=1
 1321 : I1Y913_9PASS        0.70  0.88    1  141    2  142  141    0    0  142  I1Y913     Hemoglobin subunit alpha-A OS=Mino dumontii PE=2 SV=1
 1322 : I3N2T5_SPETR        0.70  0.92  144  288    3  147  145    0    0  147  I3N2T5     Uncharacterized protein OS=Spermophilus tridecemlineatus PE=3 SV=1
 1323 : K7GM56_PIG          0.70  0.78   17  141    2  108  125    1   18  108  K7GM56     Uncharacterized protein (Fragment) OS=Sus scrofa GN=LOC100737768 PE=3 SV=1
 1324 : P84479_MELGA2QMB    0.70  0.89  144  288    2  146  145    0    0  146  P84479     Hemoglobin beta chain OS=Meleagris gallopavo PE=1 SV=1
 1325 : Q18PE4_MUSCR        0.70  0.91  144  288    3  147  145    0    0  147  Q18PE4     Beta-globin OS=Mus caroli GN=Hbb1 PE=3 SV=1
 1326 : Q198B5_COLLI        0.70  0.90   17  141    1  125  125    0    0  125  Q198B5     Alpah-A globin (Fragment) OS=Columba livia GN=HBA2 PE=3 SV=1
 1327 : Q5XME1_NOMDO        0.70  0.89    1  141    2  142  141    0    0  142  Q5XME1     Alpha A hemoglobin OS=Nomonyx dominicus GN=HBA2 PE=3 SV=1
 1328 : A8DUL5_MOUSE        0.69  0.90  144  288    3  147  145    0    0  147  A8DUL5     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1329 : A8DUP0_MOUSE        0.69  0.91  144  288    3  147  145    0    0  147  A8DUP0     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1330 : A8DUP5_MOUSE        0.69  0.90  144  288    3  147  145    0    0  147  A8DUP5     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1331 : A8DUQ5_MOUSE        0.69  0.92  144  288    3  147  145    0    0  147  A8DUQ5     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1332 : B1Q450_MOUSE        0.69  0.92  144  288    3  147  145    0    0  147  B1Q450     Hemoglobin beta chain subunit OS=Mus musculus GN=Hbb-b1 PE=2 SV=1
 1333 : C6L8R0_DRONO        0.69  0.86    1  141    2  142  141    0    0  142  C6L8R0     Hemoglobin subunit alpha-A OS=Dromaius novaehollandiae GN=HBAA PE=2 SV=1
 1334 : C7EIJ7_ANSIN        0.69  0.87    1  141    2  142  141    0    0  142  C7EIJ7     Hemoglobin alpha A subunit OS=Anser indicus GN=HBA2 PE=3 SV=1
 1335 : C7EIJ8_ANSIN        0.69  0.87    1  141    2  142  141    0    0  142  C7EIJ8     Hemoglobin alpha A subunit OS=Anser indicus GN=HBA2 PE=3 SV=1
 1336 : C7EIJ9_9AVES        0.69  0.89    1  141    2  142  141    0    0  142  C7EIJ9     Hemoglobin alpha A subunit OS=Oxyura ferruginea GN=HBA2 PE=3 SV=1
 1337 : C7EIM6_CHLME        0.69  0.89    1  141    2  142  141    0    0  142  C7EIM6     Hemoglobin alpha A subunit OS=Chloephaga melanoptera GN=HBA2 PE=3 SV=1
 1338 : C7EIT3_LOPSP        0.69  0.87    1  141    2  142  141    0    0  142  C7EIT3     Hemoglobin alpha A subunit OS=Lophonetta specularioides alticola GN=HBA2 PE=3 SV=1
 1339 : C7EJW1_ANSSE        0.69  0.86    1  141    2  142  141    0    0  142  C7EJW1     Hemoglobin alpha A subunit OS=Anseranas semipalmata GN=HBA2 PE=3 SV=1
 1340 : C7EJW4_DENVD        0.69  0.88    1  141    2  142  141    0    0  142  C7EJW4     Hemoglobin alpha A subunit OS=Dendrocygna viduata GN=HBA2 PE=3 SV=1
 1341 : C7EJW6_DENAU        0.69  0.89    1  141    2  142  141    0    0  142  C7EJW6     Hemoglobin alpha A subunit OS=Dendrocygna autumnalis GN=HBA2 PE=3 SV=1
 1342 : C7EJW8_DENAR        0.69  0.89    1  141    2  142  141    0    0  142  C7EJW8     Hemoglobin alpha A subunit OS=Dendrocygna arborea GN=HBA2 PE=3 SV=1
 1343 : C7EJW9_DENBI        0.69  0.88    1  141    2  142  141    0    0  142  C7EJW9     Hemoglobin alpha A subunit OS=Dendrocygna bicolor GN=HBA2 PE=3 SV=1
 1344 : C7EJX2_DENAC        0.69  0.88    1  141    2  142  141    0    0  142  C7EJX2     Hemoglobin alpha A subunit OS=Dendrocygna arcuata GN=HBA2 PE=3 SV=1
 1345 : C7EJX4_BIZLO        0.69  0.89    1  141    2  142  141    0    0  142  C7EJX4     Hemoglobin alpha A subunit OS=Biziura lobata GN=HBA2 PE=3 SV=1
 1346 : C7EK13_NETPU        0.69  0.89    1  141    2  142  141    0    0  142  C7EK13     Hemoglobin alpha A subunit OS=Nettapus pulchellus GN=HBA2 PE=3 SV=1
 1347 : C7EK16_9AVES        0.69  0.89    1  141    2  142  141    0    0  142  C7EK16     Hemoglobin alpha A subunit OS=Heteronetta atricapilla GN=HBA2 PE=3 SV=1
 1348 : C7EK88_CLAHY        0.69  0.89    1  141    2  142  141    0    0  142  C7EK88     Hemoglobin alpha A subunit OS=Clangula hyemalis GN=HBA2 PE=3 SV=1
 1349 : C7EK93_BUCIS        0.69  0.89    1  141    2  142  141    0    0  142  C7EK93     Hemoglobin alpha A subunit OS=Bucephala islandica GN=HBA2 PE=3 SV=1
 1350 : D0U284_MUSMC        0.69  0.90  144  288    3  147  145    0    0  147  D0U284     Beta-globin OS=Mus musculus castaneus GN=Hbbt2 PE=3 SV=1
 1351 : D0U285_MUSMC        0.69  0.91  144  288    3  147  145    0    0  147  D0U285     Beta-globin OS=Mus musculus castaneus GN=Hbbt2 PE=3 SV=1
 1352 : D0U293_MOUSE        0.69  0.90  144  288    3  147  145    0    0  147  D0U293     Beta-globin OS=Mus musculus GN=Hbbt2 PE=3 SV=1
 1353 : D3U1G8_ELEMA        0.69  0.90  144  288    3  147  145    0    0  147  D3U1G8     Hemoglobin subunit beta/delta hybrid OS=Elephas maximus GN=HBB/D PE=2 SV=1
 1354 : D3U1H5_LOXAF        0.69  0.90  144  288    3  147  145    0    0  147  D3U1H5     Hemoglobin subunit beta/delta hybrid OS=Loxodonta africana GN=HBB/D PE=2 SV=1
 1355 : D4N6V9_MUSMC        0.69  0.91  144  288    3  147  145    0    0  147  D4N6V9     Beta-globin OS=Mus musculus castaneus GN=Hbbt1 PE=3 SV=1
 1356 : E5RWQ1_9SAUR3AT5    0.69  0.90  143  288    2  147  146    0    0  147  E5RWQ1     Beta-globin OS=Podocnemis unifilis GN=HBB PE=1 SV=1
 1357 : F7APQ4_MACMU        0.69  0.86  144  272    3  132  131    2    3  176  F7APQ4     Hemoglobin subunit beta OS=Macaca mulatta GN=HBB PE=2 SV=1
 1358 : G3WEF1_SARHA        0.69  0.92  144  288    3  147  145    0    0  147  G3WEF1     Uncharacterized protein OS=Sarcophilus harrisii PE=3 SV=1
 1359 : G5BXY0_HETGA        0.69  0.86    2  141    3  142  140    0    0  142  G5BXY0     Hemoglobin subunit theta-1 OS=Heterocephalus glaber GN=GW7_12997 PE=3 SV=1
 1360 : HBA_ACCGE           0.69  0.85    1  141    2  142  141    0    0  142  P08850     Hemoglobin subunit alpha-A OS=Accipiter gentilis GN=HBAA PE=1 SV=2
 1361 : HBA_ANSIN   1HV4    0.69  0.87    1  141    2  142  141    0    0  142  P01990     Hemoglobin subunit alpha-A OS=Anser indicus GN=HBAA PE=1 SV=2
 1362 : HBA_AQUCH           0.69  0.85    1  141    2  142  141    0    0  142  P01993     Hemoglobin subunit alpha-A OS=Aquila chrysaetos GN=HBAA PE=1 SV=2
 1363 : HBA_ARAAR           0.69  0.86    1  141    2  142  141    0    0  142  P01996     Hemoglobin subunit alpha-A OS=Ara ararauna GN=HBAA PE=1 SV=2
 1364 : HBA_AYTFU           0.69  0.88    1  141    2  142  141    0    0  142  P84790     Hemoglobin subunit alpha-A OS=Aythya fuligula PE=1 SV=2
 1365 : HBA_CHLME           0.69  0.89    1  141    1  141  141    0    0  141  P07034     Hemoglobin subunit alpha-A OS=Chloephaga melanoptera GN=HBAA PE=1 SV=1
 1366 : HBA_CICCI           0.69  0.87    1  141    2  142  141    0    0  142  P01983     Hemoglobin subunit alpha-A OS=Ciconia ciconia GN=HBAA PE=1 SV=2
 1367 : HBA_COLLI   2R80    0.69  0.89    1  141    2  142  141    0    0  142  P21871     Hemoglobin subunit alpha-A OS=Columba livia GN=HBAA PE=1 SV=2
 1368 : HBA_CRONI           0.69  0.84    1  141    1  141  141    0    0  141  P01998     Hemoglobin subunit alpha OS=Crocodylus niloticus GN=HBA PE=1 SV=1
 1369 : HBA_CROSI           0.69  0.84    1  141    1  141  141    0    0  141  B0M2T2     Hemoglobin subunit alpha OS=Crocodylus siamensis GN=HBA PE=1 SV=1
 1370 : HBA_EUDCH           0.69  0.86    1  141    1  141  141    0    0  141  P10057     Hemoglobin subunit alpha OS=Eudyptes chrysocome GN=HBA PE=1 SV=1
 1371 : HBA_PHORU           0.69  0.85    1  141    1  141  141    0    0  141  P01984     Hemoglobin subunit alpha-A OS=Phoenicopterus ruber ruber GN=HBAA PE=1 SV=2
 1372 : HBA_STRCA   3FS4    0.69  0.89    1  141    1  141  141    0    0  141  P01981     Hemoglobin subunit alpha-A OS=Struthio camelus GN=HBAA PE=1 SV=1
 1373 : HBB2_IGUIG          0.69  0.86  144  288    2  146  145    0    0  146  P86390     Hemoglobin subunit beta-2 OS=Iguana iguana GN=HBB2 PE=1 SV=1
 1374 : HBB2_MOUSE  1I3R    0.69  0.91  144  288    3  147  145    0    0  147  P02089     Hemoglobin subunit beta-2 OS=Mus musculus GN=Hbb-b2 PE=1 SV=2
 1375 : HBB_ACCGE           0.69  0.90  144  288    2  146  145    0    0  146  P08851     Hemoglobin subunit beta OS=Accipiter gentilis GN=HBB PE=1 SV=1
 1376 : HBB_ANSSE           0.69  0.89  144  288    2  146  145    0    0  146  P02120     Hemoglobin subunit beta OS=Anseranas semipalmata GN=HBB PE=1 SV=1
 1377 : HBB_APUAP           0.69  0.88  144  288    2  146  145    0    0  146  P15165     Hemoglobin subunit beta OS=Apus apus GN=HBB PE=1 SV=1
 1378 : HBB_ECHTE           0.69  0.89  144  288    2  146  145    0    0  146  P24292     Hemoglobin subunit beta OS=Echinops telfairi GN=HBB PE=1 SV=1
 1379 : HBB_ELEMA           0.69  0.90  144  288    2  146  145    0    0  146  P02084     Hemoglobin subunit beta OS=Elephas maximus GN=HBB PE=1 SV=1
 1380 : HBB_LAMGL           0.69  0.91  144  288    3  147  145    0    0  147  P68226     Hemoglobin subunit beta OS=Lama glama GN=HBB PE=1 SV=2
 1381 : HBB_LAMGU           0.69  0.91  144  288    3  147  145    0    0  147  P68229     Hemoglobin subunit beta OS=Lama guanicoe GN=HBB PE=1 SV=2
 1382 : HBB_LAMPA           0.69  0.91  144  288    3  147  145    0    0  147  P68228     Hemoglobin subunit beta OS=Lama guanicoe pacos GN=HBB PE=1 SV=2
 1383 : HBB_LAMVI           0.69  0.91  144  288    3  147  145    0    0  147  P68227     Hemoglobin subunit beta OS=Lama vicugna GN=HBB PE=1 SV=2
 1384 : HBB_LOXAF           0.69  0.90  144  288    2  146  145    0    0  146  P02085     Hemoglobin subunit beta OS=Loxodonta africana GN=HBB PE=1 SV=1
 1385 : HBB_MICPE           0.69  0.90  144  288    2  146  145    0    0  146  B3EWE4     Hemoglobin subunit beta OS=Microtus pennsylvanicus PE=1 SV=1
 1386 : HBB_SPECI           0.69  0.91  144  288    2  146  145    0    0  146  P09421     Hemoglobin subunit beta OS=Spermophilus citellus GN=HBB PE=1 SV=1
 1387 : HBB_TAMHU           0.69  0.91  144  288    2  146  145    0    0  146  B3EWD8     Hemoglobin subunit beta OS=Tamiasciurus hudsonicus PE=1 SV=1
 1388 : HBD_ELEMA           0.69  0.90  144  288    3  147  145    0    0  147  Q45XI9     Hemoglobin subunit delta OS=Elephas maximus GN=HBD PE=2 SV=3
 1389 : HBD_LOXAF           0.69  0.90  144  288    3  147  145    0    0  147  Q45XJ0     Hemoglobin subunit delta OS=Loxodonta africana GN=HBD PE=2 SV=3
 1390 : L8B1Z6_ALDEL        0.69  0.83  144  288    2  146  145    0    0  146  L8B1Z6     Beta globin (Fragment) OS=Aldabrachelys elephantina PE=3 SV=1
 1391 : M7AYD8_CHEMY        0.69  0.88  143  288  124  269  146    0    0  269  M7AYD8     Hemoglobin subunit beta OS=Chelonia mydas GN=UY3_18159 PE=4 SV=1
 1392 : Q549D9_MOUSE        0.69  0.91  144  288    3  147  145    0    0  147  Q549D9     Beta-globin OS=Mus musculus GN=Hbb-b2 PE=2 SV=1
 1393 : Q54AH9_MOUSE        0.69  0.91  144  288    2  146  145    0    0  146  Q54AH9     Beta-2-globin (Fragment) OS=Mus musculus GN=Hbb-b2 PE=2 SV=1
 1394 : Q5XMD6_9AVES        0.69  0.89    1  141    2  142  141    0    0  142  Q5XMD6     Alpha A hemoglobin OS=Oxyura maccoa GN=HBA2 PE=3 SV=1
 1395 : Q5XMD7_OXYLE        0.69  0.89    1  141    2  142  141    0    0  142  Q5XMD7     Alpha A hemoglobin OS=Oxyura leucocephala GN=HBA2 PE=3 SV=1
 1396 : Q5XMD8_9AVES        0.69  0.89    1  141    2  142  141    0    0  142  Q5XMD8     Alpha A hemoglobin OS=Oxyura australis GN=HBA2 PE=3 SV=1
 1397 : Q5XMD9_OXYJA        0.69  0.89    1  141    2  142  141    0    0  142  Q5XMD9     Alpha A hemoglobin OS=Oxyura jamaicensis jamaicensis GN=HBA2 PE=3 SV=1
 1398 : Q5XME0_OXYVI        0.69  0.89    1  141    2  142  141    0    0  142  Q5XME0     Alpha A hemoglobin OS=Oxyura vittata GN=HBA2 PE=3 SV=1
 1399 : Q7ZT87_9AVES        0.69  0.87    1  141    2  142  141    0    0  142  Q7ZT87     Alpha A globin OS=Cuculus canorus GN=alpha-A PE=2 SV=1
 1400 : Q90864_CHICK        0.69  0.87  144  288    3  147  145    0    0  147  Q90864     Beta-H globin OS=Gallus gallus GN=HBE1 PE=3 SV=1
 1401 : Q9QUN8_MOUSE        0.69  0.90  144  288    2  146  145    0    0  146  Q9QUN8     Beta-2-globin (Fragment) OS=Mus musculus GN=Hbb-b2 PE=2 SV=1
 1402 : A8DUK2_MOUSE        0.68  0.89  144  288    3  151  149    1    4  151  A8DUK2     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1403 : A8DV59_MOUSE        0.68  0.91  144  288    3  147  145    0    0  147  A8DV59     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 1404 : C7EJW3_9AVES        0.68  0.89    1  141    2  142  141    0    0  142  C7EJW3     Hemoglobin alpha A subunit OS=Thalassornis leuconotus GN=HBA2 PE=3 SV=1
 1405 : D0U273_MUSCO        0.68  0.90  144  288    3  147  145    0    0  147  D0U273     Beta-globin OS=Mus cookii GN=Hbbt1 PE=3 SV=1
 1406 : D0U278_MUSPA        0.68  0.90  144  288    3  147  145    0    0  147  D0U278     Beta-globin OS=Mus pahari GN=Hbbt1 PE=3 SV=1
 1407 : D0U286_MUSCE        0.68  0.90  144  288    3  147  145    0    0  147  D0U286     Beta-globin OS=Mus cervicolor GN=Hbbt2 PE=3 SV=1
 1408 : D0U294_MUSPA        0.68  0.90  144  288    3  147  145    0    0  147  D0U294     Beta-globin OS=Mus pahari GN=Hbbt2 PE=3 SV=1
 1409 : D4N6M2_MUSMC        0.68  0.90  144  288    3  147  145    0    0  147  D4N6M2     Beta-globin OS=Mus musculus castaneus GN=Hbbt2 PE=3 SV=1
 1410 : D4N6N2_MUSMC        0.68  0.91  144  288    3  147  145    0    0  147  D4N6N2     Beta-globin OS=Mus musculus castaneus GN=Hbbt2 PE=3 SV=1
 1411 : D4N6N9_MUSMC        0.68  0.91  144  288    3  147  145    0    0  147  D4N6N9     Beta-globin OS=Mus musculus castaneus GN=Hbbt2 PE=3 SV=1
 1412 : F6VE37_HORSE        0.68  0.86  144  288    3  151  149    1    4  151  F6VE37     Uncharacterized protein OS=Equus caballus GN=LOC100054161 PE=3 SV=1
 1413 : G3WER9_SARHA        0.68  0.82    2  141    3  143  141    1    1  143  G3WER9     Uncharacterized protein OS=Sarcophilus harrisii GN=HBQ1 PE=3 SV=1
 1414 : H0YQM9_TAEGU        0.68  0.89  144  288    3  147  145    0    0  147  H0YQM9     Uncharacterized protein OS=Taeniopygia guttata GN=HBE1 PE=3 SV=1
 1415 : HBA_APUAP           0.68  0.85    1  141    2  142  141    0    0  142  P15162     Hemoglobin subunit alpha-A OS=Apus apus GN=HBAA PE=1 SV=2
 1416 : HBA_CARCR           0.68  0.85    1  141    1  141  141    0    0  141  Q10732     Hemoglobin subunit alpha-A OS=Caretta caretta GN=HBAA PE=1 SV=1
 1417 : HBB1_DRYCE          0.68  0.88  144  288    2  146  145    0    0  146  P0C0U8     Hemoglobin subunit beta-1 OS=Drymarchon corais erebennus PE=1 SV=1
 1418 : HBB1_IGUIG          0.68  0.86  144  288    2  146  145    0    0  146  P18987     Hemoglobin subunit beta-1 OS=Iguana iguana GN=HBB1 PE=1 SV=1
 1419 : HBB2_AMBCR          0.68  0.86  144  288    2  146  145    0    0  146  P86391     Hemoglobin subunit beta-2 OS=Amblyrhynchus cristatus GN=HBB2 PE=1 SV=1
 1420 : HBB2_NAJNA          0.68  0.85  144  288    2  146  145    0    0  146  P22743     Hemoglobin subunit beta-2 OS=Naja naja GN=HBB2 PE=1 SV=1
 1421 : HBB2_SPHPU          0.68  0.89  144  288    2  146  145    0    0  146  P10061     Hemoglobin subunit beta-2 OS=Sphenodon punctatus GN=HBB2 PE=1 SV=1
 1422 : HBB_DASNO           0.68  0.92  144  288    3  147  145    0    0  147  P02087     Hemoglobin subunit beta OS=Dasypus novemcinctus GN=HBB PE=1 SV=3
 1423 : HBB_DIDVI           0.68  0.92  144  288    3  147  145    0    0  147  P02109     Hemoglobin subunit beta-M OS=Didelphis virginiana GN=HBB PE=1 SV=3
 1424 : HBB_MICGA           0.68  0.84  144  288    2  146  145    0    0  146  P41332     Hemoglobin subunit beta OS=Microcephalophis gracilis GN=HBB PE=1 SV=1
 1425 : HBB_ONDZI           0.68  0.93  144  288    2  146  145    0    0  146  P02093     Hemoglobin subunit beta OS=Ondatra zibethicus GN=HBB PE=1 SV=2
 1426 : HBB_SMICR           0.68  0.92  144  288    3  147  145    0    0  147  Q28932     Hemoglobin subunit beta OS=Sminthopsis crassicaudata GN=HBB PE=2 SV=3
 1427 : HBB_VULGR           0.68  0.90  144  288    2  146  145    0    0  146  P07411     Hemoglobin subunit beta OS=Vultur gryphus GN=HBB PE=1 SV=1
 1428 : HBD_DUGDU           0.68  0.90  144  288    3  147  145    0    0  147  Q45XI7     Hemoglobin subunit delta OS=Dugong dugon GN=HBD PE=2 SV=3
 1429 : HBRH_CHICK          0.68  0.90  144  288    3  147  145    0    0  147  P02127     Hemoglobin subunit rho OS=Gallus gallus PE=1 SV=2
 1430 : I1Y910_9AVES        0.68  0.87    1  141    2  142  141    0    0  142  I1Y910     Hemoglobin subunit alpha-A OS=Phaethornis malaris PE=2 SV=1
 1431 : I1Y915_MELUD        0.68  0.86    1  141    2  142  141    0    0  142  I1Y915     Hemoglobin subunit alpha-A OS=Melopsittacus undulatus PE=2 SV=1
 1432 : R0KYP5_ANAPL        0.68  0.90  144  288    3  147  145    0    0  147  R0KYP5     Hemoglobin subunit rho (Fragment) OS=Anas platyrhynchos GN=Anapl_16678 PE=4 SV=1
 1433 : C1FY20_DASNO        0.67  0.92  144  288    3  147  145    0    0  147  C1FY20     Hemoglobin beta chain complex (Predicted) OS=Dasypus novemcinctus GN=HBB PE=3 SV=1
 1434 : C7EK14_9AVES        0.67  0.89    1  141    2  142  141    0    0  142  C7EK14     Hemoglobin alpha A subunit OS=Stictonetta naevosa GN=HBA2 PE=3 SV=1
 1435 : D0U272_MUSCO        0.67  0.90  144  288    3  147  145    0    0  147  D0U272     Beta-globin OS=Mus cookii GN=Hbbt1 PE=3 SV=1
 1436 : D3U1H9_MAMPR3VRE    0.67  0.90  144  288    3  147  145    0    0  147  D3U1H9     Hemoglobin subunit beta/delta hybrid OS=Mammuthus primigenius GN=HBB/D PE=1 SV=1
 1437 : E5RWQ0_9SAUR3AT5    0.67  0.85    1  141    2  142  141    0    0  142  E5RWQ0     AlphaA-globin OS=Podocnemis unifilis GN=HBAA PE=1 SV=1
 1438 : G3X8H7_LOXAF        0.67  0.86    2  141    3  142  140    0    0  142  G3X8H7     Uncharacterized protein OS=Loxodonta africana GN=LOC100656617 PE=3 SV=1
 1439 : HBA_AEGMO           0.67  0.86    1  141    2  142  141    0    0  142  P07417     Hemoglobin subunit alpha-A OS=Aegypius monachus GN=HBAA PE=1 SV=2
 1440 : HBA_ALLMI           0.67  0.83    1  141    2  142  141    0    0  142  P01999     Hemoglobin subunit alpha OS=Alligator mississippiensis GN=HBA PE=1 SV=2
 1441 : HBA_APTFO           0.67  0.86    1  141    2  142  141    0    0  142  P01980     Hemoglobin subunit alpha OS=Aptenodytes forsteri GN=HBA PE=1 SV=3
 1442 : HBA_CAICR           0.67  0.84    1  141    1  141  141    0    0  141  P02000     Hemoglobin subunit alpha OS=Caiman crocodilus GN=HBA PE=1 SV=1
 1443 : HBA_CHRPI           0.67  0.85    1  141    1  141  141    0    0  141  P13273     Hemoglobin subunit alpha-A OS=Chrysemys picta bellii GN=HBAA PE=1 SV=1
 1444 : HBA_EUDSC           0.67  0.87    1  141    1  141  141    0    0  141  P19789     Hemoglobin subunit alpha-A OS=Eudynamys scolopacea GN=HBAA PE=1 SV=1
 1445 : HBA_GYPRU           0.67  0.84    1  141    1  141  141    0    0  141  P08256     Hemoglobin subunit alpha-A/A' OS=Gyps rueppellii GN=HBAA PE=1 SV=1
 1446 : HBA_PHACA           0.67  0.84    1  141    1  141  141    0    0  141  P10780     Hemoglobin subunit alpha-A OS=Phalacrocorax carbo GN=HBAA PE=1 SV=1
 1447 : HBA_RHEAM           0.67  0.84    1  141    1  141  141    0    0  141  P01982     Hemoglobin subunit alpha-A OS=Rhea americana GN=HBAA PE=1 SV=1
 1448 : HBA_TRIOC           0.67  0.86    1  141    1  141  141    0    0  141  P19832     Hemoglobin subunit alpha-A OS=Trigonoceps occipitalis GN=HBAA PE=1 SV=1
 1449 : HBA_VULGR           0.67  0.87    1  141    1  141  141    0    0  141  P07404     Hemoglobin subunit alpha-A OS=Vultur gryphus GN=HBAA PE=1 SV=1
 1450 : HBB1_SPHPU          0.67  0.82  144  288    2  146  145    0    0  146  P10060     Hemoglobin subunit beta-1 OS=Sphenodon punctatus GN=HBB1 PE=1 SV=1
 1451 : HBB_APTFO           0.67  0.88  144  288    2  146  145    0    0  146  P80216     Hemoglobin subunit beta OS=Aptenodytes forsteri GN=HBB PE=1 SV=1
 1452 : HBB_LIOMI           0.67  0.90  144  288    2  146  145    0    0  146  P16418     Hemoglobin subunit beta OS=Liophis miliaris GN=HBB PE=1 SV=1
 1453 : HBD_DENDR           0.67  0.88  144  288    3  147  145    0    0  147  Q45XI4     Hemoglobin subunit deltaH OS=Dendrohyrax dorsalis GN=HBD PE=2 SV=3
 1454 : I1VYJ5_9AVES        0.67  0.84    1  141    2  142  141    0    0  142  I1VYJ5     Hemoglobin subunit alpha-A OS=Pelecanus onocrotalus PE=2 SV=1
 1455 : I1VYJ6_9AVES        0.67  0.85    1  141    2  142  141    0    0  142  I1VYJ6     Hemoglobin subunit alpha-A OS=Pelecanus crispus PE=2 SV=1
 1456 : I1Y914_9AVES        0.67  0.84    1  141    2  142  141    0    0  142  I1Y914     Hemoglobin subunit alpha-A OS=Phoenicopterus roseus PE=2 SV=1
 1457 : K7FBN5_PELSI        0.67  0.86  144  288    3  147  145    0    0  147  K7FBN5     Uncharacterized protein OS=Pelodiscus sinensis PE=3 SV=1
 1458 : K7WL83_MESAU        0.67  0.91  158  288    1  131  131    0    0  131  K7WL83     Beta-globin (Fragment) OS=Mesocricetus auratus PE=2 SV=1
 1459 : L5LQX1_MYODS        0.67  0.87    1  141    2  142  141    0    0  142  L5LQX1     Hemoglobin subunit theta-1 OS=Myotis davidii GN=MDA_GLEAN10007591 PE=3 SV=1
 1460 : B5FX70_TAEGU        0.66  0.86  144  288    3  147  145    0    0  147  B5FX70     Putative hemoglobin beta chain OS=Taeniopygia guttata PE=2 SV=1
 1461 : C7EJW2_CHATO        0.66  0.84    1  141    2  142  141    0    0  142  C7EJW2     Hemoglobin alpha A subunit OS=Chauna torquata GN=HBA2 PE=3 SV=1
 1462 : F1NMZ3_CHICK        0.66  0.89  144  288    3  147  145    0    0  147  F1NMZ3     Hemoglobin subunit epsilon OS=Gallus gallus GN=HBE PE=2 SV=1
 1463 : G1NPZ7_MELGA        0.66  0.88  144  288    3  147  145    0    0  147  G1NPZ7     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100548634 PE=3 SV=1
 1464 : G3ICM5_CRIGR        0.66  0.90  144  288    3  147  145    0    0  147  G3ICM5     Hemoglobin subunit beta OS=Cricetulus griseus GN=I79_021423 PE=3 SV=1
 1465 : G3UPN4_MELGA        0.66  0.88  144  288    3  148  146    1    1  148  G3UPN4     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100548634 PE=3 SV=1
 1466 : H0UWE7_CAVPO        0.66  0.86  144  288    3  147  145    0    0  147  H0UWE7     Uncharacterized protein OS=Cavia porcellus GN=LOC100720944 PE=3 SV=1
 1467 : HBA_PSIKR   2ZFB    0.66  0.88    1  141    1  141  141    0    0  141  P19831     Hemoglobin subunit alpha OS=Psittacula krameri GN=HBA PE=1 SV=1
 1468 : HBB_CAVPO   3HYU    0.66  0.86  144  288    2  146  145    0    0  146  P02095     Hemoglobin subunit beta OS=Cavia porcellus GN=HBB PE=1 SV=1
 1469 : HBB_MESAU           0.66  0.90  144  288    3  147  145    0    0  147  P02094     Hemoglobin subunit beta OS=Mesocricetus auratus GN=HBB PE=1 SV=2
 1470 : HBD_HETBR           0.66  0.88  144  288    3  147  145    0    0  147  Q45XI5     Hemoglobin subunit deltaH OS=Heterohyrax brucei PE=2 SV=3
 1471 : HBE_CHICK           0.66  0.89  144  288    3  147  145    0    0  147  P02128     Hemoglobin subunit epsilon OS=Gallus gallus GN=HBE PE=1 SV=2
 1472 : I1Y926_9PASS        0.66  0.84    1  141    2  142  141    0    0  142  I1Y926     Hemoglobin subunit alpha-D OS=Mino dumontii PE=2 SV=1
 1473 : I1Y928_9AVES        0.66  0.85   17  141   17  141  125    0    0  141  I1Y928     Hemoglobin subunit alpha-D OS=Pelecanus onocrotalus PE=2 SV=1
 1474 : I3N5Z8_SPETR        0.66  0.84    2  141    3  142  140    0    0  142  I3N5Z8     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=HBQ1 PE=3 SV=1
 1475 : L8HMV9_BOSMU        0.66  0.83  172  288    1  117  123    2   12  117  L8HMV9     Hemoglobin fetal subunit beta (Fragment) OS=Bos grunniens mutus GN=M91_09199 PE=3 SV=1
 1476 : Q62669_RAT          0.66  0.88  144  288    3  147  145    0    0  147  Q62669     Protein Hbb-b1 OS=Rattus norvegicus GN=Hbb-b1 PE=3 SV=1
 1477 : Q63011_RAT          0.66  0.88  144  288    2  146  145    0    0  146  Q63011     Zero beta-globin (Fragment) OS=Rattus norvegicus GN=MGC72973 PE=3 SV=1
 1478 : Q6PDU6_RAT          0.66  0.88  144  288    3  147  145    0    0  147  Q6PDU6     Beta-glo OS=Rattus norvegicus GN=Hbb-b1 PE=2 SV=1
 1479 : Q9PVL9_HYNRE        0.66  0.82    2  141    3  142  140    0    0  142  Q9PVL9     Larval alpha-globin OS=Hynobius retardatus PE=2 SV=1
 1480 : B9EIX8_MOUSE        0.65  0.85   12  141   13  142  130    0    0  142  B9EIX8     MCG1039741 OS=Mus musculus GN=Hbq1b PE=2 SV=1
 1481 : E1B976_BOVIN        0.65  0.84  144  288    3  149  147    2    2  149  E1B976     Uncharacterized protein OS=Bos taurus PE=3 SV=1
 1482 : F1RII5_PIG          0.65  0.90  144  285    3  144  142    0    0  144  F1RII5     Uncharacterized protein OS=Sus scrofa GN=LOC100515788 PE=3 SV=2
 1483 : F6YIC8_HORSE        0.65  0.84    2  141    3  142  140    0    0  142  F6YIC8     Hemoglobin subunit zeta OS=Equus caballus GN=HBZ1 PE=3 SV=1
 1484 : G3IF93_CRIGR        0.65  0.90  144  288    3  147  145    0    0  147  G3IF93     Hemoglobin subunit beta-1 OS=Cricetulus griseus GN=I79_022414 PE=3 SV=1
 1485 : HBA_VIPAS           0.65  0.78    1  141    1  141  141    0    0  141  P02010     Hemoglobin subunit alpha OS=Vipera aspis GN=HBA PE=1 SV=1
 1486 : L8J2H0_BOSMU        0.65  0.83    1  139   10  148  139    0    0  150  L8J2H0     Hemoglobin subunit alpha-1 (Fragment) OS=Bos grunniens mutus GN=M91_08815 PE=3 SV=1
 1487 : Q38IW0_XENTR        0.65  0.84    2  141    3  142  140    0    0  142  Q38IW0     Alpha globin larval-6 OS=Xenopus tropicalis GN=hba2 PE=2 SV=1
 1488 : Q3U0A6_MOUSE        0.65  0.85   12  141   13  142  130    0    0  142  Q3U0A6     Protein Hbq1b OS=Mus musculus GN=Hbq1b PE=2 SV=1
 1489 : Q62670_RAT          0.65  0.87  144  288    3  147  145    0    0  147  Q62670     0 beta-2 globin OS=Rattus norvegicus GN=MGC72973 PE=3 SV=1
 1490 : R0J7H7_ANAPL        0.65  0.90  144  288    3  147  145    0    0  147  R0J7H7     Hemoglobin subunit epsilon (Fragment) OS=Anas platyrhynchos GN=Anapl_16676 PE=4 SV=1
 1491 : A4ZQ34_PERMA        0.64  0.85    2  141    3  142  140    0    0  142  A4ZQ34     Hemoglobin subunit theta OS=Peromyscus maniculatus GN=HBQ PE=3 SV=1
 1492 : A4ZQ59_PERMA        0.64  0.86    2  141    3  142  140    0    0  142  A4ZQ59     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1493 : A4ZQ75_PERMA        0.64  0.85    2  141    3  142  140    0    0  142  A4ZQ75     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1494 : A4ZQ79_PERMA        0.64  0.85    2  141    3  142  140    0    0  142  A4ZQ79     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1495 : A4ZQ81_PERMA        0.64  0.85    2  141    3  142  140    0    0  142  A4ZQ81     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1496 : A4ZQ82_PERMA        0.64  0.84    2  141    3  142  140    0    0  142  A4ZQ82     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1497 : A4ZQ86_PERLE        0.64  0.85    2  141    3  142  140    0    0  142  A4ZQ86     Hemoglobin subunit theta OS=Peromyscus leucopus PE=3 SV=1
 1498 : A9L8U0_PAPAN        0.64  0.86    2  141    3  142  140    0    0  142  A9L8U0     Hemoglobin, theta 1 (Predicted) OS=Papio anubis GN=HBQ1 PE=3 SV=1
 1499 : D3ZPM3_RAT          0.64  0.81    2  141    3  142  140    0    0  142  D3ZPM3     Protein Hbq1 OS=Rattus norvegicus GN=Hbq1 PE=2 SV=1
 1500 : D4A021_RAT          0.64  0.82    2  120    3  121  119    0    0  143  D4A021     Protein Hbq1 OS=Rattus norvegicus GN=Hbq1b PE=2 SV=1
 1501 : F7C7G9_MACMU        0.64  0.86    2  141    3  142  140    0    0  142  F7C7G9     Uncharacterized protein OS=Macaca mulatta GN=HBQ1 PE=3 SV=1
 1502 : HBA1_ALDEL          0.64  0.87    1  141    2  142  141    0    0  142  P83131     Hemoglobin A subunit alpha-1 OS=Aldabrachelys elephantina PE=1 SV=2
 1503 : HBA5_XENLA          0.64  0.84    2  141    3  142  140    0    0  142  P06638     Hemoglobin subunit alpha-5 OS=Xenopus laevis GN=hba5 PE=2 SV=2
 1504 : HBAA_CHENI          0.64  0.86    1  141    2  142  141    0    0  142  P83135     Hemoglobin subunit alpha-A OS=Chelonoidis nigra GN=HBAA PE=1 SV=2
 1505 : HBD_PROCA           0.64  0.88  144  288    3  147  145    0    0  147  Q45XI6     Hemoglobin subunit deltaH OS=Procavia capensis PE=2 SV=3
 1506 : I3VNF2_STUVU        0.64  0.84    2  141    2  141  140    0    0  141  I3VNF2     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Sturnus vulgaris PE=3 SV=1
 1507 : L8HU81_BOSMU        0.64  0.81  144  288    3  151  149    3    4  151  L8HU81     Uncharacterized protein (Fragment) OS=Bos grunniens mutus GN=M91_21162 PE=3 SV=1
 1508 : Q38IV9_XENTR        0.64  0.83    2  141    3  142  140    0    0  142  Q38IV9     Alpha globin larval-7 OS=Xenopus tropicalis GN=hba4 PE=2 SV=1
 1509 : Q7T1E9_9SAUR        0.64  0.86    1  141    1  141  141    0    0  141  Q7T1E9     Hemoglobin alpha-globin (Fragment) OS=Chelonoidis chilensis PE=3 SV=1
 1510 : A4ZQ37_PERMA        0.63  0.84    2  141    3  142  140    0    0  142  A4ZQ37     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1511 : A4ZQ60_PERMA        0.63  0.84    2  141    3  142  140    0    0  142  A4ZQ60     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1512 : A4ZQ62_PERMA        0.63  0.84    2  141    3  142  140    0    0  142  A4ZQ62     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1513 : A4ZQ65_PERMA        0.63  0.85    2  141    3  142  140    0    0  142  A4ZQ65     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1514 : A4ZQ69_PERMA        0.63  0.85    2  141    3  142  140    0    0  142  A4ZQ69     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1515 : A4ZQ71_PERMA        0.63  0.86    2  141    3  142  140    0    0  142  A4ZQ71     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1516 : A4ZQ74_PERMA        0.63  0.85    2  141    3  142  140    0    0  142  A4ZQ74     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1517 : A4ZQ77_PERMA        0.63  0.84    2  141    3  142  140    0    0  142  A4ZQ77     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1518 : G1R965_NOMLE        0.63  0.87    2  141    3  142  140    0    0  142  G1R965     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100583844 PE=3 SV=1
 1519 : G3WEX2_SARHA        0.63  0.86  144  288    3  147  145    0    0  147  G3WEX2     Uncharacterized protein OS=Sarcophilus harrisii PE=3 SV=1
 1520 : H0WAL2_CAVPO        0.63  0.83    2  140    3  141  139    0    0  142  H0WAL2     Uncharacterized protein OS=Cavia porcellus GN=LOC100717416 PE=3 SV=1
 1521 : H0Z1T1_TAEGU        0.63  0.84    2  141    3  142  140    0    0  142  H0Z1T1     Uncharacterized protein OS=Taeniopygia guttata GN=HBZ PE=3 SV=1
 1522 : H9GIN1_ANOCA        0.63  0.85  144  288    4  148  145    0    0  148  H9GIN1     Uncharacterized protein (Fragment) OS=Anolis carolinensis GN=LOC100552694 PE=3 SV=1
 1523 : HBA3_XENLA          0.63  0.80    2  141    3  142  140    0    0  142  P06636     Hemoglobin subunit alpha-3 OS=Xenopus laevis GN=hba3 PE=2 SV=2
 1524 : HBBN_AMMLE          0.63  0.87  149  288    2  141  140    0    0  141  P02080     Hemoglobin subunit beta-C(NA) OS=Ammotragus lervia PE=1 SV=1
 1525 : HBB_MESBR           0.63  0.88  144  288    2  146  145    0    0  146  P18707     Hemoglobin subunit beta OS=Mesocricetus brandti GN=HBB PE=1 SV=1
 1526 : HBB_MICXA           0.63  0.90  144  288    2  146  145    0    0  146  P02092     Hemoglobin subunit beta OS=Microtus xanthognathus GN=HBB PE=1 SV=1
 1527 : HBB_OVIMU           0.63  0.83  145  288    2  145  144    0    0  145  P02076     Hemoglobin subunit beta OS=Ovis orientalis musimon GN=HBB PE=1 SV=1
 1528 : I3VNE7_PASMO        0.63  0.84    2  141    2  141  140    0    0  141  I3VNE7     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Passer montanus PE=3 SV=1
 1529 : J3RZP8_CROAD        0.63  0.88  144  288    3  147  145    0    0  147  J3RZP8     Hemoglobin subunit beta-1-like OS=Crotalus adamanteus PE=2 SV=1
 1530 : J3SCF9_CROAD        0.63  0.83  144  288    3  147  145    0    0  147  J3SCF9     Hemoglobin subunit beta-2 OS=Crotalus adamanteus PE=2 SV=1
 1531 : L8AYC4_ALDEL        0.63  0.87    1  141    1  141  141    0    0  141  L8AYC4     Alpha A-globin (Fragment) OS=Aldabrachelys elephantina PE=3 SV=1
 1532 : Q7SYU7_XENLA        0.63  0.80    2  141    3  142  140    0    0  142  Q7SYU7     Hba3 protein OS=Xenopus laevis GN=hba3 PE=2 SV=1
 1533 : A4ZQ55_PERMA        0.62  0.84    2  141    3  142  140    0    0  142  A4ZQ55     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 1534 : B6SEZ2_BUFMA        0.62  0.81  144  287    3  146  144    0    0  147  B6SEZ2     Larval betaglobin OS=Bufo marinus PE=2 SV=1
 1535 : B8K133_RABIT        0.62  0.81    2  141    3  142  140    0    0  142  B8K133     Hemoglobin subunit theta-1 (Predicted) OS=Oryctolagus cuniculus GN=HBQ1_1 PE=3 SV=1
 1536 : B8K136_RABIT        0.62  0.82    2  132    3  133  131    0    0  135  B8K136     Hemoglobin, theta 1 (Predicted) (Fragment) OS=Oryctolagus cuniculus GN=HBQ1_3 PE=3 SV=1
 1537 : F7GH03_MONDO        0.62  0.86  144  288    3  147  145    0    0  147  F7GH03     Uncharacterized protein OS=Monodelphis domestica GN=LOC100016060 PE=3 SV=1
 1538 : G3RJU5_GORGO        0.62  0.85    2  141    3  142  140    0    0  142  G3RJU5     Uncharacterized protein OS=Gorilla gorilla gorilla GN=HBQ1 PE=3 SV=1
 1539 : HBA1_NAJNA          0.62  0.80    1  141    1  141  141    0    0  141  Q9PRL9     Hemoglobin subunit alpha-1 OS=Naja naja PE=1 SV=1
 1540 : HBA2_ALDEL          0.62  0.86    1  141    2  142  141    0    0  142  P83132     Hemoglobin A subunit alpha-2 OS=Aldabrachelys elephantina PE=1 SV=2
 1541 : HBAD_MELGA          0.62  0.83    1  141    1  141  141    0    0  141  P81024     Hemoglobin subunit alpha-D OS=Meleagris gallopavo GN=HBAD PE=1 SV=1
 1542 : HBAT_HUMAN          0.62  0.86    2  141    3  142  140    0    0  142  P09105     Hemoglobin subunit theta-1 OS=Homo sapiens GN=HBQ1 PE=1 SV=2
 1543 : HBAT_PONPY          0.62  0.86    2  141    3  142  140    0    0  142  P06890     Hemoglobin subunit theta-1 OS=Pongo pygmaeus GN=HBQ1 PE=3 SV=2
 1544 : HBB_CARCR           0.62  0.84  143  288    1  146  146    0    0  146  Q10733     Hemoglobin subunit beta OS=Caretta caretta GN=HBB PE=1 SV=1
 1545 : HBE_CAIMO           0.62  0.88  144  288    3  147  145    0    0  147  P14261     Hemoglobin subunit epsilon OS=Cairina moschata GN=HBE PE=2 SV=2
 1546 : I1VYK3_9AVES        0.62  0.84    1  141    1  141  141    0    0  141  I1VYK3     Hemoglobin subunit alpha-D OS=Pelecanus crispus PE=2 SV=1
 1547 : I3VNE6_9FURN        0.62  0.85    2  141    2  141  140    0    0  141  I3VNE6     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Phleocryptes melanops PE=3 SV=1
 1548 : I3VNE8_PHACA        0.62  0.84    2  141    2  141  140    0    0  141  I3VNE8     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Phalacrocorax carbo PE=3 SV=1
 1549 : I3VNF0_COLLI        0.62  0.85    2  141    2  141  140    0    0  141  I3VNF0     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Columba livia PE=3 SV=1
 1550 : K7FZX0_PELSI        0.62  0.81    2  141    4  143  140    0    0  143  K7FZX0     Uncharacterized protein (Fragment) OS=Pelodiscus sinensis GN=HBZ PE=3 SV=1
 1551 : Q533G8_MACEU        0.62  0.83    2  141    3  142  140    0    0  142  Q533G8     Zeta' globin OS=Macropus eugenii PE=3 SV=1
 1552 : Q9BEI1_SMICR        0.62  0.86  144  288    3  147  145    0    0  147  Q9BEI1     Omega globin OS=Sminthopsis crassicaudata PE=3 SV=1
 1553 : A2VDC3_XENLA        0.61  0.80  144  288    3  147  145    0    0  147  A2VDC3     LOC100037217 protein OS=Xenopus laevis GN=LOC100037217 PE=2 SV=1
 1554 : A4IGT0_XENTR        0.61  0.83  144  288    3  147  145    0    0  147  A4IGT0     LOC100037901 protein OS=Xenopus tropicalis GN=LOC100037901 PE=2 SV=1
 1555 : B0JZZ3_XENTR        0.61  0.82  144  288    3  147  145    0    0  147  B0JZZ3     Uncharacterized protein OS=Xenopus tropicalis PE=2 SV=1
 1556 : B0VX79_CALJA        0.61  0.86    2  141    3  142  140    0    0  142  B0VX79     Theta 1 globin (Predicted) OS=Callithrix jacchus GN=HBQ1_2 PE=3 SV=1
 1557 : B1MT39_CALMO        0.61  0.86    2  141    3  142  140    0    0  142  B1MT39     Theta 1 globin (Predicted) OS=Callicebus moloch GN=HBQ1_2 PE=3 SV=1
 1558 : B8K130_RABIT        0.61  0.81    2  141    3  142  140    0    0  142  B8K130     Hemoglobin subunit zeta (Predicted) OS=Oryctolagus cuniculus GN=RA_m008_jsm295ECf PE=3 SV=1
 1559 : B8K131_RABIT        0.61  0.82    2  141    3  142  140    0    0  142  B8K131     Zeta globin (Predicted) OS=Oryctolagus cuniculus GN=HBZ_1 PE=3 SV=1
 1560 : F7F0N7_ORNAN        0.61  0.82    2  141    3  142  140    0    0  142  F7F0N7     Uncharacterized protein OS=Ornithorhynchus anatinus GN=HBZ PE=3 SV=1
 1561 : G1Q293_MYOLU        0.61  0.83    2  141    3  142  140    0    0  142  G1Q293     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
 1562 : G1T6U0_RABIT        0.61  0.81    2  141    3  142  140    0    0  142  G1T6U0     Uncharacterized protein OS=Oryctolagus cuniculus GN=HBZ0 PE=3 SV=1
 1563 : G3QIW6_GORGO        0.61  0.65  143  275    2   97  133    1   37  121  G3QIW6     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
 1564 : G5DZ36_9PIPI        0.61  0.80    6  137    1  132  132    0    0  132  G5DZ36     Putative hemoglobin subunit alpha-1 (Fragment) OS=Hymenochirus curtipes PE=2 SV=1
 1565 : HBA4_XENLA          0.61  0.81    2  141    3  142  140    0    0  142  P06637     Hemoglobin subunit alpha-4 OS=Xenopus laevis GN=hba4 PE=2 SV=2
 1566 : HBAD_AEGMO          0.61  0.84    1  141    1  141  141    0    0  141  P68059     Hemoglobin subunit alpha-D OS=Aegypius monachus GN=HBAD PE=1 SV=1
 1567 : HBAD_CHRPI          0.61  0.79    1  141    1  141  141    0    0  141  P02005     Hemoglobin subunit alpha-D OS=Chrysemys picta bellii GN=HBAD PE=1 SV=1
 1568 : HBAD_PHRHI          0.61  0.77    1  141    1  141  141    0    0  141  P02006     Hemoglobin subunit alpha-D OS=Phrynops hilarii GN=HBAD PE=1 SV=1
 1569 : HBAD_TRIOC          0.61  0.84    1  141    1  141  141    0    0  141  P68060     Hemoglobin subunit alpha-D OS=Trigonoceps occipitalis GN=HBAD PE=1 SV=1
 1570 : HBA_DRYCE           0.61  0.79    1  141    1  141  141    0    0  141  P0C0U6     Hemoglobin subunit alpha-A OS=Drymarchon corais erebennus PE=1 SV=1
 1571 : I1Y927_9AVES        0.61  0.80    1  141    1  142  142    1    1  142  I1Y927     Hemoglobin subunit alpha-D OS=Phoenicopterus roseus PE=2 SV=1
 1572 : I3VNE9_OPIHO        0.61  0.84    2  141    2  141  140    0    0  141  I3VNE9     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Opisthocomus hoazin PE=3 SV=1
 1573 : I3VNF1_GRUCN        0.61  0.84    2  141    2  141  140    0    0  141  I3VNF1     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Grus canadensis PE=3 SV=1
 1574 : J3S8W7_CROAD        0.61  0.81    1  141    2  142  141    0    0  142  J3S8W7     Hemoglobin subunit alpha 1 OS=Crotalus adamanteus PE=2 SV=1
 1575 : J9JHW7_CANFA        0.61  0.81    2  141    3  142  140    0    0  142  J9JHW7     Uncharacterized protein OS=Canis familiaris GN=LOC100855600 PE=3 SV=1
 1576 : Q533G9_MACEU        0.61  0.83    2  141    3  142  140    0    0  142  Q533G9     Zeta globin OS=Macropus eugenii PE=3 SV=1
 1577 : Q9BEI2_MACEU        0.61  0.85  144  288    3  147  145    0    0  147  Q9BEI2     Omega globin OS=Macropus eugenii PE=3 SV=1
 1578 : R0JDK1_ANAPL        0.61  0.84    2  141    3  142  140    0    0  142  R0JDK1     Hemoglobin subunit pi (Fragment) OS=Anas platyrhynchos GN=Anapl_06469 PE=4 SV=1
 1579 : A1A4Q7_BOVIN        0.60  0.81    1  139    2  140  139    0    0  142  A1A4Q7     Hemoglobin, theta 1 OS=Bos taurus GN=HBQ1 PE=2 SV=1
 1580 : A9JSP7_XENTR        0.60  0.81  144  287    3  146  144    0    0  147  A9JSP7     Hemoglobin, epsilon 1 OS=Xenopus tropicalis GN=hbe1 PE=2 SV=1
 1581 : B3EX28_SORAR        0.60  0.83    2  141    3  142  140    0    0  142  B3EX28     Hemoglobin subunit zeta (Predicted) OS=Sorex araneus GN=HBZ PE=3 SV=1
 1582 : B8K135_RABIT        0.60  0.81    2  141    3  142  140    0    0  142  B8K135     Hemoglobin, zeta (Predicted) OS=Oryctolagus cuniculus GN=HBZ_2 PE=3 SV=1
 1583 : F6RIQ8_XENTR        0.60  0.81  144  287    3  146  144    0    0  147  F6RIQ8     Uncharacterized protein OS=Xenopus tropicalis GN=hbe1 PE=3 SV=1
 1584 : G1N9G9_MELGA        0.60  0.83    1  141    1  141  141    0    0  141  G1N9G9     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100551072 PE=3 SV=1
 1585 : G3WDN9_SARHA        0.60  0.83    2  141    3  142  140    0    0  142  G3WDN9     Uncharacterized protein OS=Sarcophilus harrisii GN=HBZ PE=3 SV=1
 1586 : HBA3_PLEWA          0.60  0.79    1  141    2  142  141    0    0  142  P11896     Hemoglobin larval subunit alpha OS=Pleurodeles waltl PE=2 SV=1
 1587 : HBAD_ACCGE          0.60  0.84    1  141    1  141  141    0    0  141  P08849     Hemoglobin subunit alpha-D OS=Accipiter gentilis GN=HBAD PE=1 SV=1
 1588 : HBAD_CHENI          0.60  0.78    1  141    1  141  141    0    0  141  P83124     Hemoglobin subunit alpha-D OS=Chelonoidis nigra GN=HBAD PE=1 SV=1
 1589 : HBAD_CHICK  1HBR    0.60  0.82    1  141    1  141  141    0    0  141  P02001     Hemoglobin subunit alpha-D OS=Gallus gallus GN=HBAD PE=1 SV=1
 1590 : HBAD_GYPRU          0.60  0.84    1  141    1  141  141    0    0  141  P08257     Hemoglobin subunit alpha-D/D' OS=Gyps rueppellii GN=HBAD PE=1 SV=1
 1591 : HBAD_PHACO          0.60  0.83    1  141    1  141  141    0    0  141  P02002     Hemoglobin subunit alpha-D OS=Phasianus colchicus colchicus GN=HBAD PE=1 SV=1
 1592 : HBAD_RHEAM          0.60  0.83    1  141    1  141  141    0    0  141  P04241     Hemoglobin subunit alpha-D OS=Rhea americana GN=HBAD PE=1 SV=1
 1593 : HBAD_STRCA          0.60  0.82    1  141    1  141  141    0    0  141  P04242     Hemoglobin subunit alpha-D OS=Struthio camelus GN=HBAD PE=1 SV=1
 1594 : HBAZ_HUMAN  3W4U    0.60  0.81    2  141    3  142  140    0    0  142  P02008     Hemoglobin subunit zeta OS=Homo sapiens GN=HBZ PE=1 SV=2
 1595 : HBB2_XENTR          0.60  0.81  144  287    3  146  144    0    0  147  P08423     Hemoglobin subunit beta-2 OS=Xenopus tropicalis GN=hbb2 PE=2 SV=2
 1596 : HBPI_CAIMO          0.60  0.83    2  141    3  142  140    0    0  142  P04243     Hemoglobin subunit pi OS=Cairina moschata PE=3 SV=2
 1597 : L9KYF1_TUPCH        0.60  0.83    2  141    3  142  140    0    0  142  L9KYF1     Hemoglobin subunit zeta OS=Tupaia chinensis GN=TREES_T100011779 PE=3 SV=1
 1598 : Q1W6G9_HUMAN        0.60  0.81    2  141    3  142  140    0    0  142  Q1W6G9     Hemoglobin zeta subunit OS=Homo sapiens GN=HBZ PE=3 SV=1
 1599 : Q7T1E8_9SAUR        0.60  0.80    1  141    1  141  141    0    0  141  Q7T1E8     Hemoglobin alpha-D globin (Fragment) OS=Chelonoidis chilensis PE=3 SV=1
 1600 : B0VX76_CALJA        0.59  0.81    2  141    3  142  140    0    0  142  B0VX76     Zeta globin (Predicted) OS=Callithrix jacchus GN=HBZ PE=3 SV=1
 1601 : B1MT33_CALMO        0.59  0.82    2  141    3  142  140    0    0  142  B1MT33     Zeta globin (Predicted) OS=Callicebus moloch GN=HBZ PE=3 SV=1
 1602 : B3VL86_HUMAN        0.59  0.78  144  286    3  134  143    2   11  139  B3VL86     Mutant beta-globin OS=Homo sapiens GN=HBB PE=3 SV=1
 1603 : B5XE30_SALSA        0.59  0.79    2  141    3  143  141    1    1  143  B5XE30     Hemoglobin subunit alpha OS=Salmo salar GN=HBA PE=2 SV=1
 1604 : C0H7D9_SALSA        0.59  0.79    2  140    3  142  140    1    1  143  C0H7D9     Hemoglobin subunit alpha OS=Salmo salar GN=HBA PE=2 SV=1
 1605 : C1FXX6_DASNO        0.59  0.82    2  141    3  142  140    0    0  142  C1FXX6     Zeta globin (Predicted) OS=Dasypus novemcinctus GN=HBZ PE=3 SV=1
 1606 : G1N9E8_MELGA        0.59  0.83    2  141    3  142  140    0    0  142  G1N9E8     Uncharacterized protein OS=Meleagris gallopavo GN=P23 PE=3 SV=1
 1607 : G3SEU0_GORGO        0.59  0.81    2  141    3  142  140    0    0  142  G3SEU0     Uncharacterized protein OS=Gorilla gorilla gorilla GN=HBZ PE=3 SV=1
 1608 : G3U5A2_LOXAF        0.59  0.81    2  141    3  142  140    0    0  142  G3U5A2     Uncharacterized protein OS=Loxodonta africana GN=LOC100658044 PE=3 SV=1
 1609 : G3UJH3_LOXAF        0.59  0.81    2  141    3  142  140    0    0  142  G3UJH3     Uncharacterized protein OS=Loxodonta africana GN=LOC100657757 PE=3 SV=1
 1610 : H2NPI8_PONAB        0.59  0.82    2  141    3  139  140    1    3  139  H2NPI8     Uncharacterized protein OS=Pongo abelii GN=HBQ1 PE=3 SV=1
 1611 : HBA2_STEMC          0.59  0.81    1  141    1  141  141    0    0  141  P82112     Hemoglobin subunit alpha-2 OS=Stercorarius maccormicki PE=1 SV=1
 1612 : HBA3_XENTR          0.59  0.81    2  141    3  142  140    0    0  142  P08422     Hemoglobin subunit alpha-3 OS=Xenopus tropicalis GN=hba-l8 PE=2 SV=2
 1613 : HBAD_ALDEL  2Z6N    0.59  0.79    1  141    1  141  141    0    0  141  P83134     Hemoglobin D subunit alpha OS=Aldabrachelys elephantina PE=1 SV=1
 1614 : HBAD_CAIMO          0.59  0.82    1  141    1  141  141    0    0  141  P02003     Hemoglobin subunit alpha-D OS=Cairina moschata GN=HBAD PE=2 SV=1
 1615 : HBAD_COLLI          0.59  0.77    1  141    1  140  141    1    1  140  O12985     Hemoglobin subunit alpha-D OS=Columba livia GN=HBAD PE=2 SV=1
 1616 : HBAT_HORSE          0.59  0.83    2  141    3  142  140    0    0  142  P06714     Hemoglobin subunit theta-1 OS=Equus caballus GN=HBQ1 PE=3 SV=2
 1617 : HBAZ_HORSE          0.59  0.83    2  141    3  142  140    0    0  142  P13787     Hemoglobin subunit zeta OS=Equus caballus GN=HBZ1 PE=3 SV=2
 1618 : HBAZ_PANTR          0.59  0.81    2  141    3  142  140    0    0  142  P06347     Hemoglobin subunit zeta OS=Pan troglodytes GN=HBZ1 PE=3 SV=2
 1619 : HBA_MICGA           0.59  0.78    1  141    1  141  141    0    0  141  P41331     Hemoglobin subunit alpha OS=Microcephalophis gracilis GN=HBA PE=1 SV=1
 1620 : L5KH60_PTEAL        0.59  0.81    2  141    3  142  140    0    0  142  L5KH60     Hemoglobin subunit zeta OS=Pteropus alecto GN=PAL_GLEAN10011814 PE=3 SV=1
 1621 : Q6F3D2_AMBME        0.59  0.71    2  141    4  143  140    0    0  143  Q6F3D2     Minor alpha globin chain OS=Ambystoma mexicanum GN=Hb-am PE=2 SV=1
 1622 : Q7LZM7_VARKO        0.59  0.79    1  141    1  141  141    0    0  141  Q7LZM7     Hemoglobin alpha 1 chain OS=Varanus komodoensis PE=3 SV=1
 1623 : Q8QG65_CHEDN        0.59  0.79    1  141    1  141  141    0    0  141  Q8QG65     Alpha-D chain hemoglobin OS=Chelonoidis denticulata PE=2 SV=1
 1624 : Q9PVL8_HYNRE        0.59  0.81  144  288    3  147  145    0    0  147  Q9PVL8     Larval beta-globin OS=Hynobius retardatus PE=2 SV=1
 1625 : B0BMS6_XENTR        0.58  0.78  144  287    3  146  144    0    0  147  B0BMS6     LOC100145107 protein OS=Xenopus tropicalis GN=LOC100145107 PE=2 SV=1
 1626 : B4USK1_OTOGA        0.58  0.83    2  141    3  142  140    0    0  142  B4USK1     Uncharacterized protein OS=Otolemur garnettii GN=HBZ PE=3 SV=1
 1627 : B5FXM1_TAEGU        0.58  0.84    1  141    1  141  141    0    0  141  B5FXM1     Putative hemoglobin alpha-D chain OS=Taeniopygia guttata PE=2 SV=1
 1628 : C0H8L6_SALSA        0.58  0.79    2  141    3  143  141    1    1  143  C0H8L6     Hemoglobin subunit alpha OS=Salmo salar GN=HBA PE=2 SV=1
 1629 : D7RTU5_NEOJU        0.58  0.82    1  141    1  141  141    0    0  141  D7RTU5     Hemoglobin alpha D subunit OS=Neochen jubata GN=HBA1 PE=3 SV=1
 1630 : G5BXY2_HETGA        0.58  0.79    2  141    3  142  140    0    0  142  G5BXY2     Hemoglobin subunit alpha OS=Heterocephalus glaber GN=GW7_12999 PE=3 SV=1
 1631 : G5DZM8_9PIPI        0.58  0.81  159  285    1  127  127    0    0  128  G5DZM8     Putative hemoglobin, delta (Fragment) OS=Pipa carvalhoi PE=2 SV=1
 1632 : HBA1_TRICR          0.58  0.76    2  141    3  142  140    0    0  142  P10783     Hemoglobin subunit alpha-1 OS=Triturus cristatus PE=1 SV=1
 1633 : HBAD_ANAPL          0.58  0.82    1  141    1  141  141    0    0  141  P04442     Hemoglobin subunit alpha-D OS=Anas platyrhynchos GN=HBAD PE=2 SV=1
 1634 : HBAD_AYTFU          0.58  0.82    1  141    1  141  141    0    0  141  P84791     Hemoglobin subunit alpha-D OS=Aythya fuligula GN=HBAD PE=1 SV=1
 1635 : HBAD_BRACA          0.58  0.82    1  141    1  141  141    0    0  141  P04240     Hemoglobin subunit alpha-D OS=Branta canadensis GN=HBAD PE=1 SV=1
 1636 : HBAD_CHECB          0.58  0.79    1  141    1  141  141    0    0  141  Q9DF25     Hemoglobin subunit alpha-D OS=Chelonoidis carbonaria GN=HBAD PE=2 SV=1
 1637 : HBAD_STUVU          0.58  0.84    1  141    1  141  141    0    0  141  P02004     Hemoglobin subunit alpha-D OS=Sturnus vulgaris GN=HBAD PE=1 SV=1
 1638 : HBA_XENTR           0.58  0.78    2  141    3  142  140    0    0  142  P07428     Hemoglobin subunit alpha OS=Xenopus tropicalis GN=hba-A PE=2 SV=2
 1639 : HBPI_CHICK          0.58  0.81    2  141    3  142  140    0    0  142  P02007     Hemoglobin subunit pi OS=Gallus gallus PE=1 SV=3
 1640 : I1VYK1_BUBBB        0.58  0.84    1  141    1  141  141    0    0  141  I1VYK1     Hemoglobin subunit alpha-D OS=Bubo bubo bubo PE=2 SV=1
 1641 : I1Y916_9AVES        0.58  0.79    1  141    1  141  141    0    0  141  I1Y916     Hemoglobin subunit alpha-D OS=Phaethornis malaris PE=2 SV=1
 1642 : M1VK56_9NEOB        0.58  0.78  144  287    3  146  144    0    0  147  M1VK56     Larval beta globin OS=Rhacophorus arboreus PE=2 SV=1
 1643 : Q6DJ70_XENTR        0.58  0.81  144  288    3  147  145    0    0  147  Q6DJ70     MGC88976 protein OS=Xenopus tropicalis GN=hbg2 PE=2 SV=1
 1644 : Q6DJI3_XENLA        0.58  0.77    1  141    2  142  141    0    0  142  Q6DJI3     LOC397869 protein OS=Xenopus laevis GN=hba1 PE=2 SV=1
 1645 : Q90ZA5_AMBME        0.58  0.79    2  141    3  142  140    0    0  142  Q90ZA5     Alpha-globin OS=Ambystoma mexicanum PE=2 SV=1
 1646 : Q91469_SALSA        0.58  0.79    2  141    3  143  141    1    1  143  Q91469     Alpha-globin OS=Salmo salar PE=3 SV=1
 1647 : C0H7I8_SALSA        0.57  0.79    2  141    3  143  141    1    1  143  C0H7I8     Hemoglobin subunit alpha OS=Salmo salar GN=HBA PE=2 SV=1
 1648 : C1C3X8_LITCT        0.57  0.80  144  288    3  147  145    0    0  147  C1C3X8     Hemoglobin subunit beta-3 OS=Lithobates catesbeiana GN=HBB3 PE=2 SV=1
 1649 : D7RTP9_BRABN        0.57  0.81    1  141    1  141  141    0    0  141  D7RTP9     Hemoglobin alpha D subunit OS=Branta bernicla GN=HBA1 PE=3 SV=1
 1650 : D7RTQ0_BRACA        0.57  0.81    1  141    1  141  141    0    0  141  D7RTQ0     Hemoglobin alpha D subunit OS=Branta canadensis GN=HBA1 PE=3 SV=1
 1651 : D7RTQ1_BRALE        0.57  0.81    1  141    1  141  141    0    0  141  D7RTQ1     Hemoglobin alpha D subunit OS=Branta leucopsis GN=HBA1 PE=3 SV=1
 1652 : D7RTQ2_BRASA        0.57  0.81    1  141    1  141  141    0    0  141  D7RTQ2     Hemoglobin alpha D subunit OS=Branta sandvicensis GN=HBA1 PE=3 SV=1
 1653 : D7RTQ3_ANSCE        0.57  0.81    1  141    1  141  141    0    0  141  D7RTQ3     Hemoglobin alpha D subunit OS=Anser caerulescens GN=HBA1 PE=3 SV=1
 1654 : D7RTQ4_ANSRO        0.57  0.81    1  141    1  141  141    0    0  141  D7RTQ4     Hemoglobin alpha D subunit OS=Anser rossii GN=HBA1 PE=3 SV=1
 1655 : D7RTQ5_CHECA        0.57  0.81    1  141    1  141  141    0    0  141  D7RTQ5     Hemoglobin alpha D subunit OS=Chen canagica GN=HBA1 PE=3 SV=1
 1656 : D7RTQ6_ANSCY        0.57  0.81    1  141    1  141  141    0    0  141  D7RTQ6     Hemoglobin alpha D subunit OS=Anser cygnoides GN=HBA1 PE=3 SV=1
 1657 : D7RTQ7_ANSIN        0.57  0.81    1  141    1  141  141    0    0  141  D7RTQ7     Hemoglobin alpha D subunit OS=Anser indicus GN=HBA1 PE=3 SV=1
 1658 : D7RTQ9_ANSAL        0.57  0.81    1  141    1  141  141    0    0  141  D7RTQ9     Hemoglobin alpha D subunit OS=Anser albifrons GN=HBA1 PE=3 SV=1
 1659 : D7RTR0_9AVES        0.57  0.81    1  141    1  141  141    0    0  141  D7RTR0     Hemoglobin alpha D subunit OS=Anser anser GN=HBA1 PE=3 SV=1
 1660 : D7RTR2_9AVES        0.57  0.81    1  141    1  141  141    0    0  141  D7RTR2     Hemoglobin alpha D subunit OS=Anser fabalis GN=HBA1 PE=3 SV=1
 1661 : D7RTR4_CYGAT        0.57  0.80    1  141    1  141  141    0    0  141  D7RTR4     Hemoglobin alpha D subunit OS=Cygnus atratus GN=HBA1 PE=3 SV=1
 1662 : D7RTR6_CYGOL        0.57  0.80    1  141    1  141  141    0    0  141  D7RTR6     Hemoglobin alpha D subunit OS=Cygnus olor GN=HBA1 PE=3 SV=1
 1663 : D7RTR9_COSCO        0.57  0.81    1  141    1  141  141    0    0  141  D7RTR9     Hemoglobin alpha D subunit OS=Coscoroba coscoroba GN=HBA1 PE=3 SV=1
 1664 : D7RTS1_CERNO        0.57  0.81    1  141    1  141  141    0    0  141  D7RTS1     Hemoglobin alpha D subunit OS=Cereopsis novaehollandiae GN=HBA1 PE=3 SV=1
 1665 : D7RTS2_CHLPI        0.57  0.82    1  141    1  141  141    0    0  141  D7RTS2     Hemoglobin alpha D subunit OS=Chloephaga picta leucoptera GN=HBA1 PE=3 SV=1
 1666 : D7RTS3_9AVES        0.57  0.82    1  141    1  141  141    0    0  141  D7RTS3     Hemoglobin alpha D subunit OS=Chloephaga poliocephala GN=HBA1 PE=3 SV=1
 1667 : D7RTS5_9AVES        0.57  0.82    1  141    1  141  141    0    0  141  D7RTS5     Hemoglobin alpha D subunit OS=Chloephaga hybrida malvinarum GN=HBA1 PE=3 SV=1
 1668 : D7RTS6_9AVES        0.57  0.82    1  141    1  141  141    0    0  141  D7RTS6     Hemoglobin alpha D subunit OS=Chloephaga rubidiceps GN=HBA1 PE=3 SV=1
 1669 : D7RTS7_CHLME        0.57  0.82    1  141    1  141  141    0    0  141  D7RTS7     Hemoglobin alpha D subunit OS=Chloephaga melanoptera GN=HBA1 PE=3 SV=1
 1670 : E1BAP8_BOVIN        0.57  0.81    2  141    3  142  140    0    0  142  E1BAP8     Uncharacterized protein OS=Bos taurus GN=HBZ PE=3 SV=1
 1671 : F1RGX7_PIG          0.57  0.82    2  141    3  142  140    0    0  142  F1RGX7     Uncharacterized protein OS=Sus scrofa GN=LOC100737689 PE=3 SV=1
 1672 : F6YMJ4_MONDO        0.57  0.83    2  141    3  142  140    0    0  142  F6YMJ4     Uncharacterized protein OS=Monodelphis domestica GN=LOC100618817 PE=3 SV=1
 1673 : G3V8R3_RAT          0.57  0.81    2  141    3  142  140    0    0  142  G3V8R3     Protein Hbz OS=Rattus norvegicus GN=Hbz PE=3 SV=1
 1674 : HBA1_IGUIG          0.57  0.81    1  141    1  141  141    0    0  141  P18974     Hemoglobin subunit alpha-1 OS=Iguana iguana PE=1 SV=1
 1675 : HBA1_XENBO          0.57  0.77    1  141    2  142  141    0    0  142  P07430     Hemoglobin subunit alpha-1 OS=Xenopus borealis GN=hba1 PE=2 SV=2
 1676 : HBA2_TRICR          0.57  0.73    1  141    1  141  141    0    0  141  P10784     Hemoglobin subunit alpha-2 OS=Triturus cristatus PE=1 SV=1
 1677 : HBA2_VARAL          0.57  0.79    1  141    1  141  141    0    0  141  P18981     Hemoglobin subunit alpha-2 OS=Varanus albigularis PE=1 SV=2
 1678 : HBA2_XENLA          0.57  0.76    1  141    2  142  141    0    0  142  P02013     Hemoglobin subunit alpha-2 OS=Xenopus laevis GN=hba2 PE=2 SV=2
 1679 : HBA3_LITCT          0.57  0.81    2  141    2  141  140    0    0  141  P02011     Hemoglobin subunit alpha-3 OS=Lithobates catesbeiana PE=1 SV=1
 1680 : HBAD_ANSAN          0.57  0.81    1  141    1  141  141    0    0  141  P04238     Hemoglobin subunit alpha-D OS=Anser anser anser GN=HBAD PE=1 SV=1
 1681 : HBAD_ANSIN          0.57  0.81    1  141    1  141  141    0    0  141  P04239     Hemoglobin subunit alpha-D OS=Anser indicus GN=HBAD PE=1 SV=1
 1682 : HBAD_CHLME          0.57  0.82    1  141    1  141  141    0    0  141  P07035     Hemoglobin subunit alpha-D OS=Chloephaga melanoptera GN=HBAD PE=1 SV=1
 1683 : HBAD_COTJA          0.57  0.83    1  141    1  141  141    0    0  141  P30892     Hemoglobin subunit alpha-D OS=Coturnix coturnix japonica GN=HBAD PE=1 SV=1
 1684 : HBAD_PASMO          0.57  0.84    1  141    1  141  141    0    0  141  P07413     Hemoglobin subunit alpha-D OS=Passer montanus GN=HBAD PE=1 SV=1
 1685 : HBAD_TURME          0.57  0.81    1  141    1  141  141    0    0  141  P14523     Hemoglobin subunit alpha-D OS=Turdus merula GN=HBAD PE=1 SV=1
 1686 : HBA_SALSA           0.57  0.78    2  141    3  143  141    1    1  143  P11251     Hemoglobin subunit alpha OS=Salmo salar GN=hba PE=2 SV=2
 1687 : HBB3_LITCT          0.57  0.79  144  288    3  147  145    0    0  147  P02136     Hemoglobin subunit beta-3 OS=Lithobates catesbeiana PE=1 SV=2
 1688 : I1VYJ9_9AVES        0.57  0.80    1  141    1  141  141    0    0  141  I1VYJ9     Hemoglobin subunit alpha-D OS=Oreotrochilus estella PE=2 SV=1
 1689 : I1VYK0_9CORV        0.57  0.82    1  141    1  141  141    0    0  141  I1VYK0     Hemoglobin subunit alpha-D OS=Corvus cornix PE=2 SV=1
 1690 : I1VYK2_PHORB        0.57  0.77    1  141    1  142  142    1    1  142  I1VYK2     Hemoglobin subunit alpha-D OS=Phoenicopterus ruber PE=2 SV=1
 1691 : I1Y917_9AVES        0.57  0.79    1  141    1  141  141    0    0  141  I1Y917     Hemoglobin subunit alpha-D OS=Patagona gigas PE=2 SV=1
 1692 : I1Y918_ADEME        0.57  0.79    1  141    1  141  141    0    0  141  I1Y918     Hemoglobin subunit alpha-D OS=Adelomyia melanogenys PE=2 SV=1
 1693 : I1Y920_9AVES        0.57  0.79    1  141    1  141  141    0    0  141  I1Y920     Hemoglobin subunit alpha-D OS=Amazilia amazilia PE=2 SV=1
 1694 : I1Y921_9AVES        0.57  0.79    1  141    1  141  141    0    0  141  I1Y921     Hemoglobin subunit alpha-D OS=Amazilia viridicauda PE=2 SV=1
 1695 : I1Y924_9AVES        0.57  0.80    1  141    1  141  141    0    0  141  I1Y924     Hemoglobin subunit alpha-D OS=Oreotrochilus melanogaster PE=2 SV=1
 1696 : I1Y925_TROAE        0.57  0.84    1  141    1  141  141    0    0  141  I1Y925     Hemoglobin subunit alpha-D (Fragment) OS=Troglodytes aedon PE=2 SV=1
 1697 : L0H3N1_9AVES        0.57  0.82    1  141    1  141  141    0    0  141  L0H3N1     Hemoglobin alpha D subunit OS=Oxyura ferruginea GN=HBA1 PE=3 SV=1
 1698 : L0H5V9_OXYJA        0.57  0.82    1  141    1  141  141    0    0  141  L0H5V9     Hemoglobin alpha D subunit OS=Oxyura jamaicensis jamaicensis GN=HBA1 PE=3 SV=1
 1699 : L7MZW5_ANOCA        0.57  0.76  144  288    3  137  145    1   10  137  L7MZW5     Uncharacterized protein OS=Anolis carolinensis GN=LOC100552694 PE=3 SV=1
 1700 : M1VEK6_9NEOB        0.57  0.78  144  288    3  147  145    0    0  147  M1VEK6     Larval beta globin OS=Rana ornativentris PE=2 SV=1
 1701 : M3YX88_MUSPF        0.57  0.79    2  141    3  142  140    0    0  142  M3YX88     Uncharacterized protein OS=Mustela putorius furo GN=Hba-x PE=3 SV=1
 1702 : Q38IW1_XENTR        0.57  0.79    1  141    2  142  141    0    0  142  Q38IW1     Alpha globin larval-5 OS=Xenopus tropicalis GN=hba-l5 PE=2 SV=1
 1703 : Q38IW2_XENTR        0.57  0.79    1  141    2  142  141    0    0  142  Q38IW2     Alpha globin larval-4 OS=Xenopus tropicalis GN=HBA-L4 PE=3 SV=1
 1704 : Q38IW3_XENTR        0.57  0.79    1  141    2  142  141    0    0  142  Q38IW3     Alpha globin larval-3 OS=Xenopus tropicalis GN=HBA-L3 PE=3 SV=1
 1705 : Q6DGK4_DANRE        0.57  0.84  144  287    3  146  144    0    0  147  Q6DGK4     Zgc:92880 OS=Danio rerio GN=zgc:92880 PE=2 SV=1
 1706 : Q91702_XENLA        0.57  0.73  165  288    1  124  124    0    0  124  Q91702     Beta-2 globin (Fragment) OS=Xenopus laevis PE=2 SV=1
 1707 : Q92015_SALSA        0.57  0.78    2  141    3  143  141    1    1  143  Q92015     Alpha-globin OS=Salmo salar GN=HBA PE=2 SV=1
 1708 : C1BG68_ONCMY        0.56  0.79    2  140    3  142  140    1    1  143  C1BG68     Hemoglobin subunit alpha-1 OS=Oncorhynchus mykiss GN=HBA1 PE=2 SV=1
 1709 : C1C3J9_LITCT        0.56  0.82    2  141    3  142  140    0    0  142  C1C3J9     Hemoglobin subunit alpha-3 OS=Lithobates catesbeiana GN=HBA3 PE=2 SV=1
 1710 : D2HDV1_AILME        0.56  0.81    2  141    3  142  140    0    0  142  D2HDV1     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=LOC100471516 PE=3 SV=1
 1711 : D7RTR3_CYGBU        0.56  0.80    1  141    1  141  141    0    0  141  D7RTR3     Hemoglobin alpha D subunit OS=Cygnus buccinator GN=HBA1 PE=3 SV=1
 1712 : D7RTR5_CYGCO        0.56  0.80    1  141    1  141  141    0    0  141  D7RTR5     Hemoglobin alpha D subunit OS=Cygnus columbianus GN=HBA1 PE=3 SV=1
 1713 : D7RTR7_9AVES        0.56  0.80    1  141    1  141  141    0    0  141  D7RTR7     Hemoglobin alpha D subunit OS=Cygnus melancoryphus GN=HBA1 PE=3 SV=1
 1714 : E3TFT0_ICTPU        0.56  0.76    2  141    3  143  141    1    1  143  E3TFT0     Hemoglobin subunit alpha OS=Ictalurus punctatus GN=HBA PE=2 SV=1
 1715 : G1K3A4_XENTR        0.56  0.76    2  141    3  143  141    1    1  143  G1K3A4     Uncharacterized protein OS=Xenopus tropicalis GN=hba1 PE=3 SV=1
 1716 : G5BXY3_HETGA        0.56  0.82    2  141    3  142  140    0    0  142  G5BXY3     Hemoglobin subunit zeta OS=Heterocephalus glaber GN=GW7_13000 PE=3 SV=1
 1717 : H2QA69_PANTR        0.56  0.80    2  141    3  142  140    0    0  142  H2QA69     Uncharacterized protein OS=Pan troglodytes GN=HBZ PE=3 SV=1
 1718 : HBA1_ONCMY  1OUT    0.56  0.78    2  141    2  144  143    2    3  144  P02019     Hemoglobin subunit alpha-1 OS=Oncorhynchus mykiss GN=hba1 PE=1 SV=1
 1719 : HBA1_PLEWA          0.56  0.74    2  141    3  142  140    0    0  142  P06639     Hemoglobin subunit alpha-1 OS=Pleurodeles waltl PE=2 SV=4
 1720 : HBA1_XENLA          0.56  0.77    1  141    2  142  141    0    0  142  P02012     Hemoglobin subunit alpha-1 OS=Xenopus laevis GN=hba1 PE=2 SV=2
 1721 : HBA2_XENBO          0.56  0.77    1  141    2  142  141    0    0  142  P07431     Hemoglobin subunit alpha-2 OS=Xenopus borealis GN=hba2 PE=2 SV=2
 1722 : HBAZ_CAPHI          0.56  0.81    2  141    3  142  140    0    0  142  P13786     Hemoglobin subunit zeta OS=Capra hircus GN=HBZ1 PE=3 SV=2
 1723 : HBAZ_PIG            0.56  0.81    2  141    2  141  140    0    0  141  P02009     Hemoglobin subunit zeta OS=Sus scrofa PE=1 SV=1
 1724 : HBA_TARGR           0.56  0.76    2  141    3  142  140    0    0  142  P02014     Hemoglobin subunit alpha OS=Taricha granulosa GN=HBA PE=1 SV=1
 1725 : HBB1_MURHE          0.56  0.79  144  287    2  145  144    0    0  146  Q7LZC2     Hemoglobin subunit beta-1 OS=Muraena helena GN=hbb1 PE=1 SV=1
 1726 : HBB2_XENLA          0.56  0.80  144  288    3  147  145    0    0  147  P02133     Hemoglobin subunit beta-2 OS=Xenopus laevis GN=hbb2 PE=2 SV=2
 1727 : HBBC_ANGAN          0.56  0.81  144  287    2  145  144    0    0  146  P80727     Hemoglobin cathodic subunit beta OS=Anguilla anguilla GN=hbb2 PE=1 SV=1
 1728 : I1VYJ7_9EMBE        0.56  0.82    1  141    1  141  141    0    0  141  I1VYJ7     Hemoglobin subunit alpha-D OS=Zonotrichia capensis PE=3 SV=1
 1729 : I1Y919_9AVES        0.56  0.79    1  141    1  141  141    0    0  141  I1Y919     Hemoglobin subunit alpha-D OS=Aglaeactis castelnaudii PE=2 SV=1
 1730 : I3MFW1_SPETR        0.56  0.81    2  141    3  142  140    0    0  142  I3MFW1     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=HBZ PE=3 SV=1
 1731 : M1VNS7_9NEOB        0.56  0.78  152  288    7  143  137    0    0  143  M1VNS7     Adult beta globin OS=Rhacophorus arboreus PE=2 SV=1
 1732 : Q5BJC7_DANRE        0.56  0.79    2  141    3  143  141    1    1  143  Q5BJC7     Si:xx-by187g17.5 OS=Danio rerio GN=si:ch211-5k11.6 PE=2 SV=1
 1733 : Q66KY4_XENLA        0.56  0.81  144  287    3  146  144    0    0  147  Q66KY4     MGC85319 protein OS=Xenopus laevis GN=hbe1 PE=2 SV=1
 1734 : Q6DES4_XENTR        0.56  0.80    1  141    2  142  141    0    0  142  Q6DES4     Alpha globin larval-1 OS=Xenopus tropicalis GN=hbz PE=2 SV=1
 1735 : Q6ZM12_DANRE        0.56  0.84  144  287    3  146  144    0    0  147  Q6ZM12     Novel beta globin OS=Danio rerio GN=OTTDARP00000002003 PE=3 SV=1
 1736 : Q6ZM13_DANRE        0.56  0.79    2  141    3  143  141    1    1  143  Q6ZM13     Novel alpha globin OS=Danio rerio GN=si:ch211-5k11.6 PE=3 SV=1
 1737 : Q98974_ONCMY        0.56  0.79    2  141    3  143  141    1    1  143  Q98974     Alpha-globin IV OS=Oncorhynchus mykiss GN=HBA1 PE=2 SV=1
 1738 : A9YVA0_ONCMA        0.55  0.77    2  141    3  143  141    1    1  143  A9YVA0     Alpha-globin 4 OS=Oncorhynchus masou formosanus GN=hbaa4 PE=2 SV=1
 1739 : C1BIB0_ONCMY        0.55  0.78    2  141    3  143  141    1    1  143  C1BIB0     Hemoglobin subunit alpha-1 OS=Oncorhynchus mykiss GN=HBA1 PE=2 SV=1
 1740 : D0VWS3_PERFV3BJ1    0.55  0.73    2  141    2  142  141    1    1  142  D0VWS3     Hemoglobin alpha OS=Perca flavescens PE=1 SV=1
 1741 : D6R731_HYPMO        0.55  0.85  144  287    3  146  144    0    0  147  D6R731     Hemoglobin beta chain OS=Hypophthalmichthys molitrix PE=2 SV=1
 1742 : F1MMI1_BOVIN        0.55  0.80    2  141    3  142  140    0    0  142  F1MMI1     Uncharacterized protein (Fragment) OS=Bos taurus GN=HBZ PE=3 SV=1
 1743 : H0Z1S1_TAEGU        0.55  0.80    1  141    1  143  143    1    2  143  H0Z1S1     Uncharacterized protein OS=Taeniopygia guttata GN=HBM PE=3 SV=1
 1744 : H9GGM8_ANOCA        0.55  0.77    1  141    2  142  141    0    0  142  H9GGM8     Uncharacterized protein OS=Anolis carolinensis GN=LOC100556620 PE=3 SV=1
 1745 : HBAC_LITCT          0.55  0.75    2  141    3  142  140    0    0  142  P55267     Hemoglobin subunit alpha-C OS=Lithobates catesbeiana PE=1 SV=2
 1746 : HBAD_APUAP          0.55  0.80    1  141    1  141  141    0    0  141  P15164     Hemoglobin subunit alpha-D OS=Apus apus GN=HBAD PE=1 SV=1
 1747 : HBAD_SPHPU          0.55  0.78    1  141    1  141  141    0    0  141  P10062     Hemoglobin subunit alpha-D OS=Sphenodon punctatus GN=HBAD PE=1 SV=1
 1748 : HBAZ_MOUSE          0.55  0.80    2  141    3  142  140    0    0  142  P06467     Hemoglobin subunit zeta OS=Mus musculus GN=Hbz PE=2 SV=2
 1749 : HBA_THUTH           0.55  0.75    2  141    3  143  141    1    1  143  P11748     Hemoglobin subunit alpha OS=Thunnus thynnus GN=hba PE=1 SV=1
 1750 : HBB2_TELPE          0.55  0.76  144  288    2  145  145    1    1  145  P83114     Hemoglobin subunit beta-2 OS=Telmatobius peruvianus PE=1 SV=1
 1751 : HBBL_XENLA          0.55  0.81  144  287    3  146  144    0    0  147  P02137     Hemoglobin larval subunit beta-1 OS=Xenopus laevis PE=2 SV=2
 1752 : HBB_CRONI           0.55  0.82  143  288    1  146  146    0    0  146  P02129     Hemoglobin subunit beta OS=Crocodylus niloticus GN=HBB PE=1 SV=1
 1753 : HBB_RANES           0.55  0.79  149  288    1  140  140    0    0  140  P02134     Hemoglobin subunit beta OS=Rana esculenta GN=HBB PE=1 SV=1
 1754 : HBB_SILAS           0.55  0.77  145  288    4  148  145    1    1  148  O13163     Hemoglobin subunit beta OS=Silurus asotus GN=hbb PE=2 SV=2
 1755 : I1VYJ8_9FURN        0.55  0.82    1  141    1  141  141    0    0  141  I1VYJ8     Hemoglobin subunit alpha-D OS=Phleocryptes melanops PE=2 SV=1
 1756 : I1Y922_COECO        0.55  0.77    1  141    1  141  141    0    0  141  I1Y922     Hemoglobin subunit alpha-D OS=Coeligena coeligena PE=2 SV=1
 1757 : I1Y923_COEVI        0.55  0.79    1  141    1  141  141    0    0  141  I1Y923     Hemoglobin subunit alpha-D OS=Coeligena violifer PE=2 SV=1
 1758 : M4A902_XIPMA        0.55  0.76    2  141    3  143  141    1    1  143  M4A902     Uncharacterized protein OS=Xiphophorus maculatus PE=3 SV=1
 1759 : Q66KR9_XENLA        0.55  0.81  144  287    3  146  144    0    0  147  Q66KR9     Hbb-prov protein OS=Xenopus laevis GN=hbb-prov PE=2 SV=1
 1760 : Q6DKM5_XENLA        0.55  0.71  145  288    3  146  144    0    0  146  Q6DKM5     Uncharacterized protein OS=Xenopus laevis PE=2 SV=1
 1761 : Q6F3D3_AMBME        0.55  0.72    1  141    2  142  141    0    0  142  Q6F3D3     Major alpha globin chain OS=Ambystoma mexicanum GN=Hb-aM PE=2 SV=1
 1762 : Q6S9E2_ICTPU        0.55  0.78  144  288    3  148  146    1    1  148  Q6S9E2     Hemoglobin-beta OS=Ictalurus punctatus PE=2 SV=1
 1763 : Q78PA4_MOUSE        0.55  0.80    2  141    3  142  140    0    0  142  Q78PA4     Hemoglobin X, alpha-like embryonic chain in Hba complex OS=Mus musculus GN=Hba-x PE=3 SV=1
 1764 : Q7ZT86_9AVES        0.55  0.81    1  141    1  141  141    0    0  141  Q7ZT86     Alpha D globin OS=Cuculus canorus GN=alpha-D PE=2 SV=1
 1765 : Q8AYL9_THUTH        0.55  0.75    2  141    4  144  141    1    1  144  Q8AYL9     Hemoglobin alpha chain 2 OS=Thunnus thynnus PE=2 SV=1
 1766 : Q8AYM0_THUTH1V4U    0.55  0.75    2  141    4  144  141    1    1  144  Q8AYM0     Hemoglobin alpha chain 1 OS=Thunnus thynnus PE=1 SV=1
 1767 : A4ZQT5_PERMA        0.54  0.81    2  141    3  142  140    0    0  142  A4ZQT5     Embryonic alpha globin OS=Peromyscus maniculatus GN=HBZ PE=3 SV=1
 1768 : A4ZQT9_PERMA        0.54  0.81    2  141    3  142  140    0    0  142  A4ZQT9     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1769 : A4ZQU5_PERMA        0.54  0.80    2  141    3  142  140    0    0  142  A4ZQU5     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1770 : A4ZQV4_PERMA        0.54  0.81    2  141    3  142  140    0    0  142  A4ZQV4     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1771 : A4ZQW6_PERMA        0.54  0.81    2  141    3  142  140    0    0  142  A4ZQW6     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1772 : B2L5U4_9PIPI        0.54  0.71  159  282    1  124  124    0    0  124  B2L5U4     Beta-I globin (Fragment) OS=Xenopus muelleri PE=2 SV=1
 1773 : E3TGF8_ICTPU        0.54  0.73    2  141    3  143  141    1    1  143  E3TGF8     Hemoglobin embryonic subunit alpha OS=Ictalurus punctatus GN=HBAE PE=2 SV=1
 1774 : G3IA42_CRIGR        0.54  0.81    2  141    3  142  140    0    0  142  G3IA42     Hemoglobin subunit zeta OS=Cricetulus griseus GN=I79_020458 PE=3 SV=1
 1775 : H2LKT8_ORYLA        0.54  0.77    2  141    4  144  141    1    1  144  H2LKT8     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC101175238 PE=3 SV=1
 1776 : HBAD_PHACA          0.54  0.78    1  141    1  141  141    0    0  141  P10781     Hemoglobin subunit alpha-D OS=Phalacrocorax carbo GN=HBAD PE=1 SV=1
 1777 : HBB1_UROHA          0.54  0.70  144  288    2  146  146    2    2  146  P18991     Hemoglobin subunit beta-1 (Fragments) OS=Uromastyx hardwickii PE=1 SV=1
 1778 : HBB_CROSI           0.54  0.82  143  288    1  146  146    0    0  146  P86919     Hemoglobin subunit beta OS=Crocodylus siamensis GN=HBB PE=1 SV=1
 1779 : I3IZ06_ORENI        0.54  0.74    2  141   29  169  141    1    1  169  I3IZ06     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100702435 PE=3 SV=1
 1780 : I3VNF3_FALME        0.54  0.76    2  141    2  140  140    1    1  140  I3VNF3     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Falco mexicanus PE=3 SV=1
 1781 : L5KH54_PTEAL        0.54  0.68    1  140    2  175  174    1   34  176  L5KH54     Hemoglobin subunit theta-1 OS=Pteropus alecto GN=PAL_GLEAN10011809 PE=3 SV=1
 1782 : Q3KQ67_XENLA        0.54  0.77    2  141    3  142  140    0    0  142  Q3KQ67     MGC130918 protein OS=Xenopus laevis GN=hbz PE=2 SV=1
 1783 : Q7T1B1_DANRE        0.54  0.78  146  287    1  142  142    0    0  143  Q7T1B1     Embryonic globin beta e3 (Fragment) OS=Danio rerio GN=hbbe3 PE=2 SV=1
 1784 : Q8AYQ7_ORYLA        0.54  0.77    2  141    3  143  141    1    1  143  Q8AYQ7     Alpha-type globin OS=Oryzias latipes GN=Gb-alpha3 PE=3 SV=1
 1785 : A4ZQT1_PERMA        0.53  0.81    2  141    3  142  140    0    0  142  A4ZQT1     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1786 : A4ZQT2_PERMA        0.53  0.81    2  141    3  142  140    0    0  142  A4ZQT2     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1787 : A4ZQT3_PERMA        0.53  0.80    2  141    3  142  140    0    0  142  A4ZQT3     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1788 : A4ZQT6_PERMA        0.53  0.81    2  141    3  142  140    0    0  142  A4ZQT6     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1789 : A4ZQU6_PERMA        0.53  0.80    2  141    3  142  140    0    0  142  A4ZQU6     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1790 : A4ZQV0_PERMA        0.53  0.80    2  141    3  142  140    0    0  142  A4ZQV0     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1791 : A4ZQV8_PERMA        0.53  0.80    2  141    3  142  140    0    0  142  A4ZQV8     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1792 : A4ZQV9_PERMA        0.53  0.80    2  141    3  142  140    0    0  142  A4ZQV9     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1793 : A4ZQW2_PERMA        0.53  0.81    2  141    3  142  140    0    0  142  A4ZQW2     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 1794 : A8HTG8_PERFV1XQ5    0.53  0.73    2  141    3  143  141    1    1  143  A8HTG8     Alpha-type globin OS=Perca flavescens PE=2 SV=1
 1795 : D0VWV2_PERFV1XQ5    0.53  0.73    2  141    3  143  141    1    1  143  D0VWV2     Hemoglobin alpha-1 chain OS=Perca flavescens PE=1 SV=1
 1796 : G1LJX4_AILME        0.53  0.78    2  141    3  142  140    0    0  142  G1LJX4     Uncharacterized protein OS=Ailuropoda melanoleuca PE=3 SV=1
 1797 : HBAC_CONCO          0.53  0.75    2  141    3  143  141    1    1  143  P83479     Hemoglobin cathodic subunit alpha OS=Conger conger PE=1 SV=2
 1798 : HBA_AMBME           0.53  0.71    2  141    4  143  140    0    0  143  P02015     Hemoglobin subunit alpha OS=Ambystoma mexicanum GN=HBA PE=1 SV=2
 1799 : HBB1_XENBO          0.53  0.70  145  288    3  146  144    0    0  146  P07432     Hemoglobin subunit beta-1 OS=Xenopus borealis GN=hbb1 PE=2 SV=2
 1800 : HBB1_XENLA          0.53  0.70  145  288    3  146  144    0    0  146  P02132     Hemoglobin subunit beta-1 OS=Xenopus laevis GN=hbb1 PE=2 SV=2
 1801 : HBB2_XENBO          0.53  0.73  145  288    3  146  144    0    0  146  P07433     Hemoglobin subunit beta-2 OS=Xenopus borealis GN=hbb2 PE=2 SV=2
 1802 : HBBC_CONCO          0.53  0.81  144  287    2  145  144    0    0  146  P83478     Hemoglobin cathodic subunit beta OS=Conger conger PE=1 SV=1
 1803 : HBBC_GYMUN          0.53  0.78  144  287    2  145  144    0    0  146  P84204     Hemoglobin cathodic subunit beta OS=Gymnothorax unicolor PE=1 SV=1
 1804 : I3IZ56_ORENI        0.53  0.72    2  141    4  144  141    1    1  144  I3IZ56     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100704772 PE=3 SV=1
 1805 : Q38IW4_XENTR        0.53  0.78    1  141    2  142  141    0    0  142  Q38IW4     Alpha globin larval-2 OS=Xenopus tropicalis GN=HBA-L2 PE=2 SV=1
 1806 : Q6DET0_XENTR        0.53  0.78  144  287    3  146  144    0    0  147  Q6DET0     MGC89723 protein OS=Xenopus tropicalis GN=hbd PE=2 SV=1
 1807 : Q6GPP8_XENLA        0.53  0.73    1  141    2  139  141    1    3  139  Q6GPP8     MGC82702 protein OS=Xenopus laevis GN=hba-l5 PE=2 SV=1
 1808 : Q7SZV9_DANRE        0.53  0.77    2  141    3  143  141    1    1  143  Q7SZV9     Novel alpha-globin OS=Danio rerio GN=hbaa1 PE=3 SV=1
 1809 : Q7T1B0_DANRE        0.53  0.76  145  288    4  147  144    0    0  147  Q7T1B0     Embryonic globin beta e2 OS=Danio rerio GN=hbbe2 PE=2 SV=1
 1810 : Q803Z5_DANRE        0.53  0.77    2  141    3  143  141    1    1  143  Q803Z5     Hemoglobin alpha adult-1 OS=Danio rerio GN=hbaa1 PE=2 SV=1
 1811 : Q8JH89_PARDA        0.53  0.80  144  288    2  147  146    1    1  147  Q8JH89     Beta globin (Fragment) OS=Paramisgurnus dabryanus PE=2 SV=1
 1812 : A1YZP4_9TELE3BCQ    0.52  0.74    2  141    3  143  142    3    3  143  A1YZP4     Alpha-chain hemoglobin OS=Brycon cephalus PE=1 SV=1
 1813 : B0BL34_CARAU        0.52  0.77    2  141    3  143  141    1    1  143  B0BL34     Hemoglobin alpha OS=Carassius auratus GN=hba PE=2 SV=1
 1814 : B2BP38_PIMPR        0.52  0.79  144  288    3  147  145    0    0  147  B2BP38     Hemoglobin beta chain OS=Pimephales promelas PE=2 SV=1
 1815 : B9A9V6_CARAU        0.52  0.80  150  273    1  125  125    1    1  125  B9A9V6     Beta globin (Fragment) OS=Carassius auratus langsdorfii GN=hbb PE=2 SV=1
 1816 : C3KGZ6_ANOFI        0.52  0.71    2  141    3  143  141    1    1  143  C3KGZ6     Hemoglobin subunit alpha-2 OS=Anoplopoma fimbria GN=HBA2 PE=2 SV=1
 1817 : C3KHW6_ANOFI        0.52  0.71    2  141    3  143  141    1    1  143  C3KHW6     Hemoglobin subunit alpha-2 OS=Anoplopoma fimbria GN=HBA2 PE=2 SV=1
 1818 : C3KHZ8_ANOFI        0.52  0.79  144  288    3  147  145    0    0  147  C3KHZ8     Hemoglobin subunit beta-2 OS=Anoplopoma fimbria GN=HBB2 PE=2 SV=1
 1819 : C3KI50_ANOFI        0.52  0.77  144  288    3  147  145    0    0  147  C3KI50     Hemoglobin subunit beta OS=Anoplopoma fimbria GN=HBB PE=2 SV=1
 1820 : C3KIS0_ANOFI        0.52  0.79  144  288    3  147  145    0    0  147  C3KIS0     Hemoglobin subunit beta-2 OS=Anoplopoma fimbria GN=HBB2 PE=2 SV=1
 1821 : C3KIT4_ANOFI        0.52  0.79  144  288    3  147  145    0    0  147  C3KIT4     Hemoglobin subunit beta-2 OS=Anoplopoma fimbria GN=HBB2 PE=2 SV=1
 1822 : E3TCM4_9TELE        0.52  0.83  145  287    4  146  143    0    0  147  E3TCM4     Hemoglobin cathodic subunit beta OS=Ictalurus furcatus GN=HBBC PE=2 SV=1
 1823 : E7F4I1_DANRE        0.52  0.77    2  141    3  143  141    1    1  143  E7F4I1     Uncharacterized protein OS=Danio rerio GN=hbaa1 PE=2 SV=1
 1824 : G3PL48_GASAC        0.52  0.76  145  288    4  147  144    0    0  147  G3PL48     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 1825 : G8G8X6_EPICO        0.52  0.72    2  141    3  143  141    1    1  143  G8G8X6     Hemoglobin alpha chain OS=Epinephelus coioides PE=2 SV=1
 1826 : H2LKL6_ORYLA        0.52  0.74    2  141    4  144  141    1    1  144  H2LKL6     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC101174505 PE=3 SV=1
 1827 : H3ABR1_LATCH        0.52  0.78    1  141    1  141  141    0    0  141  H3ABR1     Uncharacterized protein OS=Latimeria chalumnae GN=HBZ PE=3 SV=2
 1828 : HBAC_GYMUN          0.52  0.78    2  141    2  143  142    2    2  143  P84203     Hemoglobin cathodic subunit alpha OS=Gymnothorax unicolor PE=1 SV=1
 1829 : HBAC_HOPLI          0.52  0.74    2  141    2  142  141    1    1  142  P82315     Hemoglobin cathodic subunit alpha OS=Hoplosternum littorale PE=1 SV=1
 1830 : HBA_CARAU           0.52  0.77    2  141    2  142  141    1    1  142  P02018     Hemoglobin subunit alpha OS=Carassius auratus GN=hba PE=1 SV=1
 1831 : HBA_DANRE           0.52  0.77    2  141    3  143  141    1    1  143  Q90487     Hemoglobin subunit alpha OS=Danio rerio GN=hbaa1 PE=2 SV=3
 1832 : HBA_ELEEL           0.52  0.78    2  141    2  142  141    1    1  142  P14520     Hemoglobin subunit alpha OS=Electrophorus electricus GN=hba PE=1 SV=1
 1833 : HBB1_ARCGL          0.52  0.77  157  288    1  132  132    0    0  132  Q1AGS3     Hemoglobin subunit beta-1 (Fragment) OS=Arctogadus glacialis GN=hbb1 PE=1 SV=1
 1834 : HBB1_ONCMY  1OUT    0.52  0.82  144  287    2  145  144    0    0  146  P02142     Hemoglobin subunit beta-1 OS=Oncorhynchus mykiss GN=hbb1 PE=1 SV=1
 1835 : HBB_DECMA           0.52  0.79  145  288    4  148  145    1    1  148  O13164     Hemoglobin subunit beta OS=Decapterus maruadsi GN=hbb PE=2 SV=2
 1836 : HBB_LATCH           0.52  0.78  144  288    2  146  145    0    0  146  P23741     Hemoglobin subunit beta OS=Latimeria chalumnae GN=HBB PE=1 SV=1
 1837 : HBB_LITCT           0.52  0.76  153  288    5  140  136    0    0  140  P02135     Hemoglobin subunit beta OS=Lithobates catesbeiana GN=HBB PE=1 SV=1
 1838 : I3IZ07_ORENI        0.52  0.71    2  141    4  144  141    1    1  144  I3IZ07     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100702435 PE=3 SV=1
 1839 : I3IZ17_ORENI        0.52  0.72    2  141    4  144  141    1    1  144  I3IZ17     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100702704 PE=3 SV=1
 1840 : Q0PP67_PIMPR        0.52  0.76    2  141    2  142  141    1    1  142  Q0PP67     Hemoglobin alpha chain (Fragment) OS=Pimephales promelas PE=2 SV=1
 1841 : Q1JQ69_DANRE        0.52  0.77    2  141    3  143  141    1    1  143  Q1JQ69     Hbaa1 protein OS=Danio rerio GN=hbaa1 PE=2 SV=1
 1842 : Q5BLF6_DANRE        0.52  0.78  145  287    4  146  143    0    0  147  Q5BLF6     Hemoglobin beta embryonic-3 OS=Danio rerio GN=hbbe3 PE=2 SV=1
 1843 : Q6ZM17_DANRE        0.52  0.76    2  141    3  143  141    1    1  143  Q6ZM17     Novel protein similar to zebrafish hemoglobin alpha-adult 1 (Hbaa1) OS=Danio rerio GN=si:xx-by187g17.1 PE=2 SV=1
 1844 : Q7ZYZ4_DANRE        0.52  0.72    2  141    3  143  142    3    3  143  Q7ZYZ4     Hbae3 protein OS=Danio rerio GN=hbae3 PE=2 SV=1
 1845 : Q7ZZQ6_OREMO        0.52  0.77  144  286    3  145  143    0    0  145  Q7ZZQ6     Beta-globin (Fragment) OS=Oreochromis mossambicus PE=2 SV=1
 1846 : Q8AYQ8_ORYLA        0.52  0.74    2  141    3  143  141    1    1  143  Q8AYQ8     Alpha-type globin OS=Oryzias latipes GN=Gb-alpha2 PE=3 SV=1
 1847 : Q8UW94_CYPCA        0.52  0.76  145  288    4  147  144    0    0  147  Q8UW94     Beta globin type-2 OS=Cyprinus carpio PE=3 SV=1
 1848 : Q8UW95_CYPCA        0.52  0.72    2  141    3  143  141    1    1  143  Q8UW95     Alpha globin type-2 OS=Cyprinus carpio PE=3 SV=1
 1849 : A9UM89_XENTR        0.51  0.76  145  288    4  147  144    0    0  147  A9UM89     LOC100135274 protein OS=Xenopus tropicalis GN=LOC100135274 PE=2 SV=1
 1850 : B2RVB7_MOUSE        0.51  0.79  144  287    3  146  144    0    0  147  B2RVB7     Predicted gene, EG436003 OS=Mus musculus GN=Hbb-bh2 PE=2 SV=1
 1851 : B5X5E4_SALSA        0.51  0.82  144  287    3  146  144    0    0  147  B5X5E4     Hemoglobin subunit beta-1 OS=Salmo salar GN=HBB1 PE=2 SV=1
 1852 : B6DMG4_HIPHI        0.51  0.74    2  141    4  144  141    1    1  144  B6DMG4     Alpha-globin 1 OS=Hippoglossus hippoglossus PE=2 SV=1
 1853 : B9V3T6_EPICO        0.51  0.77  159  288    1  130  130    0    0  130  B9V3T6     Hemoglobin beta chain (Fragment) OS=Epinephelus coioides PE=2 SV=1
 1854 : C1BEX8_ONCMY        0.51  0.81  144  287    3  146  144    0    0  147  C1BEX8     Hemoglobin subunit beta-1 OS=Oncorhynchus mykiss GN=HBB1 PE=2 SV=1
 1855 : C1BFD8_ONCMY        0.51  0.82  143  287    2  146  145    0    0  147  C1BFD8     Hemoglobin subunit beta-1 OS=Oncorhynchus mykiss GN=HBB1 PE=2 SV=1
 1856 : C1BJP8_OSMMO        0.51  0.74  143  288    2  147  146    0    0  147  C1BJP8     Hemoglobin subunit beta-1 OS=Osmerus mordax GN=HBB1 PE=2 SV=1
 1857 : C1BX42_ESOLU        0.51  0.74    2  141    3  143  141    1    1  143  C1BX42     Hemoglobin subunit alpha-4 OS=Esox lucius GN=HBA4 PE=2 SV=1
 1858 : C1BYD3_ESOLU        0.51  0.74    2  141    3  143  141    1    1  143  C1BYD3     Hemoglobin subunit alpha-4 OS=Esox lucius GN=HBA4 PE=2 SV=1
 1859 : C3KHR5_ANOFI        0.51  0.79  144  288    3  147  145    0    0  147  C3KHR5     Hemoglobin subunit beta-2 OS=Anoplopoma fimbria GN=HBB2 PE=2 SV=1
 1860 : C3KJ57_ANOFI        0.51  0.78  145  288    4  147  144    0    0  147  C3KJ57     Hemoglobin subunit beta-1 OS=Anoplopoma fimbria GN=HBB1 PE=2 SV=1
 1861 : D0VWV3_PERFV1XQ5    0.51  0.79  145  288    3  146  144    0    0  146  D0VWV3     Hemoglobin beta OS=Perca flavescens PE=1 SV=1
 1862 : E3TGA8_ICTPU        0.51  0.77  145  288    4  147  144    0    0  147  E3TGA8     Hemoglobin subunit beta OS=Ictalurus punctatus GN=HBB PE=2 SV=1
 1863 : G3PL38_GASAC        0.51  0.76  145  288    4  147  144    0    0  147  G3PL38     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 1864 : G3PL41_GASAC        0.51  0.73    2  141    4  144  141    1    1  144  G3PL41     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 1865 : G3PL59_GASAC        0.51  0.76  145  288    4  147  144    0    0  147  G3PL59     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 1866 : G3PL61_GASAC        0.51  0.73    2  141    4  144  141    1    1  144  G3PL61     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 1867 : G3PL66_GASAC        0.51  0.77  145  288    4  147  144    0    0  147  G3PL66     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 1868 : G3PL74_GASAC        0.51  0.77  145  288    4  147  144    0    0  147  G3PL74     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 1869 : G3PLA9_GASAC        0.51  0.76  145  288    4  147  144    0    0  147  G3PLA9     Uncharacterized protein OS=Gasterosteus aculeatus GN=LOC100174873 PE=3 SV=1
 1870 : H2LD06_ORYLA        0.51  0.71    2  141    4  144  141    1    1  144  H2LD06     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC101171201 PE=3 SV=1
 1871 : H2LKL5_ORYLA        0.51  0.75    2  141    4  144  141    1    1  144  H2LKL5     Uncharacterized protein OS=Oryzias latipes GN=LOC101174505 PE=3 SV=1
 1872 : H2QA68_PANTR        0.51  0.76    2  141    3  142  140    0    0  142  H2QA68     Uncharacterized protein OS=Pan troglodytes GN=LOC100608245 PE=3 SV=1
 1873 : HBA1_COTGO          0.51  0.73    2  141    3  143  141    1    1  143  P84653     Hemoglobin subunit alpha-1 OS=Cottoperca gobio GN=hba1 PE=1 SV=2
 1874 : HBA2_ANAMI          0.51  0.72    2  141    3  143  141    1    1  143  P83271     Hemoglobin subunit alpha-2 OS=Anarhichas minor GN=hba2 PE=1 SV=2
 1875 : HBA2_COTGO          0.51  0.71    2  141    3  143  141    1    1  143  P85083     Hemoglobin subunit alpha-2 OS=Cottoperca gobio GN=hba2 PE=1 SV=1
 1876 : HBAB_LITCT          0.51  0.74    2  141    3  142  140    0    0  142  P51465     Hemoglobin subunit alpha-B OS=Lithobates catesbeiana PE=1 SV=2
 1877 : HBAE_ORYLA          0.51  0.74    2  141    4  144  141    1    1  144  Q9PVU6     Hemoglobin embryonic subunit alpha OS=Oryzias latipes PE=2 SV=3
 1878 : HBA_LYCRE           0.51  0.71    2  141    2  142  141    1    1  142  P86882     Hemoglobin subunit alpha OS=Lycodes reticulatus GN=hba PE=1 SV=1
 1879 : HBB2_ANAMI          0.51  0.78  144  288    2  146  145    0    0  146  P83273     Hemoglobin subunit beta-2 OS=Anarhichas minor GN=hbb2 PE=1 SV=1
 1880 : HBB2_CYGMA          0.51  0.77  144  288    2  146  145    0    0  146  P23018     Hemoglobin subunit beta-2 OS=Cygnodraco mawsoni GN=hbb2 PE=1 SV=1
 1881 : HBBA_SERQU          0.51  0.79  144  288    3  148  146    1    1  148  Q9PVM2     Hemoglobin subunit beta-A OS=Seriola quinqueradiata GN=hbb1 PE=2 SV=2
 1882 : HBBB_SERQU          0.51  0.79  144  288    3  148  146    1    1  148  Q9PVM1     Hemoglobin subunit beta-B OS=Seriola quinqueradiata GN=hbb2 PE=2 SV=3
 1883 : HBBC_HOPLI          0.51  0.84  144  287    2  145  144    0    0  146  P82316     Hemoglobin cathodic subunit beta OS=Hoplosternum littorale GN=hbb PE=1 SV=1
 1884 : HBB_ALLMI           0.51  0.80  143  288    1  146  146    0    0  146  P02130     Hemoglobin subunit beta OS=Alligator mississippiensis GN=HBB PE=1 SV=1
 1885 : HBB_CYPCA           0.51  0.78  144  288    2  147  146    1    1  147  P02139     Hemoglobin subunit beta-A/B OS=Cyprinus carpio PE=1 SV=1
 1886 : J9P710_CANFA        0.51  0.68    2  141    3  169  167    1   27  169  J9P710     Uncharacterized protein OS=Canis familiaris PE=3 SV=1
 1887 : K7N5M6_ELEMC4ESA    0.51  0.75  144  288    2  146  145    0    0  146  K7N5M6     Hemoglobin beta chain OS=Eleginops maclovinus PE=1 SV=1
 1888 : M4ASJ1_XIPMA        0.51  0.77  145  288    4  147  144    0    0  147  M4ASJ1     Uncharacterized protein OS=Xiphophorus maculatus PE=3 SV=1
 1889 : O13140_CYPCA        0.51  0.77  144  288    3  148  146    1    1  148  O13140     Beta-globin OS=Cyprinus carpio GN=No.3 beta PE=3 SV=1
 1890 : O93548_DANRE        0.51  0.76  145  288    4  147  144    0    0  147  O93548     Embryonic 1 beta-globin OS=Danio rerio GN=hbbe1 PE=2 SV=1
 1891 : P70073_CYPCA        0.51  0.79  144  288    3  148  146    1    1  148  P70073     Beta-globin OS=Cyprinus carpio PE=2 SV=1
 1892 : Q1RM32_DANRE        0.51  0.78  144  288    3  148  146    1    1  148  Q1RM32     Ba1 globin OS=Danio rerio GN=ba1 PE=2 SV=1
 1893 : Q78DI0_ORYLA        0.51  0.74    2  141    4  144  141    1    1  144  Q78DI0     Alpha-type globin OS=Oryzias latipes GN=Gb-alpha1 PE=2 SV=1
 1894 : Q804E5_GASAC        0.51  0.76  145  288    4  147  144    0    0  147  Q804E5     Beta globin OS=Gasterosteus aculeatus PE=2 SV=1
 1895 : Q8AYQ1_ORYLA        0.51  0.71    2  141    3  143  141    1    1  143  Q8AYQ1     Alpha-type globin OS=Oryzias latipes GN=Gb PE=3 SV=1
 1896 : Q8AYQ6_ORYLA        0.51  0.78  145  288    4  147  144    0    0  147  Q8AYQ6     Beta-type globin OS=Oryzias latipes GN=Gb-beta3 PE=3 SV=1
 1897 : Q8JH84_CTEID        0.51  0.77    2  141    3  143  141    1    1  143  Q8JH84     Alpha globin (Fragment) OS=Ctenopharyngodon idella PE=2 SV=1
 1898 : Q8JIM9_ORYLA        0.51  0.79  144  288    3  147  145    0    0  147  Q8JIM9     Adult beta-type globin OS=Oryzias latipes GN=Gb PE=2 SV=1
 1899 : Q8JIN0_ORYLA        0.51  0.71    2  141    3  143  141    1    1  143  Q8JIN0     Adult alpha-type globin OS=Oryzias latipes GN=Gb PE=2 SV=1
 1900 : Q8UW93_CYPCA        0.51  0.79  144  288    3  147  145    0    0  147  Q8UW93     Beta globin type-3 OS=Cyprinus carpio PE=3 SV=1
 1901 : Q91470_SALSA        0.51  0.82  144  287    3  146  144    0    0  147  Q91470     Beta-globin OS=Salmo salar GN=HBB1 PE=2 SV=1
 1902 : Q91471_SALSA        0.51  0.82  143  287    2  146  145    0    0  147  Q91471     Beta globin OS=Salmo salar PE=2 SV=1
 1903 : Q98851_CYPCA        0.51  0.78  144  288    3  148  146    1    1  148  Q98851     Beta-globin OS=Cyprinus carpio PE=2 SV=1
 1904 : Q98852_CYPCA        0.51  0.78  144  288    3  148  146    1    1  148  Q98852     Beta-globin OS=Cyprinus carpio PE=2 SV=1
 1905 : Q98853_CYPCA        0.51  0.77  144  288    3  148  146    1    1  148  Q98853     Beta-globin OS=Cyprinus carpio PE=2 SV=1
 1906 : Q9YGF4_ONCMY        0.51  0.74  145  288    4  147  144    0    0  147  Q9YGF4     Embryonic beta-type globin2 OS=Oncorhynchus mykiss PE=2 SV=1
 1907 : A0EZW6_PSEMX        0.50  0.73    2  141    4  144  141    1    1  144  A0EZW6     Alpha-type globin OS=Psetta maxima PE=2 SV=1
 1908 : B0BL35_CARAU        0.50  0.78  144  288    3  148  146    1    1  148  B0BL35     Hemoglobin beta OS=Carassius auratus GN=hbb PE=2 SV=1
 1909 : B3DG37_DANRE        0.50  0.78  144  288    3  148  146    1    1  148  B3DG37     Ba1 protein OS=Danio rerio GN=ba1 PE=2 SV=1
 1910 : B3F9Q1_GADMO        0.50  0.74  144  288    3  147  145    0    0  147  B3F9Q1     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 1911 : B5X6E3_SALSA        0.50  0.81  143  287    2  146  145    0    0  147  B5X6E3     Hemoglobin subunit beta-1 OS=Salmo salar GN=HBB1 PE=2 SV=1
 1912 : B5X6T9_SALSA        0.50  0.82  144  287    3  146  144    0    0  147  B5X6T9     Hemoglobin subunit beta-1 OS=Salmo salar GN=HBB1 PE=2 SV=1
 1913 : B5X746_SALSA        0.50  0.74    2  141    3  143  141    1    1  143  B5X746     Hemoglobin subunit alpha-4 OS=Salmo salar GN=HBA4 PE=2 SV=1
 1914 : B5X930_SALSA        0.50  0.70    1  141    2  143  143    3    3  143  B5X930     Hemoglobin embryonic subunit alpha OS=Salmo salar GN=HBAE PE=2 SV=1
 1915 : B5XD73_SALSA        0.50  0.74    2  141    3  143  141    1    1  143  B5XD73     Hemoglobin subunit alpha-4 OS=Salmo salar GN=HBA4 PE=2 SV=1
 1916 : B5XGF2_SALSA        0.50  0.81  144  287    3  146  144    0    0  147  B5XGF2     Hemoglobin subunit beta-1 OS=Salmo salar GN=HBB1 PE=2 SV=1
 1917 : C0H744_SALSA        0.50  0.81  144  287    3  146  144    0    0  147  C0H744     Hemoglobin subunit beta-1 OS=Salmo salar GN=HBB1 PE=2 SV=1
 1918 : C0H789_SALSA        0.50  0.72    2  141    3  143  141    1    1  143  C0H789     Hemoglobin subunit alpha-4 OS=Salmo salar GN=HBA4 PE=2 SV=1
 1919 : C1BEY1_ONCMY        0.50  0.73    2  141    3  143  141    1    1  143  C1BEY1     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 1920 : C1BG02_ONCMY        0.50  0.74    2  141    3  143  141    1    1  143  C1BG02     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 1921 : C1BGI7_ONCMY        0.50  0.74    2  141    3  143  141    1    1  143  C1BGI7     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 1922 : C1BIL2_OSMMO        0.50  0.74    2  141    3  143  141    1    1  143  C1BIL2     Hemoglobin subunit alpha-2 OS=Osmerus mordax GN=HBA2 PE=2 SV=1
 1923 : C1BW51_ESOLU        0.50  0.73    2  141    3  143  141    1    1  143  C1BW51     Hemoglobin subunit alpha-4 OS=Esox lucius GN=HBA4 PE=2 SV=1
 1924 : C1BYS9_ESOLU        0.50  0.72    2  141    3  143  141    1    1  143  C1BYS9     Hemoglobin subunit alpha-4 OS=Esox lucius GN=HBA4 PE=2 SV=1
 1925 : C1C495_LITCT        0.50  0.75  153  288    6  141  136    0    0  141  C1C495     Hemoglobin subunit beta OS=Lithobates catesbeiana GN=HBB PE=2 SV=1
 1926 : C1JC94_HYPNO        0.50  0.78  144  287    3  147  145    1    1  147  C1JC94     Ba1 globin (Fragment) OS=Hypophthalmichthys nobilis PE=2 SV=1
 1927 : C3KHN6_ANOFI        0.50  0.79  144  288    3  147  145    0    0  147  C3KHN6     Hemoglobin subunit beta-2 OS=Anoplopoma fimbria GN=HBB2 PE=2 SV=1
 1928 : C3KID2_ANOFI        0.50  0.73    2  141    3  143  141    1    1  143  C3KID2     Hemoglobin subunit alpha-1 OS=Anoplopoma fimbria GN=HBA1 PE=2 SV=1
 1929 : F1Q6I6_DANRE        0.50  0.75    2  141    3  143  141    1    1  143  F1Q6I6     Uncharacterized protein OS=Danio rerio GN=hbz PE=3 SV=2
 1930 : G3PL33_GASAC        0.50  0.73    2  141    4  144  141    1    1  144  G3PL33     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 1931 : H2TTY2_TAKRU        0.50  0.74    2  141    4  144  141    1    1  144  H2TTY2     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101073868 PE=3 SV=1
 1932 : H3AAE3_LATCH        0.50  0.72    2  141    3  143  141    1    1  143  H3AAE3     Uncharacterized protein OS=Latimeria chalumnae PE=3 SV=1
 1933 : H6QXI7_DISMA        0.50  0.74    2  141    3  143  141    1    1  143  H6QXI7     Alpha-globin OS=Dissostichus mawsoni PE=3 SV=1
 1934 : H6QXI8_DISMA        0.50  0.74  144  288    3  147  145    0    0  147  H6QXI8     Beta-globin OS=Dissostichus mawsoni PE=3 SV=1
 1935 : HBA1_ANAMI          0.50  0.73    2  141    3  143  141    1    1  143  P83270     Hemoglobin subunit alpha-1 OS=Anarhichas minor GN=hba1 PE=1 SV=2
 1936 : HBA1_LIPTU          0.50  0.72    2  141    3  143  141    1    1  143  P85081     Hemoglobin subunit alpha-1 OS=Liparis tunicatus GN=hba1 PE=1 SV=1
 1937 : HBA1_NOTAN          0.50  0.76    2  141    2  142  141    1    1  142  P29624     Hemoglobin subunit alpha-1 OS=Notothenia angustata GN=hba1 PE=1 SV=1
 1938 : HBA4_ONCMY  2R1H    0.50  0.74    2  141    2  142  141    1    1  142  P14527     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=hba4 PE=1 SV=1
 1939 : HBAD_DRYCE          0.50  0.74    1  141    1  141  141    0    0  141  P0C0U7     Hemoglobin subunit alpha-D OS=Drymarchon corais erebennus PE=1 SV=1
 1940 : HBAD_LIOMI          0.50  0.77    1  141    1  141  141    0    0  141  P16417     Hemoglobin subunit alpha-D OS=Liophis miliaris GN=HBAD PE=1 SV=1
 1941 : HBA_CATCL           0.50  0.74    2  141    2  142  141    1    1  142  P02017     Hemoglobin subunit alpha OS=Catostomus clarkii GN=hba PE=1 SV=1
 1942 : HBA_CHEKU           0.50  0.71    2  141    2  142  141    1    1  142  P80270     Hemoglobin subunit alpha OS=Chelidonichthys kumu GN=hba PE=1 SV=1
 1943 : HBA_LATCH           0.50  0.72    2  141    2  142  141    1    1  142  P23740     Hemoglobin subunit alpha OS=Latimeria chalumnae GN=HBA PE=1 SV=1
 1944 : HBA_PSEUR           0.50  0.72    2  141    2  142  141    1    1  142  P83623     Hemoglobin subunit alpha OS=Pseudaphritis urvillii GN=hba PE=1 SV=1
 1945 : HBB1_BORSA          0.50  0.76  144  288    3  147  145    0    0  147  Q1AGS7     Hemoglobin subunit beta-1 OS=Boreogadus saida GN=hbb1 PE=1 SV=3
 1946 : HBB1_DANRE          0.50  0.78  144  288    3  148  146    1    1  148  Q90486     Hemoglobin subunit beta-1 OS=Danio rerio GN=ba1 PE=1 SV=3
 1947 : HBB2_BORSA          0.50  0.76  144  288    3  147  145    0    0  147  Q1AGS6     Hemoglobin subunit beta-2 OS=Boreogadus saida GN=hbb2 PE=1 SV=3
 1948 : HBB2_DANRE          0.50  0.78  144  288    3  148  146    1    1  148  Q90485     Hemoglobin subunit beta-2 OS=Danio rerio GN=ba2 PE=1 SV=3
 1949 : HBB2_GOBGI          0.50  0.76  144  288    2  146  145    0    0  146  P83614     Hemoglobin subunit beta-2 OS=Gobionotothen gibberifrons GN=hbb2 PE=1 SV=1
 1950 : HBB2_PSEUR          0.50  0.75  144  288    2  146  145    0    0  146  P83625     Hemoglobin subunit beta-2 OS=Pseudaphritis urvillii GN=hbb2 PE=1 SV=1
 1951 : HBB_CARAU           0.50  0.78  144  288    2  147  146    1    1  147  P02140     Hemoglobin subunit beta OS=Carassius auratus GN=hbb PE=1 SV=1
 1952 : HBB_COTGO           0.50  0.77  144  288    3  147  145    0    0  147  P84652     Hemoglobin subunit beta OS=Cottoperca gobio GN=hbb PE=1 SV=2
 1953 : K7N5M5_ELEMC4ESA    0.50  0.73    2  141    3  143  141    1    1  143  K7N5M5     Hemoglobin alpha chain OS=Eleginops maclovinus PE=1 SV=1
 1954 : M3ZD80_XIPMA        0.50  0.74    2  141    4  144  141    1    1  144  M3ZD80     Uncharacterized protein (Fragment) OS=Xiphophorus maculatus PE=3 SV=1
 1955 : M9T843_CYPCA        0.50  0.75    2  141    3  143  141    1    1  143  M9T843     Hemoglobin alpha OS=Cyprinus carpio PE=4 SV=1
 1956 : O13136_CYPCA        0.50  0.74    2  141    3  143  141    1    1  143  O13136     Alpha-globin OS=Cyprinus carpio GN=No.5 alpha PE=3 SV=1
 1957 : O13137_CYPCA        0.50  0.74    2  141    3  143  141    1    1  143  O13137     Alpha-globin OS=Cyprinus carpio GN=No.4 alpha PE=3 SV=1
 1958 : O13169_CYPCA        0.50  0.77    2  141    3  143  141    1    1  143  O13169     Alpha-globin OS=Cyprinus carpio GN=No.3 alpha PE=3 SV=1
 1959 : Q2KKV2_SINCH        0.50  0.79  144  286    3  145  143    0    0  145  Q2KKV2     Hemoglobin beta-A chain (Fragment) OS=Siniperca chuatsi PE=2 SV=1
 1960 : Q33CJ7_CYNPY        0.50  0.76  145  288    3  146  144    0    0  146  Q33CJ7     Beta-globin OS=Cynops pyrrhogaster PE=2 SV=1
 1961 : Q7LZM6_VARKO        0.50  0.74    1  141    1  141  141    0    0  141  Q7LZM6     Hemoglobin alpha 2 chain OS=Varanus komodoensis PE=3 SV=1
 1962 : Q7SZV8_DANRE        0.50  0.77    2  141    3  143  141    1    1  143  Q7SZV8     Novel alpha-globin OS=Danio rerio GN=hbae1 PE=3 SV=1
 1963 : Q8JH82_PARDA        0.50  0.76    2  141    3  143  141    1    1  143  Q8JH82     Alpha globin (Fragment) OS=Paramisgurnus dabryanus PE=2 SV=1
 1964 : Q8JH86_CYPCA        0.50  0.79  144  288    2  147  146    1    1  147  Q8JH86     Beta globin (Fragment) OS=Cyprinus carpio PE=2 SV=1
 1965 : Q8JH87_CTEID        0.50  0.79  144  288    2  147  146    1    1  147  Q8JH87     Beta globin (Fragment) OS=Ctenopharyngodon idella PE=2 SV=1
 1966 : Q8JH88_CARAU        0.50  0.77  144  288    2  147  146    1    1  147  Q8JH88     Beta globin (Fragment) OS=Carassius auratus PE=2 SV=1
 1967 : Q8JH90_CARAU        0.50  0.77    2  141    3  143  141    1    1  143  Q8JH90     Alpha globin (Fragment) OS=Carassius auratus PE=2 SV=1
 1968 : Q8JIN1_ORYLA        0.50  0.77  144  288    3  147  145    0    0  147  Q8JIN1     Beta-type globin OS=Oryzias latipes GN=Gb PE=2 SV=1
 1969 : Q91128_9PERC        0.50  0.76    2  141    3  143  141    1    1  143  Q91128     Alpha globin OS=Notothenia coriiceps PE=2 SV=1
 1970 : Q98973_ONCMY        0.50  0.74    2  141    3  143  141    1    1  143  Q98973     Alpha-globin I OS=Oncorhynchus mykiss PE=2 SV=1
 1971 : Q98SE6_9PERC        0.50  0.72    2  141    4  144  141    1    1  144  Q98SE6     AlphaNCP1 OS=Notothenia coriiceps GN=alphaNCPII PE=3 SV=1
 1972 : Q98UB8_9PERC        0.50  0.75  144  288    3  147  145    0    0  147  Q98UB8     BetaNCP2 OS=Notothenia coriiceps GN=betaNCPII PE=3 SV=1
 1973 : Q9IAJ8_NOTAN        0.50  0.76    2  141    3  143  141    1    1  143  Q9IAJ8     Alpha1 globin OS=Notothenia angustata PE=3 SV=1
 1974 : Q9PVL7_HYNRE        0.50  0.77  145  288    3  146  144    0    0  146  Q9PVL7     Adult beta-globin OS=Hynobius retardatus PE=2 SV=1
 1975 : Q9YGF5_ONCMY        0.50  0.79  144  288    3  147  145    0    0  147  Q9YGF5     Embryonic beta-type globin OS=Oncorhynchus mykiss PE=2 SV=1
 1976 : A0EZW4_PSEMX        0.49  0.77  144  282    3  141  139    0    0  141  A0EZW4     Hemoglobin beta-2 subunit (Fragment) OS=Psetta maxima PE=2 SV=1
 1977 : A9UML4_XENTR        0.49  0.77    2  141    3  143  141    1    1  143  A9UML4     LOC100135390 protein OS=Xenopus tropicalis GN=LOC100135390 PE=2 SV=1
 1978 : B3F9E3_GADMO        0.49  0.75  144  288    3  147  145    0    0  147  B3F9E3     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 1979 : B3F9F8_GADMO        0.49  0.75  144  288    3  147  145    0    0  147  B3F9F8     Hemoglobin beta 4 OS=Gadus morhua GN=HbB4 PE=3 SV=1
 1980 : B3F9Q7_GADMO        0.49  0.76  144  288    3  147  145    0    0  147  B3F9Q7     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 1981 : B3F9R0_GADMO        0.49  0.75  144  287    3  146  144    0    0  147  B3F9R0     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 1982 : B3F9U6_GADMO        0.49  0.75  144  288    3  147  145    0    0  147  B3F9U6     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 1983 : B8XJS4_GADMO        0.49  0.72    2  141    3  143  141    1    1  143  B8XJS4     Hemoglobin alpha 1 OS=Gadus morhua GN=HbA1 PE=2 SV=1
 1984 : B8XJS6_GADMO        0.49  0.75  144  288    3  147  145    0    0  147  B8XJS6     Hemoglobin beta 1 OS=Gadus morhua GN=HbB1 PE=2 SV=1
 1985 : C1BEW1_ONCMY        0.49  0.74    2  141    3  143  141    1    1  143  C1BEW1     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 1986 : C1BEX7_ONCMY        0.49  0.73    2  141    6  146  141    1    1  146  C1BEX7     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 1987 : C1BF11_ONCMY        0.49  0.74    2  141    3  143  141    1    1  143  C1BF11     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 1988 : C1BG49_ONCMY        0.49  0.73    2  141    3  143  141    1    1  143  C1BG49     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 1989 : C8YNQ3_GADMO        0.49  0.75  144  288    3  147  145    0    0  147  C8YNQ3     Hemoglobin beta 1 OS=Gadus morhua GN=HbB1 PE=3 SV=1
 1990 : C8YNQ4_GADMO        0.49  0.76  144  288    3  147  145    0    0  147  C8YNQ4     Hemoglobin beta 1 OS=Gadus morhua GN=HbB1 PE=3 SV=1
 1991 : C8YNQ6_GADMO        0.49  0.74  144  288    3  147  145    0    0  147  C8YNQ6     Hemoglobin beta 1 OS=Gadus morhua GN=HbB1 PE=3 SV=1
 1992 : D0VWS2_9TELE3BCQ    0.49  0.79  144  285    2  144  143    1    1  146  D0VWS2     Beta-chain hemoglobin OS=Brycon cephalus PE=1 SV=1
 1993 : D4HL69_GYMAC        0.49  0.76  144  282    3  141  139    0    0  141  D4HL69     Beta globin (Fragment) OS=Gymnodraco acuticeps PE=3 SV=1
 1994 : F6KMG8_EPICO        0.49  0.76  144  288    3  147  145    0    0  147  F6KMG8     Hemoglobin beta chain OS=Epinephelus coioides PE=2 SV=1
 1995 : G3PL98_GASAC        0.49  0.72    2  141    4  144  141    1    1  144  G3PL98     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus PE=3 SV=1
 1996 : G8DP12_PLAFE        0.49  0.71    2  141    3  143  141    1    1  143  G8DP12     Alpha 1-globin OS=Platichthys flesus PE=2 SV=1
 1997 : G8DP14_PLAFE        0.49  0.76  144  288    3  148  146    1    1  148  G8DP14     Beta 1-globin OS=Platichthys flesus PE=2 SV=1
 1998 : G8DP15_PLAFE        0.49  0.76  144  288    3  148  146    1    1  148  G8DP15     Beta 2-globin OS=Platichthys flesus PE=2 SV=1
 1999 : HBA2_GOBGI          0.49  0.72    2  141    2  142  141    1    1  142  P83613     Hemoglobin subunit alpha-2 OS=Gobionotothen gibberifrons GN=hba2 PE=1 SV=1
 2000 : HBA2_TRENE          0.49  0.71    2  141    2  142  141    1    1  142  P45719     Hemoglobin subunit alpha-2 OS=Trematomus newnesi GN=hba2 PE=1 SV=1
 2001 : HBAC_ANGAN          0.49  0.76    2  141    3  143  141    1    1  143  P80726     Hemoglobin cathodic subunit alpha OS=Anguilla anguilla PE=1 SV=2
 2002 : HBA_ARTOR           0.49  0.76    2  141    3  143  141    1    1  143  P0C237     Hemoglobin subunit alpha OS=Artedidraco orianae GN=hba PE=1 SV=2
 2003 : HBA_CYPCA           0.49  0.74    2  141    3  143  141    1    1  143  P02016     Hemoglobin subunit alpha OS=Cyprinus carpio GN=hba PE=1 SV=3
 2004 : HBA_PAGBO           0.49  0.75    2  141    2  142  141    1    1  142  P82990     Hemoglobin subunit alpha OS=Pagothenia borchgrevinki GN=hba PE=1 SV=1
 2005 : HBA_POGSC           0.49  0.75    2  141    3  143  141    1    1  143  P0C238     Hemoglobin subunit alpha OS=Pogonophryne scotti GN=hba PE=1 SV=2
 2006 : HBA_SQUAC           0.49  0.70    1  141    1  141  142    2    2  141  P07408     Hemoglobin subunit alpha OS=Squalus acanthias GN=HBA PE=1 SV=1
 2007 : HBA_TREBE   1S5X    0.49  0.75    2  141    2  142  141    1    1  142  P80043     Hemoglobin subunit alpha OS=Trematomus bernacchii GN=hba PE=1 SV=1
 2008 : HBB0_PAGBO          0.49  0.74  144  288    2  146  145    0    0  146  P82345     Hemoglobin subunit beta-0 OS=Pagothenia borchgrevinki GN=hbb0 PE=1 SV=1
 2009 : HBB1_PSEUR          0.49  0.75  145  288    3  146  144    0    0  146  P83624     Hemoglobin subunit beta-1 OS=Pseudaphritis urvillii GN=hbb1 PE=1 SV=1
 2010 : HBB1_TRICR          0.49  0.77  145  288    2  145  144    0    0  145  P10785     Hemoglobin subunit beta-1 OS=Triturus cristatus GN=HBB1 PE=1 SV=1
 2011 : HBBA_ANGAN          0.49  0.77  144  288    2  147  146    1    1  147  P80946     Hemoglobin anodic subunit beta OS=Anguilla anguilla GN=hbb1 PE=1 SV=1
 2012 : HBBA_GYMUN          0.49  0.79  144  288    2  147  146    1    1  147  P84206     Hemoglobin anodic subunit beta OS=Gymnothorax unicolor PE=1 SV=1
 2013 : HBBC_TREBE          0.49  0.74  144  288    2  146  145    0    0  146  P45722     Hemoglobin subunit beta-C OS=Trematomus bernacchii GN=hbbc PE=1 SV=1
 2014 : HBB_CAICR           0.49  0.79  143  288    1  146  146    0    0  146  P02131     Hemoglobin subunit beta OS=Caiman crocodilus GN=HBB PE=1 SV=1
 2015 : HBB_ELEEL           0.49  0.79  144  288    2  147  146    1    1  147  P14521     Hemoglobin subunit beta OS=Electrophorus electricus GN=hbb PE=1 SV=1
 2016 : HBB_GYMAC           0.49  0.76  144  288    3  147  145    0    0  147  P29625     Hemoglobin subunit beta OS=Gymnodraco acuticeps GN=hbb PE=1 SV=2
 2017 : I3IZ27_ORENI        0.49  0.80  144  288    3  148  146    1    1  148  I3IZ27     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100704059 PE=3 SV=1
 2018 : I3IZ54_ORENI        0.49  0.78  145  287    4  146  143    0    0  147  I3IZ54     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100704503 PE=3 SV=1
 2019 : J3SDZ6_CROAD        0.49  0.76    1  141    2  142  141    0    0  142  J3SDZ6     Alpha globin OS=Crotalus adamanteus PE=2 SV=1
 2020 : M4A8Z9_XIPMA        0.49  0.78  144  288    3  148  146    1    1  148  M4A8Z9     Uncharacterized protein OS=Xiphophorus maculatus PE=3 SV=1
 2021 : M4ASG7_XIPMA        0.49  0.76    1  141    1  141  141    0    0  141  M4ASG7     Uncharacterized protein OS=Xiphophorus maculatus GN=HBM PE=3 SV=1
 2022 : M9T2B5_CYPCA        0.49  0.75    2  141    3  143  141    1    1  143  M9T2B5     Hemoglobin alpha OS=Cyprinus carpio PE=4 SV=1
 2023 : M9V0L3_CYPCA        0.49  0.75    2  141    3  143  141    1    1  143  M9V0L3     Hemoglobin alpha OS=Cyprinus carpio PE=4 SV=1
 2024 : O13139_CYPCA        0.49  0.76    2  141    3  143  141    1    1  143  O13139     Alpha-globin OS=Cyprinus carpio GN=No.7 alpha PE=3 SV=1
 2025 : Q2KKV1_SINCH        0.49  0.77  144  286    3  146  144    1    1  146  Q2KKV1     Hemoglobin beta-A chain (Fragment) OS=Siniperca chuatsi PE=2 SV=1
 2026 : Q4RHD1_TETNG        0.49  0.70    2  141    4  144  141    1    1  144  Q4RHD1     Chromosome 3 SCAF15050, whole genome shotgun sequence OS=Tetraodon nigroviridis GN=GSTENG00034399001 PE=3 SV=1
 2027 : Q5I122_SCIOC        0.49  0.77  144  288    3  148  146    1    1  148  Q5I122     Hemoglobin beta chain OS=Sciaenops ocellatus PE=2 SV=1
 2028 : Q5RM02_LARCR        0.49  0.75    2  141    3  144  142    1    2  144  Q5RM02     Alpha1 hemoglobin OS=Larimichthys crocea PE=2 SV=2
 2029 : Q7LZM8_9PERC        0.49  0.73    2  141    2  143  142    2    2  143  Q7LZM8     Hemoglobin alpha chain OS=Bathydraco marri PE=3 SV=1
 2030 : Q7ZT21_DANRE        0.49  0.77    2  141    3  143  141    1    1  143  Q7ZT21     Embryonic alpha globin e1 OS=Danio rerio GN=hbae1 PE=2 SV=1
 2031 : Q7ZT83_9SAUR        0.49  0.76    1  141    2  142  141    0    0  142  Q7ZT83     Alpha globin OS=Leioselasma melanocephala GN=HBA PE=3 SV=1
 2032 : Q8AYQ4_ORYLA        0.49  0.77    2  141    3  143  141    1    1  143  Q8AYQ4     Alpha-type globin OS=Oryzias latipes GN=Gb-alpha4 PE=3 SV=1
 2033 : Q8JH81_MISAN        0.49  0.79  144  288    2  147  146    1    1  147  Q8JH81     Beta globin (Fragment) OS=Misgurnus anguillicaudatus PE=2 SV=1
 2034 : Q98UB9_9PERC        0.49  0.75  144  288    3  147  145    0    0  147  Q98UB9     BetaNCP1 OS=Notothenia coriiceps GN=betaNCPI PE=3 SV=1
 2035 : Q9YGF6_ONCMY        0.49  0.70    2  141    3  143  142    3    3  143  Q9YGF6     Embryonic alpha-type globin2 OS=Oncorhynchus mykiss PE=2 SV=1
 2036 : Q9YGF7_ONCMY        0.49  0.71    2  141    3  143  142    3    3  143  Q9YGF7     Embryonic alpha-type globin OS=Oncorhynchus mykiss PE=2 SV=1
 2037 : A0EZW7_PSEMX        0.48  0.74  144  288    3  147  145    0    0  147  A0EZW7     Beta-type globin OS=Psetta maxima PE=2 SV=1
 2038 : A8KBN4_DANRE        0.48  0.77    2  141    3  143  141    1    1  143  A8KBN4     Hbae1 protein OS=Danio rerio GN=hbae1 PE=2 SV=1
 2039 : A9JTR0_XENTR        0.48  0.77    2  141    3  143  141    1    1  143  A9JTR0     LOC100127827 protein OS=Xenopus tropicalis GN=LOC100127827 PE=2 SV=1
 2040 : A9YVA1_ONCMA        0.48  0.72    2  141    3  143  141    1    1  143  A9YVA1     Alpha-globin I OS=Oncorhynchus masou formosanus GN=hbaa1 PE=2 SV=1
 2041 : B3F9D4_GADMO        0.48  0.75  144  288    3  147  145    0    0  147  B3F9D4     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2042 : B3F9D7_GADMO        0.48  0.75  144  288    3  147  145    0    0  147  B3F9D7     Hemoglobin beta 4 OS=Gadus morhua GN=HbB4 PE=2 SV=1
 2043 : B3F9E0_GADMO        0.48  0.75  144  288    3  147  145    0    0  147  B3F9E0     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2044 : B3F9F2_GADMO        0.48  0.75  144  288    3  147  145    0    0  147  B3F9F2     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2045 : B3F9H3_GADMO        0.48  0.75  144  288    3  147  145    0    0  147  B3F9H3     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2046 : B3F9I7_GADMO        0.48  0.74    2  141    3  143  141    1    1  143  B3F9I7     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2047 : B3F9I8_GADMO        0.48  0.76  144  288    3  147  145    0    0  147  B3F9I8     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2048 : B3F9J4_GADMO        0.48  0.75  144  288    3  147  145    0    0  147  B3F9J4     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2049 : B3F9L5_GADMO        0.48  0.75  144  288    3  147  145    0    0  147  B3F9L5     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2050 : B3F9N0_GADMO        0.48  0.74  144  288    3  147  145    0    0  147  B3F9N0     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2051 : B3F9P2_GADMO        0.48  0.74  144  288    3  147  145    0    0  147  B3F9P2     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2052 : B3F9R6_GADMO        0.48  0.75  144  288    3  147  145    0    0  147  B3F9R6     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2053 : B3F9S2_GADMO        0.48  0.75  144  288    3  147  145    0    0  147  B3F9S2     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2054 : B3F9T7_GADMO        0.48  0.76  144  288    3  147  145    0    0  147  B3F9T7     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2055 : B3F9U0_GADMO        0.48  0.76  144  288    3  147  145    0    0  147  B3F9U0     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2056 : B3F9U3_GADMO        0.48  0.75  144  288    3  147  145    0    0  147  B3F9U3     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2057 : B8XJS7_GADMO        0.48  0.74  144  288    3  147  145    0    0  147  B8XJS7     Hemoglobin beta 2 OS=Gadus morhua GN=HbB2 PE=2 SV=1
 2058 : C1BIC4_ONCMY        0.48  0.73    2  141    3  143  141    1    1  143  C1BIC4     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 2059 : C1BLE4_OSMMO        0.48  0.77  144  288    3  147  145    0    0  147  C1BLE4     Hemoglobin subunit beta-2 OS=Osmerus mordax GN=HBB2 PE=2 SV=1
 2060 : C8YNR1_GADMO        0.48  0.74  144  288    3  147  145    0    0  147  C8YNR1     Hemoglobin beta 3 OS=Gadus morhua GN=HbB3 PE=3 SV=1
 2061 : C8YNR3_GADMO        0.48  0.75  144  288    3  147  145    0    0  147  C8YNR3     Hemoglobin beta 3 OS=Gadus morhua GN=HbB3 PE=3 SV=1
 2062 : G3PNE8_GASAC        0.48  0.73    2  141    3  143  141    1    1  143  G3PNE8     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 2063 : H2TTY0_TAKRU        0.48  0.70    2  141    4  144  141    1    1  144  H2TTY0     Uncharacterized protein OS=Takifugu rubripes GN=LOC101073868 PE=3 SV=1
 2064 : H2TTY1_TAKRU        0.48  0.70    2  141    4  144  141    1    1  144  H2TTY1     Uncharacterized protein OS=Takifugu rubripes GN=LOC101073868 PE=3 SV=1
 2065 : HBA1_ARCGL          0.48  0.73    2  141    3  143  141    1    1  143  Q1AGS5     Hemoglobin subunit alpha-1 OS=Arctogadus glacialis GN=hba1 PE=1 SV=3
 2066 : HBA1_BORSA          0.48  0.72    2  141    3  143  141    1    1  143  Q1AGS9     Hemoglobin subunit alpha-1 OS=Boreogadus saida GN=hba1 PE=1 SV=3
 2067 : HBA1_GADMO          0.48  0.71    2  141    3  143  141    1    1  143  P84609     Hemoglobin subunit alpha-1 OS=Gadus morhua GN=hba1 PE=1 SV=2
 2068 : HBA1_GOBGI          0.48  0.75    2  141    2  142  141    1    1  142  P83611     Hemoglobin subunit alpha-1 OS=Gobionotothen gibberifrons GN=hba1 PE=1 SV=1
 2069 : HBA1_NOTCO          0.48  0.75    2  141    2  142  141    1    1  142  P10777     Hemoglobin subunit alpha-1 OS=Notothenia coriiceps neglecta GN=hba1 PE=1 SV=1
 2070 : HBA1_TRENE  1T1N    0.48  0.74    2  141    2  142  141    1    1  142  P45718     Hemoglobin subunit alpha-1 OS=Trematomus newnesi GN=hba1 PE=1 SV=1
 2071 : HBA2_ARCGL          0.48  0.71    2  141    3  143  141    1    1  143  Q1AGS4     Hemoglobin subunit alpha-2 OS=Arctogadus glacialis GN=hba2 PE=1 SV=3
 2072 : HBA2_BORSA          0.48  0.70    2  141    3  143  141    1    1  143  Q1AGS8     Hemoglobin subunit alpha-2 OS=Boreogadus saida GN=hba2 PE=1 SV=3
 2073 : HBA2_NOTAN          0.48  0.70    2  141    2  141  141    2    2  141  P62363     Hemoglobin subunit alpha-2 OS=Notothenia angustata GN=hba2 PE=1 SV=1
 2074 : HBA2_NOTCO          0.48  0.70    2  141    2  141  141    2    2  141  P62387     Hemoglobin subunit alpha-2 OS=Notothenia coriiceps neglecta GN=hba2 PE=1 SV=1
 2075 : HBAA_SERQU          0.48  0.74    2  141    3  143  141    1    1  143  Q9PVM4     Hemoglobin subunit alpha-A OS=Seriola quinqueradiata GN=hbaa PE=2 SV=3
 2076 : HBAB_SERQU          0.48  0.73    2  141    3  144  142    1    2  144  Q9PVM3     Hemoglobin subunit alpha-B OS=Seriola quinqueradiata GN=hbab PE=2 SV=3
 2077 : HBA_CYGMA           0.48  0.74    2  141    2  142  141    1    1  142  P23016     Hemoglobin subunit alpha OS=Cygnodraco mawsoni GN=hba PE=1 SV=1
 2078 : HBB1_ANAMI          0.48  0.76  144  287    2  145  144    0    0  146  P83272     Hemoglobin subunit beta-1 OS=Anarhichas minor GN=hbb1 PE=1 SV=1
 2079 : HBB1_GADMO          0.48  0.75  144  288    3  147  145    0    0  147  P84610     Hemoglobin subunit beta-1 OS=Gadus morhua GN=hbb1 PE=1 SV=2
 2080 : HBB1_XENTR          0.48  0.70  144  288    3  147  145    0    0  147  P07429     Hemoglobin subunit beta-1 OS=Xenopus tropicalis GN=hbb1 PE=2 SV=2
 2081 : HBB2_ARCGL          0.48  0.74  144  288    3  147  145    0    0  147  P84604     Hemoglobin subunit beta-2 OS=Arctogadus glacialis GN=hbb2 PE=1 SV=2
 2082 : HBBC_TRENE  2AA1    0.48  0.74  144  288    2  146  145    0    0  146  P45721     Hemoglobin subunit beta-C OS=Trematomus newnesi PE=1 SV=1
 2083 : HBB_MERMR           0.48  0.75  144  288    3  147  145    0    0  147  O13078     Hemoglobin subunit beta OS=Merlangius merlangus GN=hbb PE=2 SV=2
 2084 : HBB_NOTAN           0.48  0.75  144  288    2  146  145    0    0  146  P29628     Hemoglobin subunit beta OS=Notothenia angustata GN=hbb PE=1 SV=1
 2085 : HBB_POGSC           0.48  0.77  144  288    2  146  145    0    0  146  P0C240     Hemoglobin subunit beta OS=Pogonophryne scotti GN=hbb PE=1 SV=1
 2086 : I3IYZ1_ORENI        0.48  0.78  144  288    3  147  146    2    2  147  I3IYZ1     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100701987 PE=3 SV=1
 2087 : I3IZ43_ORENI        0.48  0.76    2  141    3  143  141    1    1  143  I3IZ43     Uncharacterized protein OS=Oreochromis niloticus PE=3 SV=1
 2088 : I3KUU9_ORENI        0.48  0.74    2  141    4  144  141    1    1  144  I3KUU9     Uncharacterized protein (Fragment) OS=Oreochromis niloticus GN=LOC100704125 PE=3 SV=1
 2089 : M3ZD78_XIPMA        0.48  0.71    2  141    4  145  142    2    2  145  M3ZD78     Uncharacterized protein (Fragment) OS=Xiphophorus maculatus PE=3 SV=1
 2090 : M9T9S9_CYPCA        0.48  0.74    2  141    3  143  141    1    1  143  M9T9S9     Hemoglobin alpha OS=Cyprinus carpio PE=4 SV=1
 2091 : Q071L7_PARCR        0.48  0.74    2  141    3  143  141    1    1  143  Q071L7     Alpha globin (Fragment) OS=Parachaenichthys charcoti PE=3 SV=1
 2092 : Q0VHB0_TRENE        0.48  0.74    2  141    3  143  141    1    1  143  Q0VHB0     Alpha 1/C globin OS=Trematomus newnesi GN=alpha I PE=2 SV=1
 2093 : Q4S4F1_TETNG        0.48  0.74    2  141    3  143  141    1    1  143  Q4S4F1     Chromosome 2 SCAF14738, whole genome shotgun sequence OS=Tetraodon nigroviridis GN=GSTENG00024202001 PE=3 SV=1
 2094 : Q5EEZ5_9PERC        0.48  0.74    2  139    3  143  141    1    3  143  Q5EEZ5     Hemoglobin alpha chain (Fragment) OS=Channa argus PE=2 SV=1
 2095 : Q6T497_HIPCM        0.48  0.72    2  141    4  144  141    1    1  144  Q6T497     Hemoglobin alpha chain OS=Hippocampus comes PE=2 SV=1
 2096 : Q6Y257_PAGMA        0.48  0.71    2  141    3  143  141    1    1  143  Q6Y257     Alpha hemoglobin A OS=Pagrus major PE=2 SV=1
 2097 : Q7ZT84_ELACL        0.48  0.74    1  141    2  142  141    0    0  142  Q7ZT84     Alpha globin OS=Elaphe climacophora GN=HBA PE=2 SV=1
 2098 : Q7ZT85_NAJKA        0.48  0.75    1  141    2  142  141    0    0  142  Q7ZT85     Alpha globin OS=Naja kaouthia GN=HBA PE=2 SV=1
 2099 : Q802A3_TAKRU        0.48  0.75  144  288    3  147  145    0    0  147  Q802A3     Hemoglobin beta subunit OS=Takifugu rubripes GN=HBB PE=3 SV=1
 2100 : Q802A4_TAKRU        0.48  0.72    2  141    3  143  141    1    1  143  Q802A4     Hemoglobin alpha 3 subunit OS=Takifugu rubripes GN=HBA3 PE=3 SV=1
 2101 : Q8AYQ0_ORYLA        0.48  0.74    1  141    1  141  141    0    0  141  Q8AYQ0     Alpha-type globin OS=Oryzias latipes GN=Gb PE=3 SV=1
 2102 : Q8JH83_MISAN        0.48  0.76    2  141    3  143  141    1    1  143  Q8JH83     Alpha globin (Fragment) OS=Misgurnus anguillicaudatus PE=2 SV=1
 2103 : Q8UV18_9PERC        0.48  0.74    2  141    3  143  141    1    1  143  Q8UV18     HBA2 (Fragment) OS=Sphoeroides nephelus GN=HBA2 PE=3 SV=1
 2104 : Q90ZM4_EPICO        0.48  0.76  144  288    3  147  145    0    0  147  Q90ZM4     Hemoglobin beta chain OS=Epinephelus coioides PE=2 SV=1
 2105 : Q9IAJ9_NOTAN        0.48  0.75  144  288    3  147  145    0    0  147  Q9IAJ9     Beta globin OS=Notothenia angustata PE=3 SV=1
 2106 : B2LVG9_LATJA        0.47  0.71    2  141    4  144  141    1    1  144  B2LVG9     Head-kidney alpha-type globin OS=Lateolabrax japonicus PE=2 SV=1
 2107 : B3F9D9_GADMO        0.47  0.73    2  141    3  143  141    1    1  143  B3F9D9     Hemoglobin alpha 2 OS=Gadus morhua GN=HbA2 PE=2 SV=1
 2108 : B3F9E5_GADMO        0.47  0.74    2  141    3  143  141    1    1  143  B3F9E5     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2109 : B3F9G3_GADMO        0.47  0.73    2  141    3  143  141    1    1  143  B3F9G3     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2110 : B3F9G6_GADMO        0.47  0.73    2  141    3  143  141    1    1  143  B3F9G6     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2111 : B3F9H2_GADMO        0.47  0.73    2  141    3  143  141    1    1  143  B3F9H2     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2112 : B3F9I2_GADMO        0.47  0.74  144  288    3  147  145    0    0  147  B3F9I2     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2113 : B3F9N5_GADMO        0.47  0.73    2  141    3  143  141    1    1  143  B3F9N5     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2114 : B3F9S7_GADMO        0.47  0.72    2  141    3  143  141    1    1  143  B3F9S7     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2115 : B3F9T0_GADMO        0.47  0.73    2  141    3  143  141    1    1  143  B3F9T0     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2116 : B8XJS8_GADMO        0.47  0.74  144  288    3  147  145    0    0  147  B8XJS8     Hemoglobin beta 3 chain OS=Gadus morhua PE=2 SV=1
 2117 : C1BLI3_OSMMO        0.47  0.77  144  288    3  147  145    0    0  147  C1BLI3     Hemoglobin subunit beta OS=Osmerus mordax GN=HBB PE=2 SV=1
 2118 : D4HL67_9PERC        0.47  0.77  144  282    3  141  139    0    0  141  D4HL67     Beta globin (Fragment) OS=Gerlachea australis PE=3 SV=1
 2119 : F1RGX5_PIG          0.47  0.75    1  141    1  141  141    0    0  141  F1RGX5     Uncharacterized protein OS=Sus scrofa GN=LOC100737727 PE=3 SV=1
 2120 : H2LCU1_ORYLA        0.47  0.74    1  141    1  141  141    0    0  141  H2LCU1     Uncharacterized protein OS=Oryzias latipes GN=LOC101170468 PE=3 SV=1
 2121 : HBA2_GADMO          0.47  0.72    2  141    3  143  141    1    1  143  O42425     Hemoglobin subunit alpha-2 OS=Gadus morhua GN=hba2 PE=1 SV=3
 2122 : HBAA_GYMUN          0.47  0.75    2  141    2  142  141    1    1  142  P84205     Hemoglobin anodic subunit alpha OS=Gymnothorax unicolor PE=1 SV=1
 2123 : HBA_GYMAC           0.47  0.71    2  141    2  142  141    1    1  142  P29623     Hemoglobin subunit alpha OS=Gymnodraco acuticeps GN=hba PE=1 SV=1
 2124 : HBA_LEIXA   1SPG    0.47  0.75    2  141    2  143  142    1    2  143  P56250     Hemoglobin subunit alpha OS=Leiostomus xanthurus GN=hba PE=1 SV=1
 2125 : HBB1_GOBGI          0.47  0.76  144  288    2  146  145    0    0  146  P83612     Hemoglobin subunit beta-1 OS=Gobionotothen gibberifrons GN=hbb1 PE=1 SV=1
 2126 : HBB1_LYCRE          0.47  0.73  144  287    2  145  144    0    0  146  P86879     Hemoglobin subunit beta-1 OS=Lycodes reticulatus GN=hbb1 PE=1 SV=1
 2127 : HBB2_GADMO          0.47  0.74  144  288    3  147  145    0    0  147  P84611     Hemoglobin subunit beta-2 OS=Gadus morhua GN=hbb2 PE=1 SV=2
 2128 : HBB2_LYCRE          0.47  0.72  144  287    2  145  144    0    0  146  P86887     Hemoglobin subunit beta-2 OS=Lycodes reticulatus GN=hbb2 PE=1 SV=1
 2129 : HBB2_TRICR          0.47  0.73  144  287    2  145  144    0    0  145  P10786     Hemoglobin subunit beta-2 OS=Triturus cristatus GN=HBB2 PE=1 SV=1
 2130 : HBB_GADMO           0.47  0.72  144  288    3  147  145    0    0  147  O13077     Hemoglobin subunit beta OS=Gadus morhua GN=hbb PE=2 SV=2
 2131 : HBB_LEIXA   1SPG    0.47  0.77  144  288    2  147  146    1    1  147  P56251     Hemoglobin subunit beta OS=Leiostomus xanthurus GN=hbb PE=1 SV=1
 2132 : HBB_LEPPA           0.47  0.77  144  288    2  147  146    1    1  147  P02138     Hemoglobin subunit beta OS=Lepidosiren paradoxus GN=HBB PE=1 SV=1
 2133 : HBB_MELAE           0.47  0.75  144  288    3  147  145    0    0  147  O09232     Hemoglobin subunit beta OS=Melanogrammus aeglefinus GN=hbb PE=2 SV=2
 2134 : HBB_ONCNE           0.47  0.76  144  288    3  148  146    1    1  148  Q98TS0     Hemoglobin subunit beta OS=Oncorhynchus nerka GN=hbb PE=2 SV=3
 2135 : I3IZ10_ORENI        0.47  0.76  145  287   15  157  143    0    0  158  I3IZ10     Uncharacterized protein (Fragment) OS=Oreochromis niloticus GN=LOC100703792 PE=3 SV=1
 2136 : I6LJZ4_9PERC        0.47  0.73  144  282    3  141  139    0    0  141  I6LJZ4     Beta globin (Fragment) OS=Parachaenichthys georgianus PE=3 SV=1
 2137 : K7GQP8_PIG          0.47  0.65    2  141    9  122  141    6   28  122  K7GQP8     Uncharacterized protein (Fragment) OS=Sus scrofa GN=LOC100737768 PE=3 SV=1
 2138 : M9MQI1_9PERC        0.47  0.76  145  282    4  141  138    0    0  141  M9MQI1     Beta globin (Fragment) OS=Bathydraco scotiae PE=4 SV=1
 2139 : O13135_CYPCA        0.47  0.74    2  141    3  143  141    1    1  143  O13135     Alpha-globin OS=Cyprinus carpio GN=No.1 alpha PE=3 SV=1
 2140 : O13138_CYPCA        0.47  0.74    2  141    3  143  141    1    1  143  O13138     Alpha-globin OS=Cyprinus carpio GN=No.6 alpha PE=3 SV=1
 2141 : Q071L8_PARCR        0.47  0.73  144  282    3  141  139    0    0  141  Q071L8     Beta globin (Fragment) OS=Parachaenichthys charcoti PE=3 SV=1
 2142 : Q19LH2_SPAAU        0.47  0.74    2  141    3  143  141    1    1  143  Q19LH2     Alpha-2 globin OS=Sparus aurata PE=3 SV=1
 2143 : Q19LH3_SPAAU        0.47  0.73    2  141    3  144  142    1    2  144  Q19LH3     Alpha-1 globin OS=Sparus aurata PE=3 SV=1
 2144 : Q4F6Z2_SCIOC        0.47  0.77  144  288    3  148  146    1    1  148  Q4F6Z2     Hemoglobin beta B chain OS=Sciaenops ocellatus PE=2 SV=1
 2145 : Q5MD69_LARCR        0.47  0.75  144  288    3  148  146    1    1  148  Q5MD69     Beta hemoglobin OS=Larimichthys crocea PE=2 SV=1
 2146 : Q6F3D1_AMBME        0.47  0.72  144  288    3  147  145    0    0  147  Q6F3D1     Beta globin chain OS=Ambystoma mexicanum GN=Hb-b PE=2 SV=1
 2147 : Q7LZL6_9PERC        0.47  0.77  144  288    2  146  145    0    0  146  Q7LZL6     Hemoglobin beta chain OS=Bathydraco marri PE=3 SV=1
 2148 : Q8AYQ5_ORYLA        0.47  0.76  144  287    3  146  144    0    0  147  Q8AYQ5     Beta-type globin OS=Oryzias latipes GN=Gb-beta4 PE=3 SV=1
 2149 : Q8UW92_CYPCA        0.47  0.75    2  141    3  144  142    2    2  144  Q8UW92     Alpha globin type-3 OS=Cyprinus carpio PE=3 SV=1
 2150 : A3KP86_DANRE        0.46  0.78    1  141    1  141  141    0    0  141  A3KP86     Uncharacterized protein OS=Danio rerio GN=zgc:163057 PE=2 SV=1
 2151 : B1MT34_CALMO        0.46  0.74    1  141    1  141  141    0    0  141  B1MT34     Hemoglobin mu chain (Predicted) OS=Callicebus moloch GN=HBM PE=3 SV=1
 2152 : B3F9D6_GADMO        0.46  0.72    2  141    3  143  141    1    1  143  B3F9D6     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2153 : B3F9E2_GADMO        0.46  0.72    2  141    3  143  141    1    1  143  B3F9E2     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2154 : B3F9E8_GADMO        0.46  0.72    2  141    3  143  141    1    1  143  B3F9E8     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2155 : B3F9F7_GADMO        0.46  0.72    2  141    3  143  141    1    1  143  B3F9F7     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2156 : B3F9G0_GADMO        0.46  0.72    2  141    3  143  141    1    1  143  B3F9G0     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2157 : B3F9H5_GADMO        0.46  0.73    2  141    3  143  141    1    1  143  B3F9H5     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2158 : B3F9I1_GADMO        0.46  0.72    2  141    3  143  141    1    1  143  B3F9I1     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2159 : B3F9I4_GADMO        0.46  0.72    2  141    3  143  141    1    1  143  B3F9I4     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2160 : B3F9J9_GADMO        0.46  0.73    2  141    3  143  141    1    1  143  B3F9J9     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2161 : B3F9M4_GADMO        0.46  0.74  144  288    3  147  145    0    0  147  B3F9M4     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2162 : B3F9M6_GADMO        0.46  0.73    2  141    3  143  141    1    1  143  B3F9M6     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2163 : B3F9N2_GADMO        0.46  0.73    2  141    3  143  141    1    1  143  B3F9N2     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2164 : B3F9Q0_GADMO        0.46  0.73    2  141    3  143  141    1    1  143  B3F9Q0     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 2165 : C1BEM6_ONCMY        0.46  0.76  144  288    3  148  146    1    1  148  C1BEM6     Hemoglobin subunit beta OS=Oncorhynchus mykiss GN=HBB PE=2 SV=1
 2166 : C1BEX3_ONCMY        0.46  0.77  144  288    3  148  146    1    1  148  C1BEX3     Hemoglobin subunit beta-4 OS=Oncorhynchus mykiss GN=HBB4 PE=2 SV=1
 2167 : C1BFL6_ONCMY        0.46  0.75  144  288    3  148  146    1    1  148  C1BFL6     Hemoglobin subunit beta-4 OS=Oncorhynchus mykiss GN=HBB4 PE=2 SV=1
 2168 : C1BG64_ONCMY        0.46  0.76  144  288    3  148  146    1    1  148  C1BG64     Hemoglobin subunit beta-4 OS=Oncorhynchus mykiss GN=HBB4 PE=2 SV=1
 2169 : C1BG67_ONCMY        0.46  0.77  144  288    3  148  146    1    1  148  C1BG67     Hemoglobin subunit beta-4 OS=Oncorhynchus mykiss GN=HBB4 PE=2 SV=1
 2170 : C8YNR8_GADMO        0.46  0.74  144  288    3  147  145    0    0  147  C8YNR8     Hemoglobin beta 5 OS=Gadus morhua GN=HbB5 PE=3 SV=1
 2171 : D4HL68_CYGMA        0.46  0.73  144  282    3  141  139    0    0  141  D4HL68     Beta globin (Fragment) OS=Cygnodraco mawsoni PE=3 SV=1
 2172 : D4HL70_9PERC        0.46  0.75  144  282    3  141  139    0    0  141  D4HL70     Beta globin (Fragment) OS=Prionodraco evansii PE=3 SV=1
 2173 : D6PVN3_EPICO        0.46  0.77  144  288    3  147  145    0    0  147  D6PVN3     Hemoglobin subunit beta-2 OS=Epinephelus coioides PE=2 SV=1
 2174 : H2LKN8_ORYLA        0.46  0.76  144  288    3  147  145    0    0  147  H2LKN8     Uncharacterized protein OS=Oryzias latipes GN=LOC101154779 PE=3 SV=1
 2175 : H3A6U9_LATCH        0.46  0.75  144  288  149  304  156    1   11  304  H3A6U9     Uncharacterized protein OS=Latimeria chalumnae PE=3 SV=1
 2176 : H3D5V2_TETNG        0.46  0.70  145  288    4  143  144    1    4  143  H3D5V2     Uncharacterized protein OS=Tetraodon nigroviridis GN=HBG1 PE=3 SV=1
 2177 : HBA1_TORMA          0.46  0.65    1  141    1  141  142    2    2  141  P20244     Hemoglobin subunit alpha-1 OS=Torpedo marmorata PE=1 SV=1
 2178 : HBA_BATEA           0.46  0.65    1  141    2  142  142    2    2  142  P84216     Hemoglobin subunit alpha OS=Bathyraja eatonii GN=HBA PE=1 SV=2
 2179 : HBB1_CYGMA          0.46  0.74  144  288    3  147  145    0    0  147  P23017     Hemoglobin subunit beta-1 OS=Cygnodraco mawsoni GN=hbb1 PE=1 SV=2
 2180 : HBB1_LIPTU          0.46  0.75  144  288    3  147  145    0    0  147  P85082     Hemoglobin subunit beta-1 OS=Liparis tunicatus GN=hbb1 PE=1 SV=1
 2181 : HBB1_PAGBO          0.46  0.77  144  288    3  147  145    0    0  147  O93348     Hemoglobin subunit beta-1 OS=Pagothenia borchgrevinki GN=hbb1 PE=1 SV=3
 2182 : HBB3_MURHE          0.46  0.76  144  288    2  147  146    1    1  147  Q7LZC1     Hemoglobin subunit beta-3 OS=Muraena helena GN=hbb3 PE=1 SV=1
 2183 : HBB4_ONCMY  2R1H    0.46  0.77  144  288    3  148  146    1    1  148  P02141     Hemoglobin subunit beta-4 OS=Oncorhynchus mykiss GN=hbb4 PE=1 SV=3
 2184 : HBB_ARTOR           0.46  0.76  144  288    2  146  145    0    0  146  P0C239     Hemoglobin subunit beta OS=Artedidraco orianae GN=hbb PE=1 SV=1
 2185 : HBB_CHEKU           0.46  0.73  144  288    2  146  145    0    0  146  P80271     Hemoglobin subunit beta OS=Chelidonichthys kumu GN=hbb PE=1 SV=1
 2186 : HBB_NOTCO           0.46  0.74  144  288    2  146  145    0    0  146  P16309     Hemoglobin subunit beta OS=Notothenia coriiceps neglecta GN=hbb PE=1 SV=1
 2187 : HBB_TREBE   1S5X    0.46  0.75  144  288    3  147  145    0    0  147  P80044     Hemoglobin subunit beta OS=Trematomus bernacchii GN=hbb PE=1 SV=2
 2188 : HBB_TREHA           0.46  0.76  144  288    3  147  145    0    0  147  O93351     Hemoglobin subunit beta OS=Trematomus hansoni GN=hbb PE=2 SV=3
 2189 : J9NVU7_CANFA        0.46  0.74    1  141    1  141  141    0    0  141  J9NVU7     Uncharacterized protein OS=Canis familiaris GN=HBM PE=3 SV=1
 2190 : M3ZD71_XIPMA        0.46  0.76  144  288    3  147  145    0    0  147  M3ZD71     Uncharacterized protein OS=Xiphophorus maculatus PE=3 SV=1
 2191 : M3ZD90_XIPMA        0.46  0.70    2  140    3  144  142    2    3  145  M3ZD90     Uncharacterized protein OS=Xiphophorus maculatus PE=3 SV=1
 2192 : M9MQI0_9PERC        0.46  0.76  144  282    3  141  139    0    0  141  M9MQI0     Beta globin (Fragment) OS=Bathydraco antarcticus PE=4 SV=1
 2193 : M9MQI2_9PERC        0.46  0.76  144  282    3  141  139    0    0  141  M9MQI2     Beta globin (Fragment) OS=Bathydraco marri PE=4 SV=1
 2194 : Q071L6_PARCR        0.46  0.73  144  282    3  141  139    0    0  141  Q071L6     Beta globin (Fragment) OS=Parachaenichthys charcoti PE=3 SV=1
 2195 : Q3Y9L5_9PERO        0.46  0.75    2  141    3  144  142    1    2  144  Q3Y9L5     Hemoglobin alpha chain OS=Nibea miichthioides PE=2 SV=1
 2196 : Q3Y9L6_9PERO        0.46  0.77  144  288    3  148  146    1    1  148  Q3Y9L6     Hemoglobin beta chain OS=Nibea miichthioides PE=2 SV=1
 2197 : Q4JDG4_BATEA        0.46  0.65    1  141    2  142  142    2    2  142  Q4JDG4     Alpha 1 globin OS=Bathyraja eatonii PE=2 SV=1
 2198 : Q58L97_SCIOC        0.46  0.74    2  141    3  144  142    1    2  144  Q58L97     Hemoglobin alpha chain OS=Sciaenops ocellatus PE=2 SV=1
 2199 : Q8JH91_CYPCA        0.46  0.74    2  141    3  143  141    1    1  143  Q8JH91     Alpha globin (Fragment) OS=Cyprinus carpio PE=2 SV=1
 2200 : Q91129_9PERC        0.46  0.75  144  288    3  147  145    0    0  147  Q91129     Beta globin OS=Notothenia coriiceps PE=2 SV=1
 2201 : A9YVA2_ONCMA        0.45  0.77  144  288    3  148  146    1    1  148  A9YVA2     Beta-globin OS=Oncorhynchus masou formosanus PE=2 SV=1
 2202 : B0VX77_CALJA        0.45  0.74    1  141    1  141  141    0    0  141  B0VX77     Hemoglobin mu chain (Predicted) OS=Callithrix jacchus GN=HBM PE=3 SV=1
 2203 : B5X681_SALSA        0.45  0.72    1  141    1  141  141    0    0  141  B5X681     Hemoglobin subunit alpha-D OS=Salmo salar GN=HBAD PE=2 SV=1
 2204 : B5X6T6_SALSA        0.45  0.72    1  141    1  141  141    0    0  141  B5X6T6     Hemoglobin subunit alpha-D OS=Salmo salar GN=HBAD PE=2 SV=1
 2205 : B5X810_SALSA        0.45  0.77  144  288    3  148  146    1    1  148  B5X810     Hemoglobin subunit beta OS=Salmo salar GN=HBB PE=2 SV=1
 2206 : B5X8L0_SALSA        0.45  0.77  144  288    3  148  146    1    1  148  B5X8L0     Hemoglobin subunit beta OS=Salmo salar GN=HBB PE=2 SV=1
 2207 : B5XBX3_SALSA        0.45  0.77  144  288    3  148  146    1    1  148  B5XBX3     Hemoglobin subunit beta OS=Salmo salar GN=HBB PE=2 SV=1
 2208 : B5XD42_SALSA        0.45  0.77  144  288    3  148  146    1    1  148  B5XD42     Hemoglobin subunit beta OS=Salmo salar GN=HBB PE=2 SV=1
 2209 : B9EMG4_SALSA        0.45  0.77  144  288    3  148  146    1    1  148  B9EMG4     Hemoglobin subunit beta OS=Salmo salar GN=HBB PE=2 SV=1
 2210 : B9EMX5_SALSA        0.45  0.77  144  288    3  148  146    1    1  148  B9EMX5     Hemoglobin subunit beta OS=Salmo salar GN=HBB PE=2 SV=1
 2211 : C1BEM8_ONCMY        0.45  0.72    1  141    1  141  141    0    0  141  C1BEM8     Hemoglobin subunit alpha-D OS=Oncorhynchus mykiss GN=HBAD PE=2 SV=1
 2212 : C1BF45_ONCMY        0.45  0.75  144  288    3  148  146    1    1  148  C1BF45     Hemoglobin subunit beta-4 OS=Oncorhynchus mykiss GN=HBB4 PE=2 SV=1
 2213 : C1BMC7_9MAXI        0.45  0.77  144  288    3  148  146    1    1  148  C1BMC7     Hemoglobin subunit beta OS=Caligus rogercresseyi GN=HBB PE=2 SV=1
 2214 : C1BY22_ESOLU        0.45  0.74  145  288    4  148  145    1    1  148  C1BY22     Hemoglobin subunit beta OS=Esox lucius GN=HBB PE=2 SV=1
 2215 : C1BY71_ESOLU        0.45  0.76  144  288    3  148  146    1    1  148  C1BY71     Hemoglobin subunit beta OS=Esox lucius GN=HBB PE=2 SV=1
 2216 : C1BYA0_ESOLU        0.45  0.72    1  141    1  141  141    0    0  141  C1BYA0     Hemoglobin subunit alpha-D OS=Esox lucius GN=HBAD PE=2 SV=1
 2217 : C1BYC9_ESOLU        0.45  0.74  144  288    3  148  146    1    1  148  C1BYC9     Hemoglobin subunit beta OS=Esox lucius GN=HBB PE=2 SV=1
 2218 : C1BZ27_ESOLU        0.45  0.73  144  288    3  148  146    1    1  163  C1BZ27     Hemoglobin subunit beta OS=Esox lucius GN=HBB PE=2 SV=1
 2219 : C3KGZ6_ANOFI        0.45  0.71  145  288    3  143  146    2    7  143  C3KGZ6     Hemoglobin subunit alpha-2 OS=Anoplopoma fimbria GN=HBA2 PE=2 SV=1
 2220 : C3KHW6_ANOFI        0.45  0.71  145  288    3  143  146    2    7  143  C3KHW6     Hemoglobin subunit alpha-2 OS=Anoplopoma fimbria GN=HBA2 PE=2 SV=1
 2221 : D2HDV3_AILME        0.45  0.74    1  141    1  141  141    0    0  141  D2HDV3     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_008910 PE=3 SV=1
 2222 : E2JF88_9PERC        0.45  0.67    2  141    3  143  141    1    1  143  E2JF88     Hemoglobin-2 OS=Cynoglossus semilaevis PE=2 SV=1
 2223 : G3PND3_GASAC        0.45  0.75    1  141    1  141  141    0    0  141  G3PND3     Uncharacterized protein OS=Gasterosteus aculeatus GN=HBM PE=3 SV=1
 2224 : G5CUP5_DICLA        0.45  0.78  144  280    3  139  137    0    0  139  G5CUP5     Hemoglobin-beta (Fragment) OS=Dicentrarchus labrax PE=2 SV=1
 2225 : H2LCY1_ORYLA        0.45  0.71  148  288    4  141  141    1    3  141  H2LCY1     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC101170712 PE=3 SV=1
 2226 : HBA1_ALDEL          0.45  0.74  145  288    3  142  146    2    8  142  P83131     Hemoglobin A subunit alpha-1 OS=Aldabrachelys elephantina PE=1 SV=2
 2227 : HBA2_ALDEL          0.45  0.73  145  288    3  142  146    2    8  142  P83132     Hemoglobin A subunit alpha-2 OS=Aldabrachelys elephantina PE=1 SV=2
 2228 : HBB2_TRENE          0.45  0.76  144  288    3  147  145    0    0  147  O93349     Hemoglobin subunit beta OS=Trematomus newnesi PE=2 SV=3
 2229 : HBB_PAGMA           0.45  0.77  144  288    3  148  146    1    1  148  Q6Y239     Hemoglobin subunit beta OS=Pagrus major GN=hbb PE=2 SV=3
 2230 : HBB_SALSA           0.45  0.77  144  288    3  148  146    1    1  148  Q91473     Hemoglobin subunit beta OS=Salmo salar GN=hbb PE=2 SV=3
 2231 : HBB_THUTH           0.45  0.78  144  288    2  146  145    0    0  146  P11749     Hemoglobin subunit beta OS=Thunnus thynnus GN=hbb PE=1 SV=1
 2232 : HBB_TRENE   1T1N    0.45  0.77  144  288    2  146  145    0    0  146  P45720     Hemoglobin subunit beta-1/2 OS=Trematomus newnesi PE=1 SV=1
 2233 : HBM_HUMAN           0.45  0.74    1  141    1  141  141    0    0  141  Q6B0K9     Hemoglobin subunit mu OS=Homo sapiens GN=HBM PE=2 SV=1
 2234 : I1Y918_ADEME        0.45  0.71  145  288    2  141  146    2    8  141  I1Y918     Hemoglobin subunit alpha-D OS=Adelomyia melanogenys PE=2 SV=1
 2235 : I1Y920_9AVES        0.45  0.72  145  288    2  141  146    2    8  141  I1Y920     Hemoglobin subunit alpha-D OS=Amazilia amazilia PE=2 SV=1
 2236 : I1Y921_9AVES        0.45  0.71  145  288    2  141  146    2    8  141  I1Y921     Hemoglobin subunit alpha-D OS=Amazilia viridicauda PE=2 SV=1
 2237 : L8AYC4_ALDEL        0.45  0.74  145  288    2  141  146    2    8  141  L8AYC4     Alpha A-globin (Fragment) OS=Aldabrachelys elephantina PE=3 SV=1
 2238 : M3ZD83_XIPMA        0.45  0.79  144  288    3  148  146    1    1  148  M3ZD83     Uncharacterized protein OS=Xiphophorus maculatus PE=3 SV=1
 2239 : Q0VHA9_TRENE        0.45  0.77  144  288    3  147  145    0    0  147  Q0VHA9     Beta 1/2 globin OS=Trematomus newnesi GN=beta I PE=2 SV=1
 2240 : Q1PCB2_SPAAU        0.45  0.78  144  288    3  148  146    1    1  148  Q1PCB2     Beta globin OS=Sparus aurata PE=3 SV=1
 2241 : Q4RHD0_TETNG        0.45  0.77    2  141    3  143  141    1    1  143  Q4RHD0     Chromosome 3 SCAF15050, whole genome shotgun sequence OS=Tetraodon nigroviridis GN=GSTENG00034400001 PE=3 SV=1
 2242 : Q8AYM1_THUTH1V4U    0.45  0.78  144  288    3  147  145    0    0  147  Q8AYM1     Hemoglobin beta chain OS=Thunnus thynnus PE=1 SV=1
 2243 : C1BX81_ESOLU        0.44  0.72  144  288    3  148  146    1    1  148  C1BX81     Hemoglobin subunit beta OS=Esox lucius GN=HBB PE=2 SV=1
 2244 : HBA_CANLA           0.44  0.66  145  288    3  142  146    2    8  142  P60530     Hemoglobin subunit alpha OS=Canis latrans GN=HBA PE=1 SV=2
 2245 : HBA_CHRBR   1FHJ    0.44  0.66  145  288    2  141  146    2    8  141  P60523     Hemoglobin subunit alpha OS=Chrysocyon brachyurus GN=HBA PE=1 SV=1
 2246 : HBA_ONDZI           0.44  0.69  145  288    2  141  146    2    8  141  P01944     Hemoglobin subunit alpha OS=Ondatra zibethicus GN=HBA PE=1 SV=1
 2247 : I1Y916_9AVES        0.44  0.71  145  288    2  141  146    2    8  141  I1Y916     Hemoglobin subunit alpha-D OS=Phaethornis malaris PE=2 SV=1
 2248 : J9JHF7_CANFA        0.44  0.66  145  288    3  142  146    2    8  142  J9JHF7     Uncharacterized protein OS=Canis familiaris GN=LOC100855540 PE=3 SV=1
 2249 : Q38IV9_XENTR        0.44  0.68  145  288    3  142  146    2    8  142  Q38IV9     Alpha globin larval-7 OS=Xenopus tropicalis GN=hba4 PE=2 SV=1
 2250 : B3F9U9_GADMO        0.43  0.69  144  288    3  137  145    1   10  137  B3F9U9     Hemoglobin beta chain OS=Gadus morhua PE=3 SV=1
 2251 : HBA_CANFA   2QLS    0.43  0.66  145  288    2  141  146    2    8  141  P60529     Hemoglobin subunit alpha OS=Canis familiaris GN=HBA PE=1 SV=1
 2252 : HBA_PROLO           0.43  0.66  145  288    2  141  146    2    8  141  P18977     Hemoglobin subunit alpha OS=Procyon lotor GN=HBA PE=1 SV=1
 2253 : HBB_SQUAC           0.43  0.65  144  288    2  142  145    1    4  142  P07409     Hemoglobin subunit beta OS=Squalus acanthias GN=HBB PE=1 SV=1
 2254 : I1VYJ9_9AVES        0.43  0.73  145  288    2  141  146    2    8  141  I1VYJ9     Hemoglobin subunit alpha-D OS=Oreotrochilus estella PE=2 SV=1
 2255 : I1Y917_9AVES        0.43  0.72  145  288    2  141  146    2    8  141  I1Y917     Hemoglobin subunit alpha-D OS=Patagona gigas PE=2 SV=1
 2256 : I1Y924_9AVES        0.43  0.73  145  288    2  141  146    2    8  141  I1Y924     Hemoglobin subunit alpha-D OS=Oreotrochilus melanogaster PE=2 SV=1
 2257 : J9NXL3_CANFA        0.43  0.66  145  288    3  142  146    2    8  142  J9NXL3     Uncharacterized protein OS=Canis familiaris GN=LOC100855558 PE=3 SV=1
 2258 : L5KGV2_PTEAL        0.43  0.59    2  141    3  184  182    1   42  213  L5KGV2     Hemoglobin subunit zeta OS=Pteropus alecto GN=PAL_GLEAN10011813 PE=3 SV=1
 2259 : L5LSF0_MYODS        0.43  0.64    2  141    3  174  172    1   32  174  L5LSF0     Hemoglobin subunit zeta OS=Myotis davidii GN=MDA_GLEAN10007589 PE=3 SV=1
 2260 : Q7T1E9_9SAUR        0.43  0.73  145  288    2  141  146    2    8  141  Q7T1E9     Hemoglobin alpha-globin (Fragment) OS=Chelonoidis chilensis PE=3 SV=1
 2261 : A4GTS5_OCHCU        0.42  0.68  145  288    3  142  146    2    8  142  A4GTS5     Hemoglobin alpha chain OS=Ochotona curzoniae PE=2 SV=1
 2262 : C1BYK4_ESOLU        0.42  0.73  144  288    3  148  146    1    1  148  C1BYK4     Hemoglobin subunit beta OS=Esox lucius GN=HBB PE=2 SV=1
 2263 : C5MQS0_PERMA        0.42  0.71    2  141    4  147  146    2    8  147  C5MQS0     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 2264 : C7S3K0_PERMA        0.42  0.68  149  288    7  142  142    2    8  142  C7S3K0     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2265 : D0U294_MUSPA        0.42  0.73    2  141    4  147  146    2    8  147  D0U294     Beta-globin OS=Mus pahari GN=Hbbt2 PE=3 SV=1
 2266 : D7RTR9_COSCO        0.42  0.71  145  288    2  141  146    2    8  141  D7RTR9     Hemoglobin alpha D subunit OS=Coscoroba coscoroba GN=HBA1 PE=3 SV=1
 2267 : D9I2E7_SCAOR        0.42  0.67  149  288    7  142  142    2    8  142  D9I2E7     Hemoglobin subunit alpha OS=Scapanus orarius GN=HBA PE=2 SV=1
 2268 : D9I2F2_SCAAQ        0.42  0.66  149  288    7  142  142    2    8  142  D9I2F2     Hemoglobin subunit alpha 1 OS=Scalopus aquaticus GN=HBA1 PE=2 SV=1
 2269 : D9I2F7_SCAAQ        0.42  0.66  149  288    7  142  142    2    8  142  D9I2F7     Hemoglobin subunit alpha 2 OS=Scalopus aquaticus GN=HBA2 PE=2 SV=1
 2270 : E3TFT0_ICTPU        0.42  0.66  145  288    3  143  146    2    7  143  E3TFT0     Hemoglobin subunit alpha OS=Ictalurus punctatus GN=HBA PE=2 SV=1
 2271 : G3HBR8_CRIGR        0.42  0.67  145  288    3  142  146    2    8  142  G3HBR8     Hemoglobin subunit alpha OS=Cricetulus griseus GN=I79_007867 PE=3 SV=1
 2272 : G3ICM5_CRIGR        0.42  0.71    2  141    4  147  146    2    8  147  G3ICM5     Hemoglobin subunit beta OS=Cricetulus griseus GN=I79_021423 PE=3 SV=1
 2273 : H0WQ67_OTOGA        0.42  0.67  145  288    3  142  146    2    8  142  H0WQ67     Uncharacterized protein OS=Otolemur garnettii GN=HBQ1 PE=3 SV=1
 2274 : HBA2_STEMC          0.42  0.73  145  288    2  141  146    2    8  141  P82112     Hemoglobin subunit alpha-2 OS=Stercorarius maccormicki PE=1 SV=1
 2275 : HBA3_XENLA          0.42  0.68  145  288    3  142  146    2    8  142  P06636     Hemoglobin subunit alpha-3 OS=Xenopus laevis GN=hba3 PE=2 SV=2
 2276 : HBA4_XENLA          0.42  0.68  145  288    3  142  146    2    8  142  P06637     Hemoglobin subunit alpha-4 OS=Xenopus laevis GN=hba4 PE=2 SV=2
 2277 : HBAA_CHENI          0.42  0.73  145  288    3  142  146    2    8  142  P83135     Hemoglobin subunit alpha-A OS=Chelonoidis nigra GN=HBAA PE=1 SV=2
 2278 : HBAD_ACCGE          0.42  0.74  145  288    2  141  146    2    8  141  P08849     Hemoglobin subunit alpha-D OS=Accipiter gentilis GN=HBAD PE=1 SV=1
 2279 : HBAD_AEGMO          0.42  0.73  145  288    2  141  146    2    8  141  P68059     Hemoglobin subunit alpha-D OS=Aegypius monachus GN=HBAD PE=1 SV=1
 2280 : HBAD_ANAPL          0.42  0.72  145  288    2  141  146    2    8  141  P04442     Hemoglobin subunit alpha-D OS=Anas platyrhynchos GN=HBAD PE=2 SV=1
 2281 : HBAD_AYTFU          0.42  0.71  145  288    2  141  146    2    8  141  P84791     Hemoglobin subunit alpha-D OS=Aythya fuligula GN=HBAD PE=1 SV=1
 2282 : HBAD_COTJA          0.42  0.71  145  288    2  141  146    2    8  141  P30892     Hemoglobin subunit alpha-D OS=Coturnix coturnix japonica GN=HBAD PE=1 SV=1
 2283 : HBAD_PHACA          0.42  0.73  145  288    2  141  146    2    8  141  P10781     Hemoglobin subunit alpha-D OS=Phalacrocorax carbo GN=HBAD PE=1 SV=1
 2284 : HBAD_RHEAM          0.42  0.73  145  288    2  141  146    2    8  141  P04241     Hemoglobin subunit alpha-D OS=Rhea americana GN=HBAD PE=1 SV=1
 2285 : HBAD_STRCA          0.42  0.71  145  288    2  141  146    2    8  141  P04242     Hemoglobin subunit alpha-D OS=Struthio camelus GN=HBAD PE=1 SV=1
 2286 : HBAD_TRIOC          0.42  0.73  145  288    2  141  146    2    8  141  P68060     Hemoglobin subunit alpha-D OS=Trigonoceps occipitalis GN=HBAD PE=1 SV=1
 2287 : HBA_AILFU           0.42  0.66  145  288    3  142  146    2    8  142  P18969     Hemoglobin subunit alpha OS=Ailurus fulgens GN=HBA PE=1 SV=2
 2288 : HBA_BRATR           0.42  0.68  145  288    2  141  146    2    8  141  P14525     Hemoglobin subunit alpha OS=Bradypus tridactylus GN=HBA PE=1 SV=1
 2289 : HBA_DASAK   1CG5    0.42  0.63    1  141    2  142  144    4    6  142  P56691     Hemoglobin subunit alpha OS=Dasyatis akajei GN=hba PE=1 SV=2
 2290 : HBA_DRYCE           0.42  0.68  145  288    2  141  147    4   10  141  P0C0U6     Hemoglobin subunit alpha-A OS=Drymarchon corais erebennus PE=1 SV=1
 2291 : HBA_ELEEL           0.42  0.68  145  288    2  142  146    2    7  142  P14520     Hemoglobin subunit alpha OS=Electrophorus electricus GN=hba PE=1 SV=1
 2292 : HBA_LUTLU           0.42  0.67  145  288    2  141  146    2    8  141  P10892     Hemoglobin subunit alpha OS=Lutra lutra GN=HBA PE=1 SV=1
 2293 : HBA_MACGG           0.42  0.69  145  288    2  141  146    2    8  141  P24659     Hemoglobin subunit alpha-1/2 OS=Macroderma gigas PE=1 SV=1
 2294 : HBA_MARFO           0.42  0.66  145  288    2  141  146    2    8  141  P17689     Hemoglobin subunit alpha OS=Martes foina GN=HBA PE=1 SV=1
 2295 : HBA_MEGLY           0.42  0.68  145  288    2  141  146    2    8  141  P11751     Hemoglobin subunit alpha OS=Megaderma lyra GN=HBA PE=1 SV=1
 2296 : HBA_MELME           0.42  0.67  145  288    2  141  146    2    8  141  P01953     Hemoglobin subunit alpha OS=Meles meles GN=HBA PE=1 SV=1
 2297 : HBA_MESAU           0.42  0.68  145  288    2  141  146    2    8  141  P01945     Hemoglobin subunit alpha OS=Mesocricetus auratus GN=HBA PE=1 SV=1
 2298 : HBA_NASNA           0.42  0.66  145  288    2  141  146    2    8  141  P26915     Hemoglobin subunit alpha OS=Nasua nasua GN=HBA PE=1 SV=1
 2299 : HBA_SPAEH           0.42  0.68  145  288    2  141  146    2    8  141  P01943     Hemoglobin subunit alpha OS=Spalax ehrenbergi GN=HBA PE=1 SV=1
 2300 : HBA_SPHPU           0.42  0.73  145  288    2  141  146    2    8  141  P10059     Hemoglobin subunit alpha-A OS=Sphenodon punctatus GN=HBAA PE=1 SV=1
 2301 : HBA_VULVU           0.42  0.63  145  288    2  141  150    3   16  141  P21200     Hemoglobin subunit alpha OS=Vulpes vulpes GN=HBA PE=1 SV=1
 2302 : HBB_CHLAE           0.42  0.71    2  141    3  146  146    2    8  146  P02028     Hemoglobin subunit beta OS=Chlorocebus aethiops GN=HBB PE=1 SV=1
 2303 : HBB_COLPO           0.42  0.71    2  141    4  147  146    2    8  147  P19885     Hemoglobin subunit beta OS=Colobus polykomos GN=HBB PE=2 SV=2
 2304 : HBB_GORGO           0.42  0.73    2  141    4  147  146    2    8  147  P02024     Hemoglobin subunit beta OS=Gorilla gorilla gorilla GN=HBB PE=1 SV=2
 2305 : HBB_MACCA           0.42  0.71    2  141    3  146  146    2    8  146  P09840     Hemoglobin subunit beta OS=Macrotus californicus GN=HBB PE=1 SV=1
 2306 : HBB_PILBA           0.42  0.71    2  141    3  146  146    2    8  146  P02033     Hemoglobin subunit beta OS=Piliocolobus badius GN=HBB PE=1 SV=1
 2307 : HBB_SPEBE           0.42  0.73    2  141    3  146  146    2    8  146  B3EWD0     Hemoglobin subunit beta OS=Spermophilus beecheyi PE=1 SV=1
 2308 : I1VYJ5_9AVES        0.42  0.73  145  288    3  142  146    2    8  142  I1VYJ5     Hemoglobin subunit alpha-A OS=Pelecanus onocrotalus PE=2 SV=1
 2309 : I1VYK0_9CORV        0.42  0.73  145  288    2  141  146    2    8  141  I1VYK0     Hemoglobin subunit alpha-D OS=Corvus cornix PE=2 SV=1
 2310 : I1VYK2_PHORB        0.42  0.70  145  288    2  142  147    2    9  142  I1VYK2     Hemoglobin subunit alpha-D OS=Phoenicopterus ruber PE=2 SV=1
 2311 : I1VYK3_9AVES        0.42  0.73  145  288    2  141  146    2    8  141  I1VYK3     Hemoglobin subunit alpha-D OS=Pelecanus crispus PE=2 SV=1
 2312 : I1Y919_9AVES        0.42  0.73  145  288    2  141  146    2    8  141  I1Y919     Hemoglobin subunit alpha-D OS=Aglaeactis castelnaudii PE=2 SV=1
 2313 : I1Y923_COEVI        0.42  0.73  145  288    2  141  146    2    8  141  I1Y923     Hemoglobin subunit alpha-D OS=Coeligena violifer PE=2 SV=1
 2314 : I1Y926_9PASS        0.42  0.70  145  288    3  142  146    2    8  142  I1Y926     Hemoglobin subunit alpha-D OS=Mino dumontii PE=2 SV=1
 2315 : I1Y927_9AVES        0.42  0.71  145  288    2  142  147    2    9  142  I1Y927     Hemoglobin subunit alpha-D OS=Phoenicopterus roseus PE=2 SV=1
 2316 : I7B0Y9_EOSBA        0.42  0.68  145  288    3  142  146    2    8  142  I7B0Y9     Hemoglobin alpha chain OS=Eospalax baileyi PE=2 SV=1
 2317 : K7WG06_OCHER        0.42  0.69  145  288    3  142  146    2    8  142  K7WG06     Hemoglobin alpha chain OS=Ochotona erythrotis PE=2 SV=1
 2318 : K7X7N0_MICOE        0.42  0.69  145  288    3  142  146    2    8  142  K7X7N0     Hemoglobin alpha chain OS=Microtus oeconomus PE=2 SV=1
 2319 : Q198B5_COLLI        0.42  0.72  160  288    1  125  131    2    8  125  Q198B5     Alpah-A globin (Fragment) OS=Columba livia GN=HBA2 PE=3 SV=1
 2320 : Q38IW0_XENTR        0.42  0.69  145  288    3  142  146    2    8  142  Q38IW0     Alpha globin larval-6 OS=Xenopus tropicalis GN=hba2 PE=2 SV=1
 2321 : Q4S4F1_TETNG        0.42  0.69  145  288    3  143  146    2    7  143  Q4S4F1     Chromosome 2 SCAF14738, whole genome shotgun sequence OS=Tetraodon nigroviridis GN=GSTENG00024202001 PE=3 SV=1
 2322 : Q63910_RAT          0.42  0.68  145  288    3  142  146    2    8  142  Q63910     Alpha globin OS=Rattus norvegicus GN=LOC287167 PE=3 SV=2
 2323 : Q90ZA5_AMBME        0.42  0.69  145  288    3  142  146    2    8  142  Q90ZA5     Alpha-globin OS=Ambystoma mexicanum PE=2 SV=1
 2324 : Q9I977_SPAAU        0.42  0.78  144  285    3  145  143    1    1  152  Q9I977     Beta-globin OS=Sparus aurata PE=2 SV=1
 2325 : Q9PVL9_HYNRE        0.42  0.68  145  288    3  142  146    2    8  142  Q9PVL9     Larval alpha-globin OS=Hynobius retardatus PE=2 SV=1
 2326 : A4ZQB2_PERMA        0.41  0.68  145  288    3  142  146    2    8  142  A4ZQB2     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2327 : A4ZQD0_PERMA        0.41  0.68  145  288    3  142  146    2    8  142  A4ZQD0     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2328 : A4ZQF0_PERMA        0.41  0.68  145  288    3  142  146    2    8  142  A4ZQF0     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2329 : A4ZQG6_PERMA        0.41  0.68  148  288    6  141  143    3    9  141  A4ZQG6     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2330 : A4ZQH2_PERMA        0.41  0.68  148  287    6  140  142    3    9  141  A4ZQH2     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2331 : A4ZQK0_PERMA        0.41  0.69  148  288    6  141  143    3    9  141  A4ZQK0     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2332 : A4ZQM9_PERLE        0.41  0.68  145  288    3  142  146    2    8  142  A4ZQM9     Hemoglobin alpha subunit 1 OS=Peromyscus leucopus PE=3 SV=1
 2333 : A8DUN2_MOUSE        0.41  0.72    2  141    4  147  146    2    8  147  A8DUN2     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2334 : A8DUV3_MOUSE        0.41  0.68  145  288    3  142  146    2    8  142  A8DUV3     Alpha-globin OS=Mus musculus GN=Hba-a1 PE=3 SV=1
 2335 : A8E196_BUBBU        0.41  0.71    1  141    1  145  147    2    8  145  A8E196     Adult beta-globin OS=Bubalus bubalis GN=hbb PE=3 SV=1
 2336 : B2KHW1_RHIFE        0.41  0.65  145  288    3  142  146    2    8  142  B2KHW1     Theta 1 globin (Predicted) OS=Rhinolophus ferrumequinum GN=HBQ1_3 PE=3 SV=1
 2337 : B3EX31_SORAR        0.41  0.67  145  288    3  142  146    2    8  142  B3EX31     Alpha 1 globin (Predicted) OS=Sorex araneus GN=HBA1 PE=3 SV=1
 2338 : B4USM4_OTOGA        0.41  0.71    2  141    4  147  146    2    8  147  B4USM4     Beta-globin protein (Predicted) OS=Otolemur garnettii GN=HBB PE=3 SV=1
 2339 : B4USM5_OTOGA        0.41  0.71    2  141    4  147  146    2    8  147  B4USM5     Hemoglobin, beta adult major chain (Predicted) OS=Otolemur garnettii GN=HBB-B1 PE=3 SV=1
 2340 : B6CWH6_MYOAD        0.41  0.69  145  288    3  142  146    2    8  142  B6CWH6     Hemoglobin alpha chain OS=Myotis adversus GN=HBA PE=2 SV=1
 2341 : B7SBL4_PERMA        0.41  0.72    2  141    4  147  146    2    8  147  B7SBL4     Beta globin OS=Peromyscus maniculatus GN=HBB-T2 PE=3 SV=1
 2342 : C5MQR7_PERMA        0.41  0.72    2  141    4  147  146    2    8  147  C5MQR7     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 2343 : C5MQS2_PERMA        0.41  0.72    2  141    4  147  146    2    8  147  C5MQS2     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 2344 : C5MQS7_PERMA        0.41  0.72    2  141    4  147  146    2    8  147  C5MQS7     Beta globin OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 2345 : C6KGT1_MACMU        0.41  0.71    2  141    4  147  146    2    8  147  C6KGT1     Beta hemoglobin OS=Macaca mulatta PE=2 SV=1
 2346 : C6L8R0_DRONO        0.41  0.70  145  288    3  142  146    2    8  142  C6L8R0     Hemoglobin subunit alpha-A OS=Dromaius novaehollandiae GN=HBAA PE=2 SV=1
 2347 : C7S362_PERMA        0.41  0.68  145  288    3  141  146    3    9  141  C7S362     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2348 : C7S3C4_PERMA        0.41  0.68  145  288    3  142  146    2    8  142  C7S3C4     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2349 : C8C504_HUMAN        0.41  0.73    2  141    4  147  146    2    8  147  C8C504     Beta-globin OS=Homo sapiens GN=HBB PE=3 SV=1
 2350 : D0U278_MUSPA        0.41  0.73    2  141    4  147  146    2    8  147  D0U278     Beta-globin OS=Mus pahari GN=Hbbt1 PE=3 SV=1
 2351 : D2HDV4_AILME        0.41  0.66  145  288    3  142  146    2    8  142  D2HDV4     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_008911 PE=3 SV=1
 2352 : D4N6R6_MUSMC        0.41  0.71    2  141    4  147  146    2    8  147  D4N6R6     Beta-globin OS=Mus musculus castaneus GN=Hbbt1 PE=3 SV=1
 2353 : D4QBB5_BOSIN        0.41  0.71    1  141    1  145  147    2    8  145  D4QBB5     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
 2354 : D4QBF0_BOSGF        0.41  0.71    1  141    1  145  147    2    8  145  D4QBF0     Hemoglobin beta OS=Bos frontalis frontalis GN=HBB PE=3 SV=1
 2355 : D7RTS2_CHLPI        0.41  0.72  145  288    2  141  146    2    8  141  D7RTS2     Hemoglobin alpha D subunit OS=Chloephaga picta leucoptera GN=HBA1 PE=3 SV=1
 2356 : D7RTS3_9AVES        0.41  0.72  145  288    2  141  146    2    8  141  D7RTS3     Hemoglobin alpha D subunit OS=Chloephaga poliocephala GN=HBA1 PE=3 SV=1
 2357 : D7RTS5_9AVES        0.41  0.72  145  288    2  141  146    2    8  141  D7RTS5     Hemoglobin alpha D subunit OS=Chloephaga hybrida malvinarum GN=HBA1 PE=3 SV=1
 2358 : D7RTS6_9AVES        0.41  0.72  145  288    2  141  146    2    8  141  D7RTS6     Hemoglobin alpha D subunit OS=Chloephaga rubidiceps GN=HBA1 PE=3 SV=1
 2359 : D7RTU5_NEOJU        0.41  0.72  145  288    2  141  146    2    8  141  D7RTU5     Hemoglobin alpha D subunit OS=Neochen jubata GN=HBA1 PE=3 SV=1
 2360 : D9I2F5_SCAAQ        0.41  0.66  148  288    1  137  143    2    8  137  D9I2F5     Hemoglobin subunit alpha 1 (Fragment) OS=Scalopus aquaticus GN=HBA1 PE=2 SV=1
 2361 : D9YZU5_HUMAN        0.41  0.73    2  141    4  147  146    2    8  147  D9YZU5     Hemoglobin, beta OS=Homo sapiens GN=HBB PE=2 SV=1
 2362 : E2EM05_PERMA        0.41  0.68  145  288    3  142  146    2    8  142  E2EM05     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
 2363 : E5RWQ0_9SAUR3AT5    0.41  0.74  145  288    3  142  146    2    8  142  E5RWQ0     AlphaA-globin OS=Podocnemis unifilis GN=HBAA PE=1 SV=1
 2364 : F7AP85_MACMU        0.41  0.70    2  141    4  147  146    2    8  147  F7AP85     Hemoglobin subunit beta OS=Macaca mulatta GN=HBB PE=2 SV=1
 2365 : G1LJX4_AILME        0.41  0.67  145  288    3  142  146    2    8  142  G1LJX4     Uncharacterized protein OS=Ailuropoda melanoleuca PE=3 SV=1
 2366 : G1N9G9_MELGA        0.41  0.68  145  288    2  141  146    2    8  141  G1N9G9     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100551072 PE=3 SV=1
 2367 : G1S6C3_NOMLE        0.41  0.71    2  141    4  147  146    2    8  147  G1S6C3     Uncharacterized protein OS=Nomascus leucogenys PE=3 SV=1
 2368 : G1S6C6_NOMLE        0.41  0.71    2  141    4  147  146    2    8  147  G1S6C6     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100580435 PE=3 SV=1
 2369 : G3WEF1_SARHA        0.41  0.71    2  141    4  147  146    2    8  147  G3WEF1     Uncharacterized protein OS=Sarcophilus harrisii PE=3 SV=1
 2370 : G9FTH8_NEUGI        0.41  0.66  145  288    3  142  146    2    8  142  G9FTH8     Hemoglobin subunit alpha OS=Neurotrichus gibbsii GN=HBA PE=2 SV=1
 2371 : H2LD06_ORYLA        0.41  0.68  145  288    4  144  146    2    7  144  H2LD06     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC101171201 PE=3 SV=1
 2372 : H2NEE2_PONAB        0.41  0.71    2  141    4  147  146    2    8  147  H2NEE2     Uncharacterized protein OS=Pongo abelii GN=HBB PE=3 SV=1
 2373 : HBA1_EQUBU          0.41  0.72  145  288    3  142  146    2    8  142  Q9XSN3     Hemoglobin subunit alpha-1 OS=Equus burchelli GN=HBA1 PE=1 SV=3
 2374 : HBA1_TADBR          0.41  0.68  145  288    2  141  146    2    8  141  P11755     Hemoglobin subunit alpha-1 OS=Tadarida brasiliensis PE=1 SV=1
 2375 : HBA2_BUBBU  3CY5    0.41  0.70  145  288    3  142  146    2    8  142  Q9TSN8     Hemoglobin subunit alpha-2 OS=Bubalus bubalis PE=1 SV=3
 2376 : HBA2_EQUBU          0.41  0.71  145  288    3  142  146    2    8  142  Q9TVA3     Hemoglobin subunit alpha-2 OS=Equus burchelli GN=HBA2 PE=2 SV=3
 2377 : HBAB_SERQU          0.41  0.66  145  288    3  144  146    2    6  144  Q9PVM3     Hemoglobin subunit alpha-B OS=Seriola quinqueradiata GN=hbab PE=2 SV=3
 2378 : HBAD_ALDEL  2Z6N    0.41  0.73  145  288    2  141  146    2    8  141  P83134     Hemoglobin D subunit alpha OS=Aldabrachelys elephantina PE=1 SV=1
 2379 : HBAD_CHENI          0.41  0.71  145  288    2  141  146    2    8  141  P83124     Hemoglobin subunit alpha-D OS=Chelonoidis nigra GN=HBAD PE=1 SV=1
 2380 : HBAD_CHICK  1HBR    0.41  0.69  145  288    2  141  146    2    8  141  P02001     Hemoglobin subunit alpha-D OS=Gallus gallus GN=HBAD PE=1 SV=1
 2381 : HBAD_GYPRU          0.41  0.73  145  288    2  141  146    2    8  141  P08257     Hemoglobin subunit alpha-D/D' OS=Gyps rueppellii GN=HBAD PE=1 SV=1
 2382 : HBA_AILME           0.41  0.66  145  288    3  142  146    2    8  142  P18970     Hemoglobin subunit alpha OS=Ailuropoda melanoleuca GN=HBA PE=1 SV=2
 2383 : HBA_ALCAA           0.41  0.68  145  288    3  142  146    2    8  142  P01971     Hemoglobin subunit alpha OS=Alces alces alces GN=HBA PE=1 SV=2
 2384 : HBA_EQUHE           0.41  0.71  145  288    3  142  146    2    8  142  P01961     Hemoglobin subunit alpha-1/2 OS=Equus hemionus kulan PE=1 SV=3
 2385 : HBA_EUDCH           0.41  0.73  145  288    2  141  146    2    8  141  P10057     Hemoglobin subunit alpha OS=Eudyptes chrysocome GN=HBA PE=1 SV=1
 2386 : HBA_MICPE           0.41  0.70  145  288    2  141  146    2    8  141  B3EWE3     Hemoglobin subunit alpha OS=Microtus pennsylvanicus PE=1 SV=1
 2387 : HBA_MOUSE   3HRW    0.41  0.68  145  288    3  142  146    2    8  142  P01942     Hemoglobin subunit alpha OS=Mus musculus GN=Hba PE=1 SV=2
 2388 : HBA_MUSLU           0.41  0.66  145  288    2  141  146    2    8  141  P23600     Hemoglobin subunit alpha-1/2 OS=Mustela lutreola PE=1 SV=1
 2389 : HBA_MUSPF           0.41  0.66  145  288    2  141  146    2    8  141  P20243     Hemoglobin subunit alpha-1/2 OS=Mustela putorius furo PE=1 SV=1
 2390 : HBA_MUSPU           0.41  0.66  145  288    2  141  146    2    8  141  P23601     Hemoglobin subunit alpha-1/2 OS=Mustela putorius PE=1 SV=1
 2391 : HBA_MYOVE           0.41  0.69  145  288    2  141  146    2    8  141  P11757     Hemoglobin subunit alpha OS=Myotis velifer GN=HBA PE=1 SV=1
 2392 : HBA_PERCA           0.41  0.68  145  288    2  141  146    2    8  141  B3EWD5     Hemoglobin subunit alpha OS=Peromyscus californicus PE=1 SV=1
 2393 : HBA_PROCR           0.41  0.67  145  288    2  141  146    2    8  141  P23019     Hemoglobin subunit alpha OS=Proteles cristata GN=HBA PE=1 SV=1
 2394 : HBA_RANTA           0.41  0.68  145  288    2  141  146    2    8  141  P21379     Hemoglobin subunit alpha OS=Rangifer tarandus GN=HBA PE=1 SV=1
 2395 : HBA_TALEU           0.41  0.67  145  288    2  141  146    2    8  141  P01951     Hemoglobin subunit alpha OS=Talpa europaea GN=HBA PE=1 SV=1
 2396 : HBBA_CAPHI  2RI4    0.41  0.71    1  141    1  145  147    2    8  145  P02077     Hemoglobin subunit beta-A OS=Capra hircus PE=1 SV=1
 2397 : HBBL_XENLA          0.41  0.68    2  140    4  146  145    2    8  147  P02137     Hemoglobin larval subunit beta-1 OS=Xenopus laevis PE=2 SV=2
 2398 : HBB_BISBO           0.41  0.71    1  141    1  145  147    2    8  145  P09422     Hemoglobin subunit beta OS=Bison bonasus GN=HBB PE=1 SV=1
 2399 : HBB_BOSGF           0.41  0.71    1  141    1  145  147    2    8  145  P67819     Hemoglobin subunit beta OS=Bos gaurus frontalis GN=HBB PE=1 SV=1
 2400 : HBB_BUBBU   3CY5    0.41  0.71    1  141    1  145  147    2    8  145  P67820     Hemoglobin subunit beta OS=Bubalus bubalis GN=HBB PE=1 SV=1
 2401 : HBB_CYNSP           0.41  0.71    2  141    3  146  146    2    8  146  P11754     Hemoglobin subunit beta OS=Cynopterus sphinx GN=HBB PE=1 SV=1
 2402 : HBB_HUMAN   1YZI    0.41  0.73    2  141    4  147  146    2    8  147  P68871     Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2
 2403 : HBB_HYLLA           0.41  0.71    2  141    3  146  146    2    8  146  P02025     Hemoglobin subunit beta OS=Hylobates lar GN=HBB PE=1 SV=1
 2404 : HBB_MACMU           0.41  0.70    2  141    3  146  146    2    8  146  P02026     Hemoglobin subunit beta OS=Macaca mulatta GN=HBB PE=1 SV=1
 2405 : HBB_MANSP           0.41  0.71    2  141    3  146  146    2    8  146  P08259     Hemoglobin subunit beta OS=Mandrillus sphinx GN=HBB PE=1 SV=1
 2406 : HBB_PANPA           0.41  0.73    2  141    4  147  146    2    8  147  P68872     Hemoglobin subunit beta OS=Pan paniscus GN=HBB PE=1 SV=2
 2407 : HBB_PANTR           0.41  0.73    2  141    4  147  146    2    8  147  P68873     Hemoglobin subunit beta OS=Pan troglodytes GN=HBB PE=1 SV=2
 2408 : HBB_PAPAN           0.41  0.70    2  141    4  147  146    2    8  147  Q9TSP1     Hemoglobin subunit beta OS=Papio anubis GN=HBB PE=2 SV=2
 2409 : HBB_PAPCY           0.41  0.70    2  141    3  146  146    2    8  146  P02030     Hemoglobin subunit beta OS=Papio cynocephalus GN=HBB PE=1 SV=1
 2410 : HBB_SEMEN           0.41  0.71    2  141    3  146  146    2    8  146  P02032     Hemoglobin subunit beta OS=Semnopithecus entellus GN=HBB PE=1 SV=1
 2411 : HBB_SHEEP   2QU0    0.41  0.71    1  141    1  145  147    2    8  145  P02075     Hemoglobin subunit beta OS=Ovis aries GN=HBB PE=1 SV=2
 2412 : HBB_SPECI           0.41  0.72    2  141    3  146  146    2    8  146  P09421     Hemoglobin subunit beta OS=Spermophilus citellus GN=HBB PE=1 SV=1
 2413 : HBB_SUNMU           0.41  0.72    2  141    3  146  146    2    8  146  P02060     Hemoglobin subunit beta OS=Suncus murinus GN=HBB PE=1 SV=1
 2414 : HBB_TADBR           0.41  0.71    2  141    3  146  146    2    8  146  P11756     Hemoglobin subunit beta OS=Tadarida brasiliensis GN=HBB PE=1 SV=1
 2415 : HBB_TARBA           0.41  0.73    2  141    3  146  146    2    8  146  P02051     Hemoglobin subunit beta OS=Tarsius bancanus GN=HBB PE=1 SV=1
 2416 : HBD_ATEGE           0.41  0.73    2  141    4  147  146    2    8  147  P02044     Hemoglobin subunit delta OS=Ateles geoffroyi GN=HBD PE=1 SV=3
 2417 : HBD_COLPO           0.41  0.70    2  141    4  147  146    2    8  147  P19886     Hemoglobin subunit delta OS=Colobus polykomos GN=HBD PE=2 SV=2
 2418 : HBD_GORGO           0.41  0.71    2  141    4  147  146    2    8  147  P61773     Hemoglobin subunit delta OS=Gorilla gorilla gorilla GN=HBD PE=1 SV=2
 2419 : HBD_HYLLA           0.41  0.71    2  141    4  147  146    2    8  147  P61774     Hemoglobin subunit delta OS=Hylobates lar GN=HBD PE=1 SV=2
 2420 : HBD_OTOCR           0.41  0.71    2  141    4  147  146    2    8  147  Q03902     Hemoglobin subunit delta OS=Otolemur crassicaudatus GN=HBD PE=2 SV=2
 2421 : HBD_PANTR           0.41  0.71    2  141    4  147  146    2    8  147  P61772     Hemoglobin subunit delta OS=Pan troglodytes GN=HBD PE=1 SV=2
 2422 : HBD_PONPY           0.41  0.71    2  141    4  147  146    2    8  147  P61775     Hemoglobin subunit delta OS=Pongo pygmaeus GN=HBD PE=2 SV=2
 2423 : HBE_MACEU           0.41  0.71    2  141    4  147  146    2    8  147  P81042     Hemoglobin subunit epsilon OS=Macropus eugenii GN=HBE1 PE=1 SV=3
 2424 : I0B043_EPIFU        0.41  0.65  157  284    3  126  130    2    8  126  I0B043     Hemoglobin subunit alpha (Fragment) OS=Episoriculus fumidus GN=HBA PE=3 SV=1
 2425 : I1VYJ6_9AVES        0.41  0.73  145  288    3  142  146    2    8  142  I1VYJ6     Hemoglobin subunit alpha-A OS=Pelecanus crispus PE=2 SV=1
 2426 : I1Y922_COECO        0.41  0.69  145  288    2  141  146    2    8  141  I1Y922     Hemoglobin subunit alpha-D OS=Coeligena coeligena PE=2 SV=1
 2427 : I3IZ43_ORENI        0.41  0.68  145  288    3  143  146    2    7  143  I3IZ43     Uncharacterized protein OS=Oreochromis niloticus PE=3 SV=1
 2428 : I7B4Z6_OCHLA        0.41  0.69  145  288    3  142  146    2    8  142  I7B4Z6     Hemoglobin alpha chain OS=Ochotona ladacensis PE=2 SV=1
 2429 : L7N1N1_MYOLU        0.41  0.69  145  288    3  142  146    2    8  142  L7N1N1     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
 2430 : M3YX78_MUSPF        0.41  0.66  145  288    3  143  147    3    9  143  M3YX78     Uncharacterized protein OS=Mustela putorius furo PE=3 SV=1
 2431 : M3ZD81_XIPMA        0.41  0.74  144  288    3  147  145    0    0  147  M3ZD81     Uncharacterized protein OS=Xiphophorus maculatus PE=3 SV=1
 2432 : Q03901_OTOCR        0.41  0.71    2  141    4  147  146    2    8  147  Q03901     Beta-globin OS=Otolemur crassicaudatus GN=beta-globin PE=3 SV=1
 2433 : Q1KYZ6_SHEEP        0.41  0.71    1  141    1  145  147    2    8  145  Q1KYZ6     Beta-B globin chain OS=Ovis aries GN=HBBB PE=3 SV=1
 2434 : Q1KYZ7_SHEEP        0.41  0.71    1  141    1  145  147    2    8  145  Q1KYZ7     Beta-A globin chain OS=Ovis aries GN=HBBA PE=3 SV=1
 2435 : Q1KYZ9_OVIMU        0.41  0.71    1  141    1  145  147    2    8  145  Q1KYZ9     Beta globin chain OS=Ovis orientalis musimon GN=HBB PE=3 SV=1
 2436 : Q1KZF3_CAPHI        0.41  0.71    1  141    1  145  147    2    8  145  Q1KZF3     Beta A globin chain OS=Capra hircus GN=HBBA PE=3 SV=1
 2437 : Q4TU70_CEREL        0.41  0.68  145  288    3  142  146    2    8  142  Q4TU70     Alpha hemoglobin chain OS=Cervus elaphus canadensis PE=3 SV=1
 2438 : Q5RM02_LARCR        0.41  0.70  145  288    3  144  146    2    6  144  Q5RM02     Alpha1 hemoglobin OS=Larimichthys crocea PE=2 SV=2
 2439 : Q66KR9_XENLA        0.41  0.68    2  140    4  146  145    2    8  147  Q66KR9     Hbb-prov protein OS=Xenopus laevis GN=hbb-prov PE=2 SV=1
 2440 : Q6DET0_XENTR        0.41  0.66    2  140    4  146  145    2    8  147  Q6DET0     MGC89723 protein OS=Xenopus tropicalis GN=hbd PE=2 SV=1
 2441 : Q6T497_HIPCM        0.41  0.66  145  288    4  144  146    2    7  144  Q6T497     Hemoglobin alpha chain OS=Hippocampus comes PE=2 SV=1
 2442 : Q7T1E8_9SAUR        0.41  0.71  145  288    2  141  146    2    8  141  Q7T1E8     Hemoglobin alpha-D globin (Fragment) OS=Chelonoidis chilensis PE=3 SV=1
 2443 : Q8AYQ1_ORYLA        0.41  0.68  145  288    3  143  146    2    7  143  Q8AYQ1     Alpha-type globin OS=Oryzias latipes GN=Gb PE=3 SV=1
 2444 : Q8BPF4_MOUSE        0.41  0.69  145  288    3  142  146    2    8  142  Q8BPF4     Putative uncharacterized protein OS=Mus musculus GN=Hba-a2 PE=2 SV=1
 2445 : Q8JH84_CTEID        0.41  0.67  145  288    3  143  146    2    7  143  Q8JH84     Alpha globin (Fragment) OS=Ctenopharyngodon idella PE=2 SV=1
 2446 : Q8JIN0_ORYLA        0.41  0.68  145  288    3  143  146    2    7  143  Q8JIN0     Adult alpha-type globin OS=Oryzias latipes GN=Gb PE=2 SV=1
 2447 : Q91VB8_MOUSE        0.41  0.69  145  288    3  142  146    2    8  142  Q91VB8     Alpha globin 1 OS=Mus musculus GN=Hba-a1 PE=2 SV=1
 2448 : Q9CWS5_MOUSE        0.41  0.69  145  288    3  142  146    2    8  142  Q9CWS5     Putative uncharacterized protein OS=Mus musculus GN=Hba-a2 PE=2 SV=1
 2449 : Q9CY06_MOUSE        0.41  0.69  145  288    3  142  146    2    8  142  Q9CY06     Putative uncharacterized protein OS=Mus musculus GN=Hba-a1 PE=2 SV=1
 2450 : A0EZW6_PSEMX        0.40  0.69  145  288    4  144  146    2    7  144  A0EZW6     Alpha-type globin OS=Psetta maxima PE=2 SV=1
 2451 : A0N071_HUMAN        0.40  0.71    2  141    4  147  146    2    8  147  A0N071     Delta globin OS=Homo sapiens GN=HBD PE=2 SV=1
 2452 : A1YZP4_9TELE3BCQ    0.40  0.69  145  288    3  143  146    2    7  143  A1YZP4     Alpha-chain hemoglobin OS=Brycon cephalus PE=1 SV=1
 2453 : A4ZQ87_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQ87     Alpha-globin OS=Peromyscus maniculatus GN=HBA PE=2 SV=1
 2454 : A4ZQ88_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQ88     Alpha-globin OS=Peromyscus maniculatus GN=HBA PE=2 SV=1
 2455 : A4ZQ90_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQ90     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2456 : A4ZQ92_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQ92     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2457 : A4ZQ93_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQ93     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2458 : A4ZQ95_PERMA4H2L    0.40  0.68  145  288    3  142  146    2    8  142  A4ZQ95     Alpha-globin OS=Peromyscus maniculatus GN=HBA PE=1 SV=1
 2459 : A4ZQ96_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQ96     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
 2460 : A4ZQA9_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQA9     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2461 : A4ZQB7_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQB7     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2462 : A4ZQB9_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQB9     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2463 : A4ZQC3_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQC3     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2464 : A4ZQC5_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQC5     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2465 : A4ZQD3_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQD3     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
 2466 : A4ZQD6_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQD6     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2467 : A4ZQD9_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQD9     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2468 : A4ZQE7_PERMA        0.40  0.70  145  288    3  142  146    2    8  142  A4ZQE7     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2469 : A4ZQE9_PERMA        0.40  0.67  145  288    3  142  146    2    8  142  A4ZQE9     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2470 : A4ZQF6_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQF6     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2471 : A4ZQG1_PERLE        0.40  0.68  145  288    3  142  146    2    8  142  A4ZQG1     Hemoglobin alpha subunit 2 OS=Peromyscus leucopus PE=3 SV=1
 2472 : A4ZQG2_PERMA        0.40  0.66  145  285    3  138  143    3    9  140  A4ZQG2     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2473 : A4ZQH1_PERMA        0.40  0.69  148  288    6  142  143    2    8  142  A4ZQH1     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2474 : A4ZQI0_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  A4ZQI0     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2475 : A4ZQI8_PERMA        0.40  0.67  157  288   11  137  134    3    9  137  A4ZQI8     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2476 : A4ZQI9_PERMA        0.40  0.67  145  288    3  141  146    3    9  141  A4ZQI9     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2477 : A4ZQJ7_PERMA        0.40  0.68  147  288    5  141  144    3    9  141  A4ZQJ7     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2478 : A4ZQL3_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  A4ZQL3     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2479 : A4ZQL4_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  A4ZQL4     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2480 : A4ZQL5_PERMA        0.40  0.69  145  288    3  141  146    3    9  141  A4ZQL5     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2481 : A4ZQM0_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  A4ZQM0     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2482 : A4ZQM2_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  A4ZQM2     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2483 : A4ZQM7_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  A4ZQM7     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2484 : A4ZR26_PERMA        0.40  0.72    2  141    4  147  146    2    8  147  A4ZR26     Beta globin OS=Peromyscus maniculatus PE=3 SV=1
 2485 : A8DUK0_MOUSE        0.40  0.71    2  141    4  147  146    2    8  147  A8DUK0     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2486 : A8DUK2_MOUSE        0.40  0.70    2  141    4  151  150    3   12  151  A8DUK2     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2487 : A8DUK4_MOUSE        0.40  0.72    2  141    4  147  146    2    8  147  A8DUK4     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=2 SV=1
 2488 : A8DUK7_MOUSE        0.40  0.71    2  141    4  147  146    2    8  147  A8DUK7     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2489 : A8DUL0_MOUSE        0.40  0.71    2  141    4  147  146    2    8  147  A8DUL0     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2490 : A8DUL2_MOUSE        0.40  0.73    2  141    4  147  146    2    8  147  A8DUL2     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2491 : A8DUL7_MOUSE        0.40  0.72    2  141    4  147  146    2    8  147  A8DUL7     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2492 : A8DUM2_MOUSE        0.40  0.71    2  141    4  147  146    2    8  147  A8DUM2     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2493 : A8DUP0_MOUSE        0.40  0.72    2  141    4  147  146    2    8  147  A8DUP0     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2494 : A8DUP7_MOUSE        0.40  0.71    2  141    4  147  146    2    8  147  A8DUP7     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2495 : A8DUQ1_MOUSE        0.40  0.71    2  141    4  147  146    2    8  147  A8DUQ1     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2496 : A8DUQ5_MOUSE        0.40  0.72    2  141    4  147  146    2    8  147  A8DUQ5     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2497 : A8DUV1_MOUSE        0.40  0.68  145  288    3  142  146    2    8  142  A8DUV1     Alpha-globin OS=Mus musculus GN=Hba-a1 PE=3 SV=1
 2498 : A8E197_BUBBU        0.40  0.71    1  141    1  145  147    2    8  145  A8E197     Adult beta-globin OS=Bubalus bubalis GN=hbb PE=3 SV=1
 2499 : B0VX78_CALJA        0.40  0.68  145  288    3  142  146    2    8  142  B0VX78     Theta 1 globin (Predicted) OS=Callithrix jacchus GN=HBQ1_1 PE=3 SV=1
 2500 : B1MT78_CALMO        0.40  0.70    2  141    4  147  146    2    8  147  B1MT78     Beta globin (Predicted) OS=Callicebus moloch GN=HBB PE=3 SV=1
 2501 : B1MT79_CALMO        0.40  0.71    2  141    4  147  146    2    8  147  B1MT79     Hemoglobin subunit delta (Predicted) OS=Callicebus moloch GN=HBD PE=3 SV=1
 2502 : B1Q450_MOUSE        0.40  0.72    2  141    4  147  146    2    8  147  B1Q450     Hemoglobin beta chain subunit OS=Mus musculus GN=Hbb-b1 PE=2 SV=1
 2503 : B4USK1_OTOGA        0.40  0.71  145  288    3  142  146    2    8  142  B4USK1     Uncharacterized protein OS=Otolemur garnettii GN=HBZ PE=3 SV=1
 2504 : B5SXU4_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  B5SXU4     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2505 : B5SXV1_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  B5SXV1     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2506 : B5SXW7_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  B5SXW7     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2507 : B5SXZ1_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  B5SXZ1     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2508 : B5X930_SALSA        0.40  0.62  145  288    3  143  146    2    7  143  B5X930     Hemoglobin embryonic subunit alpha OS=Salmo salar GN=HBAE PE=2 SV=1
 2509 : B6CV73_PERMA        0.40  0.67  145  288    3  142  146    2    8  142  B6CV73     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2510 : B6CVB8_PERMA        0.40  0.67  145  288    3  142  146    2    8  142  B6CVB8     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2511 : B6CWH2_9CHIR        0.40  0.69  145  288    3  142  146    2    8  142  B6CWH2     Hemoglobin alpha chain OS=Chaerephon plicatus GN=HBA PE=2 SV=1
 2512 : B6CWH3_CYNSP        0.40  0.70  145  288    3  142  146    2    8  142  B6CWH3     Hemoglobin alpha chain OS=Cynopterus sphinx GN=HBA PE=2 SV=1
 2513 : B6CWH4_EONSP        0.40  0.69  145  288    3  142  146    2    8  142  B6CWH4     Hemoglobin alpha chain OS=Eonycteris spelaea GN=HBA PE=2 SV=1
 2514 : B6CWH8_ROULE        0.40  0.69  145  288    3  142  146    2    8  142  B6CWH8     Hemoglobin alpha chain OS=Rousettus leschenaultii GN=HBA PE=2 SV=1
 2515 : B6CWH9_TAPME        0.40  0.69  145  288    3  142  146    2    8  142  B6CWH9     Hemoglobin alpha chain OS=Taphozous melanopogon GN=HBA PE=2 SV=1
 2516 : B7SPR9_PERLE        0.40  0.72    2  141    4  147  146    2    8  147  B7SPR9     Beta-globin paralog 1 OS=Peromyscus leucopus GN=HBB-T1 PE=3 SV=1
 2517 : B8XJS4_GADMO        0.40  0.64  145  288    3  143  146    2    7  143  B8XJS4     Hemoglobin alpha 1 OS=Gadus morhua GN=HbA1 PE=2 SV=1
 2518 : C0H789_SALSA        0.40  0.65  145  288    3  143  146    2    7  143  C0H789     Hemoglobin subunit alpha-4 OS=Salmo salar GN=HBA4 PE=2 SV=1
 2519 : C3KID2_ANOFI        0.40  0.65  145  288    3  143  146    2    7  143  C3KID2     Hemoglobin subunit alpha-1 OS=Anoplopoma fimbria GN=HBA1 PE=2 SV=1
 2520 : C5MQQ9_PERMA        0.40  0.72    2  141    4  147  146    2    8  147  C5MQQ9     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 2521 : C5MQR4_PERMA        0.40  0.72    2  141    4  147  146    2    8  147  C5MQR4     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 2522 : C5MQS3_PERMA        0.40  0.72    2  141    4  147  146    2    8  147  C5MQS3     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 2523 : C5MQT2_PERMA        0.40  0.72    2  141    4  147  146    2    8  147  C5MQT2     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 2524 : C5MQT4_PERMA        0.40  0.71    2  141    4  147  146    2    8  147  C5MQT4     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 2525 : C5MQU8_PERMA        0.40  0.71    2  141    4  147  146    2    8  147  C5MQU8     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 2526 : C6KGT2_CERAT        0.40  0.70    2  141    4  147  146    2    8  147  C6KGT2     Beta hemoglobin OS=Cercocebus atys PE=2 SV=1
 2527 : C6ZP43_CAPHI        0.40  0.69  145  288    3  142  146    2    8  142  C6ZP43     I alpha globin OS=Capra hircus GN=HBAI PE=3 SV=1
 2528 : C6ZP44_SHEEP        0.40  0.69  145  288    3  142  146    2    8  142  C6ZP44     I alpha globin OS=Ovis aries ophion GN=HBAI PE=3 SV=1
 2529 : C6ZP46_AMMLE        0.40  0.69  145  288    3  142  146    2    8  142  C6ZP46     I alpha globin OS=Ammotragus lervia GN=HBAI PE=3 SV=1
 2530 : C6ZP47_OVIMU        0.40  0.69  145  288    3  142  146    2    8  142  C6ZP47     I alpha globin OS=Ovis orientalis musimon GN=HBAI PE=3 SV=1
 2531 : C6ZP48_CAPHI        0.40  0.68  145  288    3  142  146    2    8  142  C6ZP48     I alpha globin OS=Capra hircus GN=HBAI PE=3 SV=1
 2532 : C6ZP49_CAPHI        0.40  0.68  145  288    3  142  146    2    8  142  C6ZP49     II alpha globin OS=Capra hircus GN=HBAII PE=3 SV=1
 2533 : C6ZP50_AMMLE        0.40  0.68  145  288    3  142  146    2    8  142  C6ZP50     II alpha globin OS=Ammotragus lervia GN=HBAII PE=3 SV=1
 2534 : C6ZP52_CAPHI        0.40  0.67  145  288    3  142  146    2    8  142  C6ZP52     II alpha globin OS=Capra hircus GN=HBAII PE=3 SV=1
 2535 : C7EJW1_ANSSE        0.40  0.71  145  288    3  142  146    2    8  142  C7EJW1     Hemoglobin alpha A subunit OS=Anseranas semipalmata GN=HBA2 PE=3 SV=1
 2536 : C7EJW6_DENAU        0.40  0.73  145  288    3  142  146    2    8  142  C7EJW6     Hemoglobin alpha A subunit OS=Dendrocygna autumnalis GN=HBA2 PE=3 SV=1
 2537 : C7EJW8_DENAR        0.40  0.73  145  288    3  142  146    2    8  142  C7EJW8     Hemoglobin alpha A subunit OS=Dendrocygna arborea GN=HBA2 PE=3 SV=1
 2538 : C7EJX9_CERNO        0.40  0.73  145  288    3  142  146    2    8  142  C7EJX9     Hemoglobin alpha A subunit OS=Cereopsis novaehollandiae GN=HBA2 PE=3 SV=1
 2539 : C7S341_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S341     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2540 : C7S342_PERMA        0.40  0.67  145  288    3  141  146    3    9  141  C7S342     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2541 : C7S343_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S343     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2542 : C7S345_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S345     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2543 : C7S347_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S347     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2544 : C7S350_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S350     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2545 : C7S351_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S351     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2546 : C7S352_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S352     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2547 : C7S357_PERMA        0.40  0.67  145  288    3  141  146    3    9  141  C7S357     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2548 : C7S358_PERMA        0.40  0.67  145  288    3  141  146    3    9  141  C7S358     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2549 : C7S365_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S365     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2550 : C7S370_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S370     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2551 : C7S374_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S374     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2552 : C7S379_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S379     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2553 : C7S380_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S380     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2554 : C7S383_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S383     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2555 : C7S384_PERMA        0.40  0.67  145  288    3  141  146    3    9  141  C7S384     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2556 : C7S388_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S388     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2557 : C7S3A8_PERMA        0.40  0.69  148  288    6  142  143    2    8  142  C7S3A8     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2558 : C7S3B6_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S3B6     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2559 : C7S3C6_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3C6     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2560 : C7S3C9_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3C9     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2561 : C7S3D2_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3D2     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2562 : C7S3D4_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3D4     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2563 : C7S3D6_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3D6     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2564 : C7S3D7_PERMA        0.40  0.67  145  288    3  141  146    3    9  141  C7S3D7     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2565 : C7S3F2_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3F2     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2566 : C7S3G0_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S3G0     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2567 : C7S3G8_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3G8     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2568 : C7S3H0_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3H0     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2569 : C7S3H1_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3H1     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2570 : C7S3I0_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3I0     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2571 : C7S3I5_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3I5     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2572 : C7S3J3_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3J3     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2573 : C7S3J4_PERMA        0.40  0.67  145  288    3  142  146    2    8  142  C7S3J4     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2574 : C7S3J6_PERMA        0.40  0.68  145  288    3  141  146    3    9  141  C7S3J6     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2575 : C7S3J9_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  C7S3J9     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2576 : C8AUM4_PERMA        0.40  0.71    2  141    4  147  146    2    8  147  C8AUM4     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T2 PE=3 SV=1
 2577 : C8AUN2_PERMA        0.40  0.72    2  141    4  147  146    2    8  147  C8AUN2     Beta globin OS=Peromyscus maniculatus GN=HBB-T2 PE=3 SV=1
 2578 : C8AUN8_PERMA        0.40  0.71    2  141    4  147  146    2    8  147  C8AUN8     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T2 PE=3 SV=1
 2579 : D0U269_MUSMC        0.40  0.71    2  141    4  147  146    2    8  147  D0U269     Beta-globin OS=Mus musculus castaneus GN=Hbbt1 PE=3 SV=1
 2580 : D0U270_MUSMC        0.40  0.71    2  141    4  147  146    2    8  147  D0U270     Beta-globin OS=Mus musculus castaneus GN=Hbbt1 PE=3 SV=1
 2581 : D0U271_MUSCE        0.40  0.73    2  141    4  147  146    2    8  147  D0U271     Beta-globin OS=Mus cervicolor GN=Hbbt1 PE=3 SV=1
 2582 : D0U274_MUSMA        0.40  0.72    2  141    4  147  146    2    8  147  D0U274     Beta-globin OS=Mus macedonicus GN=Hbbt1 PE=3 SV=1
 2583 : D0U279_MUSSA        0.40  0.72    2  141    4  147  146    2    8  147  D0U279     Beta-globin OS=Mus saxicola GN=Hbbt1 PE=3 SV=1
 2584 : D0U281_MUSSP        0.40  0.72    2  141    4  147  146    2    8  147  D0U281     Beta-globin OS=Mus spretus GN=Hbbt1 PE=3 SV=1
 2585 : D0U282_MUSSI        0.40  0.71    2  141    4  147  146    2    8  147  D0U282     Beta-globin OS=Mus spicilegus GN=Hbbt1 PE=3 SV=1
 2586 : D1MPT0_EQUAS1S0H    0.40  0.71    2  141    3  146  146    2    8  146  D1MPT0     Hemoglobin beta chain OS=Equus asinus PE=1 SV=1
 2587 : D3TTK1_DELDE        0.40  0.69    2  141    4  147  146    2    8  147  D3TTK1     Hemoglobin beta1 chain OS=Delphinus delphis PE=2 SV=1
 2588 : D3TTK2_DELDE        0.40  0.69    2  141    4  147  146    2    8  147  D3TTK2     Hemoglobin beta2 chain OS=Delphinus delphis PE=2 SV=1
 2589 : D3TTK3_DELDE        0.40  0.69    2  141    4  147  146    2    8  147  D3TTK3     Hemoglobin beta4 chain OS=Delphinus delphis PE=2 SV=1
 2590 : D3TTK4_DELDE        0.40  0.69    2  141    4  147  146    2    8  147  D3TTK4     Hemoglobin beta5 chain OS=Delphinus delphis PE=2 SV=1
 2591 : D3U1G4_ELEMA        0.40  0.68  145  288    3  142  146    2    8  142  D3U1G4     Hemoglobin subunit alpha OS=Elephas maximus GN=HBA-T2 PE=2 SV=1
 2592 : D3U1H2_LOXAF        0.40  0.68  145  288    3  142  146    2    8  142  D3U1H2     Hemoglobin subunit alpha OS=Loxodonta africana GN=HBA-T2 PE=2 SV=1
 2593 : D3U1H8_MAMPR3VRE    0.40  0.68  145  288    3  142  146    2    8  142  D3U1H8     Hemoglobin subunit alpha OS=Mammuthus primigenius GN=HBA-T2 PE=1 SV=1
 2594 : D3U1H9_MAMPR3VRE    0.40  0.68    2  141    4  147  146    2    8  147  D3U1H9     Hemoglobin subunit beta/delta hybrid OS=Mammuthus primigenius GN=HBB/D PE=1 SV=1
 2595 : D4N6V9_MUSMC        0.40  0.72    2  141    4  147  146    2    8  147  D4N6V9     Beta-globin OS=Mus musculus castaneus GN=Hbbt1 PE=3 SV=1
 2596 : D4QBB4_BOVIN        0.40  0.71    1  141    1  145  147    2    8  145  D4QBB4     Hemoglobin beta OS=Bos taurus GN=HBB PE=2 SV=1
 2597 : D4QBB8_BOSIN        0.40  0.71    1  141    1  145  147    2    8  145  D4QBB8     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
 2598 : D4QBD0_BOSIN        0.40  0.71    1  141    1  145  147    2    8  145  D4QBD0     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
 2599 : D4QBD1_BOSIN        0.40  0.71    1  141    1  145  147    2    8  145  D4QBD1     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
 2600 : D4QBD6_BOSJA        0.40  0.71    1  141    1  145  147    2    8  145  D4QBD6     Hemoglobin beta OS=Bos javanicus GN=HBB PE=3 SV=1
 2601 : D4QBD7_BOSJA        0.40  0.71    1  141    1  145  147    2    8  145  D4QBD7     Hemoglobin beta OS=Bos javanicus javanicus GN=HBB PE=3 SV=1
 2602 : D4QBE2_BOSJA        0.40  0.71    1  141    1  145  147    2    8  145  D4QBE2     Hemoglobin beta OS=Bos javanicus javanicus GN=HBB PE=3 SV=1
 2603 : D4QBE6_9CETA        0.40  0.71    1  141    1  145  147    2    8  145  D4QBE6     Hemoglobin beta OS=Bos javanicus birmanicus x Bos indicus GN=HBB PE=3 SV=1
 2604 : D4QBE7_9CETA        0.40  0.71    1  141    1  145  147    2    8  145  D4QBE7     Hemoglobin beta OS=Bos javanicus birmanicus x Bos indicus GN=HBB PE=3 SV=1
 2605 : D4QBF1_BOSGF        0.40  0.71    1  141    1  145  147    2    8  145  D4QBF1     Hemoglobin beta OS=Bos frontalis frontalis GN=HBB PE=3 SV=1
 2606 : D4QBF3_BOSMU        0.40  0.71    1  141    1  145  147    2    8  145  D4QBF3     Hemoglobin beta OS=Bos mutus grunniens GN=HBB PE=3 SV=1
 2607 : D4QBF4_BOSMU        0.40  0.71    1  141    1  145  147    2    8  145  D4QBF4     Hemoglobin beta OS=Bos mutus grunniens GN=HBB PE=3 SV=1
 2608 : D4QBF7_BISBI        0.40  0.71    1  141    1  145  147    2    8  145  D4QBF7     Hemoglobin beta OS=Bison bison GN=HBB PE=3 SV=1
 2609 : D7RTP9_BRABN        0.40  0.72  145  288    2  141  146    2    8  141  D7RTP9     Hemoglobin alpha D subunit OS=Branta bernicla GN=HBA1 PE=3 SV=1
 2610 : D7RTQ0_BRACA        0.40  0.72  145  288    2  141  146    2    8  141  D7RTQ0     Hemoglobin alpha D subunit OS=Branta canadensis GN=HBA1 PE=3 SV=1
 2611 : D7RTQ1_BRALE        0.40  0.72  145  288    2  141  146    2    8  141  D7RTQ1     Hemoglobin alpha D subunit OS=Branta leucopsis GN=HBA1 PE=3 SV=1
 2612 : D7RTQ2_BRASA        0.40  0.72  145  288    2  141  146    2    8  141  D7RTQ2     Hemoglobin alpha D subunit OS=Branta sandvicensis GN=HBA1 PE=3 SV=1
 2613 : D7RTQ3_ANSCE        0.40  0.72  145  288    2  141  146    2    8  141  D7RTQ3     Hemoglobin alpha D subunit OS=Anser caerulescens GN=HBA1 PE=3 SV=1
 2614 : D7RTQ4_ANSRO        0.40  0.72  145  288    2  141  146    2    8  141  D7RTQ4     Hemoglobin alpha D subunit OS=Anser rossii GN=HBA1 PE=3 SV=1
 2615 : D7RTQ5_CHECA        0.40  0.72  145  288    2  141  146    2    8  141  D7RTQ5     Hemoglobin alpha D subunit OS=Chen canagica GN=HBA1 PE=3 SV=1
 2616 : D7RTQ6_ANSCY        0.40  0.72  145  288    2  141  146    2    8  141  D7RTQ6     Hemoglobin alpha D subunit OS=Anser cygnoides GN=HBA1 PE=3 SV=1
 2617 : D7RTQ7_ANSIN        0.40  0.72  145  288    2  141  146    2    8  141  D7RTQ7     Hemoglobin alpha D subunit OS=Anser indicus GN=HBA1 PE=3 SV=1
 2618 : D7RTQ9_ANSAL        0.40  0.72  145  288    2  141  146    2    8  141  D7RTQ9     Hemoglobin alpha D subunit OS=Anser albifrons GN=HBA1 PE=3 SV=1
 2619 : D7RTR0_9AVES        0.40  0.72  145  288    2  141  146    2    8  141  D7RTR0     Hemoglobin alpha D subunit OS=Anser anser GN=HBA1 PE=3 SV=1
 2620 : D7RTR2_9AVES        0.40  0.72  145  288    2  141  146    2    8  141  D7RTR2     Hemoglobin alpha D subunit OS=Anser fabalis GN=HBA1 PE=3 SV=1
 2621 : D7RTR3_CYGBU        0.40  0.71  145  288    2  141  146    2    8  141  D7RTR3     Hemoglobin alpha D subunit OS=Cygnus buccinator GN=HBA1 PE=3 SV=1
 2622 : D7RTR4_CYGAT        0.40  0.72  145  288    2  141  146    2    8  141  D7RTR4     Hemoglobin alpha D subunit OS=Cygnus atratus GN=HBA1 PE=3 SV=1
 2623 : D7RTR5_CYGCO        0.40  0.71  145  288    2  141  146    2    8  141  D7RTR5     Hemoglobin alpha D subunit OS=Cygnus columbianus GN=HBA1 PE=3 SV=1
 2624 : D7RTR6_CYGOL        0.40  0.72  145  288    2  141  146    2    8  141  D7RTR6     Hemoglobin alpha D subunit OS=Cygnus olor GN=HBA1 PE=3 SV=1
 2625 : D7RTR7_9AVES        0.40  0.71  145  288    2  141  146    2    8  141  D7RTR7     Hemoglobin alpha D subunit OS=Cygnus melancoryphus GN=HBA1 PE=3 SV=1
 2626 : D7RTS1_CERNO        0.40  0.71  145  288    2  141  146    2    8  141  D7RTS1     Hemoglobin alpha D subunit OS=Cereopsis novaehollandiae GN=HBA1 PE=3 SV=1
 2627 : D7RTS7_CHLME        0.40  0.72  145  288    2  141  146    2    8  141  D7RTS7     Hemoglobin alpha D subunit OS=Chloephaga melanoptera GN=HBA1 PE=3 SV=1
 2628 : E2ELZ8_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  E2ELZ8     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
 2629 : E2EM07_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  E2EM07     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
 2630 : E2EM16_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  E2EM16     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
 2631 : E2EM18_PERMA        0.40  0.68  145  288    3  142  146    2    8  142  E2EM18     Alpha-globin OS=Peromyscus maniculatus GN=Hba PE=2 SV=1
 2632 : E7F4I1_DANRE        0.40  0.67  145  288    3  143  146    2    7  143  E7F4I1     Uncharacterized protein OS=Danio rerio GN=hbaa1 PE=2 SV=1
 2633 : F1Q6I6_DANRE        0.40  0.67  145  288    3  143  146    2    7  143  F1Q6I6     Uncharacterized protein OS=Danio rerio GN=hbz PE=3 SV=2
 2634 : F1RGX4_PIG          0.40  0.65  145  288    3  142  146    2    8  142  F1RGX4     Uncharacterized protein OS=Sus scrofa GN=LOC100737768 PE=3 SV=1
 2635 : F2Z285_LEPEU3LQD    0.40  0.66  145  288    2  141  146    2    8  141  F2Z285     Hemoglobin subunit alpha OS=Lepus europaeus PE=1 SV=1
 2636 : F6MFG2_PANHO        0.40  0.70  145  288    3  142  146    2    8  142  F6MFG2     Hemoglobin alpha chain OS=Pantholops hodgsonii PE=2 SV=1
 2637 : F6RDD3_HORSE        0.40  0.71    2  141    4  147  146    2    8  147  F6RDD3     Hemoglobin subunit beta OS=Equus caballus GN=HBB PE=3 SV=1
 2638 : F6VEZ4_CALJA        0.40  0.71    2  141    4  147  146    2    8  147  F6VEZ4     Uncharacterized protein OS=Callithrix jacchus GN=HBD PE=3 SV=1
 2639 : F6YIC8_HORSE        0.40  0.72  145  288    3  142  146    2    8  142  F6YIC8     Hemoglobin subunit zeta OS=Equus caballus GN=HBZ1 PE=3 SV=1
 2640 : F7AI41_ORNAN        0.40  0.72    2  141    8  151  146    2    8  151  F7AI41     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus GN=LOC100088690 PE=3 SV=1
 2641 : F7AV81_MACMU        0.40  0.70    2  141    4  147  146    2    8  147  F7AV81     Hemoglobin beta chain OS=Macaca mulatta GN=HBB PE=2 SV=1
 2642 : G1N9E8_MELGA        0.40  0.74  145  288    3  142  146    2    8  142  G1N9E8     Uncharacterized protein OS=Meleagris gallopavo GN=P23 PE=3 SV=1
 2643 : G1Q6N1_MYOLU        0.40  0.69  145  288    3  142  146    2    8  142  G1Q6N1     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
 2644 : G1R963_NOMLE        0.40  0.68  145  288    3  142  146    2    8  142  G1R963     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100583507 PE=3 SV=1
 2645 : G3PL41_GASAC        0.40  0.68  145  288    4  144  146    2    7  144  G3PL41     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 2646 : G3RLZ6_GORGO        0.40  0.67  157  288   18  145  134    2    8  145  G3RLZ6     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
 2647 : G3RNU8_GORGO        0.40  0.68  157  288   18  145  134    2    8  145  G3RNU8     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
 2648 : G3S2S3_GORGO        0.40  0.71    2  141    4  147  146    2    8  147  G3S2S3     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
 2649 : G3S489_GORGO        0.40  0.68  145  288    3  142  146    2    8  142  G3S489     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
 2650 : G3SF30_GORGO        0.40  0.68  157  288   18  145  134    2    8  145  G3SF30     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
 2651 : G3V8R3_RAT          0.40  0.69  145  288    3  142  146    2    8  142  G3V8R3     Protein Hbz OS=Rattus norvegicus GN=Hbz PE=3 SV=1
 2652 : G5BS34_HETGA        0.40  0.69    2  141    4  147  146    2    8  147  G5BS34     Hemoglobin subunit gamma OS=Heterocephalus glaber GN=GW7_03825 PE=3 SV=1
 2653 : G5BXY3_HETGA        0.40  0.72  145  288    3  142  146    2    8  142  G5BXY3     Hemoglobin subunit zeta OS=Heterocephalus glaber GN=GW7_13000 PE=3 SV=1
 2654 : G7PQY3_MACFA        0.40  0.70    2  141    4  147  146    2    8  147  G7PQY3     Hemoglobin beta chain OS=Macaca fascicularis GN=EGM_05960 PE=3 SV=1
 2655 : G8ZF10_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF10     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2656 : G8ZF16_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF16     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2657 : G8ZF18_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF18     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2658 : G8ZF19_RABIT        0.40  0.67  145  288    3  142  146    2    8  142  G8ZF19     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2659 : G8ZF20_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF20     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2660 : G8ZF22_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF22     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2661 : G8ZF24_RABIT        0.40  0.67  145  288    3  142  146    2    8  142  G8ZF24     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2662 : G8ZF25_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF25     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2663 : G8ZF27_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF27     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2664 : G8ZF28_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF28     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2665 : G8ZF31_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF31     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2666 : G8ZF32_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF32     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2667 : G8ZF33_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF33     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2668 : G8ZF35_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF35     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2669 : G8ZF38_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF38     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2670 : G8ZF40_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF40     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2671 : G8ZF41_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF41     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2672 : G8ZF42_RABIT        0.40  0.67  145  288    3  142  146    2    8  142  G8ZF42     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2673 : G8ZF50_RABIT        0.40  0.66  145  288    3  142  146    2    8  142  G8ZF50     Alpha-globin 2 OS=Oryctolagus cuniculus GN=HBA2 PE=3 SV=1
 2674 : G8ZF61_SYLFL        0.40  0.68  145  288    3  142  146    2    8  142  G8ZF61     Alpha-globin OS=Sylvilagus floridanus GN=HBA PE=3 SV=1
 2675 : G9FTH2_CONCR        0.40  0.69    2  141    4  147  146    2    8  147  G9FTH2     Hemoglobin subunit delta 2 OS=Condylura cristata GN=HBD2 PE=2 SV=1
 2676 : G9FTH3_CONCR        0.40  0.69    2  141    4  147  146    2    8  147  G9FTH3     Hemoglobin subunit delta 1 OS=Condylura cristata GN=HBD1 PE=2 SV=1
 2677 : G9K3W2_MUSPF        0.40  0.72    2  140    7  149  145    2    8  149  G9K3W2     Hemoglobin, gamma A (Fragment) OS=Mustela putorius furo PE=2 SV=1
 2678 : H2NPI7_PONAB        0.40  0.69  145  288    3  142  146    2    8  142  H2NPI7     Uncharacterized protein OS=Pongo abelii GN=HBA2 PE=3 SV=1
 2679 : H3AAE3_LATCH        0.40  0.62  145  288    3  143  146    2    7  143  H3AAE3     Uncharacterized protein OS=Latimeria chalumnae PE=3 SV=1
 2680 : H6QXI7_DISMA        0.40  0.68  145  288    3  143  146    2    7  143  H6QXI7     Alpha-globin OS=Dissostichus mawsoni PE=3 SV=1
 2681 : HBA1_ARCGA          0.40  0.65  145  288    3  142  146    2    8  142  P41329     Hemoglobin subunit alpha-1 OS=Arctocephalus galapagoensis PE=1 SV=2
 2682 : HBA1_BOSMU          0.40  0.69  145  288    2  141  146    2    8  141  P01967     Hemoglobin subunit alpha-1 OS=Bos mutus grunniens PE=1 SV=1
 2683 : HBA1_BUBBU          0.40  0.71  145  288    3  142  146    2    8  142  Q9TSN7     Hemoglobin subunit alpha-1 OS=Bubalus bubalis PE=2 SV=3
 2684 : HBA1_CAPHI  2RI4    0.40  0.69  145  288    3  142  146    2    8  142  P0CH25     Hemoglobin subunit alpha-1 OS=Capra hircus GN=HBA1 PE=1 SV=1
 2685 : HBA1_GADMO          0.40  0.64  145  288    3  143  146    2    7  143  P84609     Hemoglobin subunit alpha-1 OS=Gadus morhua GN=hba1 PE=1 SV=2
 2686 : HBA1_HYLLA          0.40  0.68  145  288    3  142  146    2    8  142  Q9TS35     Hemoglobin subunit alpha-1 OS=Hylobates lar GN=HBA1 PE=2 SV=2
 2687 : HBA1_LIPTU          0.40  0.65  145  288    3  143  146    2    7  143  P85081     Hemoglobin subunit alpha-1 OS=Liparis tunicatus GN=hba1 PE=1 SV=1
 2688 : HBA1_STEMC          0.40  0.71  145  288    2  141  146    2    8  141  P82111     Hemoglobin subunit alpha-1 OS=Stercorarius maccormicki PE=1 SV=1
 2689 : HBA1_TACAC          0.40  0.68  145  288    2  141  146    2    8  141  P01977     Hemoglobin subunit alpha-1 OS=Tachyglossus aculeatus aculeatus PE=1 SV=1
 2690 : HBA1_TRENE  1T1N    0.40  0.68  145  288    2  142  146    2    7  142  P45718     Hemoglobin subunit alpha-1 OS=Trematomus newnesi GN=hba1 PE=1 SV=1
 2691 : HBA2_ARCGA          0.40  0.66  145  288    3  142  146    2    8  142  P41330     Hemoglobin subunit alpha-2 OS=Arctocephalus galapagoensis PE=1 SV=2
 2692 : HBA2_BORSA          0.40  0.64  145  288    3  143  146    2    7  143  Q1AGS8     Hemoglobin subunit alpha-2 OS=Boreogadus saida GN=hba2 PE=1 SV=3
 2693 : HBA2_BOSMU          0.40  0.69  145  288    2  141  146    2    8  141  P01968     Hemoglobin subunit alpha-2 OS=Bos mutus grunniens PE=1 SV=1
 2694 : HBA2_CAPHI          0.40  0.68  145  288    3  142  146    2    8  142  P0CH26     Hemoglobin subunit alpha-2 OS=Capra hircus GN=HBA2 PE=1 SV=1
 2695 : HBA2_COTGO          0.40  0.67  145  288    3  143  146    2    7  143  P85083     Hemoglobin subunit alpha-2 OS=Cottoperca gobio GN=hba2 PE=1 SV=1
 2696 : HBA2_EQUGR          0.40  0.71  145  288    3  142  146    2    8  142  Q7JFN6     Hemoglobin subunit alpha-2 OS=Equus grevyi GN=HBA2 PE=2 SV=3
 2697 : HBA2_HYLLA          0.40  0.68  145  288    3  142  146    2    8  142  Q9TS34     Hemoglobin subunit alpha-2 OS=Hylobates lar GN=HBA2 PE=2 SV=2
 2698 : HBA2_TACAC          0.40  0.69  145  288    2  141  146    2    8  141  P01978     Hemoglobin subunit alpha-2 OS=Tachyglossus aculeatus aculeatus PE=1 SV=1
 2699 : HBA3_BUBBU          0.40  0.69  145  288    3  142  146    2    8  142  Q9TSN9     Hemoglobin subunit alpha-3 OS=Bubalus bubalis PE=2 SV=3
 2700 : HBA3_XENTR          0.40  0.69  145  288    3  142  146    2    8  142  P08422     Hemoglobin subunit alpha-3 OS=Xenopus tropicalis GN=hba-l8 PE=2 SV=2
 2701 : HBA4_BUBBU          0.40  0.70  145  288    3  142  146    2    8  142  Q9XSK1     Hemoglobin subunit alpha-4 OS=Bubalus bubalis PE=2 SV=3
 2702 : HBA5_XENLA          0.40  0.68  145  288    3  142  146    2    8  142  P06638     Hemoglobin subunit alpha-5 OS=Xenopus laevis GN=hba5 PE=2 SV=2
 2703 : HBAD_ANSAN          0.40  0.72  145  288    2  141  146    2    8  141  P04238     Hemoglobin subunit alpha-D OS=Anser anser anser GN=HBAD PE=1 SV=1
 2704 : HBAD_ANSIN          0.40  0.72  145  288    2  141  146    2    8  141  P04239     Hemoglobin subunit alpha-D OS=Anser indicus GN=HBAD PE=1 SV=1
 2705 : HBAD_APUAP          0.40  0.71  145  288    2  141  146    2    8  141  P15164     Hemoglobin subunit alpha-D OS=Apus apus GN=HBAD PE=1 SV=1
 2706 : HBAD_CAIMO          0.40  0.71  145  288    2  141  146    2    8  141  P02003     Hemoglobin subunit alpha-D OS=Cairina moschata GN=HBAD PE=2 SV=1
 2707 : HBAD_CHECB          0.40  0.73  145  288    2  141  146    2    8  141  Q9DF25     Hemoglobin subunit alpha-D OS=Chelonoidis carbonaria GN=HBAD PE=2 SV=1
 2708 : HBAD_CHLME          0.40  0.72  145  288    2  141  146    2    8  141  P07035     Hemoglobin subunit alpha-D OS=Chloephaga melanoptera GN=HBAD PE=1 SV=1
 2709 : HBAD_MELGA          0.40  0.69  145  288    2  141  146    2    8  141  P81024     Hemoglobin subunit alpha-D OS=Meleagris gallopavo GN=HBAD PE=1 SV=1
 2710 : HBAD_STUVU          0.40  0.71  145  288    2  141  146    2    8  141  P02004     Hemoglobin subunit alpha-D OS=Sturnus vulgaris GN=HBAD PE=1 SV=1
 2711 : HBA_AEGMO           0.40  0.73  145  288    3  142  146    2    8  142  P07417     Hemoglobin subunit alpha-A OS=Aegypius monachus GN=HBAA PE=1 SV=2
 2712 : HBA_AMMLE           0.40  0.69  145  288    3  142  146    2    8  142  P68239     Hemoglobin subunit alpha-1/2 OS=Ammotragus lervia PE=1 SV=2
 2713 : HBA_ANSSE           0.40  0.71  145  288    3  142  146    2    8  142  P01985     Hemoglobin subunit alpha-A OS=Anseranas semipalmata GN=HBAA PE=1 SV=2
 2714 : HBA_ANTPA           0.40  0.68  145  288    3  142  146    2    8  142  P14387     Hemoglobin subunit alpha OS=Antrozous pallidus GN=HBA PE=1 SV=2
 2715 : HBA_APTFO           0.40  0.73  145  288    3  142  146    2    8  142  P01980     Hemoglobin subunit alpha OS=Aptenodytes forsteri GN=HBA PE=1 SV=3
 2716 : HBA_APUAP           0.40  0.71  145  288    3  142  146    2    8  142  P15162     Hemoglobin subunit alpha-A OS=Apus apus GN=HBAA PE=1 SV=2
 2717 : HBA_BISBO           0.40  0.70  145  288    3  142  146    2    8  142  P09423     Hemoglobin subunit alpha-I/II OS=Bison bonasus PE=1 SV=2
 2718 : HBA_BOSGF           0.40  0.70  145  288    3  142  146    2    8  142  P01969     Hemoglobin subunit alpha OS=Bos gaurus frontalis GN=HBA PE=1 SV=2
 2719 : HBA_BOVIN   2QSS    0.40  0.69  145  288    3  142  146    2    8  142  P01966     Hemoglobin subunit alpha OS=Bos taurus GN=HBA PE=1 SV=2
 2720 : HBA_CALAR           0.40  0.68  145  288    2  141  146    2    8  141  P18972     Hemoglobin subunit alpha OS=Callithrix argentata GN=HBA PE=1 SV=1
 2721 : HBA_CARCR           0.40  0.71  145  288    2  141  146    2    8  141  Q10732     Hemoglobin subunit alpha-A OS=Caretta caretta GN=HBAA PE=1 SV=1
 2722 : HBA_CERSI           0.40  0.68  145  288    3  142  146    2    8  142  P01963     Hemoglobin subunit alpha OS=Ceratotherium simum GN=HBA PE=1 SV=2
 2723 : HBA_CHAMP           0.40  0.69  145  288    2  141  146    2    8  141  Q7M2Y4     Hemoglobin subunit alpha OS=Chalinolobus morio GN=HBA PE=1 SV=1
 2724 : HBA_CHRPI           0.40  0.73  145  288    2  141  146    2    8  141  P13273     Hemoglobin subunit alpha-A OS=Chrysemys picta bellii GN=HBAA PE=1 SV=1
 2725 : HBA_CHRRI           0.40  0.71  145  288    2  141  146    2    8  141  P08260     Hemoglobin subunit alpha-A OS=Chroicocephalus ridibundus GN=HBAA PE=1 SV=1
 2726 : HBA_COLLI   2R80    0.40  0.72  145  288    3  142  146    2    8  142  P21871     Hemoglobin subunit alpha-A OS=Columba livia GN=HBAA PE=1 SV=2
 2727 : HBA_CRIGA           0.40  0.68  145  288    3  142  146    2    8  142  P19014     Hemoglobin subunit alpha OS=Cricetomys gambianus GN=HBA PE=1 SV=2
 2728 : HBA_CROCR           0.40  0.66  145  288    2  141  146    2    8  141  P18973     Hemoglobin subunit alpha OS=Crocuta crocuta GN=HBA PE=1 SV=1
 2729 : HBA_CRONI           0.40  0.73  145  288    2  141  146    2    8  141  P01998     Hemoglobin subunit alpha OS=Crocodylus niloticus GN=HBA PE=1 SV=1
 2730 : HBA_CROSI           0.40  0.72  145  288    2  141  146    2    8  141  B0M2T2     Hemoglobin subunit alpha OS=Crocodylus siamensis GN=HBA PE=1 SV=1
 2731 : HBA_CTEGU           0.40  0.68  145  288    2  141  146    2    8  141  P20854     Hemoglobin subunit alpha OS=Ctenodactylus gundi GN=HBA PE=1 SV=1
 2732 : HBA_CYNSP           0.40  0.69  145  288    2  141  146    2    8  141  P11753     Hemoglobin subunit alpha OS=Cynopterus sphinx GN=HBA PE=1 SV=1
 2733 : HBA_CYPCA           0.40  0.67  145  288    3  143  146    2    7  143  P02016     Hemoglobin subunit alpha OS=Cyprinus carpio GN=hba PE=1 SV=3
 2734 : HBA_DANRE           0.40  0.67  145  288    3  143  146    2    7  143  Q90487     Hemoglobin subunit alpha OS=Danio rerio GN=hbaa1 PE=2 SV=3
 2735 : HBA_DASNO           0.40  0.68  145  288    2  141  146    2    8  141  P01964     Hemoglobin subunit alpha OS=Dasypus novemcinctus GN=HBA PE=1 SV=1
 2736 : HBA_DASVI           0.40  0.73  145  288    3  142  146    2    8  142  P07419     Hemoglobin subunit alpha OS=Dasyurus viverrinus GN=HBA PE=2 SV=2
 2737 : HBA_ELEMA           0.40  0.68  145  288    2  141  146    2    8  141  P01954     Hemoglobin subunit alpha OS=Elephas maximus GN=HBA PE=1 SV=1
 2738 : HBA_EQUAS   1S0H    0.40  0.71  145  288    3  142  146    2    8  142  P01959     Hemoglobin subunit alpha OS=Equus asinus GN=HBA1 PE=1 SV=3
 2739 : HBA_EQUPR           0.40  0.72  145  288    3  142  146    2    8  142  Q9XSE9     Hemoglobin subunit alpha OS=Equus caballus przewalskii GN=HBA PE=2 SV=3
 2740 : HBA_EQUZE           0.40  0.71  145  288    3  142  146    2    8  142  P01960     Hemoglobin subunit alpha OS=Equus zebra GN=HBA PE=1 SV=2
 2741 : HBA_ERIEU           0.40  0.69  145  288    2  141  146    2    8  141  P01949     Hemoglobin subunit alpha OS=Erinaceus europaeus GN=HBA PE=1 SV=1
 2742 : HBA_EULFU           0.40  0.66  145  288    2  141  146    2    8  141  P01936     Hemoglobin subunit alpha OS=Eulemur fulvus fulvus GN=HBA PE=1 SV=1
 2743 : HBA_FRAPO           0.40  0.73  145  288    2  141  146    2    8  141  P22741     Hemoglobin subunit alpha-A OS=Francolinus pondicerianus GN=HBAA PE=1 SV=1
 2744 : HBA_GORGO           0.40  0.69  145  288    2  141  146    2    8  141  P01923     Hemoglobin subunit alpha OS=Gorilla gorilla gorilla GN=HBA PE=1 SV=1
 2745 : HBA_GYMAC           0.40  0.66  145  288    2  142  146    2    7  142  P29623     Hemoglobin subunit alpha OS=Gymnodraco acuticeps GN=hba PE=1 SV=1
 2746 : HBA_GYPRU           0.40  0.72  145  288    2  141  146    2    8  141  P08256     Hemoglobin subunit alpha-A/A' OS=Gyps rueppellii GN=HBAA PE=1 SV=1
 2747 : HBA_HELMA           0.40  0.66  145  288    3  142  146    2    8  142  P68237     Hemoglobin subunit alpha OS=Helarctos malayanus GN=HBA PE=1 SV=2
 2748 : HBA_HIPAM           0.40  0.68  145  288    2  141  146    2    8  141  P19015     Hemoglobin subunit alpha OS=Hippopotamus amphibius GN=HBA PE=1 SV=1
 2749 : HBA_HORSE   2ZLU    0.40  0.72  145  288    3  142  146    2    8  142  P01958     Hemoglobin subunit alpha OS=Equus caballus GN=HBA PE=1 SV=2
 2750 : HBA_LAMGL           0.40  0.66  145  288    2  141  146    2    8  141  P01973     Hemoglobin subunit alpha OS=Lama glama GN=HBA PE=1 SV=1
 2751 : HBA_LAMGU           0.40  0.66  145  288    2  141  146    2    8  141  P67815     Hemoglobin subunit alpha OS=Lama guanicoe GN=HBA PE=1 SV=1
 2752 : HBA_LAMPA           0.40  0.66  145  288    2  141  146    2    8  141  P67816     Hemoglobin subunit alpha OS=Lama guanicoe pacos GN=HBA PE=1 SV=1
 2753 : HBA_LAMVI           0.40  0.66  145  288    2  141  146    2    8  141  P07425     Hemoglobin subunit alpha OS=Lama vicugna GN=HBA PE=1 SV=1
 2754 : HBA_LATCH           0.40  0.62  145  288    2  142  146    2    7  142  P23740     Hemoglobin subunit alpha OS=Latimeria chalumnae GN=HBA PE=1 SV=1
 2755 : HBA_LOXAF           0.40  0.68  145  288    2  141  146    2    8  141  P01955     Hemoglobin subunit alpha OS=Loxodonta africana GN=HBA PE=1 SV=1
 2756 : HBA_MACEU           0.40  0.71  145  288    3  142  146    2    8  142  P81043     Hemoglobin subunit alpha OS=Macropus eugenii GN=HBA PE=1 SV=3
 2757 : HBA_MACGI           0.40  0.71  145  288    2  141  146    2    8  141  P01975     Hemoglobin subunit alpha OS=Macropus giganteus GN=HBA PE=1 SV=1
 2758 : HBA_MELCA           0.40  0.64  145  288    2  141  146    2    8  141  P15448     Hemoglobin subunit alpha OS=Mellivora capensis GN=HBA PE=1 SV=1
 2759 : HBA_ODORO           0.40  0.66  145  288    2  141  146    2    8  141  P10778     Hemoglobin subunit alpha OS=Odobenus rosmarus divergens GN=HBA PE=1 SV=1
 2760 : HBA_ORNAN           0.40  0.68  145  288    2  141  146    2    8  141  P01979     Hemoglobin subunit alpha OS=Ornithorhynchus anatinus GN=HBA PE=1 SV=1
 2761 : HBA_PAGBO           0.40  0.67  145  288    2  142  146    2    7  142  P82990     Hemoglobin subunit alpha OS=Pagothenia borchgrevinki GN=hba PE=1 SV=1
 2762 : HBA_PANHO           0.40  0.70  145  288    3  142  146    2    8  142  Q0ZA50     Hemoglobin subunit alpha OS=Pantholops hodgsonii GN=HBA PE=2 SV=3
 2763 : HBA_PERCR           0.40  0.68  145  288    2  141  146    2    8  141  B3EWD3     Hemoglobin subunit alpha OS=Peromyscus crinitus PE=1 SV=1
 2764 : HBA_PHACA           0.40  0.70  145  288    2  141  146    2    8  141  P10780     Hemoglobin subunit alpha-A OS=Phalacrocorax carbo GN=HBAA PE=1 SV=1
 2765 : HBA_PHORU           0.40  0.73  145  288    2  141  146    2    8  141  P01984     Hemoglobin subunit alpha-A OS=Phoenicopterus ruber ruber GN=HBAA PE=1 SV=2
 2766 : HBA_PHOVI           0.40  0.66  145  288    2  141  146    2    8  141  P09908     Hemoglobin subunit alpha OS=Phoca vitulina GN=HBA PE=1 SV=1
 2767 : HBA_PIG     1QPW    0.40  0.65  145  288    2  141  146    2    8  141  P01965     Hemoglobin subunit alpha OS=Sus scrofa GN=HBA PE=1 SV=1
 2768 : HBA_PIPAB           0.40  0.67  145  288    3  143  146    2    7  143  Q862A7     Hemoglobin subunit alpha OS=Pipistrellus abramus GN=HBA PE=2 SV=3
 2769 : HBA_PONPY           0.40  0.68  145  288    3  142  146    2    8  142  P06635     Hemoglobin subunit alpha OS=Pongo pygmaeus GN=HBA1 PE=2 SV=2
 2770 : HBA_PSEUR           0.40  0.66  145  288    2  142  146    2    7  142  P83623     Hemoglobin subunit alpha OS=Pseudaphritis urvillii GN=hba PE=1 SV=1
 2771 : HBA_PTEAL           0.40  0.70  145  288    2  141  146    2    8  141  P14389     Hemoglobin subunit alpha OS=Pteropus alecto GN=HBA PE=1 SV=1
 2772 : HBA_PTEBR           0.40  0.66  145  288    2  141  146    2    8  141  P10885     Hemoglobin subunit alpha OS=Pteronura brasiliensis GN=HBA PE=1 SV=1
 2773 : HBA_PTEGI   3FH9    0.40  0.70  145  288    2  141  146    2    8  141  D0VX09     Hemoglobin subunit alpha OS=Pteropus giganteus GN=HBA PE=1 SV=1
 2774 : HBA_PTEPO           0.40  0.71  145  288    2  141  146    2    8  141  P14390     Hemoglobin subunit alpha OS=Pteropus poliocephalus GN=HBA PE=1 SV=1
 2775 : HBA_RABIT   2RAO    0.40  0.66  145  288    3  142  146    2    8  142  P01948     Hemoglobin subunit alpha-1/2 OS=Oryctolagus cuniculus PE=1 SV=2
 2776 : HBA_RHIUN           0.40  0.68  145  288    2  141  146    2    8  141  P09906     Hemoglobin subunit alpha OS=Rhinoceros unicornis GN=HBA PE=1 SV=1
 2777 : HBA_ROUAE           0.40  0.69  145  288    2  141  146    2    8  141  P01956     Hemoglobin subunit alpha OS=Rousettus aegyptiacus GN=HBA PE=1 SV=1
 2778 : HBA_SHEEP   2QU0    0.40  0.69  145  288    3  142  146    2    8  142  P68240     Hemoglobin subunit alpha-1/2 OS=Ovis aries PE=1 SV=2
 2779 : HBA_STUVU           0.40  0.71  145  288    2  141  146    2    8  141  P01997     Hemoglobin subunit alpha-A OS=Sturnus vulgaris GN=HBAA PE=1 SV=1
 2780 : HBA_TAPGE           0.40  0.69  145  288    2  141  146    2    8  141  P28780     Hemoglobin subunit alpha OS=Taphozous georgianus GN=HBA PE=1 SV=1
 2781 : HBA_THUTH           0.40  0.68  145  288    3  143  146    2    7  143  P11748     Hemoglobin subunit alpha OS=Thunnus thynnus GN=hba PE=1 SV=1
 2782 : HBA_TRAST           0.40  0.69  145  288    1  140  146    2    8  140  P04237     Hemoglobin subunit alpha OS=Tragelaphus strepsiceros GN=HBA PE=1 SV=1
 2783 : HBA_TREBE   1S5X    0.40  0.67  145  288    2  142  146    2    7  142  P80043     Hemoglobin subunit alpha OS=Trematomus bernacchii GN=hba PE=1 SV=1
 2784 : HBA_TRIIN           0.40  0.71  145  288    2  141  146    2    8  141  P07414     Hemoglobin subunit alpha OS=Trichechus inunguis GN=HBA PE=1 SV=1
 2785 : HBA_TRIOC           0.40  0.73  145  288    2  141  146    2    8  141  P19832     Hemoglobin subunit alpha-A OS=Trigonoceps occipitalis GN=HBAA PE=1 SV=1
 2786 : HBA_URSMA           0.40  0.66  145  288    3  142  146    2    8  142  P68235     Hemoglobin subunit alpha OS=Ursus maritimus GN=HBA PE=1 SV=2
 2787 : HBA_URSTH           0.40  0.66  145  288    3  142  146    2    8  142  P68236     Hemoglobin subunit alpha OS=Ursus thibetanus GN=HBA PE=1 SV=2
 2788 : HBB1_MOUSE  1JEB    0.40  0.71    2  141    4  147  146    2    8  147  P02088     Hemoglobin subunit beta-1 OS=Mus musculus GN=Hbb-b1 PE=1 SV=2
 2789 : HBB2_RAT            0.40  0.73    2  141    4  147  146    2    8  147  P11517     Hemoglobin subunit beta-2 OS=Rattus norvegicus PE=1 SV=2
 2790 : HBB_ALCAA           0.40  0.70    1  141    1  145  147    2    8  145  P02073     Hemoglobin subunit beta OS=Alces alces alces GN=HBB PE=1 SV=1
 2791 : HBB_ALOBE           0.40  0.70    2  141    4  147  146    2    8  147  Q6WN29     Hemoglobin subunit beta OS=Alouatta belzebul GN=HBB PE=2 SV=3
 2792 : HBB_AOTTR           0.40  0.70    2  141    3  146  146    2    8  146  P02035     Hemoglobin subunit beta OS=Aotus trivirgatus GN=HBB PE=1 SV=1
 2793 : HBB_BLABR           0.40  0.73    2  141    3  146  146    2    8  146  B3EWE2     Hemoglobin subunit beta OS=Blarina brevicauda PE=1 SV=1
 2794 : HBB_BOSMU           0.40  0.71    1  141    1  145  147    2    8  145  P02072     Hemoglobin subunit beta OS=Bos mutus grunniens GN=HBB PE=1 SV=1
 2795 : HBB_BOVIN   2QSS    0.40  0.71    1  141    1  145  147    2    8  145  P02070     Hemoglobin subunit beta OS=Bos taurus GN=HBB PE=1 SV=1
 2796 : HBB_BRATR           0.40  0.68    2  141    4  147  146    2    8  147  P14526     Hemoglobin subunit beta OS=Bradypus tridactylus GN=HBB PE=1 SV=3
 2797 : HBB_CALTO           0.40  0.70    2  141    4  147  146    2    8  147  Q6WN20     Hemoglobin subunit beta OS=Callicebus torquatus GN=HBB PE=2 SV=3
 2798 : HBB_CEBAL           0.40  0.71    2  141    3  146  146    2    8  146  P02040     Hemoglobin subunit beta OS=Cebus albifrons GN=HBB PE=1 SV=1
 2799 : HBB_CERAT           0.40  0.70    2  141    3  146  146    2    8  146  P02031     Hemoglobin subunit beta OS=Cercocebus atys GN=HBB PE=1 SV=1
 2800 : HBB_CERSI           0.40  0.71    2  141    3  146  146    2    8  146  P02066     Hemoglobin subunit beta OS=Ceratotherium simum GN=HBB PE=1 SV=1
 2801 : HBB_EQUHE           0.40  0.70    2  141    3  146  146    2    8  146  P67823     Hemoglobin subunit beta OS=Equus hemionus kulan GN=HBB PE=1 SV=1
 2802 : HBB_EQUZE           0.40  0.70    2  141    3  146  146    2    8  146  P67824     Hemoglobin subunit beta OS=Equus zebra GN=HBB PE=1 SV=1
 2803 : HBB_HORSE   2ZLU    0.40  0.71    2  141    3  146  146    2    8  146  P02062     Hemoglobin subunit beta OS=Equus caballus GN=HBB PE=1 SV=1
 2804 : HBB_LAGLA           0.40  0.71    2  141    4  147  146    2    8  147  Q6WN25     Hemoglobin subunit beta OS=Lagothrix lagotricha GN=HBB PE=2 SV=3
 2805 : HBB_MACFA           0.40  0.70    2  141    4  147  146    2    8  147  P68223     Hemoglobin subunit beta OS=Macaca fascicularis GN=HBB PE=1 SV=2
 2806 : HBB_MACFU           0.40  0.70    2  141    4  147  146    2    8  147  P68222     Hemoglobin subunit beta OS=Macaca fuscata fuscata GN=HBB PE=1 SV=2
 2807 : HBB_MACNE           0.40  0.70    2  141    4  147  146    2    8  147  P68225     Hemoglobin subunit beta OS=Macaca nemestrina GN=HBB PE=1 SV=2
 2808 : HBB_MACSP           0.40  0.70    2  141    4  147  146    2    8  147  P68224     Hemoglobin subunit beta OS=Macaca speciosa GN=HBB PE=1 SV=2
 2809 : HBB_MARMA           0.40  0.72    2  141    3  146  146    2    8  146  P08853     Hemoglobin subunit beta OS=Marmota marmota marmota GN=HBB PE=1 SV=1
 2810 : HBB_MEGLY           0.40  0.70    2  141    3  146  146    2    8  146  P11752     Hemoglobin subunit beta OS=Megaderma lyra GN=HBB PE=1 SV=1
 2811 : HBB_MICPE           0.40  0.73    2  141    3  146  146    2    8  146  B3EWE4     Hemoglobin subunit beta OS=Microtus pennsylvanicus PE=1 SV=1
 2812 : HBB_MUSLU           0.40  0.71    2  141    3  146  146    2    8  146  P23602     Hemoglobin subunit beta OS=Mustela lutreola GN=HBB PE=1 SV=1
 2813 : HBB_ODOVI   1HDS    0.40  0.72    1  141    1  145  147    2    8  145  P02074     Hemoglobin subunit beta-3 OS=Odocoileus virginianus virginianus GN=HBB PE=1 SV=1
 2814 : HBB_ONDZI           0.40  0.72    2  141    3  146  146    2    8  146  P02093     Hemoglobin subunit beta OS=Ondatra zibethicus GN=HBB PE=1 SV=2
 2815 : HBB_OTOCR           0.40  0.70    2  141    3  146  146    2    8  146  P02050     Hemoglobin subunit beta-1/2 OS=Otolemur crassicaudatus GN=HBB PE=1 SV=1
 2816 : HBB_PERCA           0.40  0.73    2  141    3  146  146    2    8  146  B3EWD6     Hemoglobin subunit beta OS=Peromyscus californicus PE=1 SV=1
 2817 : HBB_PERCR           0.40  0.73    2  141    3  146  146    2    8  146  B3EWD4     Hemoglobin subunit beta OS=Peromyscus crinitus PE=1 SV=1
 2818 : HBB_PITPI           0.40  0.70    2  141    4  147  146    2    8  147  Q6WN27     Hemoglobin subunit beta OS=Pithecia pithecia GN=HBB PE=2 SV=3
 2819 : HBB_PTEAL           0.40  0.70    2  141    3  146  146    2    8  146  P14391     Hemoglobin subunit beta OS=Pteropus alecto GN=HBB PE=1 SV=1
 2820 : HBB_PTEGI   3FH9    0.40  0.70    2  141    3  146  146    2    8  146  D0VX08     Hemoglobin subunit beta OS=Pteropus giganteus GN=HBB PE=1 SV=1
 2821 : HBB_PTEPO           0.40  0.70    2  141    3  146  146    2    8  146  P14392     Hemoglobin subunit beta OS=Pteropus poliocephalus GN=HBB PE=1 SV=1
 2822 : HBB_RHIUN           0.40  0.71    2  141    3  146  146    2    8  146  P09907     Hemoglobin subunit beta OS=Rhinoceros unicornis GN=HBB PE=1 SV=1
 2823 : HBB_ROUAE           0.40  0.70    2  141    3  146  146    2    8  146  P02058     Hemoglobin subunit beta OS=Rousettus aegyptiacus GN=HBB PE=1 SV=1
 2824 : HBB_SAGFU           0.40  0.71    2  141    3  146  146    2    8  146  P02039     Hemoglobin subunit beta OS=Saguinus fuscicollis GN=HBB PE=1 SV=1
 2825 : HBB_SCICA           0.40  0.73    2  141    3  146  146    2    8  146  B3EWD2     Hemoglobin subunit beta OS=Sciurus carolinensis PE=1 SV=1
 2826 : HBB_SMICR           0.40  0.72    2  141    4  147  146    2    8  147  Q28932     Hemoglobin subunit beta OS=Sminthopsis crassicaudata GN=HBB PE=2 SV=3
 2827 : HBB_SPAEH           0.40  0.73    2  141    3  146  146    2    8  146  P02090     Hemoglobin subunit beta OS=Spalax ehrenbergi GN=HBB PE=1 SV=1
 2828 : HBB_SPETO           0.40  0.72    2  141    3  146  146    2    8  146  P07410     Hemoglobin subunit beta-S/F OS=Spermophilus townsendii PE=1 SV=1
 2829 : HBB_TALEU           0.40  0.69    2  141    3  146  146    2    8  146  P02061     Hemoglobin subunit beta OS=Talpa europaea GN=HBB PE=1 SV=1
 2830 : HBB_TAMHU           0.40  0.71    2  141    3  146  146    2    8  146  B3EWD8     Hemoglobin subunit beta OS=Tamiasciurus hudsonicus PE=1 SV=1
 2831 : HBB_TAMMR           0.40  0.73    2  141    3  146  146    2    8  146  B3EWC8     Hemoglobin subunit beta OS=Tamias merriami PE=1 SV=1
 2832 : HBB_TAMST           0.40  0.73    2  141    3  146  146    2    8  146  B3EWE0     Hemoglobin subunit beta OS=Tamias striatus PE=1 SV=1
 2833 : HBB_TARSY           0.40  0.73    2  141    4  147  146    2    8  147  P13557     Hemoglobin subunit beta OS=Tarsius syrichta GN=HBB PE=2 SV=2
 2834 : HBB_THEGE           0.40  0.70    2  141    3  146  146    2    8  146  P02029     Hemoglobin subunit beta OS=Theropithecus gelada GN=HBB PE=1 SV=1
 2835 : HBB_TRAST           0.40  0.71    1  141    1  145  147    2    8  145  P04245     Hemoglobin subunit beta OS=Tragelaphus strepsiceros GN=HBB PE=1 SV=1
 2836 : HBD_AOTTR           0.40  0.72    2  141    3  146  146    2    8  146  P02046     Hemoglobin subunit delta OS=Aotus trivirgatus GN=HBD PE=1 SV=1
 2837 : HBD_ATEFU           0.40  0.72    2  141    3  146  146    2    8  146  P33499     Hemoglobin subunit delta OS=Ateles fusciceps GN=HBD PE=1 SV=1
 2838 : HBD_HUMAN   1SI4    0.40  0.71    2  141    4  147  146    2    8  147  P02042     Hemoglobin subunit delta OS=Homo sapiens GN=HBD PE=1 SV=2
 2839 : HBD_SAGMY           0.40  0.72    2  141    3  146  146    2    8  146  P68014     Hemoglobin subunit delta OS=Saguinus mystax GN=HBD PE=1 SV=1
 2840 : HBD_SAGNI           0.40  0.72    2  141    3  146  146    2    8  146  P68015     Hemoglobin subunit delta OS=Saguinus nigricollis GN=HBD PE=1 SV=1
 2841 : HBD_SAISC           0.40  0.72    2  141    3  146  146    2    8  146  P02047     Hemoglobin subunit delta OS=Saimiri sciureus GN=HBD PE=1 SV=1
 2842 : I0B042_EPIFU        0.40  0.66  145  288    3  142  146    2    8  142  I0B042     Hemoglobin subunit alpha OS=Episoriculus fumidus GN=HBA PE=3 SV=1
 2843 : I1VYJ3_BUBBB        0.40  0.73  145  288    3  142  146    2    8  142  I1VYJ3     Hemoglobin subunit alpha-A OS=Bubo bubo bubo PE=2 SV=1
 2844 : I1VYJ8_9FURN        0.40  0.74  145  288    2  141  146    2    8  141  I1VYJ8     Hemoglobin subunit alpha-D OS=Phleocryptes melanops PE=2 SV=1
 2845 : I1Y912_9CORV        0.40  0.72  145  288    3  142  146    2    8  142  I1Y912     Hemoglobin subunit alpha-A OS=Corvus cornix PE=2 SV=1
 2846 : I1Y913_9PASS        0.40  0.71  145  288    3  142  146    2    8  142  I1Y913     Hemoglobin subunit alpha-A OS=Mino dumontii PE=2 SV=1
 2847 : I1Y914_9AVES        0.40  0.72  145  288    3  142  146    2    8  142  I1Y914     Hemoglobin subunit alpha-A OS=Phoenicopterus roseus PE=2 SV=1
 2848 : I1Y915_MELUD        0.40  0.71  145  288    3  142  146    2    8  142  I1Y915     Hemoglobin subunit alpha-A OS=Melopsittacus undulatus PE=2 SV=1
 2849 : I1Y925_TROAE        0.40  0.71  145  288    2  141  146    2    8  141  I1Y925     Hemoglobin subunit alpha-D (Fragment) OS=Troglodytes aedon PE=2 SV=1
 2850 : K7N5M5_ELEMC4ESA    0.40  0.68  145  288    3  143  146    2    7  143  K7N5M5     Hemoglobin alpha chain OS=Eleginops maclovinus PE=1 SV=1
 2851 : K9J1D9_DESRO        0.40  0.71    2  141    3  146  146    2    8  146  K9J1D9     Putative hemoglobin subunit beta (Fragment) OS=Desmodus rotundus PE=2 SV=1
 2852 : L0H3N1_9AVES        0.40  0.71  145  288    2  141  146    2    8  141  L0H3N1     Hemoglobin alpha D subunit OS=Oxyura ferruginea GN=HBA1 PE=3 SV=1
 2853 : L0H5V9_OXYJA        0.40  0.71  145  288    2  141  146    2    8  141  L0H5V9     Hemoglobin alpha D subunit OS=Oxyura jamaicensis jamaicensis GN=HBA1 PE=3 SV=1
 2854 : L5KHX1_PTEAL        0.40  0.70  145  288   22  161  146    2    8  161  L5KHX1     Hemoglobin subunit alpha OS=Pteropus alecto GN=PAL_GLEAN10011811 PE=3 SV=1
 2855 : L8HT60_BOSMU        0.40  0.71    1  141   18  162  147    2    8  162  L8HT60     Hemoglobin subunit beta (Fragment) OS=Bos grunniens mutus GN=M91_21164 PE=3 SV=1
 2856 : M3YFF9_MUSPF        0.40  0.72    2  140    7  149  145    2    8  149  M3YFF9     Uncharacterized protein (Fragment) OS=Mustela putorius furo GN=Hbb-bh1 PE=3 SV=1
 2857 : M3ZD80_XIPMA        0.40  0.65  145  288    4  144  146    2    7  144  M3ZD80     Uncharacterized protein (Fragment) OS=Xiphophorus maculatus PE=3 SV=1
 2858 : M9T9S9_CYPCA        0.40  0.67  145  288    3  143  146    2    7  143  M9T9S9     Hemoglobin alpha OS=Cyprinus carpio PE=4 SV=1
 2859 : M9V0L3_CYPCA        0.40  0.67  145  288    3  143  146    2    7  143  M9V0L3     Hemoglobin alpha OS=Cyprinus carpio PE=4 SV=1
 2860 : O13135_CYPCA        0.40  0.68  145  288    3  143  146    2    7  143  O13135     Alpha-globin OS=Cyprinus carpio GN=No.1 alpha PE=3 SV=1
 2861 : O13136_CYPCA        0.40  0.67  145  288    3  143  146    2    7  143  O13136     Alpha-globin OS=Cyprinus carpio GN=No.5 alpha PE=3 SV=1
 2862 : O13138_CYPCA        0.40  0.67  145  288    3  143  146    2    7  143  O13138     Alpha-globin OS=Cyprinus carpio GN=No.6 alpha PE=3 SV=1
 2863 : O13139_CYPCA        0.40  0.68  145  288    3  143  146    2    7  143  O13139     Alpha-globin OS=Cyprinus carpio GN=No.7 alpha PE=3 SV=1
 2864 : O13169_CYPCA        0.40  0.67  145  288    3  143  146    2    7  143  O13169     Alpha-globin OS=Cyprinus carpio GN=No.3 alpha PE=3 SV=1
 2865 : Q0PG38_OCHCU        0.40  0.71    2  141    4  147  146    2    8  147  Q0PG38     Hemoglobin beta chain OS=Ochotona curzoniae PE=2 SV=1
 2866 : Q0VHB0_TRENE        0.40  0.68  145  288    3  143  146    2    7  143  Q0VHB0     Alpha 1/C globin OS=Trematomus newnesi GN=alpha I PE=2 SV=1
 2867 : Q18PE4_MUSCR        0.40  0.71    2  141    4  147  146    2    8  147  Q18PE4     Beta-globin OS=Mus caroli GN=Hbb1 PE=3 SV=1
 2868 : Q19LH3_SPAAU        0.40  0.66  145  288    3  144  146    2    6  144  Q19LH3     Alpha-1 globin OS=Sparus aurata PE=3 SV=1
 2869 : Q1JQ69_DANRE        0.40  0.67  145  288    3  143  146    2    7  143  Q1JQ69     Hbaa1 protein OS=Danio rerio GN=hbaa1 PE=2 SV=1
 2870 : Q1KYZ8_OVIMU        0.40  0.71    1  141    1  145  147    2    8  145  Q1KYZ8     Beta globin chain OS=Ovis orientalis musimon GN=HBB PE=3 SV=1
 2871 : Q28383_HORSE        0.40  0.72  145  288    3  142  146    2    8  142  Q28383     Horse BII alpha-2 globin OS=Equus caballus PE=3 SV=1
 2872 : Q28743_SHEEP        0.40  0.68  145  288    3  142  146    2    8  142  Q28743     Alpha globin chain OS=Ovis aries PE=3 SV=1
 2873 : Q28744_SHEEP        0.40  0.69  145  288    3  142  146    2    8  142  Q28744     Alpha globin chain OS=Ovis aries PE=3 SV=1
 2874 : Q28745_SHEEP        0.40  0.69  145  288    3  142  146    2    8  142  Q28745     Alpha globin chain OS=Ovis aries PE=3 SV=1
 2875 : Q3Y9L5_9PERO        0.40  0.68  145  288    3  144  146    2    6  144  Q3Y9L5     Hemoglobin alpha chain OS=Nibea miichthioides PE=2 SV=1
 2876 : Q5EEZ5_9PERC        0.40  0.68  145  286    3  143  144    2    5  143  Q5EEZ5     Hemoglobin alpha chain (Fragment) OS=Channa argus PE=2 SV=1
 2877 : Q5XME1_NOMDO        0.40  0.73  145  288    3  142  146    2    8  142  Q5XME1     Alpha A hemoglobin OS=Nomonyx dominicus GN=HBA2 PE=3 SV=1
 2878 : Q61287_MOUSE        0.40  0.68  145  288    3  142  146    2    8  142  Q61287     Alpha-globin OS=Mus musculus GN=Hba-a1 PE=2 SV=1
 2879 : Q6ZM17_DANRE        0.40  0.67  145  288    3  143  146    2    7  143  Q6ZM17     Novel protein similar to zebrafish hemoglobin alpha-adult 1 (Hbaa1) OS=Danio rerio GN=si:xx-by187g17.1 PE=2 SV=1
 2880 : Q7SYU7_XENLA        0.40  0.69  145  288    3  142  146    2    8  142  Q7SYU7     Hba3 protein OS=Xenopus laevis GN=hba3 PE=2 SV=1
 2881 : Q7ZT86_9AVES        0.40  0.71  145  288    2  141  146    2    8  141  Q7ZT86     Alpha D globin OS=Cuculus canorus GN=alpha-D PE=2 SV=1
 2882 : Q8AYL9_THUTH        0.40  0.68  145  288    4  144  146    2    7  144  Q8AYL9     Hemoglobin alpha chain 2 OS=Thunnus thynnus PE=2 SV=1
 2883 : Q8AYM0_THUTH1V4U    0.40  0.68  145  288    4  144  146    2    7  144  Q8AYM0     Hemoglobin alpha chain 1 OS=Thunnus thynnus PE=1 SV=1
 2884 : Q8QG65_CHEDN        0.40  0.72  145  288    2  141  146    2    8  141  Q8QG65     Alpha-D chain hemoglobin OS=Chelonoidis denticulata PE=2 SV=1
 2885 : Q8UW95_CYPCA        0.40  0.68  145  288    3  143  146    2    7  143  Q8UW95     Alpha globin type-2 OS=Cyprinus carpio PE=3 SV=1
 2886 : Q91128_9PERC        0.40  0.68  145  288    3  143  146    2    7  143  Q91128     Alpha globin OS=Notothenia coriiceps PE=2 SV=1
 2887 : Q9CY10_MOUSE        0.40  0.69  160  288   18  142  131    2    8  142  Q9CY10     Putative uncharacterized protein OS=Mus musculus GN=Hba-a1 PE=2 SV=1
 2888 : Q9YGF6_ONCMY        0.40  0.63  145  288    3  143  146    2    7  143  Q9YGF6     Embryonic alpha-type globin2 OS=Oncorhynchus mykiss PE=2 SV=1
 2889 : A4ZQC9_PERMA        0.39  0.68  145  288    3  142  146    2    8  142  A4ZQC9     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2890 : A4ZQD4_PERMA        0.39  0.68  145  288    3  142  146    2    8  142  A4ZQD4     Hemoglobin alpha subunit 2 OS=Peromyscus maniculatus PE=3 SV=1
 2891 : A4ZQG5_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  A4ZQG5     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2892 : A4ZQG9_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  A4ZQG9     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2893 : A4ZQH0_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  A4ZQH0     Alpha globin OS=Peromyscus maniculatus PE=3 SV=1
 2894 : A4ZQH3_PERMA        0.39  0.68  145  287    3  140  145    3    9  141  A4ZQH3     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2895 : A4ZQH7_PERMA        0.39  0.67  145  288    3  141  146    3    9  141  A4ZQH7     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2896 : A4ZQI1_PERMA        0.39  0.67  145  288    3  141  146    3    9  141  A4ZQI1     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2897 : A4ZQI5_PERMA        0.39  0.66  145  285    3  138  143    3    9  140  A4ZQI5     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2898 : A4ZQJ0_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  A4ZQJ0     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2899 : A4ZQK4_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  A4ZQK4     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2900 : A4ZQK5_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  A4ZQK5     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2901 : A4ZQL6_PERMA        0.39  0.67  145  288    3  141  146    3    9  141  A4ZQL6     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2902 : A4ZQL8_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  A4ZQL8     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2903 : A4ZQM1_PERMA        0.39  0.69  145  288    3  142  146    2    8  142  A4ZQM1     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2904 : A4ZQM3_PERMA        0.39  0.67  145  288    3  141  146    3    9  141  A4ZQM3     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 2905 : A8DUL5_MOUSE        0.39  0.71    2  141    4  147  146    2    8  147  A8DUL5     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2906 : A8DUP3_MOUSE        0.39  0.71    2  141    4  147  146    2    8  147  A8DUP3     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2907 : A8DUP5_MOUSE        0.39  0.71    2  141    4  147  146    2    8  147  A8DUP5     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 2908 : A8E1A0_BUBBU        0.39  0.71    1  141    1  145  147    2    8  145  A8E1A0     Putative gamma-globin OS=Bubalus bubalis GN=hbb PE=3 SV=1
 2909 : A9L8X9_PAPAN        0.39  0.70    2  141    4  147  146    2    8  147  A9L8X9     Hemoglobin subunit gamma-1 (Predicted) OS=Papio anubis GN=HBG2_1 PE=3 SV=1
 2910 : B0BL34_CARAU        0.39  0.67  145  288    3  143  146    2    7  143  B0BL34     Hemoglobin alpha OS=Carassius auratus GN=hba PE=2 SV=1
 2911 : B0VXB4_CALJA        0.39  0.71    2  141    4  147  146    2    8  147  B0VXB4     Delta globin (Predicted) OS=Callithrix jacchus GN=HBD PE=3 SV=1
 2912 : B1MT35_CALMO        0.39  0.68  145  288    3  142  146    2    8  142  B1MT35     Alpha 2 globin variant (Predicted) OS=Callicebus moloch GN=HBQ1_1 PE=3 SV=1
 2913 : B2DBE5_MUSCR        0.39  0.71    2  141    4  147  146    2    8  147  B2DBE5     Hemoglobin beta 2 OS=Mus caroli GN=Hbb1 PE=3 SV=1
 2914 : B2KHZ5_RHIFE        0.39  0.70    2  141    4  147  146    2    8  147  B2KHZ5     Delta globin (Predicted) OS=Rhinolophus ferrumequinum GN=HBD PE=3 SV=1
 2915 : B4USK2_OTOGA        0.39  0.68  145  288    3  142  146    2    8  142  B4USK2     Theta 1 globin (Predicted) OS=Otolemur garnettii GN=HBQ1 PE=3 SV=1
 2916 : B6CVB2_PERMA        0.39  0.68  145  287    3  140  145    3    9  141  B6CVB2     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2917 : B6CVB6_PERMA        0.39  0.68  145  288    3  142  146    2    8  142  B6CVB6     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2918 : B6CVB7_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  B6CVB7     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 2919 : B6CWH5_9CHIR        0.39  0.68  145  288    3  142  146    2    8  142  B6CWH5     Hemoglobin alpha chain OS=Hipposideros armiger GN=HBA PE=2 SV=1
 2920 : B6CWH7_9CHIR        0.39  0.68  145  288    3  142  146    2    8  142  B6CWH7     Hemoglobin alpha chain OS=Rhinolophus pusillus GN=HBA PE=2 SV=1
 2921 : B8K131_RABIT        0.39  0.70  145  288    3  142  146    2    8  142  B8K131     Zeta globin (Predicted) OS=Oryctolagus cuniculus GN=HBZ_1 PE=3 SV=1
 2922 : B8K132_RABIT        0.39  0.66  145  288    3  142  146    2    8  142  B8K132     Alpha-hemoglobin (Predicted) OS=Oryctolagus cuniculus GN=HBA PE=3 SV=1
 2923 : B8K174_RABIT        0.39  0.71    2  141    4  147  146    2    8  147  B8K174     Hemoglobin, beta (Predicted) OS=Oryctolagus cuniculus GN=HBB PE=3 SV=1
 2924 : C1BEY1_ONCMY        0.39  0.68  145  288    3  143  146    2    7  143  C1BEY1     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 2925 : C1BGI7_ONCMY        0.39  0.66  145  288    3  143  146    2    7  143  C1BGI7     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 2926 : C5HYH8_ORYAF        0.39  0.69    1  141    2  146  147    2    8  146  C5HYH8     Beta-globin OS=Orycteropus afer GN=HBB-B PE=3 SV=1
 2927 : C5MQT6_PERMA        0.39  0.72    2  140    4  146  145    2    8  147  C5MQT6     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 2928 : C5MQT7_PERMA4H2L    0.39  0.73    2  141    4  147  146    2    8  147  C5MQT7     Beta globin OS=Peromyscus maniculatus GN=HBB-T1 PE=1 SV=1
 2929 : C7EIJ9_9AVES        0.39  0.73  145  288    3  142  146    2    8  142  C7EIJ9     Hemoglobin alpha A subunit OS=Oxyura ferruginea GN=HBA2 PE=3 SV=1
 2930 : C7EIM6_CHLME        0.39  0.73  145  288    3  142  146    2    8  142  C7EIM6     Hemoglobin alpha A subunit OS=Chloephaga melanoptera GN=HBA2 PE=3 SV=1
 2931 : C7EJW3_9AVES        0.39  0.73  145  288    3  142  146    2    8  142  C7EJW3     Hemoglobin alpha A subunit OS=Thalassornis leuconotus GN=HBA2 PE=3 SV=1
 2932 : C7EJW7_9AVES        0.39  0.73  145  288    3  142  146    2    8  142  C7EJW7     Hemoglobin alpha A subunit OS=Dendrocygna guttata GN=HBA2 PE=3 SV=1
 2933 : C7EJX0_DENEY        0.39  0.73  145  288    3  142  146    2    8  142  C7EJX0     Hemoglobin alpha A subunit OS=Dendrocygna eytoni GN=HBA2 PE=3 SV=1
 2934 : C7EK11_9AVES        0.39  0.73  145  288    3  142  146    2    8  142  C7EK11     Hemoglobin alpha A subunit OS=Nettapus auritus GN=HBA2 PE=3 SV=1
 2935 : C7EK13_NETPU        0.39  0.73  145  288    3  142  146    2    8  142  C7EK13     Hemoglobin alpha A subunit OS=Nettapus pulchellus GN=HBA2 PE=3 SV=1
 2936 : C7S344_PERMA        0.39  0.67  145  288    3  141  146    3    9  141  C7S344     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2937 : C7S348_PERMA        0.39  0.67  145  288    3  141  146    3    9  141  C7S348     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2938 : C7S356_PERMA        0.39  0.68  145  288    3  142  146    2    8  142  C7S356     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2939 : C7S359_PERMA        0.39  0.68  145  288    3  142  146    2    8  142  C7S359     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2940 : C7S361_PERMA        0.39  0.67  145  288    3  141  146    3    9  141  C7S361     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2941 : C7S364_PERMA        0.39  0.67  145  288    3  141  146    3    9  141  C7S364     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2942 : C7S367_PERMA        0.39  0.67  145  288    3  142  146    2    8  142  C7S367     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2943 : C7S368_PERMA        0.39  0.67  145  288    3  141  146    3    9  141  C7S368     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2944 : C7S373_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  C7S373     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2945 : C7S377_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  C7S377     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2946 : C7S386_PERMA        0.39  0.66  145  288    3  141  146    3    9  141  C7S386     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2947 : C7S387_PERMA        0.39  0.68  145  287    3  141  145    2    8  142  C7S387     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2948 : C7S392_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  C7S392     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2949 : C7S398_PERMA        0.39  0.67  145  288    3  141  146    3    9  141  C7S398     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2950 : C7S399_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  C7S399     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2951 : C7S3A7_PERMA        0.39  0.68  145  288    3  142  146    2    8  142  C7S3A7     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2952 : C7S3B1_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  C7S3B1     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2953 : C7S3B8_PERMA        0.39  0.66  145  288    3  141  146    3    9  141  C7S3B8     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2954 : C7S3B9_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  C7S3B9     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2955 : C7S3C0_PERMA        0.39  0.68  145  288    3  141  146    3    9  141  C7S3C0     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2956 : C7S3G3_PERMA        0.39  0.68  145  288    3  142  146    2    8  142  C7S3G3     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2957 : C7S3I4_PERMA        0.39  0.68  145  288    3  142  146    2    8  142  C7S3I4     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2958 : C7S3J1_PERMA        0.39  0.66  145  288    3  141  147    5   11  141  C7S3J1     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 2959 : D0U272_MUSCO        0.39  0.71    2  141    4  147  146    2    8  147  D0U272     Beta-globin OS=Mus cookii GN=Hbbt1 PE=3 SV=1
 2960 : D0U273_MUSCO        0.39  0.71    2  141    4  147  146    2    8  147  D0U273     Beta-globin OS=Mus cookii GN=Hbbt1 PE=3 SV=1
 2961 : D0U275_MUSMI        0.39  0.72    2  141    4  147  146    2    8  147  D0U275     Beta-globin OS=Mus minutoides GN=Hbbt1 PE=3 SV=1
 2962 : D0U280_MUSSA        0.39  0.71    2  141    4  147  146    2    8  147  D0U280     Beta-globin OS=Mus saxicola GN=Hbbt1 PE=3 SV=1
 2963 : D0U295_MUSSA        0.39  0.71    2  141    4  147  146    2    8  147  D0U295     Beta-globin OS=Mus saxicola GN=Hbbt2 PE=3 SV=1
 2964 : D0VWS3_PERFV3BJ1    0.39  0.66  145  288    2  142  146    2    7  142  D0VWS3     Hemoglobin alpha OS=Perca flavescens PE=1 SV=1
 2965 : D1MGQ2_HUMAN        0.39  0.69  145  288    3  142  146    2    8  142  D1MGQ2     Alpha-2 globin chain OS=Homo sapiens GN=HBA2 PE=2 SV=1
 2966 : D3GKD8_HUMAN        0.39  0.71    2  141    4  147  146    2    8  147  D3GKD8     A-gamma globin Osilo variant OS=Homo sapiens GN=HBG1 PE=3 SV=1
 2967 : D3U1G8_ELEMA        0.39  0.68    2  141    4  147  146    2    8  147  D3U1G8     Hemoglobin subunit beta/delta hybrid OS=Elephas maximus GN=HBB/D PE=2 SV=1
 2968 : D3U1H5_LOXAF        0.39  0.68    2  141    4  147  146    2    8  147  D3U1H5     Hemoglobin subunit beta/delta hybrid OS=Loxodonta africana GN=HBB/D PE=2 SV=1
 2969 : D4N6U4_MUSMC        0.39  0.71    2  141    4  147  146    2    8  147  D4N6U4     Beta-globin OS=Mus musculus castaneus GN=Hbbt1 PE=3 SV=1
 2970 : D4QBB3_BOVIN        0.39  0.71    1  141    1  145  147    2    8  145  D4QBB3     Hemoglobin beta OS=Bos taurus GN=HBB PE=3 SV=1
 2971 : D4QBC5_BOSIN        0.39  0.71    1  141    1  145  147    2    8  145  D4QBC5     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
 2972 : D4QBD2_BOSIN        0.39  0.71    1  141    1  145  147    2    8  145  D4QBD2     Hemoglobin beta OS=Bos indicus GN=HBB PE=3 SV=1
 2973 : D4QBD5_BOSJA        0.39  0.71    1  141    1  145  147    2    8  145  D4QBD5     Hemoglobin beta OS=Bos javanicus GN=HBB PE=3 SV=1
 2974 : D4QBD8_BOSJA        0.39  0.71    1  141    1  145  147    2    8  145  D4QBD8     Hemoglobin beta OS=Bos javanicus javanicus GN=HBB PE=3 SV=1
 2975 : D4QBE8_9CETA        0.39  0.71    1  141    1  145  147    2    8  145  D4QBE8     Hemoglobin beta OS=Bos javanicus birmanicus x Bos indicus GN=HBB PE=3 SV=1
 2976 : D9YZU8_HUMAN        0.39  0.69    2  141    4  147  146    2    8  147  D9YZU8     Hemoglobin, gamma A OS=Homo sapiens GN=HBG1 PE=2 SV=1
 2977 : D9YZU9_HUMAN        0.39  0.70    2  141    4  147  146    2    8  147  D9YZU9     Hemoglobin, gamma G OS=Homo sapiens GN=HBG2 PE=2 SV=1
 2978 : E2RLH6_CANFA        0.39  0.70    2  140   10  152  145    2    8  152  E2RLH6     Uncharacterized protein (Fragment) OS=Canis familiaris GN=LOC480784 PE=3 SV=2
 2979 : E7CYP2_HUMAN        0.39  0.70    2  141    4  147  146    2    8  147  E7CYP2     G gamma globin chain OS=Homo sapiens GN=HBG2 PE=3 SV=1
 2980 : F6KMN2_EPICO        0.39  0.63  147  288    1  139  144    2    7  139  F6KMN2     Hemoglobin alpha chain (Fragment) OS=Epinephelus coioides PE=2 SV=1
 2981 : F7GY95_CALJA        0.39  0.69  145  288    3  142  146    2    8  142  F7GY95     Uncharacterized protein OS=Callithrix jacchus GN=HBQ1_1 PE=3 SV=1
 2982 : G1M482_AILME        0.39  0.73    2  141    4  147  146    2    8  147  G1M482     Uncharacterized protein OS=Ailuropoda melanoleuca GN=LOC100482027 PE=3 SV=1
 2983 : G1N9H8_MELGA        0.39  0.72  145  288    3  142  146    2    8  142  G1N9H8     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100539006 PE=3 SV=1
 2984 : G1QEL0_MYOLU        0.39  0.72    2  141    4  147  146    2    8  147  G1QEL0     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
 2985 : G3ICM8_CRIGR        0.39  0.72    2  141    4  147  146    2    8  147  G3ICM8     Hemoglobin subunit epsilon-Y2 OS=Cricetulus griseus GN=I79_021426 PE=3 SV=1
 2986 : G3PL33_GASAC        0.39  0.68  145  288    4  144  146    2    7  144  G3PL33     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 2987 : G3UJH3_LOXAF        0.39  0.70  145  288    3  142  146    2    8  142  G3UJH3     Uncharacterized protein OS=Loxodonta africana GN=LOC100657757 PE=3 SV=1
 2988 : G3WE91_SARHA        0.39  0.69  145  288    3  143  147    3    9  143  G3WE91     Uncharacterized protein OS=Sarcophilus harrisii PE=3 SV=1
 2989 : G3X8H7_LOXAF        0.39  0.66  145  288    3  142  146    2    8  142  G3X8H7     Uncharacterized protein OS=Loxodonta africana GN=LOC100656617 PE=3 SV=1
 2990 : G7NQC3_MACMU        0.39  0.68  145  288    3  142  146    2    8  142  G7NQC3     Hemoglobin alpha chain OS=Macaca mulatta GN=HBA2 PE=2 SV=1
 2991 : G7Q017_MACFA        0.39  0.68  145  288    3  142  146    2    8  142  G7Q017     Hemoglobin alpha chain OS=Macaca fascicularis GN=EGM_11265 PE=3 SV=1
 2992 : G8ZF12_RABIT        0.39  0.66  145  288    3  142  146    2    8  142  G8ZF12     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2993 : G8ZF34_RABIT        0.39  0.66  145  288    3  142  146    2    8  142  G8ZF34     Alpha-globin 1 OS=Oryctolagus cuniculus GN=HBA1 PE=3 SV=1
 2994 : G9FTH5_CONCR        0.39  0.68  145  288    3  142  146    2    8  142  G9FTH5     Hemoglobin subunit alpha 1 OS=Condylura cristata GN=HBA1 PE=2 SV=1
 2995 : G9FTI0_NEUGI        0.39  0.70    2  141    4  147  146    2    8  147  G9FTI0     Hemoglobin subunit delta 1 OS=Neurotrichus gibbsii GN=HBD1 PE=2 SV=1
 2996 : HBA1_NOTAN          0.39  0.68  145  288    2  142  146    2    7  142  P29624     Hemoglobin subunit alpha-1 OS=Notothenia angustata GN=hba1 PE=1 SV=1
 2997 : HBA1_NOTCO          0.39  0.69  145  288    2  142  146    2    7  142  P10777     Hemoglobin subunit alpha-1 OS=Notothenia coriiceps neglecta GN=hba1 PE=1 SV=1
 2998 : HBA1_OTOCR          0.39  0.68  145  288    3  142  146    2    8  142  P14259     Hemoglobin subunit alpha-A OS=Otolemur crassicaudatus GN=HBAA PE=2 SV=2
 2999 : HBA2_NOTAN          0.39  0.67  145  288    2  141  146    3    8  141  P62363     Hemoglobin subunit alpha-2 OS=Notothenia angustata GN=hba2 PE=1 SV=1
 3000 : HBA2_NOTCO          0.39  0.67  145  288    2  141  146    3    8  141  P62387     Hemoglobin subunit alpha-2 OS=Notothenia coriiceps neglecta GN=hba2 PE=1 SV=1
 3001 : HBA2_OTOCR          0.39  0.67  145  288    3  142  146    2    8  142  P01939     Hemoglobin subunit alpha-B OS=Otolemur crassicaudatus GN=HBAB PE=1 SV=3
 3002 : HBA4_ONCMY  2R1H    0.39  0.66  145  288    2  142  146    2    7  142  P14527     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=hba4 PE=1 SV=1
 3003 : HBAD_BRACA          0.39  0.72  145  288    2  141  146    2    8  141  P04240     Hemoglobin subunit alpha-D OS=Branta canadensis GN=HBAD PE=1 SV=1
 3004 : HBAD_COLLI          0.39  0.69  145  288    2  140  145    2    7  140  O12985     Hemoglobin subunit alpha-D OS=Columba livia GN=HBAD PE=2 SV=1
 3005 : HBAD_PASMO          0.39  0.72  145  288    2  141  146    2    8  141  P07413     Hemoglobin subunit alpha-D OS=Passer montanus GN=HBAD PE=1 SV=1
 3006 : HBA_ACCGE           0.39  0.72  145  288    3  142  146    2    8  142  P08850     Hemoglobin subunit alpha-A OS=Accipiter gentilis GN=HBAA PE=1 SV=2
 3007 : HBA_AQUCH           0.39  0.73  145  288    3  142  146    2    8  142  P01993     Hemoglobin subunit alpha-A OS=Aquila chrysaetos GN=HBAA PE=1 SV=2
 3008 : HBA_ATEGE           0.39  0.68  145  288    3  142  146    2    8  142  P67817     Hemoglobin subunit alpha OS=Ateles geoffroyi GN=HBA PE=1 SV=2
 3009 : HBA_CARAU           0.39  0.67  145  288    2  142  146    2    7  142  P02018     Hemoglobin subunit alpha OS=Carassius auratus GN=hba PE=1 SV=1
 3010 : HBA_CEBAP           0.39  0.69  145  288    3  142  146    2    8  142  P01928     Hemoglobin subunit alpha OS=Cebus apella GN=HBA PE=1 SV=2
 3011 : HBA_CERAT           0.39  0.68  145  288    2  141  146    2    8  141  P01933     Hemoglobin subunit alpha OS=Cercocebus atys GN=HBA PE=1 SV=1
 3012 : HBA_CHICK   3BEV    0.39  0.71  145  288    3  142  146    2    8  142  P01994     Hemoglobin subunit alpha-A OS=Gallus gallus GN=HBAA PE=1 SV=2
 3013 : HBA_CHLAE           0.39  0.68  145  288    3  142  146    2    8  142  P01926     Hemoglobin subunit alpha OS=Chlorocebus aethiops GN=HBA PE=1 SV=2
 3014 : HBA_CHLME           0.39  0.73  145  288    2  141  146    2    8  141  P07034     Hemoglobin subunit alpha-A OS=Chloephaga melanoptera GN=HBAA PE=1 SV=1
 3015 : HBA_ECHTE           0.39  0.66  145  288    2  141  146    2    8  141  P24291     Hemoglobin subunit alpha OS=Echinops telfairi GN=HBA PE=1 SV=1
 3016 : HBA_EUDSC           0.39  0.75  145  288    2  141  146    2    8  141  P19789     Hemoglobin subunit alpha-A OS=Eudynamys scolopacea GN=HBAA PE=1 SV=1
 3017 : HBA_HUMAN   1Z8U    0.39  0.69  145  288    3  142  146    2    8  142  P69905     Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2
 3018 : HBA_LEPWE           0.39  0.66  145  288    2  141  146    2    8  141  P15163     Hemoglobin subunit alpha-1/2 OS=Leptonychotes weddelli PE=1 SV=1
 3019 : HBA_LYNLY           0.39  0.65  145  288    2  141  146    2    8  141  P41327     Hemoglobin subunit alpha OS=Lynx lynx GN=HBA PE=1 SV=1
 3020 : HBA_MACAS           0.39  0.68  145  288    2  141  146    2    8  141  P21766     Hemoglobin subunit alpha-1/2/3 OS=Macaca assamensis PE=1 SV=1
 3021 : HBA_MACCA           0.39  0.68  145  288    2  141  146    2    8  141  P09839     Hemoglobin subunit alpha OS=Macrotus californicus GN=HBA PE=1 SV=1
 3022 : HBA_MACFA           0.39  0.68  145  288    2  141  146    2    8  141  P21767     Hemoglobin subunit alpha-A/Q/R/T OS=Macaca fascicularis PE=1 SV=1
 3023 : HBA_MACFU           0.39  0.68  145  288    3  142  146    2    8  142  P63107     Hemoglobin subunit alpha OS=Macaca fuscata fuscata GN=HBA PE=1 SV=2
 3024 : HBA_MACMU           0.39  0.68  145  288    3  142  146    2    8  142  P63108     Hemoglobin subunit alpha OS=Macaca mulatta GN=HBA PE=1 SV=2
 3025 : HBA_MACNE           0.39  0.68  145  288    2  141  146    2    8  141  P19002     Hemoglobin subunit alpha-1/2/3 OS=Macaca nemestrina PE=1 SV=1
 3026 : HBA_MACSI           0.39  0.68  145  288    2  141  146    2    8  141  P21768     Hemoglobin subunit alpha-1/2 OS=Macaca sinica PE=1 SV=1
 3027 : HBA_MELGA   2QMB    0.39  0.71  145  288    3  142  146    2    8  142  P81023     Hemoglobin subunit alpha-A OS=Meleagris gallopavo GN=HBAA PE=1 SV=2
 3028 : HBA_MICGA           0.39  0.63  145  288    2  141  147    4   10  141  P41331     Hemoglobin subunit alpha OS=Microcephalophis gracilis GN=HBA PE=1 SV=1
 3029 : HBA_NYCCO           0.39  0.68  145  288    2  141  146    2    8  141  P01937     Hemoglobin subunit alpha OS=Nycticebus coucang GN=HBA PE=1 SV=1
 3030 : HBA_PANPA           0.39  0.69  145  288    3  142  146    2    8  142  P69906     Hemoglobin subunit alpha OS=Pan paniscus GN=HBA1 PE=1 SV=2
 3031 : HBA_PANTR           0.39  0.69  145  288    3  142  146    2    8  142  P69907     Hemoglobin subunit alpha OS=Pan troglodytes GN=HBA1 PE=1 SV=2
 3032 : HBA_PILBA           0.39  0.68  145  288    3  142  146    2    8  142  P01930     Hemoglobin subunit alpha OS=Piliocolobus badius GN=HBA PE=1 SV=2
 3033 : HBA_PROHA           0.39  0.67  145  288    2  142  147    3    9  142  P01957     Hemoglobin subunit alpha OS=Procavia capensis habessinica GN=HBA PE=1 SV=1
 3034 : HBA_PSIKR   2ZFB    0.39  0.70  145  288    2  141  146    2    8  141  P19831     Hemoglobin subunit alpha OS=Psittacula krameri GN=HBA PE=1 SV=1
 3035 : HBA_SAGFU           0.39  0.68  145  288    2  141  146    2    8  141  P01929     Hemoglobin subunit alpha OS=Saguinus fuscicollis GN=HBA PE=1 SV=1
 3036 : HBA_SAGOE           0.39  0.68  145  288    2  141  146    2    8  141  P67818     Hemoglobin subunit alpha OS=Saguinus oedipus GN=HBA PE=1 SV=1
 3037 : HBA_SCICA           0.39  0.69  145  288    2  141  146    2    8  141  B3EWD1     Hemoglobin subunit alpha OS=Sciurus carolinensis PE=1 SV=1
 3038 : HBA_SEMEN           0.39  0.69  145  288    2  141  146    2    8  141  P01924     Hemoglobin subunit alpha OS=Semnopithecus entellus GN=HBA PE=1 SV=1
 3039 : HBA_STRCA   3FS4    0.39  0.73  145  288    2  141  146    2    8  141  P01981     Hemoglobin subunit alpha-A OS=Struthio camelus GN=HBAA PE=1 SV=1
 3040 : HBA_STROE           0.39  0.70  145  288    2  141  146    2    8  141  Q7LZC3     Hemoglobin subunit alpha-A OS=Streptopelia orientalis GN=HBAA PE=1 SV=1
 3041 : HBA_SUNMU           0.39  0.67  145  288    2  141  146    2    8  141  P01950     Hemoglobin subunit alpha OS=Suncus murinus GN=HBA PE=1 SV=1
 3042 : HBA_TAMHU           0.39  0.68  145  288    2  141  146    2    8  141  B3EWD7     Hemoglobin subunit alpha OS=Tamiasciurus hudsonicus PE=1 SV=1
 3043 : HBA_TAMMR           0.39  0.67  145  288    2  141  146    2    8  141  B3EWC7     Hemoglobin subunit alpha OS=Tamias merriami PE=1 SV=1
 3044 : HBA_TAPTE           0.39  0.68  145  288    2  141  146    2    8  141  P01962     Hemoglobin subunit alpha-1/2 OS=Tapirus terrestris PE=1 SV=1
 3045 : HBA_THEGE           0.39  0.67  145  288    2  141  146    2    8  141  P01932     Hemoglobin subunit alpha OS=Theropithecus gelada GN=HBA PE=1 SV=1
 3046 : HBA_VIPAS           0.39  0.64  145  288    2  141  147    4   10  141  P02010     Hemoglobin subunit alpha OS=Vipera aspis GN=HBA PE=1 SV=1
 3047 : HBB2_CHAMP          0.39  0.71    2  141    4  147  146    2    8  147  Q7M2Y5     Hemoglobin subunit beta-2 OS=Chalinolobus morio GN=HBB2 PE=1 SV=2
 3048 : HBBA_BOSJA          0.39  0.71    1  141    1  145  147    2    8  145  P04346     Hemoglobin subunit beta-A OS=Bos javanicus PE=1 SV=1
 3049 : HBB_AOTAZ           0.39  0.69    2  141    4  147  146    2    8  147  Q6WN26     Hemoglobin subunit beta OS=Aotus azarae GN=HBB PE=2 SV=3
 3050 : HBB_ARCGA           0.39  0.71    2  141    3  146  146    2    8  146  P68047     Hemoglobin subunit beta OS=Arctocephalus galapagoensis GN=HBB PE=1 SV=1
 3051 : HBB_ATEBE           0.39  0.71    2  141    4  147  146    2    8  147  P68234     Hemoglobin subunit beta OS=Ateles belzebuth GN=HBB PE=1 SV=2
 3052 : HBB_ATEGE           0.39  0.71    2  141    4  147  146    2    8  147  P68232     Hemoglobin subunit beta OS=Ateles geoffroyi GN=HBB PE=1 SV=2
 3053 : HBB_ATEPA           0.39  0.71    2  141    4  147  146    2    8  147  Q6WN22     Hemoglobin subunit beta OS=Ateles paniscus GN=HBB PE=1 SV=3
 3054 : HBB_CALAR           0.39  0.70    2  141    3  146  146    2    8  146  P18985     Hemoglobin subunit beta OS=Callithrix argentata GN=HBB PE=1 SV=1
 3055 : HBB_CALJA           0.39  0.70    2  141    4  147  146    2    8  147  Q6WN28     Hemoglobin subunit beta OS=Callithrix jacchus GN=HBB PE=2 SV=3
 3056 : HBB_CEBCA           0.39  0.71    2  141    3  146  146    2    8  146  P67822     Hemoglobin subunit beta OS=Cebus capucinus GN=HBB PE=1 SV=1
 3057 : HBB_CROCR           0.39  0.71    2  141    3  146  146    2    8  146  P18986     Hemoglobin subunit beta OS=Crocuta crocuta GN=HBB PE=1 SV=1
 3058 : HBB_ELEMA           0.39  0.68    2  141    3  146  146    2    8  146  P02084     Hemoglobin subunit beta OS=Elephas maximus GN=HBB PE=1 SV=1
 3059 : HBB_LEPEU   3LQD    0.39  0.71    2  141    4  147  146    2    8  147  P08535     Hemoglobin subunit beta OS=Lepus europaeus GN=HBB PE=1 SV=2
 3060 : HBB_LOXAF           0.39  0.68    2  141    3  146  146    2    8  146  P02085     Hemoglobin subunit beta OS=Loxodonta africana GN=HBB PE=1 SV=1
 3061 : HBB_MARFO           0.39  0.70    2  141    3  146  146    2    8  146  P68053     Hemoglobin subunit beta OS=Martes foina GN=HBB PE=1 SV=1
 3062 : HBB_MELCA           0.39  0.71    2  141    3  146  146    2    8  146  P15449     Hemoglobin subunit beta OS=Mellivora capensis GN=HBB PE=1 SV=1
 3063 : HBB_MELME           0.39  0.71    2  141    3  146  146    2    8  146  P02055     Hemoglobin subunit beta OS=Meles meles GN=HBB PE=1 SV=1
 3064 : HBB_MESAU           0.39  0.73    2  141    4  147  146    2    8  147  P02094     Hemoglobin subunit beta OS=Mesocricetus auratus GN=HBB PE=1 SV=2
 3065 : HBB_MESBR           0.39  0.71    2  141    3  146  146    2    8  146  P18707     Hemoglobin subunit beta OS=Mesocricetus brandti GN=HBB PE=1 SV=1
 3066 : HBB_ODORO           0.39  0.71    2  141    3  146  146    2    8  146  P68046     Hemoglobin subunit beta OS=Odobenus rosmarus divergens GN=HBB PE=1 SV=1
 3067 : HBB_PAGLA           0.39  0.71    2  141    3  146  146    2    8  146  P19646     Hemoglobin subunit beta OS=Paguma larvata GN=HBB PE=1 SV=1
 3068 : HBB_PHOVI           0.39  0.70    2  141    3  146  146    2    8  146  P09909     Hemoglobin subunit beta OS=Phoca vitulina GN=HBB PE=1 SV=1
 3069 : HBB_PROCR           0.39  0.71    2  141    3  146  146    2    8  146  P23020     Hemoglobin subunit beta OS=Proteles cristata GN=HBB PE=1 SV=1
 3070 : HBB_PROHA           0.39  0.71    2  141    3  146  146    2    8  146  P02086     Hemoglobin subunit beta OS=Procavia capensis habessinica GN=HBB PE=1 SV=1
 3071 : HBB_PTEBR           0.39  0.70    2  141    3  146  146    2    8  146  P68052     Hemoglobin subunit beta OS=Pteronura brasiliensis GN=HBB PE=1 SV=1
 3072 : HBB_RABIT   2RAO    0.39  0.71    2  141    4  147  146    2    8  147  P02057     Hemoglobin subunit beta-1/2 OS=Oryctolagus cuniculus GN=HBB1 PE=1 SV=2
 3073 : HBB_RANTA           0.39  0.70    1  141    1  145  147    2    8  145  P21380     Hemoglobin subunit beta OS=Rangifer tarandus GN=HBB PE=1 SV=1
 3074 : HBB_SAGMY           0.39  0.70    2  141    3  146  146    2    8  146  P02038     Hemoglobin subunit beta OS=Saguinus mystax GN=HBB PE=1 SV=1
 3075 : HBB_SAGNI           0.39  0.70    2  141    3  146  146    2    8  146  P68054     Hemoglobin subunit beta OS=Saguinus nigricollis GN=HBB PE=1 SV=1
 3076 : HBB_SAGOE           0.39  0.70    2  141    3  146  146    2    8  146  P68055     Hemoglobin subunit beta OS=Saguinus oedipus GN=HBB PE=1 SV=1
 3077 : HBB_SAISC           0.39  0.70    2  141    4  147  146    2    8  147  P02036     Hemoglobin subunit beta OS=Saimiri sciureus GN=HBB PE=1 SV=2
 3078 : HBB_TURTR           0.39  0.69    2  141    3  146  146    2    8  146  P18990     Hemoglobin subunit beta OS=Tursiops truncatus GN=HBB PE=1 SV=1
 3079 : HBB_VULVU           0.39  0.71    2  141    3  146  146    2    8  146  P21201     Hemoglobin subunit beta OS=Vulpes vulpes GN=HBB PE=1 SV=1
 3080 : HBD_ELEMA           0.39  0.68    2  141    4  147  146    2    8  147  Q45XI9     Hemoglobin subunit delta OS=Elephas maximus GN=HBD PE=2 SV=3
 3081 : HBD_LOXAF           0.39  0.68    2  141    4  147  146    2    8  147  Q45XJ0     Hemoglobin subunit delta OS=Loxodonta africana GN=HBD PE=2 SV=3
 3082 : HBG1_HUMAN  1I3D    0.39  0.70    2  141    4  147  146    2    8  147  P69891     Hemoglobin subunit gamma-1 OS=Homo sapiens GN=HBG1 PE=1 SV=2
 3083 : HBG1_PANTR          0.39  0.70    2  141    4  147  146    2    8  147  P61920     Hemoglobin subunit gamma-1 OS=Pan troglodytes GN=HBG1 PE=1 SV=2
 3084 : HBG2_GORGO          0.39  0.70    2  141    4  147  146    2    8  147  P62742     Hemoglobin subunit gamma-2 OS=Gorilla gorilla gorilla GN=HBG2 PE=2 SV=2
 3085 : HBG2_HUMAN  1FDH    0.39  0.70    2  141    4  147  146    2    8  147  P69892     Hemoglobin subunit gamma-2 OS=Homo sapiens GN=HBG2 PE=1 SV=2
 3086 : HBG2_PANTR          0.39  0.70    2  141    4  147  146    2    8  147  P61921     Hemoglobin subunit gamma-2 OS=Pan troglodytes GN=HBG2 PE=1 SV=2
 3087 : HBPI_CHICK          0.39  0.73  145  288    3  142  146    2    8  142  P02007     Hemoglobin subunit pi OS=Gallus gallus PE=1 SV=3
 3088 : I0B041_EPIFU        0.39  0.73    2  141    4  147  146    2    8  147  I0B041     Hemoglobin subunit delta-A OS=Episoriculus fumidus GN=HBD-B PE=3 SV=1
 3089 : I1VYK1_BUBBB        0.39  0.70  145  288    2  141  146    2    8  141  I1VYK1     Hemoglobin subunit alpha-D OS=Bubo bubo bubo PE=2 SV=1
 3090 : I2CVH9_MACMU        0.39  0.68  145  288    3  142  146    2    8  142  I2CVH9     Hemoglobin subunit alpha OS=Macaca mulatta GN=HBA1 PE=2 SV=1
 3091 : I3KUU9_ORENI        0.39  0.71  145  288    4  144  146    2    7  144  I3KUU9     Uncharacterized protein (Fragment) OS=Oreochromis niloticus GN=LOC100704125 PE=3 SV=1
 3092 : I3N2T5_SPETR        0.39  0.71    2  141    4  147  146    2    8  147  I3N2T5     Uncharacterized protein OS=Spermophilus tridecemlineatus PE=3 SV=1
 3093 : I6ZW92_EOSBA        0.39  0.71    2  141    4  147  146    2    8  147  I6ZW92     Hemoglobin beta OS=Eospalax baileyi PE=2 SV=1
 3094 : K7W903_MICOE        0.39  0.71    2  141    4  147  146    2    8  147  K7W903     Hemoglobin beta chain OS=Microtus oeconomus PE=2 SV=1
 3095 : L5LQX1_MYODS        0.39  0.66  145  288    3  142  146    2    8  142  L5LQX1     Hemoglobin subunit theta-1 OS=Myotis davidii GN=MDA_GLEAN10007591 PE=3 SV=1
 3096 : L9KLQ0_TUPCH        0.39  0.71    2  141    4  147  146    2    8  147  L9KLQ0     Hemoglobin subunit epsilon-1 OS=Tupaia chinensis GN=TREES_T100005452 PE=3 SV=1
 3097 : L9KYF1_TUPCH        0.39  0.71  145  288    3  142  146    2    8  142  L9KYF1     Hemoglobin subunit zeta OS=Tupaia chinensis GN=TREES_T100011779 PE=3 SV=1
 3098 : M3YX76_MUSPF        0.39  0.65  145  288    3  142  146    2    8  162  M3YX76     Uncharacterized protein OS=Mustela putorius furo GN=HBQ1 PE=3 SV=1
 3099 : M3ZD90_XIPMA        0.39  0.61  145  287    3  144  147    3    9  145  M3ZD90     Uncharacterized protein OS=Xiphophorus maculatus PE=3 SV=1
 3100 : Q1A2D1_SHEEP        0.39  0.71    1  141    1  145  147    2    8  145  Q1A2D1     Beta-K globin chain OS=Ovis aries GN=HBBK PE=3 SV=1
 3101 : Q533G9_MACEU        0.39  0.69  145  288    3  142  146    2    8  142  Q533G9     Zeta globin OS=Macropus eugenii PE=3 SV=1
 3102 : Q5R9M5_PONAB        0.39  0.69  145  288    3  142  146    2    8  142  Q5R9M5     Putative uncharacterized protein DKFZp468J1717 OS=Pongo abelii GN=DKFZp468J1717 PE=2 SV=1
 3103 : Q5XMD6_9AVES        0.39  0.73  145  288    3  142  146    2    8  142  Q5XMD6     Alpha A hemoglobin OS=Oxyura maccoa GN=HBA2 PE=3 SV=1
 3104 : Q5XMD7_OXYLE        0.39  0.73  145  288    3  142  146    2    8  142  Q5XMD7     Alpha A hemoglobin OS=Oxyura leucocephala GN=HBA2 PE=3 SV=1
 3105 : Q5XMD8_9AVES        0.39  0.73  145  288    3  142  146    2    8  142  Q5XMD8     Alpha A hemoglobin OS=Oxyura australis GN=HBA2 PE=3 SV=1
 3106 : Q5XMD9_OXYJA        0.39  0.73  145  288    3  142  146    2    8  142  Q5XMD9     Alpha A hemoglobin OS=Oxyura jamaicensis jamaicensis GN=HBA2 PE=3 SV=1
 3107 : Q5XME0_OXYVI        0.39  0.73  145  288    3  142  146    2    8  142  Q5XME0     Alpha A hemoglobin OS=Oxyura vittata GN=HBA2 PE=3 SV=1
 3108 : Q66KY4_XENLA        0.39  0.69    2  140    4  146  145    2    8  147  Q66KY4     MGC85319 protein OS=Xenopus laevis GN=hbe1 PE=2 SV=1
 3109 : Q6Y257_PAGMA        0.39  0.66  145  288    3  143  146    2    7  143  Q6Y257     Alpha hemoglobin A OS=Pagrus major PE=2 SV=1
 3110 : Q7SZV9_DANRE        0.39  0.68  145  288    3  143  146    2    7  143  Q7SZV9     Novel alpha-globin OS=Danio rerio GN=hbaa1 PE=3 SV=1
 3111 : Q7ZT87_9AVES        0.39  0.73  145  288    3  142  146    2    8  142  Q7ZT87     Alpha A globin OS=Cuculus canorus GN=alpha-A PE=2 SV=1
 3112 : Q7ZYZ4_DANRE        0.39  0.62  145  288    3  143  146    2    7  143  Q7ZYZ4     Hbae3 protein OS=Danio rerio GN=hbae3 PE=2 SV=1
 3113 : Q803Z5_DANRE        0.39  0.67  145  288    3  143  146    2    7  143  Q803Z5     Hemoglobin alpha adult-1 OS=Danio rerio GN=hbaa1 PE=2 SV=1
 3114 : Q8JH91_CYPCA        0.39  0.66  145  288    3  143  146    2    7  143  Q8JH91     Alpha globin (Fragment) OS=Cyprinus carpio PE=2 SV=1
 3115 : Q9IAJ8_NOTAN        0.39  0.68  145  288    3  143  146    2    7  143  Q9IAJ8     Alpha1 globin OS=Notothenia angustata PE=3 SV=1
 3116 : A1A4Q7_BOVIN        0.38  0.64  145  285    3  139  143    2    8  142  A1A4Q7     Hemoglobin, theta 1 OS=Bos taurus GN=HBQ1 PE=2 SV=1
 3117 : A4ZQ60_PERMA        0.38  0.66  145  288    3  142  146    2    8  142  A4ZQ60     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3118 : A4ZQ74_PERMA        0.38  0.66  145  288    3  142  146    2    8  142  A4ZQ74     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3119 : A4ZQG4_PERMA        0.38  0.66  145  285    3  138  143    3    9  140  A4ZQG4     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 3120 : A4ZQG8_PERMA        0.38  0.69  145  288    3  142  146    2    8  142  A4ZQG8     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 3121 : A4ZQJ1_PERMA        0.38  0.68  145  288    3  141  146    3    9  141  A4ZQJ1     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 3122 : A4ZQJ3_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQJ3     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 3123 : A4ZQJ4_PERMA        0.38  0.68  145  288    3  141  146    3    9  141  A4ZQJ4     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 3124 : A4ZQJ8_PERMA        0.38  0.67  145  288    3  141  146    3    9  141  A4ZQJ8     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 3125 : A4ZQK2_PERMA        0.38  0.68  145  288    3  141  146    3    9  141  A4ZQK2     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 3126 : A4ZQK3_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQK3     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 3127 : A4ZQK6_PERMA        0.38  0.68  145  288    3  141  146    3    9  141  A4ZQK6     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 3128 : A4ZQK8_PERMA        0.38  0.68  145  288    3  141  146    3    9  141  A4ZQK8     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 3129 : A4ZQK9_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQK9     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 3130 : A4ZQL1_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQL1     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 3131 : A4ZQL9_PERMA        0.38  0.67  145  288    3  141  146    3    9  141  A4ZQL9     Hemoglobin alpha subunit 1 OS=Peromyscus maniculatus PE=3 SV=1
 3132 : A4ZQT3_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQT3     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3133 : A4ZQT5_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQT5     Embryonic alpha globin OS=Peromyscus maniculatus GN=HBZ PE=3 SV=1
 3134 : A4ZQT9_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQT9     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3135 : A4ZQU5_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQU5     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3136 : A4ZQU6_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQU6     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3137 : A4ZQV8_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQV8     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3138 : A4ZQW2_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQW2     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3139 : A4ZQW6_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  A4ZQW6     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3140 : A4ZQW7_PERLE        0.38  0.66  145  273    3  124  131    3   11  124  A4ZQW7     Hemoglobin subunit zeta (Fragment) OS=Peromyscus leucopus PE=3 SV=1
 3141 : A8DV41_MOUSE        0.38  0.71    2  141    4  147  146    2    8  147  A8DV41     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 3142 : A8DV59_MOUSE        0.38  0.72    2  141    4  147  146    2    8  147  A8DV59     Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1
 3143 : A8HTG8_PERFV1XQ5    0.38  0.67  145  288    3  143  146    2    7  143  A8HTG8     Alpha-type globin OS=Perca flavescens PE=2 SV=1
 3144 : A9L8T9_PAPAN        0.38  0.68  145  288    3  142  146    2    8  142  A9L8T9     Hemoglobin, alpha 1 (Predicted) OS=Papio anubis GN=HBA1 PE=3 SV=1
 3145 : A9L8U0_PAPAN        0.38  0.66  145  288    3  142  146    2    8  142  A9L8U0     Hemoglobin, theta 1 (Predicted) OS=Papio anubis GN=HBQ1 PE=3 SV=1
 3146 : A9L8Y0_PAPAN        0.38  0.70    2  141    4  147  146    2    8  147  A9L8Y0     Hemoglobin subunit gamma (Predicted) OS=Papio anubis GN=HBG2_2 PE=3 SV=1
 3147 : B0VX76_CALJA        0.38  0.70  145  288    3  142  146    2    8  142  B0VX76     Zeta globin (Predicted) OS=Callithrix jacchus GN=HBZ PE=3 SV=1
 3148 : B0VX79_CALJA        0.38  0.66  145  288    3  142  146    2    8  142  B0VX79     Theta 1 globin (Predicted) OS=Callithrix jacchus GN=HBQ1_2 PE=3 SV=1
 3149 : B1H216_RAT          0.38  0.68  145  288    3  142  146    2    8  142  B1H216     Hemoglobin alpha, adult chain 2 OS=Rattus norvegicus GN=Hba1 PE=2 SV=1
 3150 : B1MT33_CALMO        0.38  0.71  145  288    3  142  146    2    8  142  B1MT33     Zeta globin (Predicted) OS=Callicebus moloch GN=HBZ PE=3 SV=1
 3151 : B2BSP2_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  B2BSP2     Hemoglobin alpha chain OS=Peromyscus maniculatus GN=HBAT3 PE=3 SV=1
 3152 : B2KHV8_RHIFE        0.38  0.68  145  288    3  142  146    2    8  142  B2KHV8     Hemoglobin subunit alpha (Predicted) OS=Rhinolophus ferrumequinum GN=HBQ1_1 PE=3 SV=1
 3153 : B3EX28_SORAR        0.38  0.70  145  288    3  142  146    2    8  142  B3EX28     Hemoglobin subunit zeta (Predicted) OS=Sorex araneus GN=HBZ PE=3 SV=1
 3154 : B3F9U2_GADMO        0.38  0.60    2  141    3  174  172    2   32  174  B3F9U2     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3155 : B4USM6_OTOGA        0.38  0.71    2  141    4  147  146    2    8  147  B4USM6     Hemoglobin subunit gamma (Predicted) OS=Otolemur garnettii GN=HBG PE=3 SV=1
 3156 : B4USM7_OTOGA        0.38  0.72    2  141    4  147  146    2    8  147  B4USM7     A-gamma globin (Predicted) OS=Otolemur garnettii GN=HBG1 PE=3 SV=1
 3157 : B5FXM1_TAEGU        0.38  0.71  145  288    2  141  146    2    8  141  B5FXM1     Putative hemoglobin alpha-D chain OS=Taeniopygia guttata PE=2 SV=1
 3158 : B5SXU5_PERMA        0.38  0.67  145  288    3  141  146    3    9  141  B5SXU5     Alpha-globin subunit OS=Peromyscus maniculatus GN=HBA PE=3 SV=1
 3159 : B5X746_SALSA        0.38  0.66  145  288    3  143  146    2    7  143  B5X746     Hemoglobin subunit alpha-4 OS=Salmo salar GN=HBA4 PE=2 SV=1
 3160 : B6DMG4_HIPHI        0.38  0.65  145  288    4  144  146    2    7  144  B6DMG4     Alpha-globin 1 OS=Hippoglossus hippoglossus PE=2 SV=1
 3161 : B7SBL1_PERMA        0.38  0.71    2  141    4  147  146    2    8  147  B7SBL1     Epsilon-globin OS=Peromyscus maniculatus GN=HBE-T1 PE=3 SV=1
 3162 : B7SPR7_PERLE        0.38  0.71    2  141    4  147  146    2    8  147  B7SPR7     Epsilon globin OS=Peromyscus leucopus PE=3 SV=1
 3163 : B8K130_RABIT        0.38  0.70  145  288    3  142  146    2    8  142  B8K130     Hemoglobin subunit zeta (Predicted) OS=Oryctolagus cuniculus GN=RA_m008_jsm295ECf PE=3 SV=1
 3164 : B8K135_RABIT        0.38  0.69  145  288    3  142  146    2    8  142  B8K135     Hemoglobin, zeta (Predicted) OS=Oryctolagus cuniculus GN=HBZ_2 PE=3 SV=1
 3165 : B8K175_RABIT        0.38  0.71    2  141    4  147  146    2    8  147  B8K175     G-gamma globin (Predicted) OS=Oryctolagus cuniculus GN=HBG2 PE=3 SV=1
 3166 : B8K176_RABIT        0.38  0.71    2  141    4  147  146    2    8  147  B8K176     A-gamma globin (Predicted) OS=Oryctolagus cuniculus GN=HBG1 PE=3 SV=1
 3167 : B9EIX8_MOUSE        0.38  0.67  153  288   11  142  138    2    8  142  B9EIX8     MCG1039741 OS=Mus musculus GN=Hbq1b PE=2 SV=1
 3168 : B9VY01_ANAGE        0.38  0.73  145  288    3  142  146    2    8  142  B9VY01     Hemoglobin alpha A subunit OS=Anas georgica GN=HBA2 PE=3 SV=1
 3169 : C1BEW1_ONCMY        0.38  0.66  145  288    3  143  146    2    7  143  C1BEW1     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 3170 : C1BEX7_ONCMY        0.38  0.66  145  288    6  146  146    2    7  146  C1BEX7     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 3171 : C1BF11_ONCMY        0.38  0.66  145  288    3  143  146    2    7  143  C1BF11     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 3172 : C1BG02_ONCMY        0.38  0.67  145  288    3  143  146    2    7  143  C1BG02     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 3173 : C1BG49_ONCMY        0.38  0.66  145  288    3  143  146    2    7  143  C1BG49     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 3174 : C1BIC4_ONCMY        0.38  0.66  145  288    3  143  146    2    7  143  C1BIC4     Hemoglobin subunit alpha-4 OS=Oncorhynchus mykiss GN=HBA4 PE=2 SV=1
 3175 : C1BX42_ESOLU        0.38  0.68  145  288    3  143  146    2    7  143  C1BX42     Hemoglobin subunit alpha-4 OS=Esox lucius GN=HBA4 PE=2 SV=1
 3176 : C1C3J9_LITCT        0.38  0.68  145  288    3  142  146    2    8  142  C1C3J9     Hemoglobin subunit alpha-3 OS=Lithobates catesbeiana GN=HBA3 PE=2 SV=1
 3177 : C1FY21_DASNO        0.38  0.71    2  141    4  147  146    2    8  147  C1FY21     Hemoglobin, epsilon 1 (Predicted) OS=Dasypus novemcinctus GN=HBE1 PE=3 SV=1
 3178 : C5HYH6_CHRAS        0.38  0.71    2  141    4  147  146    2    8  147  C5HYH6     Beta-globin OS=Chrysochloris asiatica GN=HBB PE=3 SV=1
 3179 : C5MQU1_PERMA        0.38  0.73    2  141    4  147  146    2    8  147  C5MQU1     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T1 PE=3 SV=1
 3180 : C7EIJ7_ANSIN        0.38  0.73  145  288    3  142  146    2    8  142  C7EIJ7     Hemoglobin alpha A subunit OS=Anser indicus GN=HBA2 PE=3 SV=1
 3181 : C7EIJ8_ANSIN        0.38  0.73  145  288    3  142  146    2    8  142  C7EIJ8     Hemoglobin alpha A subunit OS=Anser indicus GN=HBA2 PE=3 SV=1
 3182 : C7EIL4_NEOJU        0.38  0.73  145  288    3  142  146    2    8  142  C7EIL4     Hemoglobin alpha A subunit OS=Neochen jubata GN=HBA2 PE=3 SV=1
 3183 : C7EIL5_CHLPI        0.38  0.73  145  288    3  142  146    2    8  142  C7EIL5     Hemoglobin alpha A subunit OS=Chloephaga picta picta GN=HBA2 PE=3 SV=1
 3184 : C7EIL6_CHLPI        0.38  0.73  145  288    3  142  146    2    8  142  C7EIL6     Hemoglobin alpha A subunit OS=Chloephaga picta leucoptera GN=HBA2 PE=3 SV=1
 3185 : C7EIL9_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EIL9     Hemoglobin alpha A subunit OS=Chloephaga hybrida hybrida GN=HBA2 PE=3 SV=1
 3186 : C7EIM0_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EIM0     Hemoglobin alpha A subunit OS=Chloephaga hybrida malvinarum GN=HBA2 PE=3 SV=1
 3187 : C7EIM2_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EIM2     Hemoglobin alpha A subunit OS=Chloephaga poliocephala GN=HBA2 PE=3 SV=1
 3188 : C7EIM4_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EIM4     Hemoglobin alpha A subunit OS=Chloephaga rubidiceps GN=HBA2 PE=3 SV=1
 3189 : C7EIP6_CYACY        0.38  0.73  145  288    3  142  146    2    8  142  C7EIP6     Hemoglobin alpha A subunit OS=Cyanochen cyanoptera GN=HBA2 PE=3 SV=1
 3190 : C7EIP7_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EIP7     Hemoglobin alpha A subunit OS=Merganetta armata GN=HBA2 PE=3 SV=1
 3191 : C7EIQ1_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EIQ1     Hemoglobin alpha A subunit OS=Merganetta armata GN=HBA2 PE=3 SV=1
 3192 : C7EIQ7_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EIQ7     Hemoglobin alpha A subunit OS=Merganetta armata GN=HBA2 PE=3 SV=1
 3193 : C7EIQ9_LOPSP        0.38  0.73  145  288    3  142  146    2    8  142  C7EIQ9     Hemoglobin alpha A subunit OS=Lophonetta specularioides GN=HBA2 PE=3 SV=1
 3194 : C7EIR0_LOPSP        0.38  0.73  145  288    3  142  146    2    8  142  C7EIR0     Hemoglobin alpha A subunit OS=Lophonetta specularioides specularioides GN=HBA2 PE=3 SV=1
 3195 : C7EIT1_LOPSP        0.38  0.73  145  288    3  142  146    2    8  142  C7EIT1     Hemoglobin alpha A subunit OS=Lophonetta specularioides specularioides GN=HBA2 PE=3 SV=1
 3196 : C7EIT3_LOPSP        0.38  0.72  145  288    3  142  146    2    8  142  C7EIT3     Hemoglobin alpha A subunit OS=Lophonetta specularioides alticola GN=HBA2 PE=3 SV=1
 3197 : C7EIT5_LOPSP        0.38  0.73  145  288    3  142  146    2    8  142  C7EIT5     Hemoglobin alpha A subunit OS=Lophonetta specularioides alticola GN=HBA2 PE=3 SV=1
 3198 : C7EIT6_LOPSP        0.38  0.73  145  288    3  142  146    2    8  142  C7EIT6     Hemoglobin alpha A subunit OS=Lophonetta specularioides alticola GN=HBA2 PE=3 SV=1
 3199 : C7EIU1_LOPSP        0.38  0.73  145  288    3  142  146    2    8  142  C7EIU1     Hemoglobin alpha A subunit OS=Lophonetta specularioides alticola GN=HBA2 PE=3 SV=1
 3200 : C7EIU7_LOPSP        0.38  0.72  145  288    3  142  146    2    8  142  C7EIU7     Hemoglobin alpha A subunit OS=Lophonetta specularioides alticola GN=HBA2 PE=3 SV=1
 3201 : C7EIZ0_ANACN        0.38  0.72  145  288    3  142  146    2    8  142  C7EIZ0     Hemoglobin alpha A subunit OS=Anas cyanoptera cyanoptera GN=HBA2 PE=3 SV=1
 3202 : C7EIZ1_ANACN        0.38  0.73  145  288    3  142  146    2    8  142  C7EIZ1     Hemoglobin alpha A subunit OS=Anas cyanoptera cyanoptera GN=HBA2 PE=3 SV=1
 3203 : C7EJ12_ANACN        0.38  0.73  145  288    3  142  146    2    8  142  C7EJ12     Hemoglobin alpha A subunit OS=Anas cyanoptera cyanoptera GN=HBA2 PE=3 SV=1
 3204 : C7EJ42_ANACN        0.38  0.73  145  288    3  142  146    2    8  142  C7EJ42     Hemoglobin alpha A subunit OS=Anas cyanoptera orinomus GN=HBA2 PE=3 SV=1
 3205 : C7EJ47_ANACN        0.38  0.72  145  288    3  142  146    2    8  142  C7EJ47     Hemoglobin alpha A subunit OS=Anas cyanoptera orinomus GN=HBA2 PE=3 SV=1
 3206 : C7EJ54_ANACN        0.38  0.73  145  288    3  142  146    2    8  142  C7EJ54     Hemoglobin alpha A subunit OS=Anas cyanoptera orinomus GN=HBA2 PE=3 SV=1
 3207 : C7EJ92_ANAVE        0.38  0.73  145  288    3  142  146    2    8  142  C7EJ92     Hemoglobin alpha A subunit OS=Anas versicolor versicolor GN=HBA2 PE=3 SV=1
 3208 : C7EJB6_ANAVE        0.38  0.73  145  288    3  142  146    2    8  142  C7EJB6     Hemoglobin alpha A subunit OS=Anas versicolor fretensis GN=HBA2 PE=3 SV=1
 3209 : C7EJC7_ANAPN        0.38  0.73  145  288    3  142  146    2    8  142  C7EJC7     Hemoglobin alpha A subunit OS=Anas puna GN=HBA2 PE=3 SV=1
 3210 : C7EJC8_ANAPN        0.38  0.72  145  288    3  142  146    2    8  142  C7EJC8     Hemoglobin alpha A subunit OS=Anas puna GN=HBA2 PE=3 SV=1
 3211 : C7EJC9_ANAPN        0.38  0.73  145  288    3  142  146    2    8  142  C7EJC9     Hemoglobin alpha A subunit OS=Anas puna GN=HBA2 PE=3 SV=1
 3212 : C7EJD0_ANAPN        0.38  0.73  145  288    3  142  146    2    8  142  C7EJD0     Hemoglobin alpha A subunit OS=Anas puna GN=HBA2 PE=3 SV=1
 3213 : C7EJE0_ANAPN        0.38  0.72  145  288    3  142  146    2    8  142  C7EJE0     Hemoglobin alpha A subunit OS=Anas puna GN=HBA2 PE=3 SV=1
 3214 : C7EJH0_ANAFV        0.38  0.73  145  288    3  142  146    2    8  142  C7EJH0     Hemoglobin alpha A subunit OS=Anas flavirostris flavirostris GN=HBA2 PE=3 SV=1
 3215 : C7EJH2_ANAFV        0.38  0.73  145  288    3  142  146    2    8  142  C7EJH2     Hemoglobin alpha A subunit OS=Anas flavirostris flavirostris GN=HBA2 PE=3 SV=1
 3216 : C7EJP1_ANAFV        0.38  0.73  145  288    3  142  146    2    8  142  C7EJP1     Hemoglobin alpha A subunit OS=Anas flavirostris oxyptera GN=HBA2 PE=3 SV=1
 3217 : C7EJP3_ANAFV        0.38  0.73  145  288    3  142  146    2    8  142  C7EJP3     Hemoglobin alpha A subunit OS=Anas flavirostris oxyptera GN=HBA2 PE=3 SV=1
 3218 : C7EJW2_CHATO        0.38  0.69  145  288    3  142  146    2    8  142  C7EJW2     Hemoglobin alpha A subunit OS=Chauna torquata GN=HBA2 PE=3 SV=1
 3219 : C7EJW4_DENVD        0.38  0.72  145  288    3  142  146    2    8  142  C7EJW4     Hemoglobin alpha A subunit OS=Dendrocygna viduata GN=HBA2 PE=3 SV=1
 3220 : C7EJW9_DENBI        0.38  0.72  145  288    3  142  146    2    8  142  C7EJW9     Hemoglobin alpha A subunit OS=Dendrocygna bicolor GN=HBA2 PE=3 SV=1
 3221 : C7EJX2_DENAC        0.38  0.72  145  288    3  142  146    2    8  142  C7EJX2     Hemoglobin alpha A subunit OS=Dendrocygna arcuata GN=HBA2 PE=3 SV=1
 3222 : C7EJX3_9AVES        0.38  0.72  145  288    3  142  146    2    8  142  C7EJX3     Hemoglobin alpha A subunit OS=Dendrocygna javanica GN=HBA2 PE=3 SV=1
 3223 : C7EJX4_BIZLO        0.38  0.73  145  288    3  142  146    2    8  142  C7EJX4     Hemoglobin alpha A subunit OS=Biziura lobata GN=HBA2 PE=3 SV=1
 3224 : C7EJX6_COSCO        0.38  0.73  145  288    3  142  146    2    8  142  C7EJX6     Hemoglobin alpha A subunit OS=Coscoroba coscoroba GN=HBA2 PE=3 SV=1
 3225 : C7EJY1_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EJY1     Hemoglobin alpha A subunit OS=Cygnus melancoryphus GN=HBA2 PE=3 SV=1
 3226 : C7EJY4_CYGAT        0.38  0.73  145  288    3  142  146    2    8  142  C7EJY4     Hemoglobin alpha A subunit OS=Cygnus atratus GN=HBA2 PE=3 SV=1
 3227 : C7EJY6_CYGOL        0.38  0.73  145  288    3  142  146    2    8  142  C7EJY6     Hemoglobin alpha A subunit OS=Cygnus olor GN=HBA2 PE=3 SV=1
 3228 : C7EJY8_CYGBU        0.38  0.73  145  288    3  142  146    2    8  142  C7EJY8     Hemoglobin alpha A subunit OS=Cygnus buccinator GN=HBA2 PE=3 SV=1
 3229 : C7EJY9_CYGCO        0.38  0.73  145  288    3  142  146    2    8  142  C7EJY9     Hemoglobin alpha A subunit OS=Cygnus columbianus GN=HBA2 PE=3 SV=1
 3230 : C7EJZ0_CYGCY        0.38  0.73  145  288    3  142  146    2    8  142  C7EJZ0     Hemoglobin alpha A subunit OS=Cygnus cygnus GN=HBA2 PE=3 SV=1
 3231 : C7EJZ1_ANSCY        0.38  0.72  145  288    3  142  146    2    8  142  C7EJZ1     Hemoglobin alpha A subunit OS=Anser cygnoides GN=HBA2 PE=3 SV=1
 3232 : C7EJZ2_9AVES        0.38  0.72  145  288    3  142  146    2    8  142  C7EJZ2     Hemoglobin alpha A subunit OS=Anser fabalis GN=HBA2 PE=3 SV=1
 3233 : C7EJZ3_9AVES        0.38  0.72  145  288    3  142  146    2    8  142  C7EJZ3     Hemoglobin alpha A subunit OS=Anser anser GN=HBA2 PE=3 SV=1
 3234 : C7EJZ5_ANSAL        0.38  0.72  145  288    3  142  146    2    8  142  C7EJZ5     Hemoglobin alpha A subunit OS=Anser albifrons GN=HBA2 PE=3 SV=1
 3235 : C7EJZ7_CHECA        0.38  0.72  145  288    3  142  146    2    8  142  C7EJZ7     Hemoglobin alpha A subunit OS=Chen canagica GN=HBA2 PE=3 SV=1
 3236 : C7EJZ9_ANSCE        0.38  0.72  145  288    3  142  146    2    8  142  C7EJZ9     Hemoglobin alpha A subunit OS=Anser caerulescens GN=HBA2 PE=3 SV=1
 3237 : C7EK00_ANSRO        0.38  0.72  145  288    3  142  146    2    8  142  C7EK00     Hemoglobin alpha A subunit OS=Anser rossii GN=HBA2 PE=3 SV=1
 3238 : C7EK02_BRACA        0.38  0.73  145  288    3  142  146    2    8  142  C7EK02     Hemoglobin alpha A subunit OS=Branta canadensis GN=HBA2 PE=3 SV=1
 3239 : C7EK03_BRASA        0.38  0.73  145  288    3  142  146    2    8  142  C7EK03     Hemoglobin alpha A subunit OS=Branta sandvicensis GN=HBA2 PE=3 SV=1
 3240 : C7EK05_BRABN        0.38  0.73  145  288    3  142  146    2    8  142  C7EK05     Hemoglobin alpha A subunit OS=Branta bernicla GN=HBA2 PE=3 SV=1
 3241 : C7EK07_BRALE        0.38  0.73  145  288    3  142  146    2    8  142  C7EK07     Hemoglobin alpha A subunit OS=Branta leucopsis GN=HBA2 PE=3 SV=1
 3242 : C7EK09_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK09     Hemoglobin alpha A subunit OS=Malacorhynchus membranaceus GN=HBA2 PE=3 SV=1
 3243 : C7EK12_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK12     Hemoglobin alpha A subunit OS=Nettapus coromandelianus GN=HBA2 PE=3 SV=1
 3244 : C7EK14_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK14     Hemoglobin alpha A subunit OS=Stictonetta naevosa GN=HBA2 PE=3 SV=1
 3245 : C7EK16_9AVES        0.38  0.72  145  288    3  142  146    2    8  142  C7EK16     Hemoglobin alpha A subunit OS=Heteronetta atricapilla GN=HBA2 PE=3 SV=1
 3246 : C7EK30_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK30     Hemoglobin alpha A subunit OS=Plectropterus gambensis GN=HBA2 PE=3 SV=1
 3247 : C7EK31_SARME        0.38  0.73  145  288    3  142  146    2    8  142  C7EK31     Hemoglobin alpha A subunit OS=Sarkidiornis melanotos GN=HBA2 PE=3 SV=1
 3248 : C7EK32_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK32     Hemoglobin alpha A subunit OS=Pteronetta hartlaubi GN=HBA2 PE=3 SV=1
 3249 : C7EK33_ALOAE        0.38  0.73  145  288    3  142  146    2    8  142  C7EK33     Hemoglobin alpha A subunit OS=Alopochen aegyptiaca GN=HBA2 PE=3 SV=1
 3250 : C7EK34_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK34     Hemoglobin alpha A subunit OS=Tadorna tadorna GN=HBA2 PE=3 SV=1
 3251 : C7EK36_9AVES        0.38  0.72  145  288    3  142  146    2    8  142  C7EK36     Hemoglobin alpha A subunit OS=Tadorna ferruginea GN=HBA2 PE=3 SV=1
 3252 : C7EK37_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK37     Hemoglobin alpha A subunit OS=Tadorna cana GN=HBA2 PE=3 SV=1
 3253 : C7EK38_TADTA        0.38  0.73  145  288    3  142  146    2    8  142  C7EK38     Hemoglobin alpha A subunit OS=Tadorna tadornoides GN=HBA2 PE=3 SV=1
 3254 : C7EK39_CAIMO        0.38  0.73  145  288    3  142  146    2    8  142  C7EK39     Hemoglobin alpha A subunit OS=Cairina moschata GN=HBA2 PE=3 SV=1
 3255 : C7EK40_AIXSP        0.38  0.72  145  288    3  142  146    2    8  142  C7EK40     Hemoglobin alpha A subunit OS=Aix sponsa GN=HBA2 PE=3 SV=1
 3256 : C7EK41_AIXGA        0.38  0.73  145  288    3  142  146    2    8  142  C7EK41     Hemoglobin alpha A subunit OS=Aix galericulata GN=HBA2 PE=3 SV=1
 3257 : C7EK42_CHEJU        0.38  0.73  145  288    3  142  146    2    8  142  C7EK42     Hemoglobin alpha A subunit OS=Chenonetta jubata GN=HBA2 PE=3 SV=1
 3258 : C7EK44_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK44     Hemoglobin alpha A subunit OS=Callonetta leucophrys GN=HBA2 PE=3 SV=1
 3259 : C7EK46_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK46     Hemoglobin alpha A subunit OS=Marmaronetta angustirostris GN=HBA2 PE=3 SV=1
 3260 : C7EK47_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK47     Hemoglobin alpha A subunit OS=Asarcornis scutulata GN=HBA2 PE=3 SV=1
 3261 : C7EK48_NETRU        0.38  0.73  145  288    3  142  146    2    8  142  C7EK48     Hemoglobin alpha A subunit OS=Netta rufina GN=HBA2 PE=3 SV=1
 3262 : C7EK49_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK49     Hemoglobin alpha A subunit OS=Netta peposaca GN=HBA2 PE=3 SV=1
 3263 : C7EK51_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK51     Hemoglobin alpha A subunit OS=Netta erythrophthalma GN=HBA2 PE=3 SV=1
 3264 : C7EK52_AYTVA        0.38  0.73  145  288    3  142  146    2    8  142  C7EK52     Hemoglobin alpha A subunit OS=Aythya valisineria GN=HBA2 PE=3 SV=1
 3265 : C7EK53_AYTAM        0.38  0.73  145  288    3  142  146    2    8  142  C7EK53     Hemoglobin alpha A subunit OS=Aythya americana GN=HBA2 PE=3 SV=1
 3266 : C7EK55_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK55     Hemoglobin alpha A subunit OS=Aythya ferina GN=HBA2 PE=3 SV=1
 3267 : C7EK56_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK56     Hemoglobin alpha A subunit OS=Aythya australis GN=HBA2 PE=3 SV=1
 3268 : C7EK57_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EK57     Hemoglobin alpha A subunit OS=Aythya nyroca GN=HBA2 PE=3 SV=1
 3269 : C7EK58_AYTCO        0.38  0.73  145  288    3  142  146    2    8  142  C7EK58     Hemoglobin alpha A subunit OS=Aythya collaris GN=HBA2 PE=3 SV=1
 3270 : C7EK60_AYTFU        0.38  0.73  145  288    3  142  146    2    8  142  C7EK60     Hemoglobin alpha A subunit OS=Aythya fuligula GN=HBA2 PE=3 SV=1
 3271 : C7EK61_AYTMA        0.38  0.73  145  288    3  142  146    2    8  142  C7EK61     Hemoglobin alpha A subunit OS=Aythya marila GN=HBA2 PE=3 SV=1
 3272 : C7EK64_AYTAF        0.38  0.73  145  288    3  142  146    2    8  142  C7EK64     Hemoglobin alpha A subunit OS=Aythya affinis GN=HBA2 PE=3 SV=1
 3273 : C7EK67_POLST        0.38  0.73  145  288    3  142  146    2    8  142  C7EK67     Hemoglobin alpha A subunit OS=Polysticta stelleri GN=HBA2 PE=3 SV=1
 3274 : C7EK69_SOMFI        0.38  0.73  145  288    3  142  146    2    8  142  C7EK69     Hemoglobin alpha A subunit OS=Somateria fischeri GN=HBA2 PE=3 SV=1
 3275 : C7EK71_SOMSP        0.38  0.73  145  288    3  142  146    2    8  142  C7EK71     Hemoglobin alpha A subunit OS=Somateria spectabilis GN=HBA2 PE=3 SV=1
 3276 : C7EK73_SOMMO        0.38  0.73  145  288    3  142  146    2    8  142  C7EK73     Hemoglobin alpha A subunit OS=Somateria mollissima GN=HBA2 PE=3 SV=1
 3277 : C7EK79_HISHI        0.38  0.73  145  288    3  142  146    2    8  142  C7EK79     Hemoglobin alpha A subunit OS=Histrionicus histrionicus GN=HBA2 PE=3 SV=1
 3278 : C7EK81_MELPE        0.38  0.73  145  288    3  142  146    2    8  142  C7EK81     Hemoglobin alpha A subunit OS=Melanitta perspicillata GN=HBA2 PE=3 SV=1
 3279 : C7EK83_MELFS        0.38  0.73  145  288    3  142  146    2    8  142  C7EK83     Hemoglobin alpha A subunit OS=Melanitta fusca GN=HBA2 PE=3 SV=1
 3280 : C7EK85_MELNI        0.38  0.73  145  288    3  142  146    2    8  142  C7EK85     Hemoglobin alpha A subunit OS=Melanitta nigra GN=HBA2 PE=3 SV=1
 3281 : C7EK87_CLAHY        0.38  0.73  145  288    3  142  146    2    8  142  C7EK87     Hemoglobin alpha A subunit OS=Clangula hyemalis GN=HBA2 PE=3 SV=1
 3282 : C7EK88_CLAHY        0.38  0.73  145  288    3  142  146    2    8  142  C7EK88     Hemoglobin alpha A subunit OS=Clangula hyemalis GN=HBA2 PE=3 SV=1
 3283 : C7EK89_BUCAL        0.38  0.73  145  288    3  142  146    2    8  142  C7EK89     Hemoglobin alpha A subunit OS=Bucephala albeola GN=HBA2 PE=3 SV=1
 3284 : C7EK91_BUCCL        0.38  0.73  145  288    3  142  146    2    8  142  C7EK91     Hemoglobin alpha A subunit OS=Bucephala clangula GN=HBA2 PE=3 SV=1
 3285 : C7EK93_BUCIS        0.38  0.72  145  288    3  142  146    2    8  142  C7EK93     Hemoglobin alpha A subunit OS=Bucephala islandica GN=HBA2 PE=3 SV=1
 3286 : C7EK94_MERAL        0.38  0.73  145  288    3  142  146    2    8  142  C7EK94     Hemoglobin alpha A subunit OS=Mergellus albellus GN=HBA2 PE=3 SV=1
 3287 : C7EK96_LOPCU        0.38  0.73  145  288    3  142  146    2    8  142  C7EK96     Hemoglobin alpha A subunit OS=Lophodytes cucullatus GN=HBA2 PE=3 SV=1
 3288 : C7EK98_MERMG        0.38  0.73  145  288    3  142  146    2    8  142  C7EK98     Hemoglobin alpha A subunit OS=Mergus merganser GN=HBA2 PE=3 SV=1
 3289 : C7EKA0_MERSR        0.38  0.73  145  288    3  142  146    2    8  142  C7EKA0     Hemoglobin alpha A subunit OS=Mergus serrator GN=HBA2 PE=3 SV=1
 3290 : C7EKA2_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EKA2     Hemoglobin alpha A subunit OS=Tachyeres patachonicus GN=HBA2 PE=3 SV=1
 3291 : C7EKA4_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EKA4     Hemoglobin alpha A subunit OS=Tachyeres leucocephalus GN=HBA2 PE=3 SV=1
 3292 : C7EKA5_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EKA5     Hemoglobin alpha A subunit OS=Tachyeres brachypterus GN=HBA2 PE=3 SV=1
 3293 : C7EKA8_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EKA8     Hemoglobin alpha A subunit OS=Tachyeres pteneres GN=HBA2 PE=3 SV=1
 3294 : C7EKA9_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EKA9     Hemoglobin alpha A subunit OS=Speculanas specularis GN=HBA2 PE=3 SV=1
 3295 : C7EKB2_AMABR        0.38  0.73  145  288    3  142  146    2    8  142  C7EKB2     Hemoglobin alpha A subunit OS=Amazonetta brasiliensis GN=HBA2 PE=3 SV=1
 3296 : C7EKB5_ANAPA        0.38  0.73  145  288    3  142  146    2    8  142  C7EKB5     Hemoglobin alpha A subunit OS=Anas platalea GN=HBA2 PE=3 SV=1
 3297 : C7EKB8_ANACL        0.38  0.73  145  288    3  142  146    2    8  142  C7EKB8     Hemoglobin alpha A subunit OS=Anas clypeata GN=HBA2 PE=3 SV=1
 3298 : C7EKC0_ANARH        0.38  0.73  145  288    3  142  146    2    8  142  C7EKC0     Hemoglobin alpha A subunit OS=Anas rhynchotis GN=HBA2 PE=3 SV=1
 3299 : C7EKC1_ANACN        0.38  0.73  145  288    3  142  146    2    8  142  C7EKC1     Hemoglobin alpha A subunit OS=Anas cyanoptera septentrionalium GN=HBA2 PE=3 SV=1
 3300 : C7EKC4_ANACN        0.38  0.73  145  288    3  142  146    2    8  142  C7EKC4     Hemoglobin alpha A subunit OS=Anas cyanoptera septentrionalium GN=HBA2 PE=3 SV=1
 3301 : C7EKF2_ANACN        0.38  0.72  145  288    3  142  146    2    8  142  C7EKF2     Hemoglobin alpha A subunit OS=Anas cyanoptera septentrionalium GN=HBA2 PE=3 SV=1
 3302 : C7EKJ1_ANADI        0.38  0.73  145  288    3  142  146    2    8  142  C7EKJ1     Hemoglobin alpha A subunit OS=Anas discors GN=HBA2 PE=3 SV=1
 3303 : C7EKJ5_ANAQU        0.38  0.73  145  288    3  142  146    2    8  142  C7EKJ5     Hemoglobin alpha A subunit OS=Anas querquedula GN=HBA2 PE=3 SV=1
 3304 : C7EKJ6_ANAFO        0.38  0.73  145  288    3  142  146    2    8  142  C7EKJ6     Hemoglobin alpha A subunit OS=Anas formosa GN=HBA2 PE=3 SV=1
 3305 : C7EKJ9_ANAST        0.38  0.73  145  288    3  142  146    2    8  142  C7EKJ9     Hemoglobin alpha A subunit OS=Anas strepera GN=HBA2 PE=3 SV=1
 3306 : C7EKK0_ANAFA        0.38  0.73  145  288    3  142  146    2    8  142  C7EKK0     Hemoglobin alpha A subunit OS=Anas falcata GN=HBA2 PE=3 SV=1
 3307 : C7EKK1_ANASI        0.38  0.73  145  288    3  142  146    2    8  142  C7EKK1     Hemoglobin alpha A subunit OS=Anas sibilatrix GN=HBA2 PE=3 SV=1
 3308 : C7EKK6_ANAAM        0.38  0.73  145  288    3  142  146    2    8  142  C7EKK6     Hemoglobin alpha A subunit OS=Anas americana GN=HBA2 PE=3 SV=1
 3309 : C7EKK7_ANAPE        0.38  0.73  145  288    3  142  146    2    8  142  C7EKK7     Hemoglobin alpha A subunit OS=Anas penelope GN=HBA2 PE=3 SV=1
 3310 : C7EKK8_ANAAC        0.38  0.73  145  288    3  142  146    2    8  142  C7EKK8     Hemoglobin alpha A subunit OS=Anas acuta GN=HBA2 PE=3 SV=1
 3311 : C7EKL0_ANABA        0.38  0.72  145  288    3  142  146    2    8  142  C7EKL0     Hemoglobin alpha A subunit OS=Anas bahamensis GN=HBA2 PE=3 SV=1
 3312 : C7EKL3_ANABA        0.38  0.72  145  288    3  142  146    2    8  142  C7EKL3     Hemoglobin alpha A subunit OS=Anas bahamensis GN=HBA2 PE=3 SV=1
 3313 : C7EKN4_ANACR        0.38  0.73  145  288    3  142  146    2    8  142  C7EKN4     Hemoglobin alpha A subunit OS=Anas crecca crecca GN=HBA2 PE=3 SV=1
 3314 : C7EKN6_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EKN6     Hemoglobin alpha A subunit OS=Anas carolinensis GN=HBA2 PE=3 SV=1
 3315 : C7EKN7_ANAFV        0.38  0.73  145  288    3  142  146    2    8  142  C7EKN7     Hemoglobin alpha A subunit OS=Anas flavirostris andium GN=HBA2 PE=3 SV=1
 3316 : C7EKN8_ANAFV        0.38  0.73  145  288    3  142  146    2    8  142  C7EKN8     Hemoglobin alpha A subunit OS=Anas flavirostris andium GN=HBA2 PE=3 SV=1
 3317 : C7EKN9_ANAPL        0.38  0.73  145  288    3  142  146    2    8  142  C7EKN9     Hemoglobin alpha A subunit OS=Anas platyrhynchos GN=HBA2 PE=3 SV=1
 3318 : C7EKP0_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  C7EKP0     Hemoglobin alpha A subunit OS=Anas zonorhyncha GN=HBA2 PE=3 SV=1
 3319 : C7EKP1_ANASE        0.38  0.73  145  288    3  142  146    2    8  142  C7EKP1     Hemoglobin alpha A subunit OS=Anas superciliosa GN=HBA2 PE=3 SV=1
 3320 : C7EKP2_ANAME        0.38  0.73  145  288    3  142  146    2    8  142  C7EKP2     Hemoglobin alpha A subunit OS=Anas melleri GN=HBA2 PE=3 SV=1
 3321 : C7S371_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  C7S371     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 3322 : C7S372_PERMA        0.38  0.69  145  288    3  142  146    2    8  142  C7S372     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 3323 : C7S389_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  C7S389     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 3324 : C7S391_PERMA        0.38  0.67  145  288    3  141  146    3    9  141  C7S391     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 3325 : C7S395_PERMA        0.38  0.67  145  288    3  141  146    3    9  141  C7S395     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 3326 : C7S396_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  C7S396     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 3327 : C7S3A1_PERMA        0.38  0.68  145  288    3  141  146    3    9  141  C7S3A1     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 3328 : C7S3A9_PERMA        0.38  0.69  145  288    3  142  146    2    8  142  C7S3A9     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 3329 : C7S3B3_PERMA        0.38  0.68  145  288    3  141  146    3    9  141  C7S3B3     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 3330 : C7S3I2_PERMA        0.38  0.68  145  288    3  142  146    2    8  142  C7S3I2     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 3331 : C8AUQ0_PERMA        0.38  0.72    2  141    4  147  146    2    8  147  C8AUQ0     Beta-globin subunit OS=Peromyscus maniculatus GN=HBB-T2 PE=3 SV=1
 3332 : D0U283_MUSCR        0.38  0.71    2  141    4  147  146    2    8  147  D0U283     Beta-globin OS=Mus caroli GN=Hbbt2 PE=3 SV=1
 3333 : D0U284_MUSMC        0.38  0.71    2  141    4  147  146    2    8  147  D0U284     Beta-globin OS=Mus musculus castaneus GN=Hbbt2 PE=3 SV=1
 3334 : D0U285_MUSMC        0.38  0.72    2  141    4  147  146    2    8  147  D0U285     Beta-globin OS=Mus musculus castaneus GN=Hbbt2 PE=3 SV=1
 3335 : D0U286_MUSCE        0.38  0.70    2  141    4  147  146    2    8  147  D0U286     Beta-globin OS=Mus cervicolor GN=Hbbt2 PE=3 SV=1
 3336 : D0U289_MUSMA        0.38  0.72    2  141    4  147  146    2    8  147  D0U289     Beta-globin OS=Mus macedonicus GN=Hbbt2 PE=3 SV=1
 3337 : D0U290_MUSMI        0.38  0.72    2  141    4  147  146    2    8  147  D0U290     Beta-globin OS=Mus minutoides GN=Hbbt2 PE=3 SV=1
 3338 : D0U293_MOUSE        0.38  0.71    2  141    4  147  146    2    8  147  D0U293     Beta-globin OS=Mus musculus GN=Hbbt2 PE=3 SV=1
 3339 : D0U298_MUSSI        0.38  0.72    2  141    4  147  146    2    8  147  D0U298     Beta-globin OS=Mus spicilegus GN=Hbbt2 PE=3 SV=1
 3340 : D0VWV2_PERFV1XQ5    0.38  0.66  145  288    3  143  146    2    7  143  D0VWV2     Hemoglobin alpha-1 chain OS=Perca flavescens PE=1 SV=1
 3341 : D3GKD9_HUMAN        0.38  0.69    2  141    4  147  146    2    8  147  D3GKD9     G-gamma globin Paulinia variant OS=Homo sapiens GN=HBG2 PE=3 SV=1
 3342 : D4N6M2_MUSMC        0.38  0.71    2  141    4  147  146    2    8  147  D4N6M2     Beta-globin OS=Mus musculus castaneus GN=Hbbt2 PE=3 SV=1
 3343 : D4N6N2_MUSMC        0.38  0.72    2  141    4  147  146    2    8  147  D4N6N2     Beta-globin OS=Mus musculus castaneus GN=Hbbt2 PE=3 SV=1
 3344 : D4N6N9_MUSMC        0.38  0.72    2  141    4  147  146    2    8  147  D4N6N9     Beta-globin OS=Mus musculus castaneus GN=Hbbt2 PE=3 SV=1
 3345 : D9I2E9_SCAOR        0.38  0.69    2  141    4  147  146    2    8  147  D9I2E9     Hemoglobin subunit delta OS=Scapanus orarius GN=HBD PE=2 SV=1
 3346 : F1RGX7_PIG          0.38  0.71  145  288    3  142  146    2    8  142  F1RGX7     Uncharacterized protein OS=Sus scrofa GN=LOC100737689 PE=3 SV=1
 3347 : F6RF57_HORSE        0.38  0.72    2  141    4  147  146    2    8  147  F6RF57     Uncharacterized protein OS=Equus caballus GN=HBE1 PE=3 SV=1
 3348 : F6U239_ORNAN        0.38  0.66  160  288    1  121  130    3   10  121  F6U239     Hemoglobin subunit alpha OS=Ornithorhynchus anatinus GN=HBA PE=3 SV=2
 3349 : F6WII6_MONDO        0.38  0.71    2  141    4  147  146    2    8  147  F6WII6     Uncharacterized protein OS=Monodelphis domestica GN=LOC100019461 PE=3 SV=2
 3350 : F6YMJ4_MONDO        0.38  0.72  145  288    3  142  146    2    8  142  F6YMJ4     Uncharacterized protein OS=Monodelphis domestica GN=LOC100618817 PE=3 SV=1
 3351 : F7C7G9_MACMU        0.38  0.66  145  288    3  142  146    2    8  142  F7C7G9     Uncharacterized protein OS=Macaca mulatta GN=HBQ1 PE=3 SV=1
 3352 : G1M487_AILME        0.38  0.70    2  141    4  147  146    2    8  147  G1M487     Uncharacterized protein OS=Ailuropoda melanoleuca GN=LOC100482027 PE=3 SV=1
 3353 : G1Q293_MYOLU        0.38  0.69  145  288    3  142  146    2    8  142  G1Q293     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
 3354 : G1S6C7_NOMLE        0.38  0.69    2  141    4  147  146    2    8  147  G1S6C7     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100581638 PE=3 SV=1
 3355 : G1TPE2_RABIT        0.38  0.71    2  141    9  152  146    2    8  152  G1TPE2     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus GN=HBG1 PE=3 SV=1
 3356 : G3IA42_CRIGR        0.38  0.68  145  288    3  142  146    2    8  142  G3IA42     Hemoglobin subunit zeta OS=Cricetulus griseus GN=I79_020458 PE=3 SV=1
 3357 : G3PL61_GASAC        0.38  0.68  145  288    4  144  146    2    7  144  G3PL61     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 3358 : G3SEU0_GORGO        0.38  0.69  145  288    3  142  146    2    8  142  G3SEU0     Uncharacterized protein OS=Gorilla gorilla gorilla GN=HBZ PE=3 SV=1
 3359 : G3SIN5_GORGO        0.38  0.70    2  141    4  147  146    2    8  147  G3SIN5     Uncharacterized protein OS=Gorilla gorilla gorilla PE=3 SV=1
 3360 : G3U5A2_LOXAF        0.38  0.69  145  288    3  142  146    2    8  142  G3U5A2     Uncharacterized protein OS=Loxodonta africana GN=LOC100658044 PE=3 SV=1
 3361 : G3VJC1_SARHA        0.38  0.72    2  141    4  147  146    2    8  147  G3VJC1     Uncharacterized protein OS=Sarcophilus harrisii PE=3 SV=1
 3362 : G5BS33_HETGA        0.38  0.70    2  141    4  147  146    2    8  147  G5BS33     Hemoglobin subunit beta OS=Heterocephalus glaber GN=GW7_03824 PE=3 SV=1
 3363 : G5BXY1_HETGA        0.38  0.68  145  288    3  142  146    2    8  142  G5BXY1     Hemoglobin subunit alpha OS=Heterocephalus glaber GN=GW7_12998 PE=3 SV=1
 3364 : G5BXY5_HETGA        0.38  0.67  145  284    3  138  143    4   10  138  G5BXY5     Hemoglobin subunit zeta OS=Heterocephalus glaber GN=GW7_13002 PE=3 SV=1
 3365 : G5E0T9_9PIPI        0.38  0.67  145  286    6  140  144    2   11  140  G5E0T9     Putative alpha globin larval-1 (Fragment) OS=Pipa carvalhoi PE=2 SV=1
 3366 : G5E759_LOXAF        0.38  0.71    2  141    4  147  146    2    8  147  G5E759     Uncharacterized protein OS=Loxodonta africana GN=LOC100677792 PE=3 SV=1
 3367 : G7PQY2_MACFA        0.38  0.69    2  141    4  147  146    2    8  147  G7PQY2     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_05959 PE=3 SV=1
 3368 : G8DP13_PLAFE        0.38  0.64  145  288    3  144  146    2    6  144  G8DP13     Alpha 2-globin OS=Platichthys flesus PE=2 SV=1
 3369 : G8G8X6_EPICO        0.38  0.63  145  288    3  143  146    2    7  143  G8G8X6     Hemoglobin alpha chain OS=Epinephelus coioides PE=2 SV=1
 3370 : G8ZF55_RABIT        0.38  0.64  145  288    3  142  146    2    8  142  G8ZF55     Alpha-globin 2 OS=Oryctolagus cuniculus GN=HBA2 PE=3 SV=1
 3371 : G8ZF59_RABIT        0.38  0.64  145  288    3  142  146    2    8  142  G8ZF59     Alpha-globin 2 OS=Oryctolagus cuniculus GN=HBA2 PE=3 SV=1
 3372 : G9FTH6_CONCR        0.38  0.68  145  288    3  142  146    2    8  142  G9FTH6     Hemoglobin subunit alpha 2 OS=Condylura cristata GN=HBA2 PE=2 SV=1
 3373 : G9FTH9_NEUGI        0.38  0.68    2  141    4  147  146    2    8  147  G9FTH9     Hemoglobin subunit delta 2 OS=Neurotrichus gibbsii GN=HBD2 PE=2 SV=1
 3374 : G9FTI1_NEUGI        0.38  0.68    2  140    4  146  145    2    8  146  G9FTI1     Hemoglobin subunit delta 2 (Fragment) OS=Neurotrichus gibbsii GN=HBD2 PE=3 SV=1
 3375 : H0UWE7_CAVPO        0.38  0.70    2  141    4  147  146    2    8  147  H0UWE7     Uncharacterized protein OS=Cavia porcellus GN=LOC100720944 PE=3 SV=1
 3376 : H0Z1T1_TAEGU        0.38  0.74  145  288    3  142  146    2    8  142  H0Z1T1     Uncharacterized protein OS=Taeniopygia guttata GN=HBZ PE=3 SV=1
 3377 : H2LKL5_ORYLA        0.38  0.68  145  288    4  144  146    2    7  144  H2LKL5     Uncharacterized protein OS=Oryzias latipes GN=LOC101174505 PE=3 SV=1
 3378 : H2LKL6_ORYLA        0.38  0.66  145  288    4  144  146    2    7  144  H2LKL6     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC101174505 PE=3 SV=1
 3379 : H2LKT8_ORYLA        0.38  0.69  145  288    4  144  146    2    7  144  H2LKT8     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC101175238 PE=3 SV=1
 3380 : H2NED9_PONAB        0.38  0.70    2  141    4  147  146    2    8  147  H2NED9     Uncharacterized protein OS=Pongo abelii GN=LOC100439631 PE=3 SV=1
 3381 : H2R5L8_PANTR        0.38  0.70    2  141    4  147  146    2    8  147  H2R5L8     Hemoglobin subunit gamma-2 OS=Pan troglodytes GN=HBG2 PE=3 SV=1
 3382 : H2R5L9_PANTR        0.38  0.70    2  141    4  147  146    2    8  147  H2R5L9     Hemoglobin subunit gamma-2 OS=Pan troglodytes GN=HBG2 PE=3 SV=1
 3383 : H2V2B7_TAKRU        0.38  0.67  150  288   11  146  141    2    7  146  H2V2B7     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101066922 PE=3 SV=1
 3384 : H6UZ35_PERMA        0.38  0.71    2  141    4  147  146    2    8  147  H6UZ35     Epsilon-globin OS=Peromyscus maniculatus GN=HBE-T1 PE=3 SV=1
 3385 : HBA1_COTGO          0.38  0.67  145  288    3  143  146    2    7  143  P84653     Hemoglobin subunit alpha-1 OS=Cottoperca gobio GN=hba1 PE=1 SV=2
 3386 : HBA1_EQUGR          0.38  0.68  145  288    3  142  146    2    8  142  Q9XSN2     Hemoglobin subunit alpha-1 OS=Equus grevyi GN=HBA1 PE=2 SV=3
 3387 : HBA1_GOBGI          0.38  0.68  145  288    2  142  146    2    7  142  P83611     Hemoglobin subunit alpha-1 OS=Gobionotothen gibberifrons GN=hba1 PE=1 SV=1
 3388 : HBA1_HAPGR          0.38  0.65  145  288    2  140  146    2    9  140  Q7M3B8     Hemoglobin subunit alpha-1 OS=Hapalemur griseus GN=HBA1 PE=1 SV=1
 3389 : HBA1_IGUIG          0.38  0.67  145  288    2  141  147    4   10  141  P18974     Hemoglobin subunit alpha-1 OS=Iguana iguana PE=1 SV=1
 3390 : HBA1_NAJNA          0.38  0.65  145  288    2  141  147    4   10  141  Q9PRL9     Hemoglobin subunit alpha-1 OS=Naja naja PE=1 SV=1
 3391 : HBA1_VARVI          0.38  0.67  145  288    2  141  146    2    8  141  P20018     Hemoglobin subunit alpha-1 OS=Varecia variegata PE=1 SV=1
 3392 : HBA2_ARCGL          0.38  0.64  145  288    3  143  146    2    7  143  Q1AGS4     Hemoglobin subunit alpha-2 OS=Arctogadus glacialis GN=hba2 PE=1 SV=3
 3393 : HBA2_TRENE          0.38  0.68  145  288    2  142  146    2    7  142  P45719     Hemoglobin subunit alpha-2 OS=Trematomus newnesi GN=hba2 PE=1 SV=1
 3394 : HBA2_VARVI          0.38  0.67  145  288    2  141  146    2    8  141  P20019     Hemoglobin subunit alpha-2 OS=Varecia variegata PE=1 SV=1
 3395 : HBA3_GORGO          0.38  0.66  145  288    2  141  146    2    8  141  P01934     Hemoglobin subunit alpha-3 OS=Gorilla gorilla gorilla PE=1 SV=1
 3396 : HBA3_LITCT          0.38  0.69  145  288    2  141  146    2    8  141  P02011     Hemoglobin subunit alpha-3 OS=Lithobates catesbeiana PE=1 SV=1
 3397 : HBA3_PANTR          0.38  0.66  145  288    2  141  146    2    8  141  P01935     Hemoglobin subunit alpha-3 OS=Pan troglodytes PE=1 SV=1
 3398 : HBA3_PLEWA          0.38  0.71  145  288    3  142  146    2    8  142  P11896     Hemoglobin larval subunit alpha OS=Pleurodeles waltl PE=2 SV=1
 3399 : HBAB_LITCT          0.38  0.64  145  288    3  142  146    2    8  142  P51465     Hemoglobin subunit alpha-B OS=Lithobates catesbeiana PE=1 SV=2
 3400 : HBAD_CHRPI          0.38  0.71  145  288    2  141  146    2    8  141  P02005     Hemoglobin subunit alpha-D OS=Chrysemys picta bellii GN=HBAD PE=1 SV=1
 3401 : HBAD_PHACO          0.38  0.68  145  288    2  141  146    2    8  141  P02002     Hemoglobin subunit alpha-D OS=Phasianus colchicus colchicus GN=HBAD PE=1 SV=1
 3402 : HBAZ_HUMAN  3W4U    0.38  0.70  145  288    3  142  146    2    8  142  P02008     Hemoglobin subunit zeta OS=Homo sapiens GN=HBZ PE=1 SV=2
 3403 : HBAZ_MOUSE          0.38  0.68  145  288    3  142  146    2    8  142  P06467     Hemoglobin subunit zeta OS=Mus musculus GN=Hbz PE=2 SV=2
 3404 : HBAZ_PANTR          0.38  0.69  145  288    3  142  146    2    8  142  P06347     Hemoglobin subunit zeta OS=Pan troglodytes GN=HBZ1 PE=3 SV=2
 3405 : HBA_ALLMI           0.38  0.73  145  288    3  142  146    2    8  142  P01999     Hemoglobin subunit alpha OS=Alligator mississippiensis GN=HBA PE=1 SV=2
 3406 : HBA_ANAPE           0.38  0.73  145  288    3  142  146    2    8  142  P22740     Hemoglobin subunit alpha-A OS=Anas penelope GN=HBAA PE=1 SV=2
 3407 : HBA_ANAPL   3EOK    0.38  0.73  145  288    3  142  146    2    8  142  P01986     Hemoglobin subunit alpha-A OS=Anas platyrhynchos GN=HBAA PE=1 SV=2
 3408 : HBA_ANAPP           0.38  0.73  145  288    3  142  146    2    8  142  P01988     Hemoglobin subunit alpha-A OS=Anas platyrhynchos platyrhynchos GN=HBAA PE=1 SV=2
 3409 : HBA_ANSAN   1FAW    0.38  0.72  145  288    3  142  146    2    8  142  P01989     Hemoglobin subunit alpha-A OS=Anser anser anser GN=HBAA PE=1 SV=2
 3410 : HBA_ANSIN   1HV4    0.38  0.73  145  288    3  142  146    2    8  142  P01990     Hemoglobin subunit alpha-A OS=Anser indicus GN=HBAA PE=1 SV=2
 3411 : HBA_ARAAR           0.38  0.71  145  288    3  142  146    2    8  142  P01996     Hemoglobin subunit alpha-A OS=Ara ararauna GN=HBAA PE=1 SV=2
 3412 : HBA_AYTFU           0.38  0.73  145  288    3  142  146    2    8  142  P84790     Hemoglobin subunit alpha-A OS=Aythya fuligula PE=1 SV=2
 3413 : HBA_BLABR           0.38  0.66  145  288    2  141  146    2    8  141  B3EWE1     Hemoglobin subunit alpha OS=Blarina brevicauda PE=1 SV=1
 3414 : HBA_BRACA           0.38  0.73  145  288    2  141  146    2    8  141  P01991     Hemoglobin subunit alpha-A OS=Branta canadensis GN=HBAA PE=1 SV=1
 3415 : HBA_CAICR           0.38  0.74  145  288    2  141  146    2    8  141  P02000     Hemoglobin subunit alpha OS=Caiman crocodilus GN=HBA PE=1 SV=1
 3416 : HBA_CAIMO           0.38  0.73  145  288    3  142  146    2    8  142  P01987     Hemoglobin subunit alpha-A OS=Cairina moschata GN=HBAA PE=2 SV=2
 3417 : HBA_CAMBA           0.38  0.66  145  288    2  141  146    2    8  141  P63105     Hemoglobin subunit alpha OS=Camelus bactrianus GN=HBA PE=1 SV=1
 3418 : HBA_CAMDR   3GDJ    0.38  0.66  145  288    2  141  146    2    8  141  P63106     Hemoglobin subunit alpha OS=Camelus dromedarius GN=HBA PE=1 SV=1
 3419 : HBA_CATCL           0.38  0.63  145  288    2  142  146    2    7  142  P02017     Hemoglobin subunit alpha OS=Catostomus clarkii GN=hba PE=1 SV=1
 3420 : HBA_CEBCA           0.38  0.69  145  288    2  141  146    2    8  141  P07421     Hemoglobin subunit alpha OS=Cebus capucinus GN=HBA PE=1 SV=1
 3421 : HBA_CHEKU           0.38  0.66  145  288    2  142  146    2    7  142  P80270     Hemoglobin subunit alpha OS=Chelidonichthys kumu GN=hba PE=1 SV=1
 3422 : HBA_CICCI           0.38  0.71  145  288    3  142  146    2    8  142  P01983     Hemoglobin subunit alpha-A OS=Ciconia ciconia GN=HBAA PE=1 SV=2
 3423 : HBA_COTJA   3MJP    0.38  0.72  145  288    3  142  146    2    8  142  P24589     Hemoglobin subunit alpha-A OS=Coturnix coturnix japonica GN=HBAA PE=1 SV=2
 3424 : HBA_CYGMA           0.38  0.65  145  288    2  142  146    2    7  142  P23016     Hemoglobin subunit alpha OS=Cygnodraco mawsoni GN=hba PE=1 SV=1
 3425 : HBA_CYGOL           0.38  0.73  145  288    2  141  146    2    8  141  P01992     Hemoglobin subunit alpha-A OS=Cygnus olor GN=HBAA PE=1 SV=1
 3426 : HBA_FELCA   3GYS    0.38  0.65  145  288    2  141  146    2    8  141  P07405     Hemoglobin subunit alpha OS=Felis catus GN=HBA PE=1 SV=1
 3427 : HBA_LEIXA   1SPG    0.38  0.68  145  288    2  143  146    2    6  143  P56250     Hemoglobin subunit alpha OS=Leiostomus xanthurus GN=hba PE=1 SV=1
 3428 : HBA_LORTA           0.38  0.68  145  288    2  141  146    2    8  141  P01938     Hemoglobin subunit alpha OS=Loris tardigradus GN=HBA PE=1 SV=2
 3429 : HBA_MACSP           0.38  0.68  145  288    2  141  146    2    8  141  P07402     Hemoglobin subunit alpha-1/2 OS=Macaca speciosa PE=1 SV=1
 3430 : HBA_MANSP           0.38  0.67  145  288    2  141  146    2    8  141  P08258     Hemoglobin subunit alpha-1/2 OS=Mandrillus sphinx PE=1 SV=1
 3431 : HBA_PAGLA           0.38  0.65  145  288    2  141  146    2    8  141  P19645     Hemoglobin subunit alpha OS=Paguma larvata GN=HBA PE=1 SV=1
 3432 : HBA_PAPAN           0.38  0.68  145  288    3  142  146    2    8  142  P63111     Hemoglobin subunit alpha OS=Papio anubis GN=HBA PE=2 SV=2
 3433 : HBA_PAPCY           0.38  0.68  145  288    3  142  146    2    8  142  P63112     Hemoglobin subunit alpha OS=Papio cynocephalus GN=HBA PE=1 SV=2
 3434 : HBA_PHACO           0.38  0.72  145  288    2  141  146    2    8  141  P01995     Hemoglobin subunit alpha-A OS=Phasianus colchicus colchicus GN=HBAA PE=1 SV=1
 3435 : HBA_PHYCD           0.38  0.68  145  288    2  141  146    2    8  141  P09904     Hemoglobin subunit alpha OS=Physeter catodon GN=HBA PE=1 SV=1
 3436 : HBA_RAT     3HF4    0.38  0.68  145  288    3  142  146    2    8  142  P01946     Hemoglobin subunit alpha-1/2 OS=Rattus norvegicus GN=Hba1 PE=1 SV=3
 3437 : HBA_RHEAM           0.38  0.71  145  288    2  141  146    2    8  141  P01982     Hemoglobin subunit alpha-A OS=Rhea americana GN=HBAA PE=1 SV=1
 3438 : HBA_SAGMY           0.38  0.68  145  288    2  141  146    2    8  141  Q7M3B6     Hemoglobin subunit alpha OS=Saguinus mystax GN=HBA PE=1 SV=1
 3439 : HBA_SPECI           0.38  0.67  145  288    2  141  146    2    8  141  P09420     Hemoglobin subunit alpha OS=Spermophilus citellus GN=HBA PE=1 SV=1
 3440 : HBA_SPEPA           0.38  0.68  145  288    2  141  146    2    8  141  P11750     Hemoglobin subunit alpha OS=Spermophilus parryii GN=HBA PE=1 SV=2
 3441 : HBA_SPETO           0.38  0.67  145  288    2  141  146    2    8  141  P07403     Hemoglobin subunit alpha OS=Spermophilus townsendii GN=HBA PE=1 SV=1
 3442 : HBA_TAMST           0.38  0.66  145  288    2  141  146    2    8  141  B3EWD9     Hemoglobin subunit alpha OS=Tamias striatus PE=1 SV=1
 3443 : HBA_TARBA           0.38  0.68  145  288    2  141  146    2    8  141  P01940     Hemoglobin subunit alpha OS=Tarsius bancanus GN=HBA PE=1 SV=1
 3444 : HBA_TUPGL           0.38  0.68  145  288    2  141  146    2    8  141  P01941     Hemoglobin subunit alpha OS=Tupaia glis GN=HBA PE=1 SV=1
 3445 : HBA_TURME           0.38  0.68  145  288    2  141  146    2    8  141  P14522     Hemoglobin subunit alpha-A OS=Turdus merula GN=HBAA PE=1 SV=1
 3446 : HBA_VULGR           0.38  0.72  145  288    2  141  146    2    8  141  P07404     Hemoglobin subunit alpha-A OS=Vultur gryphus GN=HBAA PE=1 SV=1
 3447 : HBB1_CHAMP          0.38  0.71    2  141    4  147  146    2    8  147  P68087     Hemoglobin subunit beta-1 OS=Chalinolobus morio GN=HBB1 PE=1 SV=2
 3448 : HBB1_PANLE          0.38  0.71    2  141    3  146  146    2    8  146  P68050     Hemoglobin subunit beta-1 OS=Panthera leo GN=HBB1 PE=1 SV=1
 3449 : HBB1_PANON          0.38  0.71    2  141    4  147  146    2    8  147  P68049     Hemoglobin subunit beta-1 OS=Panthera onca GN=HBB1 PE=1 SV=2
 3450 : HBB1_PANPS          0.38  0.71    2  141    4  147  146    2    8  147  P68051     Hemoglobin subunit beta-1 OS=Panthera pardus saxicolor GN=HBB1 PE=1 SV=2
 3451 : HBB1_PANTS          0.38  0.71    2  141    4  147  146    2    8  147  P68048     Hemoglobin subunit beta-1 OS=Panthera tigris sumatrae GN=HBB1 PE=1 SV=2
 3452 : HBB1_RAT    3HF4    0.38  0.73    2  141    4  147  146    2    8  147  P02091     Hemoglobin subunit beta-1 OS=Rattus norvegicus GN=Hbb PE=1 SV=3
 3453 : HBB1_TAPTE          0.38  0.69    2  141    3  146  146    2    8  146  P02064     Hemoglobin subunit beta-1 OS=Tapirus terrestris GN=HBB1 PE=1 SV=1
 3454 : HBB2_MOUSE  1I3R    0.38  0.72    2  141    4  147  146    2    8  147  P02089     Hemoglobin subunit beta-2 OS=Mus musculus GN=Hbb-b2 PE=1 SV=2
 3455 : HBB2_PANLE          0.38  0.71    2  141    3  146  146    2    8  146  P18988     Hemoglobin subunit beta-2 OS=Panthera leo GN=HBB2 PE=1 SV=2
 3456 : HBB2_PANON          0.38  0.71    2  141    4  147  146    2    8  147  P68064     Hemoglobin subunit beta-2 OS=Panthera onca GN=HBB2 PE=1 SV=2
 3457 : HBB2_PANPS          0.38  0.71    2  141    3  146  146    2    8  146  P68065     Hemoglobin subunit beta-2 OS=Panthera pardus saxicolor GN=HBB2 PE=1 SV=1
 3458 : HBB2_PANTS          0.38  0.71    2  141    3  146  146    2    8  146  P68194     Hemoglobin subunit beta-2 OS=Panthera tigris sumatrae GN=HBB2 PE=1 SV=1
 3459 : HBB2_TAPTE          0.38  0.69    2  141    3  146  146    2    8  146  P02065     Hemoglobin subunit beta-2 OS=Tapirus terrestris GN=HBB2 PE=1 SV=1
 3460 : HBB_AILFU           0.38  0.70    2  141    3  146  146    2    8  146  P18982     Hemoglobin subunit beta OS=Ailurus fulgens GN=HBB PE=1 SV=1
 3461 : HBB_ANTPA           0.38  0.71    2  141    3  146  146    2    8  146  P14388     Hemoglobin subunit beta OS=Antrozous pallidus GN=HBB PE=1 SV=1
 3462 : HBB_BALAC           0.38  0.71    2  141    3  146  146    2    8  146  P18984     Hemoglobin subunit beta OS=Balaenoptera acutorostrata GN=HBB PE=1 SV=1
 3463 : HBB_CALGO           0.38  0.71    2  141    4  147  146    2    8  147  Q6WN21     Hemoglobin subunit beta OS=Callimico goeldii GN=HBB PE=2 SV=3
 3464 : HBB_CANFA   2QLS    0.38  0.71    2  141    3  146  146    2    8  146  P60524     Hemoglobin subunit beta OS=Canis familiaris GN=HBB PE=1 SV=1
 3465 : HBB_CANLA           0.38  0.71    2  141    3  146  146    2    8  146  P60525     Hemoglobin subunit beta OS=Canis latrans GN=HBB PE=1 SV=1
 3466 : HBB_CAVPO   3HYU    0.38  0.70    2  141    3  146  146    2    8  146  P02095     Hemoglobin subunit beta OS=Cavia porcellus GN=HBB PE=1 SV=1
 3467 : HBB_CEBAP           0.38  0.71    2  141    4  147  146    2    8  147  P67821     Hemoglobin subunit beta OS=Cebus apella GN=HBB PE=1 SV=3
 3468 : HBB_CHRBR   1FHJ    0.38  0.71    2  141    3  146  146    2    8  146  P60526     Hemoglobin subunit beta OS=Chrysocyon brachyurus GN=HBB PE=1 SV=1
 3469 : HBB_CTEGU           0.38  0.71    2  141    3  146  146    2    8  146  P20855     Hemoglobin subunit beta OS=Ctenodactylus gundi GN=HBB PE=1 SV=1
 3470 : HBB_DASNO           0.38  0.68    2  141    4  147  146    2    8  147  P02087     Hemoglobin subunit beta OS=Dasypus novemcinctus GN=HBB PE=1 SV=3
 3471 : HBB_ECHTE           0.38  0.71    2  141    3  146  146    2    8  146  P24292     Hemoglobin subunit beta OS=Echinops telfairi GN=HBB PE=1 SV=1
 3472 : HBB_EULFU           0.38  0.71    1  141    3  147  147    2    8  147  P02053     Hemoglobin subunit beta OS=Eulemur fulvus fulvus GN=HBB PE=1 SV=2
 3473 : HBB_FELCA   3GYS    0.38  0.71    2  141    3  146  146    2    8  146  P07412     Hemoglobin subunit beta-A/B OS=Felis catus GN=HBB PE=1 SV=1
 3474 : HBB_HELMA           0.38  0.69    2  141    3  146  146    2    8  146  P68013     Hemoglobin subunit beta OS=Helarctos malayanus GN=HBB PE=1 SV=1
 3475 : HBB_HETPO           0.38  0.63  144  288    2  141  145    1    5  141  P02143     Hemoglobin subunit beta OS=Heterodontus portusjacksoni GN=HBB PE=1 SV=1
 3476 : HBB_LEPWE           0.38  0.71    2  141    3  146  146    2    8  146  P15166     Hemoglobin subunit beta OS=Leptonychotes weddelli GN=HBB PE=1 SV=1
 3477 : HBB_LORTA           0.38  0.70    2  141    3  146  146    2    8  146  P02048     Hemoglobin subunit beta OS=Loris tardigradus GN=HBB PE=1 SV=1
 3478 : HBB_LUTLU           0.38  0.70    2  141    3  146  146    2    8  146  P10893     Hemoglobin subunit beta OS=Lutra lutra GN=HBB PE=1 SV=1
 3479 : HBB_LYNLY           0.38  0.71    2  141    3  146  146    2    8  146  P41328     Hemoglobin subunit beta OS=Lynx lynx GN=HBB PE=1 SV=1
 3480 : HBB_MACGG           0.38  0.71    2  141    3  146  146    2    8  146  P24660     Hemoglobin subunit beta OS=Macroderma gigas GN=HBB PE=1 SV=1
 3481 : HBB_MICXA           0.38  0.71    2  141    3  146  146    2    8  146  P02092     Hemoglobin subunit beta OS=Microtus xanthognathus GN=HBB PE=1 SV=1
 3482 : HBB_MUSPF           0.38  0.70    2  141    3  146  146    2    8  146  P68044     Hemoglobin subunit beta OS=Mustela putorius furo GN=HBB PE=1 SV=1
 3483 : HBB_MUSPU           0.38  0.70    2  141    3  146  146    2    8  146  P68045     Hemoglobin subunit beta OS=Mustela putorius GN=HBB PE=1 SV=1
 3484 : HBB_MYOVE           0.38  0.72    2  141    3  146  146    2    8  146  P11758     Hemoglobin subunit beta OS=Myotis velifer GN=HBB PE=1 SV=1
 3485 : HBB_NASNA           0.38  0.69    2  141    3  146  146    2    8  146  P26916     Hemoglobin subunit beta OS=Nasua nasua GN=HBB PE=1 SV=1
 3486 : HBB_NYCCO           0.38  0.70    2  141    3  146  146    2    8  146  P02049     Hemoglobin subunit beta OS=Nycticebus coucang GN=HBB PE=1 SV=1
 3487 : HBB_PANPO           0.38  0.71    2  141    4  147  146    2    8  147  P04244     Hemoglobin subunit beta OS=Panthera pardus orientalis GN=HBB PE=1 SV=2
 3488 : HBB_PROLO           0.38  0.71    2  141    3  146  146    2    8  146  P18989     Hemoglobin subunit beta OS=Procyon lotor GN=HBB PE=1 SV=1
 3489 : HBB_RHIFE           0.38  0.69    2  141    4  147  146    2    8  147  B2KHZ4     Hemoglobin subunit beta OS=Rhinolophus ferrumequinum GN=HBB PE=2 SV=1
 3490 : HBB_SCAOR           0.38  0.69    2  141    4  147  146    2    8  147  Q2KPA3     Hemoglobin subunit beta OS=Scapanus orarius GN=HBB PE=2 SV=3
 3491 : HBB_TACAC           0.38  0.68    2  141    4  147  146    2    8  147  P02110     Hemoglobin subunit beta OS=Tachyglossus aculeatus aculeatus GN=HBB PE=1 SV=2
 3492 : HBB_TAPGE           0.38  0.71    2  141    3  146  146    2    8  146  P28781     Hemoglobin subunit beta OS=Taphozous georgianus GN=HBB PE=1 SV=1
 3493 : HBB_TRIIN           0.38  0.68    2  141    3  146  146    2    8  146  P07415     Hemoglobin subunit beta OS=Trichechus inunguis GN=HBB PE=1 SV=1
 3494 : HBB_URSMA           0.38  0.69    2  141    3  146  146    2    8  146  P68011     Hemoglobin subunit beta OS=Ursus maritimus GN=HBB PE=1 SV=1
 3495 : HBB_URSTH           0.38  0.69    2  141    3  146  146    2    8  146  P68012     Hemoglobin subunit beta OS=Ursus thibetanus GN=HBB PE=1 SV=1
 3496 : HBD_TARSY           0.38  0.72    2  141    4  147  146    2    8  147  P13558     Hemoglobin subunit delta OS=Tarsius syrichta GN=HBD PE=2 SV=2
 3497 : HBD_TRIMA           0.38  0.68    2  141    4  147  146    2    8  147  Q45XI8     Hemoglobin subunit delta OS=Trichechus manatus GN=HBD PE=2 SV=3
 3498 : HBE_BRATR           0.38  0.71    2  141    4  147  146    2    8  147  Q45XH3     Hemoglobin subunit epsilon OS=Bradypus tridactylus GN=HBE1 PE=2 SV=3
 3499 : HBE_CHEME           0.38  0.72    2  141    4  147  146    2    8  147  Q28338     Hemoglobin subunit epsilon OS=Cheirogaleus medius GN=HBE1 PE=2 SV=3
 3500 : HBE_DAUMA           0.38  0.73    2  141    4  147  146    2    8  147  Q28356     Hemoglobin subunit epsilon OS=Daubentonia madagascariensis GN=HBE1 PE=2 SV=3
 3501 : HBE_DIDVI           0.38  0.72    2  141    4  147  146    2    8  147  P11025     Hemoglobin subunit epsilon-M OS=Didelphis virginiana GN=HBE1 PE=2 SV=2
 3502 : HBE_EULFU           0.38  0.73    2  141    4  147  146    2    8  147  P08223     Hemoglobin subunit epsilon OS=Eulemur fulvus fulvus GN=HBE1 PE=2 SV=2
 3503 : HBE_MICMU           0.38  0.72    2  141    4  147  146    2    8  147  Q28496     Hemoglobin subunit epsilon OS=Microcebus murinus GN=HBE1 PE=2 SV=3
 3504 : HBE_MOUSE           0.38  0.73    2  141    4  147  146    2    8  147  P02104     Hemoglobin subunit epsilon-Y2 OS=Mus musculus GN=Hbb-y PE=1 SV=2
 3505 : HBE_OTOCR           0.38  0.72    2  141    4  147  146    2    8  147  P19759     Hemoglobin subunit epsilon OS=Otolemur crassicaudatus GN=HBE1 PE=2 SV=2
 3506 : HBE_PROVE           0.38  0.73    2  141    4  147  146    2    8  147  Q95238     Hemoglobin subunit epsilon OS=Propithecus verreauxi GN=HBE1 PE=2 SV=3
 3507 : HBE_RABIT           0.38  0.71    2  141    4  147  146    2    8  147  P02103     Hemoglobin subunit epsilon OS=Oryctolagus cuniculus GN=HBE1 PE=2 SV=2
 3508 : HBE_SMICR           0.38  0.71    2  141    4  147  146    2    8  147  Q28931     Hemoglobin subunit epsilon OS=Sminthopsis crassicaudata GN=HBE1 PE=2 SV=3
 3509 : HBG1_GORGO          0.38  0.69    2  141    4  147  146    2    8  147  P62741     Hemoglobin subunit gamma-1 OS=Gorilla gorilla gorilla GN=HBG1 PE=2 SV=2
 3510 : HBG1_HYLLA          0.38  0.69    2  141    4  147  146    2    8  147  P61947     Hemoglobin subunit gamma-1 OS=Hylobates lar GN=HBG1 PE=2 SV=2
 3511 : HBG1_PANPA          0.38  0.70    2  141    4  147  146    2    8  147  Q28779     Hemoglobin subunit gamma-1 OS=Pan paniscus GN=HBG1 PE=2 SV=3
 3512 : HBG1_PONPY          0.38  0.70    2  141    4  147  146    2    8  147  P18995     Hemoglobin subunit gamma-1 OS=Pongo pygmaeus GN=HBG1 PE=2 SV=2
 3513 : HBG2_HYLLA          0.38  0.69    2  141    4  147  146    2    8  147  P61948     Hemoglobin subunit gamma-2 OS=Hylobates lar GN=HBG2 PE=2 SV=2
 3514 : HBG2_PONPY          0.38  0.70    2  141    4  147  146    2    8  147  P18996     Hemoglobin subunit gamma-2 OS=Pongo pygmaeus GN=HBG2 PE=2 SV=3
 3515 : HBG_CHEME           0.38  0.70    2  141    4  147  146    2    8  147  P08224     Hemoglobin subunit gamma OS=Cheirogaleus medius GN=HBG PE=2 SV=2
 3516 : HBG_EULFU           0.38  0.70    2  141    4  147  146    2    8  147  P08225     Hemoglobin subunit gamma OS=Eulemur fulvus fulvus GN=HBG PE=2 SV=2
 3517 : HBG_MACFU           0.38  0.70    2  141    4  147  146    2    8  147  P68078     Hemoglobin subunit gamma OS=Macaca fuscata fuscata GN=HBG PE=1 SV=2
 3518 : HBG_MACMU           0.38  0.70    2  141    4  147  146    2    8  147  P68077     Hemoglobin subunit gamma OS=Macaca mulatta GN=HBG PE=1 SV=2
 3519 : HBG_MACNE           0.38  0.70    2  141    3  146  146    2    8  146  P02097     Hemoglobin subunit gamma OS=Macaca nemestrina GN=HBG PE=1 SV=1
 3520 : HBG_OTOCR           0.38  0.71    2  141    4  147  146    2    8  147  P19760     Hemoglobin subunit gamma OS=Otolemur crassicaudatus GN=HBG PE=2 SV=3
 3521 : HBG_PAPCY           0.38  0.70    2  141    4  147  146    2    8  147  P68079     Hemoglobin subunit gamma OS=Papio cynocephalus GN=HBG PE=1 SV=2
 3522 : HBG_RABIT           0.38  0.71    2  141    4  147  146    2    8  147  P02099     Hemoglobin subunit gamma OS=Oryctolagus cuniculus GN=HBG PE=2 SV=2
 3523 : HBG_TARBA           0.38  0.71    2  141    4  147  146    2    8  147  O77655     Hemoglobin subunit gamma OS=Tarsius bancanus GN=HBG PE=2 SV=3
 3524 : HBPI_CAIMO          0.38  0.71  145  288    3  142  146    2    8  142  P04243     Hemoglobin subunit pi OS=Cairina moschata PE=3 SV=2
 3525 : I1VYJ4_TROAE        0.38  0.71  145  288    3  142  146    2    8  142  I1VYJ4     Hemoglobin subunit alpha-A OS=Troglodytes aedon PE=2 SV=1
 3526 : I1VYJ7_9EMBE        0.38  0.71  145  288    2  141  146    2    8  141  I1VYJ7     Hemoglobin subunit alpha-D OS=Zonotrichia capensis PE=3 SV=1
 3527 : I1VZV6_HUMAN        0.38  0.69  145  288    3  142  146    2    8  142  I1VZV6     Hemoglobin alpha 1 OS=Homo sapiens GN=HBA1 PE=3 SV=1
 3528 : I1Y902_ADEME        0.38  0.73  145  288    3  142  146    2    8  142  I1Y902     Hemoglobin subunit alpha-A OS=Adelomyia melanogenys PE=2 SV=1
 3529 : I1Y903_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  I1Y903     Hemoglobin subunit alpha-A OS=Aglaeactis castelnaudii PE=2 SV=1
 3530 : I1Y904_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  I1Y904     Hemoglobin subunit alpha-A OS=Amazilia amazilia PE=2 SV=1
 3531 : I1Y905_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  I1Y905     Hemoglobin subunit alpha-A OS=Amazilia viridicauda PE=2 SV=1
 3532 : I1Y906_COECO        0.38  0.72  145  288    3  142  146    2    8  142  I1Y906     Hemoglobin subunit alpha-A OS=Coeligena coeligena PE=2 SV=1
 3533 : I1Y907_COEVI        0.38  0.73  145  288    3  142  146    2    8  142  I1Y907     Hemoglobin subunit alpha-A OS=Coeligena violifer PE=2 SV=1
 3534 : I1Y908_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  I1Y908     Hemoglobin subunit alpha-A OS=Oreotrochilus estella PE=2 SV=1
 3535 : I1Y909_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  I1Y909     Hemoglobin subunit alpha-A OS=Oreotrochilus melanogaster PE=2 SV=1
 3536 : I1Y911_9AVES        0.38  0.73  145  288    3  142  146    2    8  142  I1Y911     Hemoglobin subunit alpha-A OS=Patagona gigas PE=2 SV=1
 3537 : I3IZ06_ORENI        0.38  0.66  145  288   29  169  146    2    7  169  I3IZ06     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100702435 PE=3 SV=1
 3538 : I3IZ07_ORENI        0.38  0.66  145  288    4  144  146    2    7  144  I3IZ07     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100702435 PE=3 SV=1
 3539 : I3IZ17_ORENI        0.38  0.65  145  288    4  144  146    2    7  144  I3IZ17     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100702704 PE=3 SV=1
 3540 : I3IZ56_ORENI        0.38  0.65  145  288    4  144  146    2    7  144  I3IZ56     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100704772 PE=3 SV=1
 3541 : I3MFW1_SPETR        0.38  0.70  145  288    3  142  146    2    8  142  I3MFW1     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=HBZ PE=3 SV=1
 3542 : I3MFW7_SPETR        0.38  0.67  145  288    3  142  146    2    8  142  I3MFW7     Uncharacterized protein OS=Spermophilus tridecemlineatus PE=3 SV=1
 3543 : I3N129_SPETR        0.38  0.70    2  141    4  147  146    2    8  147  I3N129     Uncharacterized protein OS=Spermophilus tridecemlineatus PE=3 SV=1
 3544 : I3N5Z8_SPETR        0.38  0.66  145  288    3  142  146    2    8  142  I3N5Z8     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=HBQ1 PE=3 SV=1
 3545 : I3VNE6_9FURN        0.38  0.73  145  288    2  141  146    2    8  141  I3VNE6     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Phleocryptes melanops PE=3 SV=1
 3546 : I3VNE7_PASMO        0.38  0.73  145  288    2  141  146    2    8  141  I3VNE7     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Passer montanus PE=3 SV=1
 3547 : I3VNE8_PHACA        0.38  0.73  145  288    2  141  146    2    8  141  I3VNE8     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Phalacrocorax carbo PE=3 SV=1
 3548 : I3VNE9_OPIHO        0.38  0.73  145  288    2  141  146    2    8  141  I3VNE9     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Opisthocomus hoazin PE=3 SV=1
 3549 : I3VNF0_COLLI        0.38  0.73  145  288    2  141  146    2    8  141  I3VNF0     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Columba livia PE=3 SV=1
 3550 : I3VNF2_STUVU        0.38  0.75  145  288    2  141  146    2    8  141  I3VNF2     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Sturnus vulgaris PE=3 SV=1
 3551 : J3SDZ6_CROAD        0.38  0.65  145  288    3  142  147    4   10  142  J3SDZ6     Alpha globin OS=Crotalus adamanteus PE=2 SV=1
 3552 : J9JHW7_CANFA        0.38  0.68  145  288    3  142  146    2    8  142  J9JHW7     Uncharacterized protein OS=Canis familiaris GN=LOC100855600 PE=3 SV=1
 3553 : J9P643_CANFA        0.38  0.73    2  141    4  147  146    2    8  147  J9P643     Uncharacterized protein OS=Canis familiaris GN=LOC480784 PE=3 SV=1
 3554 : K4G6J5_CALMI        0.38  0.62  144  288    3  142  145    2    5  142  K4G6J5     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3555 : K4G723_CALMI        0.38  0.62  144  288    3  142  145    2    5  142  K4G723     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3556 : K4GI84_CALMI        0.38  0.60  156  288    1  133  138    3   10  133  K4GI84     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3557 : K4GKT1_CALMI        0.38  0.63  144  288    3  142  145    2    5  142  K4GKT1     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3558 : K7FZX0_PELSI        0.38  0.70  145  288    4  143  146    2    8  143  K7FZX0     Uncharacterized protein (Fragment) OS=Pelodiscus sinensis GN=HBZ PE=3 SV=1
 3559 : K7WTF0_OCHER        0.38  0.71    2  141    4  147  146    2    8  147  K7WTF0     Hemoglobin beta chain OS=Ochotona erythrotis PE=2 SV=1
 3560 : K9IQG0_DESRO        0.38  0.68  145  288    2  141  146    2    8  141  K9IQG0     Putative hemoglobin subunit alpha (Fragment) OS=Desmodus rotundus PE=2 SV=1
 3561 : L5M3D0_MYODS        0.38  0.72    2  141    4  147  146    2    8  147  L5M3D0     Hemoglobin subunit beta OS=Myotis davidii GN=MDA_GLEAN10001522 PE=3 SV=1
 3562 : L8J2H0_BOSMU        0.38  0.66  145  285   11  147  143    2    8  150  L8J2H0     Hemoglobin subunit alpha-1 (Fragment) OS=Bos grunniens mutus GN=M91_08815 PE=3 SV=1
 3563 : L8YGS9_TUPCH        0.38  0.68  145  288    3  142  146    2    8  142  L8YGS9     Hemoglobin subunit alpha OS=Tupaia chinensis GN=TREES_T100001160 PE=3 SV=1
 3564 : M3WND9_FELCA        0.38  0.71    2  141    4  147  146    2    8  147  M3WND9     Uncharacterized protein OS=Felis catus GN=LOC101091307 PE=3 SV=1
 3565 : M3WVZ4_FELCA        0.38  0.71    2  140    7  149  145    2    8  149  M3WVZ4     Uncharacterized protein (Fragment) OS=Felis catus GN=LOC101091558 PE=3 SV=1
 3566 : M3YFG8_MUSPF        0.38  0.70    2  141    4  147  146    2    8  147  M3YFG8     Uncharacterized protein OS=Mustela putorius furo PE=3 SV=1
 3567 : M3YFH4_MUSPF        0.38  0.68    2  141    4  147  146    2    8  147  M3YFH4     Uncharacterized protein OS=Mustela putorius furo PE=3 SV=1
 3568 : M3ZD78_XIPMA        0.38  0.65  145  288    4  145  147    3    8  145  M3ZD78     Uncharacterized protein (Fragment) OS=Xiphophorus maculatus PE=3 SV=1
 3569 : M3ZD94_XIPMA        0.38  0.62  145  274    4  129  133    4   10  145  M3ZD94     Uncharacterized protein OS=Xiphophorus maculatus PE=3 SV=1
 3570 : M4A902_XIPMA        0.38  0.66  145  288    3  143  146    2    7  143  M4A902     Uncharacterized protein OS=Xiphophorus maculatus PE=3 SV=1
 3571 : O88752_RAT          0.38  0.73    2  141    4  147  146    2    8  147  O88752     Epsilon 1 globin OS=Rattus norvegicus GN=Hbe1 PE=2 SV=1
 3572 : Q03903_MACMU        0.38  0.69    2  141    4  147  146    2    8  147  Q03903     Gamma-globin OS=Macaca mulatta GN=HBG2 PE=2 SV=1
 3573 : Q071L7_PARCR        0.38  0.66  145  288    3  143  146    2    7  143  Q071L7     Alpha globin (Fragment) OS=Parachaenichthys charcoti PE=3 SV=1
 3574 : Q071L9_PARCR        0.38  0.65  145  280    3  135  138    2    7  135  Q071L9     Alpha globin (Fragment) OS=Parachaenichthys charcoti PE=3 SV=1
 3575 : Q071M2_GYMAC        0.38  0.65  145  278    3  133  136    2    7  133  Q071M2     Alpha globin (Fragment) OS=Gymnodraco acuticeps PE=3 SV=2
 3576 : Q071M3_CYGMA        0.38  0.64  145  280    3  135  138    2    7  135  Q071M3     Alpha globin (Fragment) OS=Cygnodraco mawsoni PE=3 SV=2
 3577 : Q0PP67_PIMPR        0.38  0.68  145  288    2  142  146    2    7  142  Q0PP67     Hemoglobin alpha chain (Fragment) OS=Pimephales promelas PE=2 SV=1
 3578 : Q1KYZ5_AMMLE        0.38  0.71    1  141    1  145  147    2    8  145  Q1KYZ5     Beta globin chain OS=Ammotragus lervia GN=HBB PE=3 SV=1
 3579 : Q1W6G9_HUMAN        0.38  0.69  145  288    3  142  146    2    8  142  Q1W6G9     Hemoglobin zeta subunit OS=Homo sapiens GN=HBZ PE=3 SV=1
 3580 : Q38IW3_XENTR        0.38  0.69  145  288    3  142  146    2    8  142  Q38IW3     Alpha globin larval-3 OS=Xenopus tropicalis GN=HBA-L3 PE=3 SV=1
 3581 : Q38IW4_XENTR        0.38  0.68  145  288    3  142  146    2    8  142  Q38IW4     Alpha globin larval-2 OS=Xenopus tropicalis GN=HBA-L2 PE=2 SV=1
 3582 : Q3LRX5_PONPY        0.38  0.68  145  288    3  142  146    2    8  142  Q3LRX5     Alpha globin a3 OS=Pongo pygmaeus PE=3 SV=1
 3583 : Q3U0A6_MOUSE        0.38  0.67  153  288   11  142  138    2    8  142  Q3U0A6     Protein Hbq1b OS=Mus musculus GN=Hbq1b PE=2 SV=1
 3584 : Q4RHD1_TETNG        0.38  0.64  145  288    4  144  146    2    7  144  Q4RHD1     Chromosome 3 SCAF15050, whole genome shotgun sequence OS=Tetraodon nigroviridis GN=GSTENG00034399001 PE=3 SV=1
 3585 : Q549D9_MOUSE        0.38  0.72    2  141    4  147  146    2    8  147  Q549D9     Beta-globin OS=Mus musculus GN=Hbb-b2 PE=2 SV=1
 3586 : Q54AH9_MOUSE        0.38  0.72    2  141    3  146  146    2    8  146  Q54AH9     Beta-2-globin (Fragment) OS=Mus musculus GN=Hbb-b2 PE=2 SV=1
 3587 : Q5BJC7_DANRE        0.38  0.68  145  288    3  143  146    2    7  143  Q5BJC7     Si:xx-by187g17.5 OS=Danio rerio GN=si:ch211-5k11.6 PE=2 SV=1
 3588 : Q62669_RAT          0.38  0.73    2  141    4  147  146    2    8  147  Q62669     Protein Hbb-b1 OS=Rattus norvegicus GN=Hbb-b1 PE=3 SV=1
 3589 : Q62670_RAT          0.38  0.72    2  141    4  147  146    2    8  147  Q62670     0 beta-2 globin OS=Rattus norvegicus GN=MGC72973 PE=3 SV=1
 3590 : Q63011_RAT          0.38  0.73    2  141    3  146  146    2    8  146  Q63011     Zero beta-globin (Fragment) OS=Rattus norvegicus GN=MGC72973 PE=3 SV=1
 3591 : Q6DES4_XENTR        0.38  0.69  145  288    3  142  146    2    8  142  Q6DES4     Alpha globin larval-1 OS=Xenopus tropicalis GN=hbz PE=2 SV=1
 3592 : Q6PDU6_RAT          0.38  0.73    2  141    4  147  146    2    8  147  Q6PDU6     Beta-glo OS=Rattus norvegicus GN=Hbb-b1 PE=2 SV=1
 3593 : Q6ZM13_DANRE        0.38  0.68  145  288    3  143  146    2    7  143  Q6ZM13     Novel alpha globin OS=Danio rerio GN=si:ch211-5k11.6 PE=3 SV=1
 3594 : Q78PA4_MOUSE        0.38  0.68  145  288    3  142  146    2    8  142  Q78PA4     Hemoglobin X, alpha-like embryonic chain in Hba complex OS=Mus musculus GN=Hba-x PE=3 SV=1
 3595 : Q802A4_TAKRU        0.38  0.66  145  288    3  143  146    2    7  143  Q802A4     Hemoglobin alpha 3 subunit OS=Takifugu rubripes GN=HBA3 PE=3 SV=1
 3596 : Q8AYQ7_ORYLA        0.38  0.69  145  288    3  143  146    2    7  143  Q8AYQ7     Alpha-type globin OS=Oryzias latipes GN=Gb-alpha3 PE=3 SV=1
 3597 : Q8AYQ8_ORYLA        0.38  0.66  145  288    3  143  146    2    7  143  Q8AYQ8     Alpha-type globin OS=Oryzias latipes GN=Gb-alpha2 PE=3 SV=1
 3598 : Q8JH82_PARDA        0.38  0.68  145  288    3  143  146    2    7  143  Q8JH82     Alpha globin (Fragment) OS=Paramisgurnus dabryanus PE=2 SV=1
 3599 : Q8JH83_MISAN        0.38  0.66  145  288    3  143  146    2    7  143  Q8JH83     Alpha globin (Fragment) OS=Misgurnus anguillicaudatus PE=2 SV=1
 3600 : Q8JH90_CARAU        0.38  0.67  145  288    3  143  146    2    7  143  Q8JH90     Alpha globin (Fragment) OS=Carassius auratus PE=2 SV=1
 3601 : Q91469_SALSA        0.38  0.68  145  288    3  143  146    2    7  143  Q91469     Alpha-globin OS=Salmo salar PE=3 SV=1
 3602 : Q98973_ONCMY        0.38  0.67  145  288    3  143  146    2    7  143  Q98973     Alpha-globin I OS=Oncorhynchus mykiss PE=2 SV=1
 3603 : Q9CR49_MOUSE        0.38  0.73    2  141    4  147  146    2    8  147  Q9CR49     Hemoglobin Y, beta-like embryonic chain OS=Mus musculus GN=Hbb-y PE=2 SV=1
 3604 : Q9D0B2_MOUSE        0.38  0.73    2  141    4  147  146    2    8  147  Q9D0B2     Putative uncharacterized protein OS=Mus musculus GN=Hbb-y PE=2 SV=1
 3605 : Q9QUN8_MOUSE        0.38  0.71    2  141    3  146  146    2    8  146  Q9QUN8     Beta-2-globin (Fragment) OS=Mus musculus GN=Hbb-b2 PE=2 SV=1
 3606 : Q9YGF7_ONCMY        0.38  0.62  145  288    3  143  146    2    7  143  Q9YGF7     Embryonic alpha-type globin OS=Oncorhynchus mykiss PE=2 SV=1
 3607 : R0JDK1_ANAPL        0.38  0.73  145  288    3  142  146    2    8  142  R0JDK1     Hemoglobin subunit pi (Fragment) OS=Anas platyrhynchos GN=Anapl_06469 PE=4 SV=1
 3608 : A4ZQ34_PERMA        0.37  0.66  145  288    3  142  146    2    8  142  A4ZQ34     Hemoglobin subunit theta OS=Peromyscus maniculatus GN=HBQ PE=3 SV=1
 3609 : A4ZQ65_PERMA        0.37  0.66  145  288    3  142  146    2    8  142  A4ZQ65     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3610 : A4ZQ69_PERMA        0.37  0.66  145  288    3  142  146    2    8  142  A4ZQ69     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3611 : A4ZQ75_PERMA        0.37  0.66  145  288    3  142  146    2    8  142  A4ZQ75     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3612 : A4ZQ81_PERMA        0.37  0.65  145  288    3  142  146    2    8  142  A4ZQ81     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3613 : A4ZQ82_PERMA        0.37  0.66  145  288    3  142  146    2    8  142  A4ZQ82     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3614 : A4ZQ86_PERLE        0.37  0.66  145  288    3  142  146    2    8  142  A4ZQ86     Hemoglobin subunit theta OS=Peromyscus leucopus PE=3 SV=1
 3615 : A4ZQT1_PERMA        0.37  0.68  145  288    3  142  146    2    8  142  A4ZQT1     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3616 : A4ZQT2_PERMA        0.37  0.68  145  288    3  142  146    2    8  142  A4ZQT2     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3617 : A4ZQT6_PERMA        0.37  0.68  145  288    3  142  146    2    8  142  A4ZQT6     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3618 : A4ZQV0_PERMA        0.37  0.68  145  288    3  142  146    2    8  142  A4ZQV0     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3619 : A4ZQV4_PERMA        0.37  0.68  145  288    3  142  146    2    8  142  A4ZQV4     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3620 : A4ZQV9_PERMA        0.37  0.68  145  288    3  142  146    2    8  142  A4ZQV9     Hemoglobin subunit zeta OS=Peromyscus maniculatus PE=3 SV=1
 3621 : A8E199_BUBBU        0.37  0.71    1  141    1  145  147    2    8  145  A8E199     Putative epsilon-globin OS=Bubalus bubalis GN=hbb PE=3 SV=1
 3622 : A9YVA0_ONCMA        0.37  0.64  145  288    3  143  146    2    7  143  A9YVA0     Alpha-globin 4 OS=Oncorhynchus masou formosanus GN=hbaa4 PE=2 SV=1
 3623 : A9YVA1_ONCMA        0.37  0.66  145  288    3  143  146    2    7  143  A9YVA1     Alpha-globin I OS=Oncorhynchus masou formosanus GN=hbaa1 PE=2 SV=1
 3624 : B1MT39_CALMO        0.37  0.66  145  288    3  142  146    2    8  142  B1MT39     Theta 1 globin (Predicted) OS=Callicebus moloch GN=HBQ1_2 PE=3 SV=1
 3625 : B1MT80_CALMO        0.37  0.68    2  141    4  147  146    2    8  147  B1MT80     G-gamma globin (Predicted) OS=Callicebus moloch GN=HBG2_1 PE=3 SV=1
 3626 : B2KHZ7_RHIFE        0.37  0.70    2  141    4  147  146    2    8  147  B2KHZ7     Hemoglobin, epsilon 1 (Predicted) OS=Rhinolophus ferrumequinum GN=HBE1 PE=3 SV=1
 3627 : B5XD73_SALSA        0.37  0.66  145  288    3  143  146    2    7  143  B5XD73     Hemoglobin subunit alpha-4 OS=Salmo salar GN=HBA4 PE=2 SV=1
 3628 : B5XE30_SALSA        0.37  0.68  145  288    3  143  146    2    7  143  B5XE30     Hemoglobin subunit alpha OS=Salmo salar GN=HBA PE=2 SV=1
 3629 : B8K133_RABIT        0.37  0.63  145  288    3  142  146    2    8  142  B8K133     Hemoglobin subunit theta-1 (Predicted) OS=Oryctolagus cuniculus GN=HBQ1_1 PE=3 SV=1
 3630 : C0H7D9_SALSA        0.37  0.68  145  287    3  142  145    2    7  143  C0H7D9     Hemoglobin subunit alpha OS=Salmo salar GN=HBA PE=2 SV=1
 3631 : C0H7I8_SALSA        0.37  0.67  145  288    3  143  146    2    7  143  C0H7I8     Hemoglobin subunit alpha OS=Salmo salar GN=HBA PE=2 SV=1
 3632 : C0H8L6_SALSA        0.37  0.67  145  288    3  143  146    2    7  143  C0H8L6     Hemoglobin subunit alpha OS=Salmo salar GN=HBA PE=2 SV=1
 3633 : C1BG68_ONCMY        0.37  0.66  145  287    3  142  145    2    7  143  C1BG68     Hemoglobin subunit alpha-1 OS=Oncorhynchus mykiss GN=HBA1 PE=2 SV=1
 3634 : C1BIB0_ONCMY        0.37  0.65  145  288    3  143  146    2    7  143  C1BIB0     Hemoglobin subunit alpha-1 OS=Oncorhynchus mykiss GN=HBA1 PE=2 SV=1
 3635 : C1BIL2_OSMMO        0.37  0.67  145  288    3  143  146    2    7  143  C1BIL2     Hemoglobin subunit alpha-2 OS=Osmerus mordax GN=HBA2 PE=2 SV=1
 3636 : C1FXX6_DASNO        0.37  0.66  145  288    3  142  146    2    8  142  C1FXX6     Zeta globin (Predicted) OS=Dasypus novemcinctus GN=HBZ PE=3 SV=1
 3637 : C7S3I8_PERMA        0.37  0.68  145  288    3  142  146    2    8  142  C7S3I8     Hemoglobin alpha-subunit OS=Peromyscus maniculatus PE=3 SV=1
 3638 : D2HDV1_AILME        0.37  0.68  145  288    3  142  146    2    8  142  D2HDV1     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=LOC100471516 PE=3 SV=1
 3639 : E1BEL8_BOVIN        0.37  0.72    2  141    4  147  146    2    8  147  E1BEL8     Uncharacterized protein OS=Bos taurus GN=LOC100850173 PE=3 SV=1
 3640 : E3TGF8_ICTPU        0.37  0.65  145  288    3  143  146    2    7  143  E3TGF8     Hemoglobin embryonic subunit alpha OS=Ictalurus punctatus GN=HBAE PE=2 SV=1
 3641 : F1PYZ1_CANFA        0.37  0.70    2  140    7  149  145    2    8  149  F1PYZ1     Uncharacterized protein (Fragment) OS=Canis familiaris GN=HBG2 PE=3 SV=2
 3642 : F1RII6_PIG          0.37  0.73    2  141    4  147  146    2    8  147  F1RII6     Hemoglobin subunit epsilon OS=Sus scrofa GN=HBE1 PE=2 SV=1
 3643 : F1RII7_PIG          0.37  0.71    2  141    4  147  146    2    8  147  F1RII7     Hemoglobin subunit beta OS=Sus scrofa GN=HBB PE=2 SV=1
 3644 : F6PNA4_CANFA        0.37  0.71    2  141    4  147  146    2    8  147  F6PNA4     Uncharacterized protein OS=Canis familiaris GN=LOC480784 PE=3 SV=1
 3645 : F6VE37_HORSE        0.37  0.66    2  141    4  151  150    3   12  151  F6VE37     Uncharacterized protein OS=Equus caballus GN=LOC100054161 PE=3 SV=1
 3646 : F7F0N7_ORNAN        0.37  0.71  145  288    3  142  146    2    8  142  F7F0N7     Uncharacterized protein OS=Ornithorhynchus anatinus GN=HBZ PE=3 SV=1
 3647 : G1Q9N4_MYOLU        0.37  0.69    2  141    4  147  146    2    8  147  G1Q9N4     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
 3648 : G1R965_NOMLE        0.37  0.66  145  288    3  142  146    2    8  142  G1R965     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100583844 PE=3 SV=1
 3649 : G3PNE8_GASAC        0.37  0.66  145  288    3  143  146    2    7  143  G3PNE8     Uncharacterized protein OS=Gasterosteus aculeatus PE=3 SV=1
 3650 : G3RJU5_GORGO        0.37  0.64  145  288    3  142  146    2    8  142  G3RJU5     Uncharacterized protein OS=Gorilla gorilla gorilla GN=HBQ1 PE=3 SV=1
 3651 : G5BXY0_HETGA        0.37  0.67  144  288    2  142  147    2    8  142  G5BXY0     Hemoglobin subunit theta-1 OS=Heterocephalus glaber GN=GW7_12997 PE=3 SV=1
 3652 : G8DP12_PLAFE        0.37  0.68  145  288    3  143  146    2    7  143  G8DP12     Alpha 1-globin OS=Platichthys flesus PE=2 SV=1
 3653 : G8ZF57_RABIT        0.37  0.64  145  288    3  142  146    2    8  142  G8ZF57     Alpha-globin 2 OS=Oryctolagus cuniculus GN=HBA2 PE=3 SV=1
 3654 : G9K3W0_MUSPF        0.37  0.70    2  140   10  152  145    2    8  152  G9K3W0     Hemoglobin, delta (Fragment) OS=Mustela putorius furo PE=2 SV=1
 3655 : H0VVL2_CAVPO        0.37  0.72    2  141    4  147  146    2    8  147  H0VVL2     Uncharacterized protein OS=Cavia porcellus GN=LOC100720679 PE=3 SV=1
 3656 : H2NED8_PONAB        0.37  0.70    2  141    4  147  146    2    8  147  H2NED8     Uncharacterized protein OS=Pongo abelii GN=LOC100438895 PE=3 SV=1
 3657 : H2TTY0_TAKRU        0.37  0.64  145  288    4  144  146    2    7  144  H2TTY0     Uncharacterized protein OS=Takifugu rubripes GN=LOC101073868 PE=3 SV=1
 3658 : H2TTY1_TAKRU        0.37  0.64  145  288    4  144  146    2    7  144  H2TTY1     Uncharacterized protein OS=Takifugu rubripes GN=LOC101073868 PE=3 SV=1
 3659 : HBA1_ANAMI          0.37  0.68  145  288    3  143  146    2    7  143  P83270     Hemoglobin subunit alpha-1 OS=Anarhichas minor GN=hba1 PE=1 SV=2
 3660 : HBA1_ARCGL          0.37  0.65  145  288    3  143  146    2    7  143  Q1AGS5     Hemoglobin subunit alpha-1 OS=Arctogadus glacialis GN=hba1 PE=1 SV=3
 3661 : HBA1_BORSA          0.37  0.65  145  288    3  143  146    2    7  143  Q1AGS9     Hemoglobin subunit alpha-1 OS=Boreogadus saida GN=hba1 PE=1 SV=3
 3662 : HBA2_ANAMI          0.37  0.67  145  288    3  143  146    2    7  143  P83271     Hemoglobin subunit alpha-2 OS=Anarhichas minor GN=hba2 PE=1 SV=2
 3663 : HBA2_GOBGI          0.37  0.67  145  288    2  142  146    2    7  142  P83613     Hemoglobin subunit alpha-2 OS=Gobionotothen gibberifrons GN=hba2 PE=1 SV=1
 3664 : HBAD_TURME          0.37  0.71  145  288    2  141  146    2    8  141  P14523     Hemoglobin subunit alpha-D OS=Turdus merula GN=HBAD PE=1 SV=1
 3665 : HBAT_HUMAN          0.37  0.65  145  288    3  142  146    2    8  142  P09105     Hemoglobin subunit theta-1 OS=Homo sapiens GN=HBQ1 PE=1 SV=2
 3666 : HBAT_PONPY          0.37  0.66  145  288    3  142  146    2    8  142  P06890     Hemoglobin subunit theta-1 OS=Pongo pygmaeus GN=HBQ1 PE=3 SV=2
 3667 : HBAZ_HORSE          0.37  0.69  145  288    3  142  146    2    8  142  P13787     Hemoglobin subunit zeta OS=Equus caballus GN=HBZ1 PE=3 SV=2
 3668 : HBAZ_PIG            0.37  0.69  145  288    2  141  146    2    8  141  P02009     Hemoglobin subunit zeta OS=Sus scrofa PE=1 SV=1
 3669 : HBA_ARTOR           0.37  0.68  145  288    3  143  146    2    7  143  P0C237     Hemoglobin subunit alpha OS=Artedidraco orianae GN=hba PE=1 SV=2
 3670 : HBA_BALAC           0.37  0.71  145  288    3  142  146    2    8  142  P18971     Hemoglobin subunit alpha OS=Balaenoptera acutorostrata GN=HBA PE=1 SV=2
 3671 : HBA_LEPPA           0.37  0.62  144  288    2  143  146    2    5  143  P02020     Hemoglobin subunit alpha OS=Lepidosiren paradoxus GN=HBA PE=1 SV=1
 3672 : HBA_MARMA           0.37  0.68  145  288    2  141  146    2    8  141  P08852     Hemoglobin subunit alpha OS=Marmota marmota marmota GN=HBA PE=1 SV=1
 3673 : HBA_ODOVI   1HDS    0.37  0.64  145  288    2  141  146    2    8  141  P01972     Hemoglobin subunit alpha-1/2 OS=Odocoileus virginianus virginianus PE=1 SV=1
 3674 : HBA_PANLE           0.37  0.65  145  288    3  142  146    2    8  142  P18975     Hemoglobin subunit alpha OS=Panthera leo GN=HBA PE=1 SV=2
 3675 : HBA_PANON           0.37  0.65  145  288    3  142  146    2    8  142  P63109     Hemoglobin subunit alpha OS=Panthera onca GN=HBA PE=1 SV=2
 3676 : HBA_PANPO           0.37  0.65  145  288    2  141  146    2    8  141  P63110     Hemoglobin subunit alpha OS=Panthera pardus orientalis GN=HBA PE=1 SV=1
 3677 : HBA_POGSC           0.37  0.68  145  288    3  143  146    2    7  143  P0C238     Hemoglobin subunit alpha OS=Pogonophryne scotti GN=hba PE=1 SV=2
 3678 : HBA_SALSA           0.37  0.67  145  288    3  143  146    2    7  143  P11251     Hemoglobin subunit alpha OS=Salmo salar GN=hba PE=2 SV=2
 3679 : HBA_SPEBE           0.37  0.68  145  288    2  141  146    2    8  141  B3EWC9     Hemoglobin subunit alpha OS=Spermophilus beecheyi PE=1 SV=1
 3680 : HBBF_BOVIN          0.37  0.72    1  141    1  145  147    2    8  145  P02081     Hemoglobin fetal subunit beta OS=Bos taurus PE=1 SV=1
 3681 : HBBF_CAPHI          0.37  0.74    1  141    1  145  147    2    8  145  P02082     Hemoglobin fetal subunit beta OS=Capra hircus PE=1 SV=1
 3682 : HBBF_SHEEP          0.37  0.74    1  141    1  145  147    2    8  145  P02083     Hemoglobin fetal subunit beta OS=Ovis aries PE=1 SV=1
 3683 : HBB_AILME           0.37  0.69    2  141    4  147  146    2    8  147  P18983     Hemoglobin subunit beta OS=Ailuropoda melanoleuca GN=HBB PE=1 SV=2
 3684 : HBB_ERIEU           0.37  0.71    2  141    3  146  146    2    8  146  P02059     Hemoglobin subunit beta OS=Erinaceus europaeus GN=HBB PE=1 SV=1
 3685 : HBB_HIPAM           0.37  0.70    2  141    3  146  146    2    8  146  P19016     Hemoglobin subunit beta OS=Hippopotamus amphibius GN=HBB PE=1 SV=1
 3686 : HBB_ORNAN           0.37  0.68    2  141    3  146  146    2    8  146  P02111     Hemoglobin subunit beta OS=Ornithorhynchus anatinus GN=HBB PE=1 SV=1
 3687 : HBB_PIG     1QPW    0.37  0.71    2  141    4  147  146    2    8  147  P02067     Hemoglobin subunit beta OS=Sus scrofa GN=HBB PE=1 SV=3
 3688 : HBD_AILME           0.37  0.68    2  141    4  147  146    2    8  147  Q5XLE5     Hemoglobin subunit delta OS=Ailuropoda melanoleuca GN=HBD PE=2 SV=3
 3689 : HBD_DUGDU           0.37  0.66    2  141    4  147  146    2    8  147  Q45XI7     Hemoglobin subunit delta OS=Dugong dugon GN=HBD PE=2 SV=3
 3690 : HBE1_CAPHI          0.37  0.72    2  141    4  147  146    2    8  147  P02102     Hemoglobin subunit epsilon-1 OS=Capra hircus GN=HBE1 PE=2 SV=2
 3691 : HBE_PIG             0.37  0.73    2  141    4  147  146    2    8  147  P02101     Hemoglobin subunit epsilon OS=Sus scrofa GN=HBE1 PE=1 SV=3
 3692 : HBG1_CALMO          0.37  0.67    2  141    4  147  146    2    8  147  Q9GLX4     Hemoglobin subunit gamma-1 OS=Callicebus moloch GN=HBG1 PE=2 SV=3
 3693 : HBG1_CEBAL          0.37  0.68    2  141    4  147  146    2    8  147  Q28221     Hemoglobin subunit gamma-1 OS=Cebus albifrons GN=HBG1 PE=2 SV=3
 3694 : HBG1_CEBAP          0.37  0.68    2  141    4  147  146    2    8  147  P68256     Hemoglobin subunit gamma-1 OS=Cebus apella GN=HBG1 PE=2 SV=2
 3695 : HBG2_CEBAL          0.37  0.68    2  141    4  147  146    2    8  147  P68258     Hemoglobin subunit gamma-2 OS=Cebus albifrons GN=HBG2 PE=2 SV=2
 3696 : HBG2_CEBAP          0.37  0.68    2  141    4  147  146    2    8  147  P68257     Hemoglobin subunit gamma-2 OS=Cebus apella GN=HBG2 PE=2 SV=2
 3697 : HBG_ALOBE           0.37  0.69    2  141    4  147  146    2    8  147  P68030     Hemoglobin subunit gamma OS=Alouatta belzebul GN=HBG PE=2 SV=2
 3698 : HBG_ALOCA           0.37  0.69    2  141    4  147  146    2    8  147  P68031     Hemoglobin subunit gamma OS=Alouatta caraya GN=HBG PE=2 SV=2
 3699 : HBG_ATEGE           0.37  0.68    2  141    4  147  146    2    8  147  P68068     Hemoglobin subunit gamma OS=Ateles geoffroyi GN=HBG PE=2 SV=2
 3700 : HBG_ATEPA           0.37  0.68    2  141    4  147  146    2    8  147  P68069     Hemoglobin subunit gamma OS=Ateles paniscus GN=HBG PE=2 SV=2
 3701 : HBG_BRAAR           0.37  0.68    2  141    4  147  146    2    8  147  P68071     Hemoglobin subunit gamma OS=Brachyteles arachnoides GN=HBG PE=2 SV=2
 3702 : HBG_LAGLA           0.37  0.68    2  141    4  147  146    2    8  147  P68070     Hemoglobin subunit gamma OS=Lagothrix lagotricha GN=HBG PE=2 SV=2
 3703 : HBT_PIG             0.37  0.73    2  141    3  146  146    2    8  146  P04246     Hemoglobin subunit theta OS=Sus scrofa PE=1 SV=1
 3704 : I3VNF1_GRUCN        0.37  0.73  145  288    2  141  146    2    8  141  I3VNF1     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Grus canadensis PE=3 SV=1
 3705 : I7A6X1_OCHLA        0.37  0.71    2  141    4  147  146    2    8  147  I7A6X1     Hemoglobin beta OS=Ochotona ladacensis PE=2 SV=1
 3706 : J3S8W7_CROAD        0.37  0.63  145  288    3  142  147    4   10  142  J3S8W7     Hemoglobin subunit alpha 1 OS=Crotalus adamanteus PE=2 SV=1
 3707 : J7LGZ1_PANHO        0.37  0.74    1  141    1  145  147    2    8  145  J7LGZ1     Hemoglobin gamma OS=Pantholops hodgsonii PE=2 SV=1
 3708 : J9JHZ3_CANFA        0.37  0.70    2  140   10  152  145    2    8  152  J9JHZ3     Uncharacterized protein (Fragment) OS=Canis familiaris GN=HBD PE=3 SV=1
 3709 : K4FYN9_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4FYN9     Hemoglobin beta subunit OS=Callorhynchus milii PE=2 SV=1
 3710 : K4G2W2_CALMI        0.37  0.63  144  288    3  142  145    2    5  142  K4G2W2     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3711 : K4G2Y5_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G2Y5     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3712 : K4G3K5_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G3K5     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3713 : K4G4H0_CALMI        0.37  0.63  144  288    3  142  145    2    5  142  K4G4H0     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3714 : K4G623_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G623     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3715 : K4G661_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G661     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3716 : K4G675_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G675     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3717 : K4G6Z9_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G6Z9     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3718 : K4G727_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G727     Hemoglobin subunit epsilon-like protein OS=Callorhynchus milii PE=2 SV=1
 3719 : K4G738_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G738     Hemoglobin subunit epsilon-like protein OS=Callorhynchus milii PE=2 SV=1
 3720 : K4G769_CALMI        0.37  0.62  144  288   17  156  145    2    5  156  K4G769     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3721 : K4G7A0_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G7A0     Hemoglobin subunit epsilon-like protein OS=Callorhynchus milii PE=2 SV=1
 3722 : K4G7A1_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G7A1     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3723 : K4G7B2_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G7B2     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3724 : K4G7M3_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G7M3     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3725 : K4G7P3_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G7P3     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3726 : K4G7T9_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G7T9     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3727 : K4G851_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G851     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3728 : K4G8J1_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G8J1     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3729 : K4G8X0_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G8X0     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3730 : K4G9B9_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G9B9     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3731 : K4G9H1_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G9H1     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3732 : K4G9Q8_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G9Q8     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3733 : K4G9R0_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G9R0     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3734 : K4G9U2_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G9U2     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3735 : K4G9U8_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4G9U8     Hemoglobin subunit epsilon-like protein OS=Callorhynchus milii PE=2 SV=1
 3736 : K4G9W7_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4G9W7     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3737 : K4GAE3_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GAE3     Hemoglobin beta subunit OS=Callorhynchus milii PE=2 SV=1
 3738 : K4GAP0_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GAP0     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3739 : K4GB08_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GB08     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3740 : K4GBF5_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4GBF5     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3741 : K4GBQ2_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4GBQ2     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3742 : K4GEC4_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4GEC4     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3743 : K4GF09_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GF09     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3744 : K4GF30_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GF30     Hemoglobin subunit beta OS=Callorhynchus milii PE=2 SV=1
 3745 : K4GFF4_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GFF4     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3746 : K4GG21_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4GG21     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3747 : K4GGC5_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4GGC5     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3748 : K4GGE9_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GGE9     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3749 : K4GGM8_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GGM8     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3750 : K4GGV3_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4GGV3     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3751 : K4GJJ4_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GJJ4     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3752 : K4GJK0_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GJK0     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3753 : K4GJU9_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GJU9     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3754 : K4GJV4_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GJV4     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3755 : K4GJW1_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GJW1     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3756 : K4GK10_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4GK10     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3757 : K4GK84_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4GK84     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3758 : K4GK87_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GK87     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3759 : K4GKA4_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GKA4     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3760 : K4GKA8_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GKA8     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3761 : K4GKG4_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GKG4     Hemoglobin beta subunit OS=Callorhynchus milii PE=2 SV=1
 3762 : K4GKL1_CALMI        0.37  0.62  144  288    3  142  145    2    5  142  K4GKL1     Adult beta-type globin OS=Callorhynchus milii PE=2 SV=1
 3763 : K4GKL5_CALMI        0.37  0.61  144  288    3  142  145    2    5  142  K4GKL5     Hemoglobin subunit epsilon-like protein OS=Callorhynchus milii PE=2 SV=1
 3764 : L5KD12_PTEAL        0.37  0.71    2  141    4  147  146    2    8  147  L5KD12     Hemoglobin subunit epsilon OS=Pteropus alecto GN=PAL_GLEAN10003332 PE=3 SV=1
 3765 : L9KL50_TUPCH        0.37  0.71    2  141    4  147  146    2    8  147  L9KL50     Hemoglobin subunit epsilon OS=Tupaia chinensis GN=TREES_T100005451 PE=3 SV=1
 3766 : M3VYK8_FELCA        0.37  0.71    2  141    4  148  147    3    9  148  M3VYK8     Uncharacterized protein OS=Felis catus GN=HBE1 PE=3 SV=1
 3767 : M9T843_CYPCA        0.37  0.68  145  288    3  143  146    2    7  143  M9T843     Hemoglobin alpha OS=Cyprinus carpio PE=4 SV=1
 3768 : O13137_CYPCA        0.37  0.68  145  288    3  143  146    2    7  143  O13137     Alpha-globin OS=Cyprinus carpio GN=No.4 alpha PE=3 SV=1
 3769 : Q071M4_9PERC        0.37  0.67  145  280    3  135  138    2    7  137  Q071M4     Alpha globin (Fragment) OS=Gerlachea australis PE=3 SV=2
 3770 : Q38IW2_XENTR        0.37  0.69  145  288    3  142  146    2    8  142  Q38IW2     Alpha globin larval-4 OS=Xenopus tropicalis GN=HBA-L4 PE=3 SV=1
 3771 : Q4JDG2_9CHON        0.37  0.61  147  288    1  136  142    2    6  136  Q4JDG2     Alpha globin (Fragment) OS=Amblyraja hyperborea PE=2 SV=1
 3772 : Q533G8_MACEU        0.37  0.69  145  288    3  142  146    2    8  142  Q533G8     Zeta' globin OS=Macropus eugenii PE=3 SV=1
 3773 : Q58L97_SCIOC        0.37  0.66  145  288    3  144  146    2    6  144  Q58L97     Hemoglobin alpha chain OS=Sciaenops ocellatus PE=2 SV=1
 3774 : Q6GPP8_XENLA        0.37  0.66  145  288    3  139  146    2   11  139  Q6GPP8     MGC82702 protein OS=Xenopus laevis GN=hba-l5 PE=2 SV=1
 3775 : Q8AYQ4_ORYLA        0.37  0.66  145  288    3  143  146    2    7  143  Q8AYQ4     Alpha-type globin OS=Oryzias latipes GN=Gb-alpha4 PE=3 SV=1
 3776 : Q98974_ONCMY        0.37  0.66  145  288    3  143  146    2    7  143  Q98974     Alpha-globin IV OS=Oncorhynchus mykiss GN=HBA1 PE=2 SV=1
 3777 : Q98SE6_9PERC        0.37  0.66  145  288    4  144  146    2    7  144  Q98SE6     AlphaNCP1 OS=Notothenia coriiceps GN=alphaNCPII PE=3 SV=1
 3778 : A4ZQ37_PERMA        0.36  0.65  145  288    3  142  146    2    8  142  A4ZQ37     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3779 : A4ZQ55_PERMA        0.36  0.64  145  288    3  142  146    2    8  142  A4ZQ55     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3780 : A4ZQ59_PERMA        0.36  0.65  145  288    3  142  146    2    8  142  A4ZQ59     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3781 : A4ZQ62_PERMA        0.36  0.65  145  288    3  142  146    2    8  142  A4ZQ62     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3782 : A4ZQ71_PERMA        0.36  0.64  145  288    3  142  146    2    8  142  A4ZQ71     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3783 : A4ZQ77_PERMA        0.36  0.65  145  288    3  142  146    2    8  142  A4ZQ77     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3784 : A4ZQ79_PERMA        0.36  0.66  145  288    3  142  146    2    8  142  A4ZQ79     Hemoglobin subunit theta OS=Peromyscus maniculatus PE=3 SV=1
 3785 : A8KBN4_DANRE        0.36  0.68  145  288    3  143  146    2    7  143  A8KBN4     Hbae1 protein OS=Danio rerio GN=hbae1 PE=2 SV=1
 3786 : A9JTR0_XENTR        0.36  0.68  145  288    3  143  146    2    7  143  A9JTR0     LOC100127827 protein OS=Xenopus tropicalis GN=LOC100127827 PE=2 SV=1
 3787 : A9L8Y1_PAPAN        0.36  0.71    2  141    4  147  146    2    8  147  A9L8Y1     Hemoglobin, gamma A (Predicted) OS=Papio anubis GN=HBG1 PE=3 SV=1
 3788 : A9UML4_XENTR        0.36  0.68  145  288    3  143  146    2    7  143  A9UML4     LOC100135390 protein OS=Xenopus tropicalis GN=LOC100135390 PE=2 SV=1
 3789 : B0VX77_CALJA        0.36  0.68  145  288    2  141  146    2    8  141  B0VX77     Hemoglobin mu chain (Predicted) OS=Callithrix jacchus GN=HBM PE=3 SV=1
 3790 : B0VXB5_CALJA        0.36  0.68    2  141    4  147  146    2    8  147  B0VXB5     G-gamma globin (Predicted) OS=Callithrix jacchus GN=HBG2_1 PE=3 SV=1
 3791 : B0VXB7_CALJA        0.36  0.71    2  141    4  147  146    2    8  147  B0VXB7     A-gamma globin (Predicted) OS=Callithrix jacchus GN=HBG1 PE=3 SV=1
 3792 : B1MT34_CALMO        0.36  0.68  145  288    2  141  146    2    8  141  B1MT34     Hemoglobin mu chain (Predicted) OS=Callicebus moloch GN=HBM PE=3 SV=1
 3793 : B2LVG9_LATJA        0.36  0.68  145  288    4  144  146    2    7  144  B2LVG9     Head-kidney alpha-type globin OS=Lateolabrax japonicus PE=2 SV=1
 3794 : B3F9D9_GADMO        0.36  0.65  145  288    3  143  146    2    7  143  B3F9D9     Hemoglobin alpha 2 OS=Gadus morhua GN=HbA2 PE=2 SV=1
 3795 : B3F9E5_GADMO        0.36  0.65  145  288    3  143  146    2    7  143  B3F9E5     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3796 : B3F9G3_GADMO        0.36  0.65  145  288    3  143  146    2    7  143  B3F9G3     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3797 : B3F9I1_GADMO        0.36  0.65  145  288    3  143  146    2    7  143  B3F9I1     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3798 : B3F9I7_GADMO        0.36  0.66  145  288    3  143  146    2    7  143  B3F9I7     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3799 : B3F9N2_GADMO        0.36  0.65  145  288    3  143  146    2    7  143  B3F9N2     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3800 : B3F9N5_GADMO        0.36  0.65  145  288    3  143  146    2    7  143  B3F9N5     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3801 : B3F9Q0_GADMO        0.36  0.65  145  288    3  143  146    2    7  143  B3F9Q0     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3802 : B3RFA9_SORAR        0.36  0.66    7  141  153  301  151    3   18  301  B3RFA9     Putative uncharacterized protein SH_m009_jsmB0827r OS=Sorex araneus GN=SH_m009_jsmB0827r PE=3 SV=1
 3803 : B5G3P7_TAEGU        0.36  0.71  145  288    3  142  146    2    8  142  B5G3P7     Putative hemoglobin alpha OS=Taeniopygia guttata GN=HBA2 PE=2 SV=1
 3804 : B5G3P8_TAEGU        0.36  0.70  145  288    3  142  146    2    8  142  B5G3P8     Putative hemoglobin alpha OS=Taeniopygia guttata PE=2 SV=1
 3805 : B8K136_RABIT        0.36  0.61  145  281    3  135  139    2    8  135  B8K136     Hemoglobin, theta 1 (Predicted) (Fragment) OS=Oryctolagus cuniculus GN=HBQ1_3 PE=3 SV=1
 3806 : C1BY22_ESOLU        0.36  0.64    1  141    3  148  149    5   11  148  C1BY22     Hemoglobin subunit beta OS=Esox lucius GN=HBB PE=2 SV=1
 3807 : C8YNP9_GADMO        0.36  0.63  145  288    3  143  146    2    7  143  C8YNP9     Hemoglobin alpha 4 OS=Gadus morhua GN=HbA4 PE=3 SV=1
 3808 : D3TTJ8_DELDE        0.36  0.71  145  288    3  142  146    2    8  142  D3TTJ8     Hemoglobin alpha2 chain OS=Delphinus delphis PE=2 SV=1
 3809 : D3TTK0_DELDE        0.36  0.70  145  288    3  142  146    2    8  142  D3TTK0     Hemoglobin alpha4 chain OS=Delphinus delphis PE=2 SV=1
 3810 : D9I2F4_SCAAQ        0.36  0.69    2  141    4  147  146    2    8  147  D9I2F4     Hemoglobin subunit delta OS=Scalopus aquaticus GN=HBD PE=2 SV=1
 3811 : D9YZU7_HUMAN        0.36  0.71    2  141    4  147  146    2    8  147  D9YZU7     Hemoglobin, epsilon 1 OS=Homo sapiens GN=HBE1 PE=2 SV=1
 3812 : E1BAP8_BOVIN        0.36  0.71  145  288    3  142  146    2    8  142  E1BAP8     Uncharacterized protein OS=Bos taurus GN=HBZ PE=3 SV=1
 3813 : F6WYU4_MONDO        0.36  0.67    2  141    4  147  146    2    8  147  F6WYU4     Uncharacterized protein OS=Monodelphis domestica GN=LOC100019389 PE=3 SV=1
 3814 : F6X4Z3_CALJA        0.36  0.71    2  141    4  147  146    2    8  147  F6X4Z3     Hemoglobin subunit epsilon OS=Callithrix jacchus GN=HBE1 PE=3 SV=1
 3815 : G1K3A4_XENTR        0.36  0.63  144  288    2  143  148    3    9  143  G1K3A4     Uncharacterized protein OS=Xenopus tropicalis GN=hba1 PE=3 SV=1
 3816 : G1Q4K6_MYOLU        0.36  0.71    2  141    4  147  146    2    8  147  G1Q4K6     Uncharacterized protein OS=Myotis lucifugus PE=3 SV=1
 3817 : G1T6U0_RABIT        0.36  0.69  145  288    3  142  146    2    8  142  G1T6U0     Uncharacterized protein OS=Oryctolagus cuniculus GN=HBZ0 PE=3 SV=1
 3818 : G3PL98_GASAC        0.36  0.66  145  288    4  144  146    2    7  144  G3PL98     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus PE=3 SV=1
 3819 : G3TM42_LOXAF        0.36  0.70    2  141    4  147  146    2    8  147  G3TM42     Uncharacterized protein OS=Loxodonta africana GN=LOC100677510 PE=3 SV=1
 3820 : G3UPN4_MELGA        0.36  0.68    4  141    6  148  145    3    9  148  G3UPN4     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100548634 PE=3 SV=1
 3821 : G3WDN9_SARHA        0.36  0.66  145  288    3  142  146    2    8  142  G3WDN9     Uncharacterized protein OS=Sarcophilus harrisii GN=HBZ PE=3 SV=1
 3822 : G3WER9_SARHA        0.36  0.61  145  288    3  143  147    3    9  143  G3WER9     Uncharacterized protein OS=Sarcophilus harrisii GN=HBQ1 PE=3 SV=1
 3823 : G5BS35_HETGA        0.36  0.71    2  141    4  147  146    2    8  147  G5BS35     Hemoglobin subunit epsilon-1 OS=Heterocephalus glaber GN=GW7_03826 PE=3 SV=1
 3824 : G7NE40_MACMU        0.36  0.71    2  141    4  147  146    2    8  147  G7NE40     Hemoglobin epsilon chain OS=Macaca mulatta GN=EGK_06583 PE=2 SV=1
 3825 : G8F3D2_MACFA        0.36  0.71    2  141    4  147  146    2    8  147  G8F3D2     Hemoglobin epsilon chain OS=Macaca fascicularis GN=EGM_19916 PE=3 SV=1
 3826 : H0Z1S1_TAEGU        0.36  0.69  145  288    2  143  148    3   10  143  H0Z1S1     Uncharacterized protein OS=Taeniopygia guttata GN=HBM PE=3 SV=1
 3827 : H2NED5_PONAB        0.36  0.71    2  141    4  147  146    2    8  147  H2NED5     Uncharacterized protein OS=Pongo abelii GN=HBE1 PE=3 SV=1
 3828 : H2QA69_PANTR        0.36  0.68  145  288    3  142  146    2    8  142  H2QA69     Uncharacterized protein OS=Pan troglodytes GN=HBZ PE=3 SV=1
 3829 : H2TTY2_TAKRU        0.36  0.65  145  288    4  144  146    2    7  144  H2TTY2     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101073868 PE=3 SV=1
 3830 : H9GGM8_ANOCA        0.36  0.67  145  288    3  142  146    2    8  142  H9GGM8     Uncharacterized protein OS=Anolis carolinensis GN=LOC100556620 PE=3 SV=1
 3831 : HBA1_ONCMY  1OUT    0.36  0.65  145  288    2  144  148    3    9  144  P02019     Hemoglobin subunit alpha-1 OS=Oncorhynchus mykiss GN=hba1 PE=1 SV=1
 3832 : HBA1_TORMA          0.36  0.60  145  288    2  141  146    3    8  141  P20244     Hemoglobin subunit alpha-1 OS=Torpedo marmorata PE=1 SV=1
 3833 : HBA2_GADMO          0.36  0.64  145  288    3  143  146    2    7  143  O42425     Hemoglobin subunit alpha-2 OS=Gadus morhua GN=hba2 PE=1 SV=3
 3834 : HBAA_GYMUN          0.36  0.68  145  288    2  142  146    2    7  142  P84205     Hemoglobin anodic subunit alpha OS=Gymnothorax unicolor PE=1 SV=1
 3835 : HBAA_SERQU          0.36  0.67  145  288    3  143  146    2    7  143  Q9PVM4     Hemoglobin subunit alpha-A OS=Seriola quinqueradiata GN=hbaa PE=2 SV=3
 3836 : HBAC_ANGAN          0.36  0.70  145  288    3  143  146    2    7  143  P80726     Hemoglobin cathodic subunit alpha OS=Anguilla anguilla PE=1 SV=2
 3837 : HBAC_CONCO          0.36  0.67  145  288    3  143  146    2    7  143  P83479     Hemoglobin cathodic subunit alpha OS=Conger conger PE=1 SV=2
 3838 : HBAC_HOPLI          0.36  0.64  145  288    2  142  146    2    7  142  P82315     Hemoglobin cathodic subunit alpha OS=Hoplosternum littorale PE=1 SV=1
 3839 : HBAD_DRYCE          0.36  0.63  145  288    2  141  147    4   10  141  P0C0U7     Hemoglobin subunit alpha-D OS=Drymarchon corais erebennus PE=1 SV=1
 3840 : HBAD_LIOMI          0.36  0.64  145  288    2  141  147    4   10  141  P16417     Hemoglobin subunit alpha-D OS=Liophis miliaris GN=HBAD PE=1 SV=1
 3841 : HBAD_PHRHI          0.36  0.68  145  288    2  141  146    2    8  141  P02006     Hemoglobin subunit alpha-D OS=Phrynops hilarii GN=HBAD PE=1 SV=1
 3842 : HBAE_ORYLA          0.36  0.68  145  288    4  144  146    2    7  144  Q9PVU6     Hemoglobin embryonic subunit alpha OS=Oryzias latipes PE=2 SV=3
 3843 : HBAZ_CAPHI          0.36  0.70  145  288    3  142  146    2    8  142  P13786     Hemoglobin subunit zeta OS=Capra hircus GN=HBZ1 PE=3 SV=2
 3844 : HBA_CAVPO   3HYU    0.36  0.64  145  288    3  142  146    2    8  142  P01947     Hemoglobin subunit alpha OS=Cavia porcellus GN=HBA PE=1 SV=2
 3845 : HBA_HETPO           0.36  0.61  143  288    7  148  148    3    8  148  P02021     Hemoglobin subunit alpha OS=Heterodontus portusjacksoni GN=HBA PE=1 SV=1
 3846 : HBA_PANPS           0.36  0.65  145  288    2  141  146    2    8  141  P18976     Hemoglobin subunit alpha OS=Panthera pardus saxicolor GN=HBA PE=1 SV=1
 3847 : HBA_PANTS           0.36  0.65  145  288    2  141  146    2    8  141  P10883     Hemoglobin subunit alpha OS=Panthera tigris sumatrae GN=HBA PE=1 SV=1
 3848 : HBA_PASMO           0.36  0.71  145  288    2  141  146    2    8  141  P07407     Hemoglobin subunit alpha-A OS=Passer montanus GN=HBAA PE=1 SV=1
 3849 : HBA_SQUAC           0.36  0.59  145  288    2  141  146    3    8  141  P07408     Hemoglobin subunit alpha OS=Squalus acanthias GN=HBA PE=1 SV=1
 3850 : HBA_TURTR           0.36  0.71  145  288    2  141  146    2    8  141  P18978     Hemoglobin subunit alpha OS=Tursiops truncatus GN=HBA PE=1 SV=1
 3851 : HBA_XENTR           0.36  0.63  144  288    2  142  147    2    8  142  P07428     Hemoglobin subunit alpha OS=Xenopus tropicalis GN=hba-A PE=2 SV=2
 3852 : HBB_CAMBA           0.36  0.67    2  141    4  147  146    2    8  147  P68230     Hemoglobin subunit beta OS=Camelus bactrianus GN=HBB PE=1 SV=2
 3853 : HBB_CAMDR   3GDJ    0.36  0.67    2  141    4  147  146    2    8  147  P68231     Hemoglobin subunit beta OS=Camelus dromedarius GN=HBB PE=1 SV=2
 3854 : HBB_HAPGR           0.36  0.71    2  141    3  146  146    2    8  146  Q7M3C2     Hemoglobin subunit beta OS=Hapalemur griseus GN=HBB PE=1 SV=1
 3855 : HBB_LAMGL           0.36  0.68    2  141    4  147  146    2    8  147  P68226     Hemoglobin subunit beta OS=Lama glama GN=HBB PE=1 SV=2
 3856 : HBB_LAMGU           0.36  0.68    2  141    4  147  146    2    8  147  P68229     Hemoglobin subunit beta OS=Lama guanicoe GN=HBB PE=1 SV=2
 3857 : HBB_LAMPA           0.36  0.68    2  141    4  147  146    2    8  147  P68228     Hemoglobin subunit beta OS=Lama guanicoe pacos GN=HBB PE=1 SV=2
 3858 : HBB_LAMVI           0.36  0.68    2  141    4  147  146    2    8  147  P68227     Hemoglobin subunit beta OS=Lama vicugna GN=HBB PE=1 SV=2
 3859 : HBB_LEMCA           0.36  0.68    2  141    3  146  146    2    8  146  P02054     Hemoglobin subunit beta OS=Lemur catta GN=HBB PE=1 SV=1
 3860 : HBB_PHYCD           0.36  0.69    2  141    3  146  146    2    8  146  P09905     Hemoglobin subunit beta-1/2 OS=Physeter catodon GN=HBB PE=1 SV=1
 3861 : HBB_SCAAQ           0.36  0.69    2  141    4  147  146    2    8  147  Q2KPA4     Hemoglobin subunit beta OS=Scalopus aquaticus GN=HBB PE=2 SV=3
 3862 : HBB_VARVI           0.36  0.70    2  141    3  146  146    2    8  146  P21667     Hemoglobin subunit beta OS=Varecia variegata GN=HBB PE=1 SV=1
 3863 : HBD_DENDR           0.36  0.68    2  141    4  147  146    2    8  147  Q45XI4     Hemoglobin subunit deltaH OS=Dendrohyrax dorsalis GN=HBD PE=2 SV=3
 3864 : HBE_ATEBE           0.36  0.71    2  141    4  147  146    2    8  147  P51438     Hemoglobin subunit epsilon OS=Ateles belzebuth GN=HBE1 PE=2 SV=2
 3865 : HBE_CALJA           0.36  0.71    2  141    4  147  146    2    8  147  P68026     Hemoglobin subunit epsilon OS=Callithrix jacchus GN=HBE1 PE=2 SV=2
 3866 : HBE_CALPY           0.36  0.71    2  141    4  147  146    2    8  147  P68027     Hemoglobin subunit epsilon OS=Callithrix pygmaea GN=HBE1 PE=2 SV=2
 3867 : HBE_GORGO           0.36  0.71    2  141    4  147  146    2    8  147  Q6LDH0     Hemoglobin subunit epsilon OS=Gorilla gorilla gorilla GN=HBE1 PE=2 SV=3
 3868 : HBE_HUMAN   1A9W    0.36  0.71    2  141    4  147  146    2    8  147  P02100     Hemoglobin subunit epsilon OS=Homo sapiens GN=HBE1 PE=1 SV=2
 3869 : HBE_HYLSY           0.36  0.71    2  141    4  147  146    2    8  147  Q95190     Hemoglobin subunit epsilon OS=Hylobates syndactylus GN=HBE1 PE=2 SV=3
 3870 : HBE_MACMU           0.36  0.71    2  141    4  147  146    2    8  147  Q28507     Hemoglobin subunit epsilon OS=Macaca mulatta GN=HBE1 PE=2 SV=3
 3871 : HBE_PANPA           0.36  0.71    2  141    4  147  146    2    8  147  Q28775     Hemoglobin subunit epsilon OS=Pan paniscus GN=HBE1 PE=2 SV=3
 3872 : HBE_PANTR           0.36  0.71    2  141    4  147  146    2    8  147  Q6LDH1     Hemoglobin subunit epsilon OS=Pan troglodytes GN=HBE1 PE=2 SV=3
 3873 : HBE_PONPY           0.36  0.71    2  141    4  147  146    2    8  147  P18994     Hemoglobin subunit epsilon OS=Pongo pygmaeus GN=HBE1 PE=2 SV=2
 3874 : HBE_TARSY           0.36  0.72    2  141    4  147  146    2    8  147  P18435     Hemoglobin subunit epsilon OS=Tarsius syrichta GN=HBE1 PE=2 SV=2
 3875 : HBG_ALOSE           0.36  0.68    2  141    4  147  146    2    8  147  P56285     Hemoglobin subunit gamma OS=Alouatta seniculus GN=HBG PE=2 SV=2
 3876 : HBG_AOTAZ           0.36  0.68    2  141    4  147  146    2    8  147  Q27940     Hemoglobin subunit gamma OS=Aotus azarae GN=HBG PE=2 SV=3
 3877 : HBG_CALJA           0.36  0.68    2  141    4  147  146    2    8  147  Q9GJS7     Hemoglobin subunit gamma OS=Callithrix jacchus GN=HBG1 PE=2 SV=3
 3878 : HBG_ELEMA           0.36  0.70    2  141    4  147  146    2    8  147  Q45XH7     Hemoglobin subunit gamma OS=Elephas maximus GN=HBG PE=2 SV=3
 3879 : HBG_LOXAF           0.36  0.70    2  141    4  147  146    2    8  147  Q45XH8     Hemoglobin subunit gamma OS=Loxodonta africana GN=HBG PE=2 SV=2
 3880 : I1VYJ2_9EMBE        0.36  0.70  145  288    3  142  146    2    8  142  I1VYJ2     Hemoglobin subunit alpha-A OS=Zonotrichia capensis PE=3 SV=1
 3881 : I1Y910_9AVES        0.36  0.72  145  288    3  142  146    2    8  142  I1Y910     Hemoglobin subunit alpha-A OS=Phaethornis malaris PE=2 SV=1
 3882 : I3MVJ8_SPETR        0.36  0.70    2  141    4  147  146    2    8  147  I3MVJ8     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=HBE1 PE=3 SV=1
 3883 : I3VNF3_FALME        0.36  0.71  145  288    2  140  146    3    9  140  I3VNF3     Hemoglobin subunit alpha-E/Pi (Fragment) OS=Falco mexicanus PE=3 SV=1
 3884 : K4FY85_CALMI        0.36  0.61  143  288    8  149  148    3    8  149  K4FY85     Hemoglobin subunit alpha OS=Callorhynchus milii PE=2 SV=1
 3885 : L5KH60_PTEAL        0.36  0.69  145  288    3  142  146    2    8  142  L5KH60     Hemoglobin subunit zeta OS=Pteropus alecto GN=PAL_GLEAN10011814 PE=3 SV=1
 3886 : L5LSF0_MYODS        0.36  0.67  145  279    3  133  137    2    8  174  L5LSF0     Hemoglobin subunit zeta OS=Myotis davidii GN=MDA_GLEAN10007589 PE=3 SV=1
 3887 : L5MBE6_MYODS        0.36  0.70    2  141    4  147  146    2    8  147  L5MBE6     Hemoglobin subunit epsilon OS=Myotis davidii GN=MDA_GLEAN10001458 PE=3 SV=1
 3888 : L9KR86_TUPCH        0.36  0.70    2  141    4  147  146    2    8  147  L9KR86     Hemoglobin subunit beta OS=Tupaia chinensis GN=TREES_T100005453 PE=3 SV=1
 3889 : M3YX88_MUSPF        0.36  0.68  145  288    3  142  146    2    8  142  M3YX88     Uncharacterized protein OS=Mustela putorius furo GN=Hba-x PE=3 SV=1
 3890 : M9T2B5_CYPCA        0.36  0.67  145  288    3  143  146    2    7  143  M9T2B5     Hemoglobin alpha OS=Cyprinus carpio PE=4 SV=1
 3891 : Q19LH2_SPAAU        0.36  0.67  145  288    3  143  146    2    7  143  Q19LH2     Alpha-2 globin OS=Sparus aurata PE=3 SV=1
 3892 : Q28460_MIRAN        0.36  0.71    2  141    3  146  146    2    8  146  Q28460     MRNA, . (Fragment) OS=Mirounga angustirostris PE=2 SV=1
 3893 : Q38IW1_XENTR        0.36  0.71  145  288    3  142  146    2    8  142  Q38IW1     Alpha globin larval-5 OS=Xenopus tropicalis GN=hba-l5 PE=2 SV=1
 3894 : Q3KQ67_XENLA        0.36  0.67  145  288    3  142  146    2    8  142  Q3KQ67     MGC130918 protein OS=Xenopus laevis GN=hbz PE=2 SV=1
 3895 : Q4RHD0_TETNG        0.36  0.64  145  288    3  143  146    2    7  143  Q4RHD0     Chromosome 3 SCAF15050, whole genome shotgun sequence OS=Tetraodon nigroviridis GN=GSTENG00034400001 PE=3 SV=1
 3896 : Q6H1L9_MACEU        0.36  0.63  145  288    3  142  146    2    8  142  Q6H1L9     Theta globin OS=Macropus eugenii PE=3 SV=1
 3897 : Q78DI0_ORYLA        0.36  0.68  145  288    4  144  146    2    7  144  Q78DI0     Alpha-type globin OS=Oryzias latipes GN=Gb-alpha1 PE=2 SV=1
 3898 : Q7LZM8_9PERC        0.36  0.67  145  288    2  143  147    2    8  143  Q7LZM8     Hemoglobin alpha chain OS=Bathydraco marri PE=3 SV=1
 3899 : Q7SZV8_DANRE        0.36  0.67  145  288    3  143  146    2    7  143  Q7SZV8     Novel alpha-globin OS=Danio rerio GN=hbae1 PE=3 SV=1
 3900 : Q7ZT21_DANRE        0.36  0.68  145  288    3  143  146    2    7  143  Q7ZT21     Embryonic alpha globin e1 OS=Danio rerio GN=hbae1 PE=2 SV=1
 3901 : Q8AYQ9_ORYLA        0.36  0.66  144  286    3  143  143    1    2  145  Q8AYQ9     Beta-type globin OS=Oryzias latipes GN=Gb-beta2 PE=3 SV=1
 3902 : Q8UV18_9PERC        0.36  0.66  145  288    3  143  146    2    7  143  Q8UV18     HBA2 (Fragment) OS=Sphoeroides nephelus GN=HBA2 PE=3 SV=1
 3903 : Q92015_SALSA        0.36  0.68  145  288    3  143  146    2    7  143  Q92015     Alpha-globin OS=Salmo salar GN=HBA PE=2 SV=1
 3904 : Q9GLX3_CHISA        0.36  0.62    2  141    4  138  146    3   17  138  Q9GLX3     Gamma1-globin OS=Chiropotes satanas PE=3 SV=1
 3905 : Q9GLX5_AOTNA        0.36  0.68    2  141    4  147  146    2    8  147  Q9GLX5     Hybrid gamma1/gamma2-globin OS=Aotus nancymaae PE=3 SV=1
 3906 : Q9GLX7_SAISC        0.36  0.68    2  141    4  147  146    2    8  147  Q9GLX7     Hybrid gamma1/gamma2-globin OS=Saimiri sciureus PE=3 SV=1
 3907 : B3F9D6_GADMO        0.35  0.64  145  288    3  143  146    2    7  143  B3F9D6     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3908 : B3F9E2_GADMO        0.35  0.64  145  288    3  143  146    2    7  143  B3F9E2     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3909 : B3F9E8_GADMO        0.35  0.64  145  288    3  143  146    2    7  143  B3F9E8     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3910 : B3F9F7_GADMO        0.35  0.64  145  288    3  143  146    2    7  143  B3F9F7     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3911 : B3F9G0_GADMO        0.35  0.64  145  288    3  143  146    2    7  143  B3F9G0     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3912 : B3F9G6_GADMO        0.35  0.65  145  288    3  143  146    2    7  143  B3F9G6     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3913 : B3F9H2_GADMO        0.35  0.64  145  288    3  143  146    2    7  143  B3F9H2     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3914 : B3F9I4_GADMO        0.35  0.64  145  288    3  143  146    2    7  143  B3F9I4     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3915 : B3F9J9_GADMO        0.35  0.65  145  288    3  143  146    2    7  143  B3F9J9     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3916 : B3F9M6_GADMO        0.35  0.65  145  288    3  143  146    2    7  143  B3F9M6     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3917 : B3F9S7_GADMO        0.35  0.64  145  288    3  143  146    2    7  143  B3F9S7     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3918 : B3F9T0_GADMO        0.35  0.65  145  288    3  143  146    2    7  143  B3F9T0     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3919 : C1FY20_DASNO        0.35  0.68    2  141    4  147  146    2    8  147  C1FY20     Hemoglobin beta chain complex (Predicted) OS=Dasypus novemcinctus GN=HBB PE=3 SV=1
 3920 : D3TTJ9_DELDE        0.35  0.69  145  288    3  142  146    2    8  142  D3TTJ9     Hemoglobin alpha3 chain OS=Delphinus delphis PE=2 SV=1
 3921 : D3ZPM3_RAT          0.35  0.64  145  286    3  140  144    2    8  142  D3ZPM3     Protein Hbq1 OS=Rattus norvegicus GN=Hbq1 PE=2 SV=1
 3922 : F1MMI1_BOVIN        0.35  0.69  145  288    3  142  146    2    8  142  F1MMI1     Uncharacterized protein (Fragment) OS=Bos taurus GN=HBZ PE=3 SV=1
 3923 : F2Z287_ISUOX3MKB    0.35  0.51  144  288    2  136  146    3   12  136  F2Z287     Hemoglobin subunit beta OS=Isurus oxyrhynchus PE=1 SV=1
 3924 : G3IF93_CRIGR        0.35  0.71    2  141    4  147  146    2    8  147  G3IF93     Hemoglobin subunit beta-1 OS=Cricetulus griseus GN=I79_022414 PE=3 SV=1
 3925 : H2NPI8_PONAB        0.35  0.64  145  288    3  139  146    3   11  139  H2NPI8     Uncharacterized protein OS=Pongo abelii GN=HBQ1 PE=3 SV=1
 3926 : H3ABR1_LATCH        0.35  0.65  145  288    2  141  146    2    8  141  H3ABR1     Uncharacterized protein OS=Latimeria chalumnae GN=HBZ PE=3 SV=2
 3927 : HBA2_TORMA          0.35  0.58  145  288    2  141  146    3    8  141  P20245     Hemoglobin subunit alpha-2 OS=Torpedo marmorata PE=1 SV=1
 3928 : HBA2_VARAL          0.35  0.65  145  288    2  141  147    4   10  141  P18981     Hemoglobin subunit alpha-2 OS=Varanus albigularis PE=1 SV=2
 3929 : HBAA_ANGAN          0.35  0.64  145  288    3  143  146    2    7  143  P80945     Hemoglobin anodic subunit alpha OS=Anguilla anguilla GN=hba PE=1 SV=2
 3930 : HBAC_GYMUN          0.35  0.65  145  288    2  143  147    3    8  143  P84203     Hemoglobin cathodic subunit alpha OS=Gymnothorax unicolor PE=1 SV=1
 3931 : HBAD_SPHPU          0.35  0.68  145  288    2  141  146    2    8  141  P10062     Hemoglobin subunit alpha-D OS=Sphenodon punctatus GN=HBAD PE=1 SV=1
 3932 : HBAT_HORSE          0.35  0.62  145  288    3  142  146    2    8  142  P06714     Hemoglobin subunit theta-1 OS=Equus caballus GN=HBQ1 PE=3 SV=2
 3933 : HBB1_TORMA          0.35  0.59  145  288    3  142  144    1    4  142  P20246     Hemoglobin subunit beta-1 OS=Torpedo marmorata GN=HBB1 PE=1 SV=1
 3934 : HBB2_TORMA          0.35  0.59  145  288    3  142  144    1    4  142  P20247     Hemoglobin subunit beta-2 OS=Torpedo marmorata GN=HBB2 PE=1 SV=1
 3935 : HBB_MACRU           0.35  0.67    2  141    3  146  146    2    8  146  P02107     Hemoglobin subunit beta OS=Macropus rufus GN=HBB PE=1 SV=1
 3936 : HBB_OVIMU           0.35  0.64    1  141    1  145  147    2    8  145  P02076     Hemoglobin subunit beta OS=Ovis orientalis musimon GN=HBB PE=1 SV=1
 3937 : HBB_POTTR           0.35  0.67    2  141    3  146  146    2    8  146  P02108     Hemoglobin subunit beta OS=Potorous tridactylus GN=HBB PE=1 SV=1
 3938 : HBB_TUPGL           0.35  0.70    2  141    3  146  146    2    8  146  P02052     Hemoglobin subunit beta OS=Tupaia glis GN=HBB PE=1 SV=1
 3939 : HBD_HETBR           0.35  0.68    2  141    4  147  146    2    8  147  Q45XI5     Hemoglobin subunit deltaH OS=Heterohyrax brucei PE=2 SV=3
 3940 : HBD_PROCA           0.35  0.68    2  141    4  147  146    2    8  147  Q45XI6     Hemoglobin subunit deltaH OS=Procavia capensis PE=2 SV=3
 3941 : J9NVU7_CANFA        0.35  0.68  145  288    2  141  146    2    8  141  J9NVU7     Uncharacterized protein OS=Canis familiaris GN=HBM PE=3 SV=1
 3942 : Q7ZT83_9SAUR        0.35  0.63  145  288    3  142  147    4   10  142  Q7ZT83     Alpha globin OS=Leioselasma melanocephala GN=HBA PE=3 SV=1
 3943 : Q7ZT85_NAJKA        0.35  0.63  145  288    3  142  147    4   10  142  Q7ZT85     Alpha globin OS=Naja kaouthia GN=HBA PE=2 SV=1
 3944 : Q8JH89_PARDA        0.35  0.67    5  141    6  147  145    5   11  147  Q8JH89     Beta globin (Fragment) OS=Paramisgurnus dabryanus PE=2 SV=1
 3945 : Q8UW92_CYPCA        0.35  0.67  145  288    3  144  147    3    8  144  Q8UW92     Alpha globin type-3 OS=Cyprinus carpio PE=3 SV=1
 3946 : A9L8T8_PAPAN        0.34  0.68  145  288    2  141  146    2    8  141  A9L8T8     Hemoglobin, mu (Predicted) OS=Papio anubis GN=HBM PE=3 SV=1
 3947 : B3F9H5_GADMO        0.34  0.64  145  288    3  143  146    2    7  143  B3F9H5     Hemoglobin alpha chain OS=Gadus morhua PE=3 SV=1
 3948 : C1BW51_ESOLU        0.34  0.65  145  288    3  143  146    2    7  143  C1BW51     Hemoglobin subunit alpha-4 OS=Esox lucius GN=HBA4 PE=2 SV=1
 3949 : C1BYD3_ESOLU        0.34  0.65  145  288    3  143  146    2    7  143  C1BYD3     Hemoglobin subunit alpha-4 OS=Esox lucius GN=HBA4 PE=2 SV=1
 3950 : C1BYS9_ESOLU        0.34  0.65  145  288    3  143  146    2    7  143  C1BYS9     Hemoglobin subunit alpha-4 OS=Esox lucius GN=HBA4 PE=2 SV=1
 3951 : D2HDV3_AILME        0.34  0.68  145  288    2  141  146    2    8  141  D2HDV3     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_008910 PE=3 SV=1
 3952 : E2JF88_9PERC        0.34  0.60  145  288    3  143  146    2    7  143  E2JF88     Hemoglobin-2 OS=Cynoglossus semilaevis PE=2 SV=1
 3953 : F6YMF4_MONDO        0.34  0.67  145  288    3  142  146    2    8  142  F6YMF4     Uncharacterized protein OS=Monodelphis domestica GN=LOC100618857 PE=4 SV=1
 3954 : F6ZP35_MACMU        0.34  0.68  145  288    2  141  146    2    8  141  F6ZP35     Uncharacterized protein OS=Macaca mulatta GN=HBM PE=3 SV=1
 3955 : G1R944_NOMLE        0.34  0.68  145  288    2  141  146    2    8  141  G1R944     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100583176 PE=3 SV=1
 3956 : G3QY87_GORGO        0.34  0.68  145  288    2  141  146    2    8  141  G3QY87     Uncharacterized protein OS=Gorilla gorilla gorilla GN=HBM PE=3 SV=1
 3957 : G7Q016_MACFA        0.34  0.66  145  288    2  141  146    2    8  141  G7Q016     Hemoglobin mu chain OS=Macaca fascicularis GN=EGM_11264 PE=3 SV=1
 3958 : G9K3W3_MUSPF        0.34  0.67  145  287    2  140  145    2    8  140  G9K3W3     Hemoglobin subunit mu (Fragment) OS=Mustela putorius furo PE=2 SV=1
 3959 : H0WKY2_OTOGA        0.34  0.68  145  288    2  141  146    2    8  141  H0WKY2     Uncharacterized protein OS=Otolemur garnettii GN=HBM PE=3 SV=1
 3960 : H2LKV1_ORYLA        0.34  0.62  144  286    3  151  151    2   10  153  H2LKV1     Uncharacterized protein OS=Oryzias latipes GN=LOC101159018 PE=3 SV=1
 3961 : H2NPI6_PONAB        0.34  0.68  145  288    2  141  146    2    8  141  H2NPI6     Uncharacterized protein OS=Pongo abelii GN=HBM PE=3 SV=1
 3962 : H2R1M1_PANTR        0.34  0.68  145  288    2  141  146    2    8  141  H2R1M1     Uncharacterized protein OS=Pan troglodytes GN=LOC100608451 PE=3 SV=1
 3963 : H3A6U9_LATCH        0.34  0.62    2  141  150  304  157    3   19  304  H3A6U9     Uncharacterized protein OS=Latimeria chalumnae PE=3 SV=1
 3964 : HBA1_XENBO          0.34  0.66  145  288    3  142  146    2    8  142  P07430     Hemoglobin subunit alpha-1 OS=Xenopus borealis GN=hba1 PE=2 SV=2
 3965 : HBA1_XENLA          0.34  0.65  145  288    3  142  146    2    8  142  P02012     Hemoglobin subunit alpha-1 OS=Xenopus laevis GN=hba1 PE=2 SV=2
 3966 : HBA2_XENLA          0.34  0.64  145  288    3  142  146    2    8  142  P02013     Hemoglobin subunit alpha-2 OS=Xenopus laevis GN=hba2 PE=2 SV=2
 3967 : HBA_LYCRE           0.34  0.66  145  288    2  142  146    2    7  142  P86882     Hemoglobin subunit alpha OS=Lycodes reticulatus GN=hba PE=1 SV=1
 3968 : HBB_BATEA           0.34  0.61  144  288    2  141  145    2    5  141  P84217     Hemoglobin subunit beta OS=Bathyraja eatonii GN=HBB PE=1 SV=1
 3969 : HBB_MUSGR   1GCV    0.34  0.57  144  288    3  137  145    1   10  137  Q9YGW1     Hemoglobin subunit beta OS=Mustelus griseus GN=HBB PE=1 SV=1
 3970 : HBM_BOVIN           0.34  0.66  145  288    2  141  146    2    8  141  A1A4Q3     Hemoglobin subunit mu OS=Bos taurus GN=HBM PE=2 SV=1
 3971 : HBM_HUMAN           0.34  0.68  145  288    2  141  146    2    8  141  Q6B0K9     Hemoglobin subunit mu OS=Homo sapiens GN=HBM PE=2 SV=1
 3972 : L8HUF7_BOSMU        0.34  0.54  145  288    4  150  149    3    7  150  L8HUF7     Hemoglobin subunit beta (Fragment) OS=Bos grunniens mutus GN=M91_21159 PE=3 SV=1
 3973 : Q4JDG3_BATEA        0.34  0.61  144  288    3  142  145    2    5  142  Q4JDG3     Beta 1 globin OS=Bathyraja eatonii PE=2 SV=1
 3974 : Q6DJI3_XENLA        0.34  0.65  145  288    3  142  146    2    8  142  Q6DJI3     LOC397869 protein OS=Xenopus laevis GN=hba1 PE=2 SV=1
 3975 : HBA1_PLEWA          0.33  0.63  144  288    2  142  147    2    8  142  P06639     Hemoglobin subunit alpha-1 OS=Pleurodeles waltl PE=2 SV=4
 3976 : Q4JDG1_9CHON        0.33  0.57  144  288    1  140  147    4    9  140  Q4JDG1     Beta globin (Fragment) OS=Amblyraja hyperborea PE=2 SV=1
 3977 : Q6GPU5_XENLA        0.33  0.61  145  288    3  142  146    2    8  142  Q6GPU5     MGC82602 protein OS=Xenopus laevis GN=MGC82602 PE=2 SV=1
 3978 : Q7LZM6_VARKO        0.33  0.63  145  288    2  141  147    4   10  141  Q7LZM6     Hemoglobin alpha 2 chain OS=Varanus komodoensis PE=3 SV=1
 3979 : Q8BYM1_MOUSE        0.33  0.61  153  282   11  133  132    3   11  145  Q8BYM1     Hemoglobin, theta 1 OS=Mus musculus GN=Hbq1a PE=2 SV=1
 3980 : F1Q6U4_DANRE        0.32  0.52  145  288    3  123  146    5   27  123  F1Q6U4     Uncharacterized protein OS=Danio rerio GN=hbae3 PE=2 SV=1
 3981 : F2Z286_ISUOX3MKB    0.32  0.60  145  288    2  140  146    3    9  140  F2Z286     Hemoglobin subunit alpha OS=Isurus oxyrhynchus PE=1 SV=1
 3982 : HBA_MUSGR   1GCV    0.32  0.59  145  288    3  141  146    3    9  141  Q9YGW2     Hemoglobin subunit alpha OS=Mustelus griseus GN=HBA PE=1 SV=1
 3983 : J9P710_CANFA        0.32  0.57  145  288    3  169  173    3   35  169  J9P710     Uncharacterized protein OS=Canis familiaris PE=3 SV=1
 3984 : M3WAU3_FELCA        0.32  0.66  145  288    2  141  146    2    8  141  M3WAU3     Uncharacterized protein OS=Felis catus GN=HBM PE=3 SV=1
 3985 : Q6F3D2_AMBME        0.32  0.62  145  288    4  143  146    2    8  143  Q6F3D2     Minor alpha globin chain OS=Ambystoma mexicanum GN=Hb-am PE=2 SV=1
 3986 : Q7T1B2_DANRE        0.32  0.53  145  288    3  123  146    5   27  123  Q7T1B2     Embryonic globin alpha a3 OS=Danio rerio GN=hbae3 PE=2 SV=1
 3987 : D4A021_RAT          0.31  0.60  145  282    3  131  140    3   13  143  D4A021     Protein Hbq1 OS=Rattus norvegicus GN=Hbq1b PE=2 SV=1
 3988 : HBA_AMBME           0.31  0.59  144  288    3  143  147    2    8  143  P02015     Hemoglobin subunit alpha OS=Ambystoma mexicanum GN=HBA PE=1 SV=2
 3989 : HBB_DASAK   1CG5    0.31  0.53  144  288    3  142  145    2    5  142  P56692     Hemoglobin subunit beta OS=Dasyatis akajei GN=HBB PE=1 SV=2
 3990 : L5KH54_PTEAL        0.31  0.50  145  287    3  175  179    3   42  176  L5KH54     Hemoglobin subunit theta-1 OS=Pteropus alecto GN=PAL_GLEAN10011809 PE=3 SV=1
 3991 : F6QUQ8_XENTR        0.30  0.51  144  288    3  126  147    4   25  126  F6QUQ8     Uncharacterized protein OS=Xenopus tropicalis PE=3 SV=1
 3992 : F7BMQ3_MACMU        0.30  0.52    2  141    3  138  155    3   34  138  F7BMQ3     Uncharacterized protein OS=Macaca mulatta PE=3 SV=1
## ALIGNMENTS    1 -   70
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1    1 A V              0   0  136  867   26  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVV
     2    2 A L        -     0   0   22 1663    3  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
     3    3 A S     >  -     0   0   51 1663   48  S  SSS    S     S  SS    S  S SS      S  S  SSSSS    S SSSSSSSSSSSSSSS
     4    4 A P  H  > S+     0   0   84 1664   53  P  PPP    P     P  PP    P  P PP      P  P  PPPPP    P PPPPPPPPPPPPPPP
     5    5 A A  H  > S+     0   0   62 1663   62  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
     6    6 A D  H  > S+     0   0    8 1667   20  D  DDD    D     D  DD    D  D DD      D  D  DDDDD    D DDDDDDDDDDDDDDD
     7    7 A K  H  X S+     0   0   46 1668    8  K  KKK    K     K  KK    K  K KK      K  K  KKKKK    K KKKKKKKKKKKKKKK
     8    8 A T  H  X S+     0   0   95 1666   59  T  TTT    T     T  TT    T  N TT      S  T  STTSS    T SSTSTTSTTTSSSTT
     9    9 A N  H  X S+     0   0   43 1665   80  N  NNN    N     N  NN    N  N NN      N  N  NNNNN    N NNNNNNNNNNNNNNN
    10   10 A V  H  X S+     0   0    2 1667   12  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVV
    11   11 A K  H  X S+     0   0   99 1668   70  K  KKK    K     K  KK    K  K KK      K  K  KKKKK    K KKKKKKKKKKKKKKK
    12   12 A A  H  X S+     0   0   67 1669   58  A  AAA    A     T  AA    A  A TA      A  A  AAAAA    A AATATTAADAAAATT
    13   13 A A  H  < S+     0   0    5 1672   61  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
    14   14 A W  H  X S+     0   0   22 1672    7  W  WWW    W     W  WW    W  W WW      W  W  WWWWW    W WWWWWWWWWWWWWCW
    15   15 A G  H  < S+     0   0   51 1672   52  G  GGG    G     G  GG    G  G GG      G  G  GGGGG    G GGGGGGGGGDGGGRG
    16   16 A K  T  < S+     0   0  111 1673    8  K  KKK    K     K  KK    K  K KK      K  K  KKKKK    K KKKKKKKKKKKKKKK
    17   17 A V  T >4 S+     0   0    1 1676   26  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVV
    18   18 A G  T 3< S+     0   0   49 1676   66  G  GGG    G     G  GG    G  G GG      G  G  GGGGG    G GGGGGGGGGGGGGRG
    19   19 A A  T 3  S+     0   0   96 1676   70  A  AAA    A     A  AA    A  A AG      S  G  SGGGG    G GGAGGAGGGGGGGAG
    20   20 A H  S <> S+     0   0   92 1674   65  H  HHH    H     H  HH    H  H HH      H  H  HHHHH    H HHHHHHHHHHHHHHH
    21   21 A A  H  > S+     0   0    6 1158   58  A  AAA    A     A  AA    A  A AG      A  A  AAAAA    A AAAAAAAAAAAAAAG
    22   22 A G  H  > S+     0   0   19 1159   49  G  GGG    G     G  GG    G  G GG      G  G  GGGGG    G GGGGGGGGGGGGGGG
    23   23 A E  H  > S+     0   0  120 1676   42  E  EEE    E     D  DD    E  D DE      D  E  DEEEE    E DEDDDDEEEEDDDDE
    24   24 A Y  H  X S+     0   0   23 1676   70  Y  YYY    Y     Y  YY    Y  Y YY      Y  Y  YYYYY    Y YYYYYYYYYYYYYYY
    25   25 A G  H  X S+     0   0    4 1676    6  G  GGG    G     G  GG    G  G GG      G  G  GGGGG    G GGGGGGGGGGGGGGG
    26   26 A A  H  X S+     0   0   15 1676   45  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
    27   27 A E  H  X S+     0   0   45 1676    7  E  EEE    E     E  EE    E  E EE      E  E  EEEEE    E EEEEEDEEEEEEEEE
    28   28 A A  H  X S+     0   0    0 1674   28  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
    29   29 A L  H  X S+     0   0    4 1677    2  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
    30   30 A E  H  X S+     0   0   36 1677   56  E  EEE    E     E  EE    E  E EE      E  E  EEEEE    E EEEEEEEEEEEEEEE
    31   31 A R  H  X S+     0   0    3 1678    1  R  RRR    R     R  RR    R  R RR      R  R  RRRRR    R RRRRRRRRRRRRRRR
    32   32 A M  H  X S+     0   0   11 1677   19  M  MMM    M     M  MM    M  M MM      M  M  MMMMM    M MMMMMMMMMMMMMMM
    33   33 A F  H  < S+     0   0   11 1667   15  F  FFF    F     F  FF    F  F FF      F  F  FFFFF    F FFFFFFFFFFFFFFF
    34   34 A L  H  < S+     0   0   58 1672   64  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
    35   35 A S  H  < S+     0   0   15 1674   70  S  SSS    S     S  SS    S  S SS      S  S  SSSSS    S SSSSSSSSSSSSSSS
    36   36 A F    ><  +     0   0   36 1674   14  F  FFF    F     F  FF    F  F FF      F  F  FFFFF    F FFFFFFFFFFFFFFF
    37   37 A P  G >  S+     0   0   44 1674    0  P  PPP    P     P  PP    P  P PP      P  P  PPPPP    P PPPPPPPPPPPPPPP
    38   38 A T  G >  S+     0   0   37 1674  100  T  TTT    T     T  TT    T  T TT      T  T  TTTTT    T TTTTTTTTTTTTTTT
    39   39 A T  G X  S+     0   0    3 1674    2  T  TTT    T     T  TT    T  T TT      T  T  TTTTT    T TTTTTTTTTTTTTTT
    40   40 A K  G X  S+     0   0   64 1674   41  K  KKK    K     K  KK    K  K KK      K  K  KKKKK    K KKKKKKKKKKKKKKK
    41   41 A T  G <  S+     0   0    7 1675   64  T  TTT    T     T  TT    T  T TT      T  T  TTTTT    T TTTTTTTTTTTTTTT
    42   42 A Y  G <  S+     0   0   16 1675    3  Y  YYY    Y     Y  YY    Y  Y YY      Y  Y  YYYYY    Y YYYYYYYYYYYYYYY
    43   43 A F    X   +     0   0   31 1676    0  F  FFF    F     F  FF    F  F FF      F  F  FFFFF    F FFFFFFFFFFFFFFF
    44   44 A P  T 3  S+     0   0   70 1676   66  P  PPP    P     P  PP    P  P PP      P  P  PPPPP    P PPPPPPPPPPPPPPP
    45   45 A H  T 3  S+     0   0  122 1676   59  H  HHH    H     H  HH    H  H HH      H  H  HHHHH    H HHHHHHHHHHHHHHH
    46   46 A F  S <  S-     0   0   44 1676    8  F  FFF    F     F  FF    F  F FF      F  F  FFFFF    F FFFFFFFFFFFFFFF
    47   47 A D        -     0   0   81 1676   46  D  DDD    D     D  DD    D  D DD      D  D  DDDDD    D DDDDDDDDDDDDDDD
    48   48 A L        +     0   0   55 1674   66  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
    49   49 A S  S >  S-     0   0   58 1674   83  S  SSS    S     S  SS    S  S SS      S  S  SSSSS    S SSSSSSSSSSSSSSS
    50   50 A H  T 3  S+     0   0  150 1674   86  H  HHH    H     H  HH    H  H HH      H  H  HHHHH    H HHHHHHHHHHHHHHH
    51   51 A G  T 3  S+     0   0   40 1676   21  G  GGG    G     G  GG    G  G GG      G  G  GGGGG    G GGGGGGGGGGGGGGG
    52   52 A S    X>  -     0   0   13 1677   46  S  SSS    S     S  SS    S  S SS      S  S  SSSSS    S SSSSSSSSSSSSSSS
    53   53 A A  H 3> S+     0   0   80 1675   50  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
    54   54 A Q  H 3> S+     0   0   86 1677   56  Q  QQQ    Q     Q  QQ    Q  Q QQ      Q  Q  QQQQQ    Q QQQQQQQQQQQQQQQ
    55   55 A V  H <> S+     0   0   12 1676   15  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVV
    56   56 A K  H  X S+     0   0  130 1677   25  K  KKK    K     K  KK    K  K KK      K  K  KKKKK    K KKKKKKKKKKKKKKK
    57   57 A G  H  X S+     0   0   37 1678   52  G  GGG    G     G  GG    G  G DG      G  G  GGGGG    G GGGGGGGGGGGGGGG
    58   58 A H  H  X S+     0   0   53 1678    7  H  HHH    H     H  HH    H  H HH      H  H  HHHHH    H HHHHHHHHHHHHHHH
    59   59 A G  H  X S+     0   0    0 1678    1  G  GGG    G     G  GG    G  G GG      G  G  GGGGG    G GGGGGGGGGGGGGGG
    60   60 A K  H  X S+     0   0  132 1677   49  K  KKK    K     K  KK    K  K KK      K  K  KKKKK    K KKKKKKKKKKKKKKK
    61   61 A K  H  X S+     0   0  166 1677   22  K  KKK    K     K  KK    K  K KK      K  K  KKKKK    K KKKKKKKKKKKKKKK
    62   62 A V  H  X S+     0   0   31 1677    6  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVV
    63   63 A A  H  X S+     0   0    1 1677   69  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
    64   64 A D  H  X S+     0   0   83 1677   63  D  DDD    D     D  DD    D  D DD      D  D  DDDDD    D DDDDDDDDDDDDDDD
    65   65 A A  H  X S+     0   0   23 1678   36  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
    66   66 A L  H  X S+     0   0   15 1678   27  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
    67   67 A T  H  X S+     0   0   52 1678   69  T  TTT    T     T  TT    T  T TT      T  T  TTTTT    T TTTTSSTTTTTTTIT
    68   68 A N  H  X S+     0   0   60 1678   62  N  NNN    N     N  NN    N  N NN      N  L  NLLLL    L NLNNNNLLLLVNNNL
    69   69 A A  H  < S+     0   0    0 1678   26  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
    70   70 A V  H >< S+     0   0   10 1678   47  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVA
    71   71 A A  H 3< S+     0   0   71 1678   70  A  AAA    A     A  AA    A  A AA      A  G  AGGGG    G AGAAAAGDGGAAAAA
    72   72 A H  T >< S+     0   0   84 1678   50  H  HHH    H     H  HH    H  H HH      H  H  HHHHH    H HHHHHHHHHHHLHHH
    73   73 A V  T <  S+     0   0   14 1678   26  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVV
    74   74 A D  T 3  S+     0   0  114 1678    3  D  DDD    D     D  DD    H  D DD      D  D  DDDDD    D DDDDDDDDDDDDDDD
    75   75 A D  S X> S+     0   0   85 1678   30  D  DDD    D     D  DD    D  D DD      D  D  DDDDD    D DDDDDDDDDDDDDDD
    76   76 A M  H 3>  +     0   0   13 1678   19  M  MMM    M     M  MM    M  M MM      M  M  MMMMM    M MMMMMMMMMMMMMMM
    77   77 A P  H 34 S+     0   0   69 1672   78  P  PPP    P     P  PP    P  P PP      P  P  PPPPP    P PPPPPPPPPPPPPPP
    78   78 A N  H X4 S+     0   0   91 1678   38  N  NNN    N     N  NN    N  N NH      N  H  NHQNN    Q NQNNNNHQQHNNNNS
    79   79 A A  H 3< S+     0   0   34 1678   50  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
    80   80 A L  T 3X S+     0   0    5 1678   14  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLQLLLLLLLLLLLL
    81   81 A S  H <> S+     0   0   43 1678   57  S  SSS    S     S  SS    S  S SS      S  S  SSSSS    S SSTSSSSSSSSSSSS
    82   82 A A  H  > S+     0   0   77 1678   70  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
    83   83 A L  H  > S+     0   0   54 1678    0  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
    84   84 A S  H  X S+     0   0    3 1677    3  S  SSS    S     S  SS    S  S SS      S  S  SSSSS    S SSSSSSSSSSSSSSS
    85   85 A D  H  X S+     0   0   67 1678   28  D  DDD    D     D  DD    D  D DD      D  D  DDDDD    D DDDDDDDDDDDDDDD
    86   86 A L  H >X>S+     0   0   68 1678    8  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
    87   87 A H  I 3<>S+     0   0   41 1678    0  H  HHH    H     H  HH    H  H HH      H  H  HHHHH    H HHHHHHHHHHHHHHH
    88   88 A A  I 3<5S+     0   0    6 1678   45  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
    89   89 A H  I <<5S+     0   0  111 1678   83  H  HHH    H     H  HH    H  H HH      H  H  HHHHH    H HHHHHHHHHHHHHHH
    90   90 A K  I  <5S+     0   0  162 1678   37  K  KKK    K     K  KK    K  K KK      K  K  KKKKK    K KKKKKKKKKKKKKKK
    91   91 A L  I      -     0   0    3 1677    2  D  DDD    D     D  DD    D  D DD      D  D  DDDDD    D DDDDDDDDDDDDDDD
    95   95 A P  T >> S+     0   0   40 1677    0  P  PPP    P     P  PP    P  P PP      P  P  PPPPP    P PPPPPPPPPPPPPPP
    96   96 A V  H 3> S+     0   0   56 1677   76  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVV
    97   97 A N  H <> S+     0   0   10 1676    1  N  NNN    N     N  NN    N  N NN      N  N  NNNNN    N NNNNNNNNNNNNNNN
    98   98 A F  H <> S+     0   0   23 1678    0  F  FFF    F     F  FF    F  F FF      F  F  FFFFF    F FFFFFFFFFFFFFFF
    99   99 A K  H  X S+     0   0  129 1678   26  K  KKK    K     K  KK    K  K KK      K  K  KKKKK    K KKKKKKKKKKKKKKK
   100  100 A L  H  X S+     0   0   20 1675   16  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
   101  101 A L  H  X S+     0   0   40 1677    2  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
   102  102 A S  H  X S+     0   0   16 1677   44  S  SSS    S     S  SS    S  S SS      S  S  SSSSS    S SSSSSSSSSSSSSSS
   103  103 A H  H  X S+     0   0   16 1677   45  H  HHH    H     H  HH    H  H HH      H  H  HHHHH    H HHHHHHHHHHHHHHH
   104  104 A C  H  X S+     0   0    0 1676   70  C  CCC    C     C  CC    C  C CC      C  C  CCCCC    C CCCCCCCCCCCCCCC
   105  105 A L  H  X S+     0   0   11 1676   23  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
   106  106 A L  H  X S+     0   0    2 1677   44  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
   107  107 A V  H  X S+     0   0    0 1677   30  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVV
   108  108 A T  H  < S+     0   0    1 1677   51  T  TTT    T     T  TT    T  T TT      T  T  TTTTT    T TTTTTTTTTTTTTTT
   109  109 A L  H >X S+     0   0    4 1677   20  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
   110  110 A A  H 3< S+     0   0    0 1677   13  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
   111  111 A A  T 3< S+     0   0   10 1675   90  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
   112  112 A H  T <4 S+     0   0   53 1678   39  H  HHH    H     H  HH    H  H HH      H  H  HHHHH    H HHHHHHHHHHHHHHH
   113  113 A L  S >X S-     0   0    3 1678   63  L  LLL    L     L  HL    L  H LL      H  L  HLLLL    L HLHHHHLLLLLHHLH
   114  114 A P  T 34 S+     0   0   90 1678   50  P  PPP    P     P  PP    P  P PP      P  P  PPPPP    P PPPPPPPPPPPPPPP
   115  115 A A  T 34 S+     0   0   80 1590   72  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
   116  116 A E  T <4 S+     0   0   79 1678   38  E  EEE    E     E  EE    E  E EE      E  E  EEEEE    E DEEDDDEEEEDDDEE
   117  117 A F     <  +     0   0    8 1678    7  F  FFF    F     F  FF    F  F FF      F  F  FFFFF    F FFFFFFFFFFFFFFF
   118  118 A T     >  -     0   0   62 1678   18  T  TTT    T     T  TT    T  T TT      T  T  TTTTT    T TTTTTTTTTTTTTTT
   119  119 A P  H  > S+     0   0   22 1678   12  P  PPP    P     P  PP    P  P PP      P  P  PPPPP    P PPPPPPPPPPPPPPP
   120  120 A A  H  > S+     0   0   35 1677   58  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
   121  121 A V  H  > S+     0   0   17 1677   38  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVV
   122  122 A H  H  X S+     0   0    2 1676   32  H  HHH    H     H  HH    H  H HH      H  H  HHHHH    H HHHHHHHHHHHHHHH
   123  123 A A  H  X S+     0   0   16 1676   34  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
   124  124 A S  H  X S+     0   0    3 1676   45  S  SSS    S     S  SS    S  S SS      S  S  SSSSS    S SSSSSSSSSSSSSSS
   125  125 A L  H  X S+     0   0    3 1676   46  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
   126  126 A D  H  X S+     0   0   21 1676   30  D  DDD    D     D  DD    D  D DD      D  D  DDDDD    D DDDDDDDDDDDDDDD
   127  127 A K  H  X S+     0   0   36 1676    0  K  KKK    K     K  KK    K  K KK      K  K  KKKKK    K KKKKKKKKKKKKKKK
   128  128 A F  H  X S+     0   0    2 1676   41  F  FFF    F     F  FF    F  F FF      F  F  FFFFF    F FFFFFFFFFFFFFFF
   129  129 A L  H  X S+     0   0    7 1676   33  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
   130  130 A A  H  X S+     0   0   39 1676   54  A  AAA    A     A  AA    A  A AA      A  A  AAAAA    A AAAAAAAAAAAAAAA
   131  131 A S  H  X S+     0   0   29 1676   65  S  SSS    S     S  SS    S  S SS      S  S  SSSSS    S SSSSSSSSSSSSSSS
   132  132 A V  H  X S+     0   0    9 1676   11  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVV
   133  133 A S  H  X S+     0   0   17 1675   49  S  SSS    S     S  SS    S  S SS      S  S  SSSSS    S SSSSSSSGSSSSSSS
   134  134 A T  H  X S+     0   0   88 1674   74  T  TTT    T     T  TT    T  T TT      T  T  TTTTT    T TTTTTTTTTTTTTTT
   135  135 A V  H  < S+     0   0   21 1675   55  V  VVV    V     V  VV    V  V VV      V  V  VVVVV    V VVVVVVVVVVVVVVV
   136  136 A L  H  < S+     0   0   19 1674    0  L  LLL    L     L  LL    L  L LL      L  L  LLLLL    L LLLLLLLLLLLLLLL
   137  137 A T  H >< S+     0   0   42 1674   54  T  TTT    T     T  TT    T  T TT      T  T  TTTTT    T TTTTTTTTTTTTTTT
   138  138 A S  T 3< S+     0   0   57 1669   77  S  SSS    S     S  SS    S  S SS      S  S  SSSSS    S SSSSSSSSSSSSSSS
   139  139 A K  T 3  S+     0   0   77 1669   12  K  KKK    K     K  KK    K  K KK      K  K  KKKKK    K KKKKKKKKKKKKKKK
   140  140 A Y    <         0   0   19 1666    0  Y  YYY    Y     Y  YY    Y  Y YY      Y  Y  YYYYY    Y YYYYYYYYYYYYYYY
   141  141 A R              0   0   75 1644   37  R  RRR    R     R  RR    R  R RR      R  R  RRRRR    R RRRRRRRRRRRRRRR
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41   G    GGGG  GGGG GG  GGGG GG G  GGGG G GG G      GGGG G               
   144    2 B H        -     0   0  151 1032   46   H    HHHH  HHHH HH  HHHH HH H  HHHH H HH H      HHHH H               
   145    3 B F        -     0   0   37 2258   27   F    FFFF  FFFF FF  FFFF FF F  FFFF F FF F      FFFF F               
   146    4 B T    >>  -     0   0   75 2258   47   T    TTTT  TTTT TT  TTTT TT T  TTTT T TT T      TTTT T               
   147    5 B E  H 3> S+     0   0  133 2262   54   E    EEEE  EEEE EE  EEEE EE E  EEEE E EE E      EEEE E               
   148    6 B E  H 3> S+     0   0  151 2265   64   E    EEEE  EEEE EE  EEEE EE E  EEEE E EE E      EEEE E               
   149    7 B D  H X> S+     0   0   26 2283   21   D    DDDD  DDDD DD  DDDD DD D  DDDDDD DD D      DDDD D               
   150    8 B K  H 3X S+     0   0   82 2285   24   K    KKKK  KKKK KK  KKKK KK K  KKKKKK KK K      KKKK K               
   151    9 B A  H 3X S+     0   0   51 2283   64   A    AAAA  AAAA AA  AAAA AA A  AAAAAA AA A      AAAA A               
   152   10 B T  H < S+     0   0    5 2293   58   L    LLLL  LLLL LL  LLLL LL L  LLLLLL LL L      LLLL L               
   157   15 B W  G >< S+     0   0   32 2299    7   W    WWWW  WWWW WW  WWWW WW W  WWWWWW WW W      WWWW W               
   158   16 B G  G 3  S+     0   0   69 2299   51   G    GGGG  GGGG GG  GGGG GG G  GGGGGG GG G      GGGG G               
   159   17 B K  G <  S+     0   0  109 2303   19   K    KKKK  KKKK KK  KKKK KK K  KKKKKK KK K      KKKK K               
   160   18 B V    <   -     0   0   19 2307   28   V    VVVV VVVVV VV  VVVV VV L  VVVVVV VV L      VVLV V               
   161   19 B N     >  -     0   0   97 2308   63   N    NNNN NNNNN NN  NNNN NN N  NNNNNN NN N      NNNN N               
   162   20 B V  H  > S+     0   0   26 2306   77   V    VVVV VVVVV VV  VVVV VV V  VVVVVV VV V      VVVV V               
   163   21 B E  H  > S+     0   0   84 2303   46   E    EEEE EEEEE EE  EEEE EE E  EEEEEE EE E      EEEE E               
   164   22 B D  H  4 S+     0   0   90 2307   47   D    DDDD DDDDD DD  DDDD DD D  DDDDDD DD D      DDDD D               
   165   23 B A  H  X S+     0   0   13 2309   68   A    AAAA AAAAA AA  AAAA AA A  AAAAAA AA A      AVAA A               
   166   24 B G  H  X S+     0   0    0 2309    5   G    GGGG GGGGG GG  GGGG GG G  GGGGGG GG G      GGGG G               
   167   25 B G  H  X S+     0   0    5 2309   51   G    GGGG GGGGG GG  GGGG GG G  GGGGGG GG G      GGGG G               
   168   26 B E  H  > S+     0   0   52 2309   25   E    EEEE EEEEE EE  EEEE EE E  EEEEEE EE E      EEEE E               
   169   27 B T  H  X S+     0   0    4 2307   28   T    TTTT TTTTT TT  TTTT TT T  TTTTTT TT T      TTTT T               
   170   28 B L  H  X S+     0   0    7 2310    2   L    LLLL LLLLL LL  LLLL LL L  LLLLLL LL L      LLLL L               
   171   29 B G  H  X S+     0   0    0 2310   62   G    GGGG GGGGG GG  GGGG GG G  GGGGGG GG G      GGGG G               
   172   30 B R  H  X S+     0   0    8 2309    2   R    RRRR RRRRR RR  RRRR RR R  RRRRRR RR R      RRRR R               
   173   31 B L  H  X S+     0   0   12 2309   37   L    LLLL LLLLL LL  LLLL LL L  LLLLLL LL L      LLLL L               
   174   32 B L  H  < S+     0   0    0 2309   14   L    LLLL LLLLL LL  LLLL LL L  LLLLLL LL L      LLLL L               
   175   33 B V  H  < S+     0   0   26 2310   56   VV   VVVV VVVVV VV  VVVV VV V  VVVVVV VV VV     VVLV V               
   176   34 B V  H  < S+     0   0    2 2312   61   VV   VVVV VVVVV VV  VVVV VV V  VVVVVV VV VV     VVVV V               
   177   35 B Y  S >< S-     0   0   26 2312   13   YY   YYYY YYYYY YY  YYYY YY Y  YYYYYY YY YY     YYYY Y               
   178   36 B P  T 3   +     0   0   29 2313    0   PP   PPPP PPPPP PP  PPPP PP P  PPPPPP PP PP     PPPP P               
   179   37 B W  T 3  S+     0   0   22 2313   94   WW   WWWW WWWWW WW  WWWW WW W  WWWWWW WW WW     WWWW W               
   180   38 B T  S X  S+     0   0    3 2313    3   TT   TTTT TTTTT TT  TTTT TT T  TTTTTT TT TP     TTTT T               
   181   39 B Q  G >  S+     0   0   40 2313   46   QQ   QQQQ QQQQQ QQ  QQQQ QQ Q  QQQQQQ QQ QQ     QQQQ Q               
   182   40 B R  G 3  S+     0   0   64 2316   69   RR   RRRR RRRRR RR  RRRR RR R  RRRRRR RR RR     RRRR R               
   183   41 B F  G <  S+     0   0   60 2316    8   FF   FFFF FFFFF FF  FFFF FF F  FFFFFF FF FF     FFFF F               
   184   42 B F    X   +     0   0   26 2316    0   FF   FFFF FFFFF FF  FFFF FF F  FFFFFF FF FF     FFFF F               
   185   43 B D  T 3  S+     0   0  125 2315   68   DD   DDDD DDDDD DD  DDDD DD D  DDDDDD DD DD     DDDD D               
   186   44 B S  T 3  S+     0   0  109 2316   73   SS   SSSS SSSSS SS  SSSS SS S  SSSSSS SS SS     SSSS S               
   187   45 B F  S <  S-     0   0   34 2315    6   FF   FFFF FFFFF FF  FFFF FF F  FFFFFF FF FF     FFFF F               
   188   46 B G        +     0   0   57 2304   43   GG   GGGG GGGGG GG  GGGG GG G  GGGGGG GG GG     GGGG G               
   189   47 B N        +     0   0  101 1087   32   NN   NNNN NNNNN NN  NNNN NN N  NNNNNN NN NN     NNNN N               
   190   48 B L        +     0   0   18 1086    4   LL   LLLL LLLLL LL  LLLL LL L  LLLLLL LL LL     LLLL L               
   191   49 B S        +     0   0   87 1087   39   SS   SSSS SSSSS SS  SSSS SS S  SSSSSS SS SS     SSSS S               
   192   50 B S  S >> S-     0   0   64 1089   48   SS   SSSS SSSSS SS  SSSS SS S  SSSSSS SS SS     SSSS S               
   193   51 B A  H 3> S+     0   0   28 1160   49   AA   AAAA AAAAA AA  AAAA AA A  AAAAAA AA AA     AAAA A               
   194   52 B S  H 3> S+     0   0  104 1382   69   SS   SSSS SSSSS SS  SSSS SS S  SSSSSS SS SS     SSSS S               
   195   53 B A  H <4 S+     0   0   24 2309   70   AA   AAAA AAAAA AA  AAAA AA A  AAAAAA AA AA     AAAA A               
   196   54 B I  H  < S+     0   0    2 2309   82   II   IIII IIIII II  IIII II I  IIIIII II II     IIII I               
   197   55 B M  H  < S+     0   0   39 2309   88   MM   MMMM MMMMM MM  MMMM MM M  MMMMMM MM MM     MMMM M               
   198   56 B G  S  < S+     0   0   41 2311   27   GG   GGGG GGGGG GG  GGGG GG G  GGGGGG GG GG     GGGG G               
   199   57 B N     >  -     0   0   13 2313   52   NN   NNNN NNNNN NN  NNNN NN N  NNNNNN NN NN     NNNN N               
   200   58 B P  H  > S+     0   0   95 2311   53   PP   PPPP PPPPP PP  PPPP PP P  PPPPPP PP PP     PPPP P               
   201   59 B K  H  > S+     0   0  126 2313   69   KK   KKKK KKKKK KK  KKKK KK K  KKKKKK KK KK     KKKK K               
   202   60 B V  H  > S+     0   0    1 2312   13   VV   VVVV VVVVV VV  VVVV VV V  VVVVVV VV VV     VVVV V               
   203   61 B K  H  X S+     0   0  112 2311   50   KK   KKKK KKKKK KK  KKKK KK K  KKKKKK KK KK     KKKK K               
   204   62 B A  H  X S+     0   0   53 2312   51   AA   AAAA AAAAA AA  AAAA AA A  AAAAAA AA AA     AAAA A               
   205   63 B H  H  X S+     0   0   62 2314    5   HH   HHHH HHHHH HH  HHHH HH H  HHHHHH HH HH     HHHH H               
   206   64 B G  H  X S+     0   0    0 2314    1   GG   GGGG GGGGG GG  GGGG GG G  GGGGGG GG GG     GGGG G               
   207   65 B K  H  X S+     0   0   94 2312   54   KK   KKKK KKKKK KK  KKKK KK K  KKKKKK KK KK     KKKK K               
   208   66 B K  H  X S+     0   0  156 2313   28   KK   KKKK KKKKK KK  KKKK KK K  KKKKKK KK KK     KKKK K               
   209   67 B V  H  X S+     0   0   40 2314    7   VV   VVVV VVVVV VV  VVVV VV V  VVVVVV VV VV     VVVV V               
   210   68 B L  H  X S+     0   0    5 2314   63   LL   LLLL LLLLL LL  LLLL LL L  LLLLLL LL LL     LLLL L               
   211   69 B T  H  X S+     0   0   52 2310   68   TT   TTTT TTTTT TT  TTTT TT T  TTTTTT TT TT     TTTT T               
   212   70 B S  H  < S+     0   0   44 2314   47   SS   SSSS SSSSS SS  SSSS SS S  SSSSSS SS SS     SSSS S               
   213   71 B L  H >X S+     0   0   17 2314   25   LL   LLLL LLLLL LL  LLLL LL L  LLLLLL LL LL     LLLL L               
   214   72 B G  H >X S+     0   0   10 2314   68   GG   GGGG GGGGG GG  GGGG GG G  GGGGGG GG GG     GGGG G               
   215   73 B D  H 3< S+     0   0   98 2312   70   DD   DDDD DDDDD DD  DDDD DD D  GDDDDD GD DD     GGDD D               
   216   74 B A  H X4 S+     0   0    0 2314   20   AA   AAAA AAAAA AA  AAAA AA A  AAAAAA AA AA     AAAA A               
   217   75 B I  H X< S+     0   0   14 2313   43   II   IIII IIITI II  IIII II I  IIIIIV II VI     IIVI I               
   218   76 B K  T 3< S+     0   0  162 2315   65   KK   KKKK KKKKK KK  KKKK KK K  KKKKKK KK KK     KKKK K               
   219   77 B H  T X   +     0   0   96 2315   51   HH   HHHH HHHHH HH  HHHN NN N  HNNNHN NN NH     NNNN N               
   220   78 B L  T <   +     0   0   17 2315   32   LL   LLLL LLLLL LL  LLLL LL L  LLLLLL LL LL     LLLL L               
   221   79 B D  T 3  S+     0   0  159 2315    5   DD   DDDD DDDDD DD  DDDD DD D  DDDDDD DD DD     DDDD D               
   222   80 B D    <>  +     0   0   85 2315   35   DD   DDDD DDYDD DD  DDDD DD D  DDDDDD DD DD     DDDD D               
   223   81 B L  H  > S+     0   0   17 2313   25   LL   LLLL LLLLL LL  LLLL LL L  LLLLLL LL LL     LLLL L               
   224   82 B K  H  > S+     0   0  143 2307   71   KK   KKKK KKKKK KK  KKKK KK K  KKKKKK KK KK     KKKK K               
   225   83 B G  H  4 S+     0   0   48 2312   51   GG   GGGG GGGGG GG  GGGG GG G  GGGGGG GG GG     GGGG G               
   226   84 B T  H  < S+     0   0   55 2313   57   TT   TTTT TTTTT TT  TTTT TT T  TTTTTT TT TT     TTTT T               
   227   85 B F  H  X S+     0   0    7 2314   23   FF   FFFF FFFFF FF  FFFF FF F  FFFFFF FF FF     FFFF F               
   228   86 B A  H  X S+     0   0   21 2315   60   AA   AAAA AAAAA AA  AAAA AA A  AAAAAA AA AA     AAAA A               
   229   87 B Q  H  > S+     0   0  150 2310   74   QQ   QQQQ QQQQQ QQ  QQQQ QQ Q  QQQQQQ QQ QQ     QQQQ Q               
   230   88 B L  H  > S+     0   0   57 2316    0   LL   LLLL LLLLL LL  LLLL LL L  LLLLLL LL LL     LLLL L               
   231   89 B S  H  X S+     0   0    0 2315    2   SS   SSSS SSSSS SS  SSSS SS S  SSSSSS SS SS     SSSS S               
   232   90 B E  H  X S+     0   0   81 2316   47   EE   EEEE EEEEE EE  EEEE EE E  EEEEEE EE EE     EEEE E               
   233   91 B L  H  X>S+     0   0   77 2316   21   LL   LLLL LLLLL LL  LLLL LL L  LLLLLL LL LL     LLLL L               
   234   92 B H  I  <>S+     0   0   33 2316    0   HH   HHHH HHHHH HH  HHHH HH H  HHHHHH HH HH     HHHH H               
   235   93 B C  I  X5S+     0   0   12 2316   54   CC   CCCC CCCCR CC  CCCC CC C  CCCCCC CC CC     CCCC C               
   236   94 B D  I  <5S+     0   0   66 2315   78   DD   DDDD DDDDD DD  DDDD DD D  DDDDDD DD DD     DDDD D               
   237   95 B K  I  <5S+     0   0  155 2316   36   KK   KKKK KKKKK KK  KKKK KK K  KKKKKK KK KK     KKKK K               
   238   96 B L  I  4   -     0   0    3 2315    2   DD   DDDD DDDDD DD  DDDD DD D  DDDDDD DD DD     DDDD D               
   242  100 B P  T >> S+     0   0   17 2316    1   PP   PPPP PPPPP PP  PPPP PP P  PPPPPP PP PP     PPPP P               
   243  101 B E  H 3> S+     0   0   31 2316   76   EE   EEEE EEEEE EE  EEEE EE E  EEEEEE EE EE     EEEE E               
   244  102 B N  H <> S+     0   0   13 2316    2   NN   NNNN NNNNN NN  NNNN NN N  NNNNNN NN NN     NNNN N               
   245  103 B F  H <> S+     0   0   22 2316    1   FF   FFFF FFFFF FF  FFFF FF F  FFFFFF FF FF     FFFF F               
   246  104 B K  H  X S+     0   0  120 2316   30   KK   KKKK KKKKK RR  KRKR RR R  RRRRKR RR RR     RRRR R               
   247  105 B L  H  X S+     0   0   17 2300   17   LL   LLLL LLLLL LL  LLLL LL L  LLLLLL LL LL     LLLL L               
   248  106 B L  H  X S+     0   0   38 2308    2   LL   LLLL LLLLL LL  LLLL LL L  LLLLLL LL LL     LLLL L               
   249  107 B G  H  X S+     0   0    6 2310   44   GG   GGGG GGGGG GG  GGGG GG G  GGGGGG GG GG     GGGG G               
   250  108 B N  H  X S+     0   0   34 2311   57   NN   NNNN NNNNN NN  NNNN NN N  NNNNNN NN NN     NNNN N               
   251  109 B V  H  X S+     0   0    1 2310   66   VV   VVVV VVVVV VV  VVVV VV V  VVVVVV VV VV     VVVV V               
   252  110 B L  H  X S+     0   0    9 2310   23   LL   LLLL LLLLL LL  LLLL LL L  LLLLLL LL LL     LLLL L               
   253  111 B V  H  X S+     0   0    0 2312   56   VV   VVVV VVVVV VV  VVVV VV V  VVVVVV VV VV     VVVV V               
   254  112 B T  H  X S+     0   0    1 2312   29   TT   TTTT TTTTT TT  TTTT TT T  TTTTTT TT TT     TTTT T               
   255  113 B V  H  X S+     0   0    6 2315   53   VV   VVVV VVVVV VV  VVVV VV V  VVVVVV VV VV     VVVV V               
   256  114 B L  H  X S+     0   0    4 2315   24   LL   LLLL LLLLL LL  LLLL LL L  LLLLLL LL LL     LLLL L               
   257  115 B A  H  X S+     0   0    0 2315   11   AA   AAAA AAAAA AA  AAAA AA A  AAAAAA AA AA     AAAA A               
   258  116 B I  H  < S+     0   0   27 2307   85   II   IIII IIIII II  IIII II I  IIIIII II II     IIII I               
   259  117 B H  H  < S+     0   0  114 2316   52   HH   HHHH HHHHH HH  HHHH HY H  HHHHHH HY HH     HHHR Y               
   260  118 B F  H >< S-     0   0   18 2316   62   FF   FFFF FFFFF FF  FFFF FF F  FFFFFF FF FF     FFFF F               
   261  119 B G  G >< S+     0   0   17 2314   55   GG   GGGG GSGGG GG  GGGG GG G  GGGGGG GG GG     GGGG G               
   262  120 B K  G 3  S+     0   0  193 2165   71   KK   KKKK KKKKK KK  KKKK KK K  KKKKKK KK KK     KKKK K               
   263  121 B E  G <  S+     0   0   93 2313   44   EE   EEEE EEEEE EE  EEEE EE E  EEEEEE EE EE     EEEE E               
   264  122 B F  S <  S-     0   0    0 2313    7   FF   FFFF FFFFF FF  FFFF FF F  FFFFFF FF FF     FFFF F               
   265  123 B T    >>  -     0   0   53 2311   23   TT   TTT  TTTTT TT  TTTT TT T  TTTTTT TT TT     TTTT T               
   266  124 B P  H 3> S+     0   0   23 2311   20   PP   PPP  PPPPP PP  PPPP PP P  PPPPPP PP PP     PPPP P               
   267  125 B E  H 3> S+     0   0  105 2307   52   EE   EEE  EEEEE EE  EEEE EE E  EEEEEE EE EE     EEEE E               
   268  126 B V  H <> S+     0   0   22 2310   50   VV   VVV  VVVVV VV  VVVV VV V  VVVVVV VV VV     VVVV V               
   269  127 B Q  H  X S+     0   0    0 2291   35   QQ   QQQ  QQQQQ QQ  QQQQ QQ Q  QQQQQQ QQ QQ     QQQQ Q               
   270  128 B A  H  X S+     0   0   15 2300   35   AA   AAA  AAAAA AA  AAAA AA A  AAAAAA AA AA     AAAA A               
   271  129 B S  H  X S+     0   0    1 2302   49   SS   SSS  SSSSS SS  SSSS SS S  SSSSSS SS SS     SSSS S               
   272  130 B W  H  X S+     0   0    1 2304   51   WW   WWW  WWWWW WW  WWWW WW W  WWWWWW WW WW     WWWW W               
   273  131 B Q  H  X S+     0   0    5 2306   39   QQ   QQQ  QQQQQ QQ  QQQQ QQ Q  QQQQQQ QQ QQ     QQQQ Q               
   274  132 B K  H  X S+     0   0  100 2304    1   KK   KKK  KKKKK KK  KKKK KK K  KKKKKK KK KK     KKKK K               
   275  133 B M  H  X S+     0   0    1 2301   33   MM   MMM  MMMMM MM  MMMM MM M  MMMMMM MM MM     MMMM M               
   276  134 B V  H  X S+     0   0    6 2303   34   VV   VVV  VVVVV VV  VVVV VV V  VVVVAV VV VV     VVVV V               
   277  135 B T  H  X S+     0   0   80 2301   65   TT   TTT  TTTTT TT  TTTT A  T  TAAAEA AA AT     AATA A               
   278  136 B G  H  X S+     0   0   23 2301   71   GG   GGG  GAGAG GA  AAAG G  G  AGGGDG GG GA     GGGG G               
   279  137 B V  H  X S+     0   0   17 2298   15   VV   VVV  VVVVV VV  VVVV V  V  VVVV V VV VV     VVVV V               
   280  138 B A  H  X S+     0   0    5 2297   60   AA   AAA  AAAAA AA  AAAA A  A  AAAA A AA AA     AAAA A               
   281  139 B S  H  X S+     0   0   67 2291   79   SS   SSS  SSSSS SS  SSSS S  S  SSSS S SS SS     SSSS S               
   282  140 B A  H  < S+     0   0    2 2289   52   AA   AAA  AAAAA AA  AAAA A  A  AAAA A AA AA     AAAA A               
   283  141 B L  H  < S+     0   0   19 2272    1   LL   LLL  LLLLL LL  LLLL L  L  LLLL L LL LL     LLLL L               
   284  142 B S  H >< S+     0   0   44 2267   58   SS   SSS  SSSSS SS  SSSS S  S  SSSS S SS SS     SSSS S               
   285  143 B S  T 3< S+     0   0   57 2265   80   SS   SSS  SSSSS SS  SSSS S  S  SSSS S SS SS     SSSS S               
   286  144 B R  T 3  S+     0   0  128 2255   28   RR   RRR  RRRRR RR  RRRR R  R  RRRR R RR RR     RRRR R               
   287  145 B Y    <         0   0   31 2246    0   YY   YYY  YYYYY YY  YYYY Y  Y  YYYY Y YY YY     YYYY Y               
   288  146 B H              0   0  136 2186   41   HH   HHH  HHHHH HH  HHHH H  H  HHHH H HH HH     HHHH H               
## ALIGNMENTS   71 -  140
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....8....:....9....:....0....:....1....:....2....:....3....:....4
     1    1 A V              0   0  136  867   26  VVVVVVVVVVVVVVV VVVVVVVVVVVVV       VVVV  VVVVVVVV      VVVVVVVVVVVVVV
     2    2 A L        -     0   0   22 1663    3  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
     3    3 A S     >  -     0   0   51 1663   48  SSSSSSSSSSSSSSS SSSSSSSSSSSSS       SSSS  SSSSSSSS      SSSSSSSSSSSSSS
     4    4 A P  H  > S+     0   0   84 1664   53  PPPPPPPPPPPPPPP SPPPPPPSPPPPP       PPPP  PPPAPAPP      PPPPPPPSPAPAAA
     5    5 A A  H  > S+     0   0   62 1663   62  AADADTTDDTAAAAD AAAEAAAAAAAAA       AAAA  AAAAAAAA      AAAAAADAAAAAAA
     6    6 A D  H  > S+     0   0    8 1667   20  DDDDDDDDDDDDDDD DDDDDDDDDDDDD       DDDD  DDDDDDDD      DDDDDDDDDDDDDD
     7    7 A K  H  X S+     0   0   46 1668    8  KKKKKKKKKKKKKKK KKKKKKKKKKKKK       KKKK  KKKKKKKK      KKKKKKKKKKKKKK
     8    8 A T  H  X S+     0   0   95 1666   59  KTKTKSSKKSTTTTK TTTATTTTTKNTT       TSTS  TTTTTGAT      NAAATASANGNSGG
     9    9 A N  H  X S+     0   0   43 1665   80  NNHNHINHHNNNNNH NNNNNNNNNNNNN       NNNN  NNNNNNNN      NNNNNNNNNNNNNN
    10   10 A V  H  X S+     0   0    2 1667   12  VVVVVVVVVVVIVVV IVVTVVVIVVVVV       VVIV  VVVVVVIV      VVVVIVVVVVVVVV
    11   11 A K  H  X S+     0   0   99 1668   70  KKKKKKKKKKKKKKK KKKKkKKKKKKKK       KKKK  kKKKKKKK      KKKKKKKKKKKKKK
    12   12 A A  H  X S+     0   0   67 1669   58  AAATAAAAAAAAAAD AAAAgAAAADAAA       AAAA  gAAATAAA      AAAAAAAASASAAA
    13   13 A A  H  < S+     0   0    5 1672   61  AAAAAAAAAAAASAA AAAVPAAASCCAA       AAAA  PAAAAATA      CAAAAAAAAAAAAA
    14   14 A W  H  X S+     0   0   22 1672    7  WWWWWWWWWWWWWWW WWWWWWWWWWWWW       WWWW  WWWWWWWW      WWWWWWWWWWWWWW
    15   15 A G  H  < S+     0   0   51 1672   52  DEGEGEEGGEEDEDG DEDEVDDDEEEEE       DDDD  VGGDNDDD      EGGGDGADNGKGGG
    16   16 A K  T  < S+     0   0  111 1673    8  KKKKKKKKKKKKKKK KKKKKKKKKKKKK       KKKK  KKKKAKKK      KKKKKKKKAKAKKK
    17   17 A V  T >4 S+     0   0    1 1676   26  VVVVVVVVVVIVIVV VVVVAVVVLIIVV       VVVV  AVVIVVIV      IVVVVVVVIVIVVV
    18   18 A G  T 3< S+     0   0   49 1676   66  GGGGGGGGGGGGGGG GGGGLGGGGGGGG       GGGG  LGGGGGGG      GGGGGGGGGGGGGG
    19   19 A A  T 3  S+     0   0   96 1676   70  GSEGEAAEEGGAGGE GGADPGGGGGGGG       GGAG  PAAGGGGG      GGSSAGGGSGSGGD
    20   20 A H  S <> S+     0   0   92 1674   65  HHHHHHHHHHHHHHH NHHHYHNNHHHHH       NNHN  YHHHQQHH      HHHHHHSNHHHHHH
    21   21 A A  H  > S+     0   0    6 1158   58  AAAAAAAAAAGAGAA AAATAAAAGGGGA       VAAA  AAAGAAAA      GGAAAAAVAAAAAA
    22   22 A G  H  > S+     0   0   19 1159   49  GGGGGGGGGGAGAGG GGGAGGGGAAAAG       GGGG  GGGGGGGG      AGGGGGGGGAGAAA
    23   23 A E  H  > S+     0   0  120 1676   42  EDEEEDDEEDADADQ EDDDDDEEAEAAD       EEDE  DDZEEEED      AEEEDEDEEEEDEE
    24   24 A Y  H  X S+     0   0   23 1676   70  YYYYYYYYYYYYYYY YYYYHYYYYYYYY       YYYY  HYYYHYYY      YLYYYYYYHYHYYY
    25   25 A G  H  X S+     0   0    4 1676    6  GGGGGGGGGGGGGGG GGGAIGGGGGGGG       GGGG  IGGGGGGG      GGGGGGGGGGGGGG
    26   26 A A  H  X S+     0   0   15 1676   45  AAAAAAAAAAAAAAA AAATAAAAAAAAA       AAAA  AAAAAAGA      AAAAAAAAAAAAAA
    27   27 A E  H  X S+     0   0   45 1676    7  EEEEEEEEEEEEEEE EEEEEEEEEEEEE       EEEE  EEEEEEEE      EEEEEEEEEEEEEE
    28   28 A A  H  X S+     0   0    0 1674   28  AAAAAAAAAAAAAAA AAAAAAAAAAAAA       AAAA  AAAAAAAA      AAAAAAAAAAAAAA
    29   29 A L  H  X S+     0   0    4 1677    2  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
    30   30 A E  H  X S+     0   0   36 1677   56  EEEEEEEEEEEEEEE EEEEEEEEEEEEE       EEEE  EEEEEEEE      EEEEEEEEEEEEEE
    31   31 A R  H  X S+     0   0    3 1678    1  RRRRRRRRRRRRRRR RRRRRRRRRRRRR       RRRR  RRRRRRRR      RRRRRRRRRRRRRR
    32   32 A M  H  X S+     0   0   11 1677   19  MMMMMMMMMMMMMMM MMMMMMMMMMMMM       MMMM  MMMMMMTM      MMMMMMMMMMMMMM
    33   33 A F  H  < S+     0   0   11 1667   15  FFFFFFFFFFFFFFF FFFFFFFFFFFFF       FFFF  FFFFFFFF      FFFFFFFFFFFFFF
    34   34 A L  H  < S+     0   0   58 1672   64  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLAL      LTLLLLLLLLLLLL
    35   35 A S  H  < S+     0   0   15 1674   70  SSSSSSSSSSSSSSS SSSSSSSSSSSSS       SSSS  SSSSSSSS      SSSSSSSSSSSSSS
    36   36 A F    ><  +     0   0   36 1674   14  FFFFFFFFFFFFFFF FFFFFFFFFFFFF       FFFF  FFFFFFFF      FFFFFFFFFFFFFF
    37   37 A P  G >  S+     0   0   44 1674    0  PPPPPPPPPPPPPPP PPPPPPPPPPPPP       PPPP  PPPPPPPP      PPPPPPPPPPPPPP
    38   38 A T  G >  S+     0   0   37 1674  100  TTTTTTTTTTTTTTT TTTTTTTTTTTTT       TTTT  TTTTTTTT      TTTTTTTTPTPTTT
    39   39 A T  G X  S+     0   0    3 1674    2  TTTTTTTTTTTTTTT TTTTTTTTTTTTT       TTTT  TTTTTTTT      TTTTTTTTTTTTTT
    40   40 A K  G X  S+     0   0   64 1674   41  KKKKKKKKKKKKKKK KKKKKKKKKKKKK       KKKK  KKKKKKKK      KKKKKKKKKKKKKK
    41   41 A T  G <  S+     0   0    7 1675   64  TTTTTTTTTTTTTTT TTTTTTTTTTTTT       TTTT  TTTTTTTT      TTTTTTTTTTTTTT
    42   42 A Y  G <  S+     0   0   16 1675    3  YYYYYYYYYYYYYYY YYYYYYYYYYYYY       YYYY  YYYYYYYY      YYYYYYYYYYYYYY
    43   43 A F    X   +     0   0   31 1676    0  FFFFFFFFFFFFFFF FFFFFFFFFFFFF       FFFF  FFFFFFFF      FFFFFFFFFFFFFF
    44   44 A P  T 3  S+     0   0   70 1676   66  PPPPPPPPPPPPPPP PPPPPPPPPPPPP       PPPP  PPPPPPPP      PPPPPPPPPPPPPP
    45   45 A H  T 3  S+     0   0  122 1676   59  HHHHHQHHHHHHHHH HHHHHHHHHHHHH       HHHH  HHHHHHHH      HHHHHHHHHHHHHH
    46   46 A F  S <  S-     0   0   44 1676    8  FFFFFFFFFFFFFFF FFFFFFFFFFFFF       FFFF  FFFFFFFF      FFFFFFFFFFFFFF
    47   47 A D        -     0   0   81 1676   46  NDNDDDDDDDDDDDD DDDDDDDDDDDDD       DDDD  DDDDDDDs      DDDDDDDDDDDDDD
    48   48 A L        +     0   0   55 1674   66  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLVLLLl      LVVVLVLLLLLLLL
    49   49 A S  S >  S-     0   0   58 1674   83  SSSSSSSSSSSSSSS SSSSSSASSSSSS       AASS  SSSSSASS      SSSSSTSSSSSSSS
    50   50 A H  T 3  S+     0   0  150 1674   86  HHHHHHHHHHHHHHH HHHHHHHHHHHHH       HHHH  HHHHHHHH      HHHHHHHHHHHHHH
    51   51 A G  T 3  S+     0   0   40 1676   21  GGGGGGGGGGGGGGG GGGGGGGGGGGGG       GGGG  GGGGGGGG      GGGGGGGGGGGGGG
    52   52 A S    X>  -     0   0   13 1677   46  SSSSSSSSSSSSSSS SSSSSSSSSSSSS       SSSS  SSSSSSSS      SSSSSSSSSSSSSS
    53   53 A A  H 3> S+     0   0   80 1675   50  DADADATDDAAAASD ASAAAAPAAAAAS       PAAA  AAAAGAAA      AAAAAAAAAAAAAA
    54   54 A Q  H 3> S+     0   0   86 1677   56  QQQQQQQQQQQQQQQ QQQQQQQQQQQQQ       QQQQ  QZZQQQQQ      QQQQQQQQQQQQQQ
    55   55 A V  H <> S+     0   0   12 1676   15  VVVVVVVVVVIVVVV VVVVVVVVLVVVV       VVVV  VVVVVVVV      VVVVVVVVIVIVVV
    56   56 A K  H  X S+     0   0  130 1677   25  KKKKNKKNNKQKQKK KKKKKKKKQQQQK       KKKK  KKKKKKKK      QKKKKKKKKKKKKK
    57   57 A G  H  X S+     0   0   37 1678   52  GAGAKGGKKAGGGGK GGGGGGGGGGGGG       GGGG  GGGAAGGA      GAAAGAGGTGTGGG
    58   58 A H  H  X S+     0   0   53 1678    7  HHHHHHHHHHHHHHH HHHHHHHHHHHHH       HHHH  HHHHHHHH      HHHHHHHHHHHHHH
    59   59 A G  H  X S+     0   0    0 1678    1  GGGGGGGGGGGGGGG GGGGGGGGGGGGG       GGGG  GGGGGGGG      GGGGGGGGGGGGGG
    60   60 A K  H  X S+     0   0  132 1677   49  KKKKKKKKKKKKKKK KKKKKKKKKKKKK       KKKK  KKKKKKKK      KKKKKKKKKAKAAA
    61   61 A K  H  X S+     0   0  166 1677   22  KKKKKKKKKKKKKKK KKKKKKKKKKKKK       KKKK  KKKKKKKK      KKKKKKKKKKKKKK
    62   62 A V  H  X S+     0   0   31 1677    6  VVVVVVVVVVVVVVV VVVVVVVVVVVVV       VVVV  VVVVVVVV      VVVVVVVVVVVVVV
    63   63 A A  H  X S+     0   0    1 1677   69  AAAAAAAAAAAGAAA GGGAAGGGAAAAG       GGGA  AAAAAAAG      AAAAGAGGAAAAAA
    64   64 A D  H  X S+     0   0   83 1677   63  DDDDDDDDDDDDDDD DDDKKDDDDDDDD       DDDD  KKKDDDDD      DDDDDDDEDADNAA
    65   65 A A  H  X S+     0   0   23 1678   36  AAAAAAAAAAAAAAA AAAAAAAAAAAAA       AAAA  AAAAAAAA      AAAAAAAAAAAAAA
    66   66 A L  H  X S+     0   0   15 1678   27  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
    67   67 A T  H  X S+     0   0   52 1678   69  TTTTTTTTTTAGATT TGGTTGTTAAAAG       TTGG  TTSATTTN      ATTTGTTTTTTTTT
    68   68 A N  H  X S+     0   0   60 1678   62  LNLTLNNLLNNNNTL NNNNNNNNNNNNN       NKNK  NBBNNNNN      NNQQNQNTNKNKKK
    69   69 A A  H  < S+     0   0    0 1678   26  AAAAAAAAAAAAAAA AAAAAAAAAAAAA       AAAA  AAAAAAAA      AAAAAVAAAAAAAA
    70   70 A V  H >< S+     0   0   10 1678   47  VVVVVVVVVVAVAVV VVVVVVVVAAAAV       VVVV  VVVAVVVV      AAVVVVVVVVVVVV
    71   71 A A  H 3< S+     0   0   71 1678   70  GSGSGLLGGSAAAGG GAAEAASGAAAGA       SGAG  EZZSSGAG      ANDDADGGNGNGGG
    72   72 A H  T >< S+     0   0   84 1678   50  HHHHHHHHHHHHHHH HHHHHHHHHHHHH       HSHS  HHHHHHHH      HHHHHHHHHHHHHH
    73   73 A V  T <  S+     0   0   14 1678   26  VVVVVVVVVVVMVIV LMMLVMILVVVLM       IIMI  LLLLLMLM      VLLLMLMMILILLL
    74   74 A D  T 3  S+     0   0  114 1678    3  DDDDDDDDDDDDDDD DDDDDDDDDDDDD       DDDD  DDDDDDDD      DDDDDDDDDDDDDD
    75   75 A D  S X> S+     0   0   85 1678   30  DDDDDDDDDDDDDND DDDDDDDDDDDDD       DDDD  DDDDDDDD      DDDDDDDDDDDDDD
    76   76 A M  H 3>  +     0   0   13 1678   19  MMMMMMMMMMLLLMM LLLMMLLLLLLLL       LLLL  MMMLMLLL      LLLLLLLLMLMLLL
    77   77 A P  H 34 S+     0   0   69 1672   78  PPPPPPPPPPPPPPP PPPPPPPPPPPPP       PAPA  PPPPPPPP      PPPPPPPPPPPPPP
    78   78 A N  H X4 S+     0   0   91 1678   38  QSHSQSSQQSSGGNQ GGGNNGGGGGSSG       GGGG  NNNNGGGT      GSGGGGGGGGGGGG
    79   79 A A  H 3< S+     0   0   34 1678   50  AAAAAAAAAAAAAAA AAAAAAAAAAAAA       AAAA  AAAAAAAA      AAAAAAAAAAAAAA
    80   80 A L  T 3X S+     0   0    5 1678   14  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
    81   81 A S  H <> S+     0   0   43 1678   57  SSSSSSSSSSSSSSS SSSSSSSSSSSSS       SSSS  SSSSSSSS      SSSSSSSSSSSSSS
    82   82 A A  H  > S+     0   0   77 1678   70  KAKAKAAKKAAAAAK AAAAAAAAAAAAA       AAAA  AAAAAAAA      TAAAAAAAAEAEEE
    83   83 A L  H  > S+     0   0   54 1678    0  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
    84   84 A S  H  X S+     0   0    3 1677    3  SSSSSSSSSSSSSSS SSSSSSSSSSSSS       SSSS  SSSSSSSS      SSSSSSSSSSSSSS
    85   85 A D  H  X S+     0   0   67 1678   28  DDDDDDDDDDDDDDD DDDDDDDDDDDDD       DDDD  DBBDDDDD      DDDDDDDDDDDDDD
    86   86 A L  H >X>S+     0   0   68 1678    8  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
    87   87 A H  I 3<>S+     0   0   41 1678    0  HHHHHHHHHHHHHHH HHHHHHHHHHHHH       HHHH  HHHHHHHH      HHHHHHHHHHHHHH
    88   88 A A  I 3<5S+     0   0    6 1678   45  AAAAAAAAAAAAAAA AAAAAAAAAAAAA       AAAA  AAAAAAAA      AAAAAAAAAAAAAA
    89   89 A H  I <<5S+     0   0  111 1678   83  HHHHHHHHHHHYHHH YYYHHYYYHHHHY       YHYH  HHHHHYYH      HHHHYQYYHHHHHH
    90   90 A K  I  <5S+     0   0  162 1678   37  KKKKKKKKKKKKKKK KKKKKKKKKKKKK       KKKK  KKKKKKKK      KKKKKKKKKKKKKK
    91   91 A L  I      -     0   0    3 1677    2  DDDDDDDDDDDDDDD DDDDDDDDDDDDD       DDDD  DBBDDDDD      DDDDDDDDDDDDDD
    95   95 A P  T >> S+     0   0   40 1677    0  PPPPPPPPPPPPPPP PPPPPPPPPPPPP       PPPP  PPPPPPPP      PPPPPPPPPPPPPP
    96   96 A V  H 3> S+     0   0   56 1677   76  VVVVVVVVVVVVVVV VVVVVVVVVVVVV       VVVV  VVVVVVVV      VVVVVVVVVVVVVV
    97   97 A N  H <> S+     0   0   10 1676    1  NNNNNNNNNNNNNNN NNNNNNNNNNNNN       NNNN  NBBNNNNN      NNNNNNNNNNNNNN
    98   98 A F  H <> S+     0   0   23 1678    0  FFFFFFFFFFFFFFF FFFFFFFFFFFFF       FFFF  FFFFFFFF      FFFFFFFFFFFFFF
    99   99 A K  H  X S+     0   0  129 1678   26  KKKKKKKKKKKKKKK KKKKKKKKKKKKK       KKKK  KKKKKKKK      KKKKKKKKKKKKKK
   100  100 A L  H  X S+     0   0   20 1675   16  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
   101  101 A L  H  X S+     0   0   40 1677    2  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
   102  102 A S  H  X S+     0   0   16 1677   44  SSSSSSRSSSSSSSS SSSSSSSSSSSSS       SSSS  SNNSSSSS      SSAASASSSSSSSS
   103  103 A H  H  X S+     0   0   16 1677   45  HHHHHHHHHHHHHHH HHHHHHHHHHHHH       HHHH  HHHHHHHH      HHHHHHHHHHHHHH
   104  104 A C  H  X S+     0   0    0 1676   70  CCCCCCCCCCCCCCC CCCCCCCCCCCCC       CCCC  CCCCCCCC      CCCCCCCCCSCSSS
   105  105 A L  H  X S+     0   0   11 1676   23  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
   106  106 A L  H  X S+     0   0    2 1677   44  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
   107  107 A V  H  X S+     0   0    0 1677   30  VVVVVVVVVVVVVVV VVVVVVVVVVVVV       VVVV  VVVVVVVV      VVVVVVVVVVVVVV
   108  108 A T  H  < S+     0   0    1 1677   51  TTTTTTTTTTTTTTT TTTTTTTTTTTTT       TTTT  TTTTTTTT      TTTTTTTTTTTTTT
   109  109 A L  H >X S+     0   0    4 1677   20  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
   110  110 A A  H 3< S+     0   0    0 1677   13  AAAAAAAAAAAAAAA AAAAAAAAAAAAA       AAAA  AAAAAAAA      AAAAAAAAAAAAAA
   111  111 A A  T 3< S+     0   0   10 1675   90  ACACACCAACACACA NSCAACNNAAAAS       SSSS  AAACSSCC      ANNNCNCSSSSSSS
   112  112 A H  T <4 S+     0   0   53 1678   39  HHHHHHHHHHHHHHH HHHHHHHHHHHHH       HHHH  HBBHHHHH      HHHHHHHHHHHHHH
   113  113 A L  S >X S-     0   0    3 1678   63  LHLHLLHLLHHLHHL LHHLLHLLLHHHH       LNHH  LFFHHHHH      HHHHHHHLHLHLLL
   114  114 A P  T 34 S+     0   0   90 1678   50  PPPPPPPPPPPPPPP PAPPPPPPPPPPA       PPPP  PPPPPPPP      PPPPPPPPPPPPPP
   115  115 A A  T 34 S+     0   0   80 1590   72  AAAAAAAAAAAGAAA SANAAGSSAAAAA       SSNA  ASSAAAAA      ANNNNNSSASANNN
   116  116 A E  T <4 S+     0   0   79 1678   38  EDEDEEEEEEEEEDE DDEEEDDDDEEED       DEEE  EZZEEEEE      EEEEEEDDEDEDDD
   117  117 A F     <  +     0   0    8 1678    7  FFFFFFFFFLFFFFF FFFFFFFFFFFFF       FFFF  FFFFFFFF      FFLLFFFFFFFFFF
   118  118 A T     >  -     0   0   62 1678   18  TTTTTTTTTTTTTTT TTTTTTTTTTTTT       TTTT  TTTTTTTT      TTTTTTTTTTTTTT
   119  119 A P  H  > S+     0   0   22 1678   12  PPPPPPPPPPPPPPP PPPPPPPPPPPPP       PPPP  PPPPPPPP      PPPPPPPPPPPPPP
   120  120 A A  H  > S+     0   0   35 1677   58  AAAAAAAAAAAAAAA AAAAAAAAAAAAA       AAAA  AAAAAAAA      AAAAAAAAAAAAAA
   121  121 A V  H  > S+     0   0   17 1677   38  VVVVVVVVVVVIVVV VVIVVVVVVVVVV       VVII  VVVVVIVV      VVVVIVVVVVVVVV
   122  122 A H  H  X S+     0   0    2 1676   32  HHHHHHHHHHHHHHH HHHHHHHHHHHHH       HHHH  HHHHHHHH      HHHHHHHHHHHHHH
   123  123 A A  H  X S+     0   0   16 1676   34  AAAAAAAAAAAAAAA AAAAAAAAAAAAA       AAAA  AAAAAAAA      AAAAAAAAAAAAAA
   124  124 A S  H  X S+     0   0    3 1676   45  SSSSSSSSSSSSSSS SSSSSSSSSSSSS       SSSS  SSSSSSSS      SSSSSSSSSSSSSS
   125  125 A L  H  X S+     0   0    3 1676   46  LLLLLLLLLFLLLLL LLLLLLLLLLLLL       LLLL  LVVLLLLL      LLLLLLLLLLLLLL
   126  126 A D  H  X S+     0   0   21 1676   30  DDDDDDDDDDDDDDD DDDDDDDDDDDDD       DDDD  DDDDDDDD      DDDDDDDDDDDDDD
   127  127 A K  H  X S+     0   0   36 1676    0  KKKKKKKKKKKKKKK KKKKKKKKKKKKK       KKKK  KKKKKKKK      KKKKKKKKKKKKKK
   128  128 A F  H  X S+     0   0    2 1676   41  FFFFFFFFFFFFFFF FFFFFFFFFFFFF       FFFF  FFFFFFFF      FFFFFFFFFFFFFF
   129  129 A L  H  X S+     0   0    7 1676   33  LLLLLMMLLMLLLVL LLMLLLLLLLLLL       LLML  LLLLFFLL      LLLLMLMLFLFLLL
   130  130 A A  H  X S+     0   0   39 1676   54  AAAAAAAAAAAAAAA AAAAAAAAAAAAA       AAAA  AAAAAASA      AAAAAAAAAAAAAA
   131  131 A S  H  X S+     0   0   29 1676   65  SSSSSSSSSSSSSSS SSSSSSSSSSSTS       SSSS  SSSTASSN      SNNNSNSSANASNN
   132  132 A V  H  X S+     0   0    9 1676   11  VVVVVVVVVVVVVVV VVVVVVVVVVVVV       VVVV  VVVVVVVV      VVVVVVVVVVVVVV
   133  133 A S  H  X S+     0   0   17 1675   49  SSSSSSSSSSSSSSS SSSSSSSSSSSSS       SSSS  SSSASSSS      SSSSSSSSSSSSSS
   134  134 A T  H  X S+     0   0   88 1674   74  TTTTTTTTTTTTTTT TTTTTTTTTTTTT       TTTT  TTTTTTTT      TTTTTTTTTTTTTT
   135  135 A V  H  < S+     0   0   21 1675   55  VVVVVVVVVVVVVVV VVVVVVVVVVVVV       VVVV  VVVVVVVV      VVVVVVVVVVVVVV
   136  136 A L  H  < S+     0   0   19 1674    0  LLLLLLLLLLLLLLL LLLLLLLLLLLLL       LLLL  LLLLLLLL      LLLLLLLLLLLLLL
   137  137 A T  H >< S+     0   0   42 1674   54  TTTTTTTTTTTVTTT TTVTTVTTTTTTT       TTVT  TTTTTTTV      TTTTVTTTTTTTTT
   138  138 A S  T 3< S+     0   0   57 1669   77  SSSSSSSSSSSSSSS SSSSSSSSSSSSS       SSSS  SSSSSSSS      SSSSSSSSSSSSSS
   139  139 A K  T 3  S+     0   0   77 1669   12  KKKKKKKKKKKKKKK KKKKKKKKKKKKK       KKKK  KKKKKKKK      KKKKKKKKKKKKKK
   140  140 A Y    <         0   0   19 1666    0  YYYYYYYYYYYYYYY YYYYYYYYYYYYY       YYYY  YYYYYYYY      YYYYYYYYYYYYYY
   141  141 A R              0   0   75 1644   37  RRRRRRRRRRRRRRR RRRRRRRRRRRRR       RRRR  RRRRRRRR      RRRRRRRRRRRRRR
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41                 S             SSSSSSS    SS        SSSSSS              
   144    2 B H        -     0   0  151 1032   46                 N             NNNNNNN    NN        NNNNNN              
   145    3 B F        -     0   0   37 2258   27                 F             FFFFFFF    FF        FFFFFF              
   146    4 B T    >>  -     0   0   75 2258   47                 T             TTTTTTT    TT        TTTTTT              
   147    5 B E  H 3> S+     0   0  133 2262   54                 A             AAAAAAA    AA        AAAAAA              
   148    6 B E  H 3> S+     0   0  151 2265   64                 E             EEEEEEE    EE        EEEEEE              
   149    7 B D  H X> S+     0   0   26 2283   21                 D             DDDDDDD    DD        DDDDDD              
   150    8 B K  H 3X S+     0   0   82 2285   24                 K             KKKKKKK    KK        KKKKKK              
   151    9 B A  H 3X S+     0   0   51 2283   64                 A             AAAAAAA    AA        AAAAAA              
   152   10 B T  H < S+     0   0    5 2293   58                 L             LLLLLLL    LL        LLLLLL              
   157   15 B W  G >< S+     0   0   32 2299    7                 W             WWWWWWW    WW        WWWWWW              
   158   16 B G  G 3  S+     0   0   69 2299   51                 G             AAGGGGA    AA        GAAGGA              
   159   17 B K  G <  S+     0   0  109 2303   19                 K             KKKKKKK    KK        KKKKKK              
   160   18 B V    <   -     0   0   19 2307   28                 V             VVVVVVV    VV        VVVVVV              
   161   19 B N     >  -     0   0   97 2308   63                 N             NNNNNNN    NN        NNNNNN              
   162   20 B V  H  > S+     0   0   26 2306   77                 V             VVVVVVV    VV        VVVVVV              
   163   21 B E  H  > S+     0   0   84 2303   46                 E             EEEEEEE    EE        EEEEEE              
   164   22 B D  H  4 S+     0   0   90 2307   47                 D             DDDDDDD    DD        DDDDDD              
   165   23 B A  H  X S+     0   0   13 2309   68                 A             AAAAAAA    AA        AAAAAA              
   166   24 B G  H  X S+     0   0    0 2309    5                 G             GGGGGGG    GG        GGGGGG              
   167   25 B G  H  X S+     0   0    5 2309   51                 G             GGGGGGG    GG        GGGGGG              
   168   26 B E  H  > S+     0   0   52 2309   25                 E             EEEEEEE    EE        EEEEEE              
   169   27 B T  H  X S+     0   0    4 2307   28                 T             TTTTTTT    TT        TTTTTT              
   170   28 B L  H  X S+     0   0    7 2310    2                 L             LLLLLLL    LL        LLLLLL              
   171   29 B G  H  X S+     0   0    0 2310   62                 G             GGGGGGG    GG        GGGGGG              
   172   30 B R  H  X S+     0   0    8 2309    2                 R             RRRRRRR    RR        RRRRRR              
   173   31 B L  H  X S+     0   0   12 2309   37                 L             LLLLLLL    LL        LLLLLL              
   174   32 B L  H  < S+     0   0    0 2309   14                 L             LLLLLLL    LL        LLLLLL              
   175   33 B V  H  < S+     0   0   26 2310   56                 V             VVVVVVV    VV        VVVVVV              
   176   34 B V  H  < S+     0   0    2 2312   61                 V             VVVVVVV    VV        VVVVVV              
   177   35 B Y  S >< S-     0   0   26 2312   13                 Y             YYYYYYY    YY        YYYYYY              
   178   36 B P  T 3   +     0   0   29 2313    0                 P             PPPPPPP    PP        PPPPPP              
   179   37 B W  T 3  S+     0   0   22 2313   94                 W             WWWWWWW    WW        WWWWWW              
   180   38 B T  S X  S+     0   0    3 2313    3                 T             TTTTTTT    TT        TTTTTT              
   181   39 B Q  G >  S+     0   0   40 2313   46                 Q             QQQQQQQ    QQ        QQQQQQ              
   182   40 B R  G 3  S+     0   0   64 2316   69                 R             RRRRRRR    RR        RRRRRR              
   183   41 B F  G <  S+     0   0   60 2316    8                 F             FFFFFFF    FF        FFFFFF              
   184   42 B F    X   +     0   0   26 2316    0                 F             FFFFFFF    FF        FFFFFF              
   185   43 B D  T 3  S+     0   0  125 2315   68                 D             DDDDDDD    DD        DDDDDD              
   186   44 B S  T 3  S+     0   0  109 2316   73                 S             SSSSSSS    SS        SSSSSS              
   187   45 B F  S <  S-     0   0   34 2315    6                 F             FFFFFFF    FF        FFFFFF              
   188   46 B G        +     0   0   57 2304   43                 G             GGGGGGG    GG        GGGGGG              
   189   47 B N        +     0   0  101 1087   32                 S             SSSSSSS    SS        SSSSSS              
   190   48 B L        +     0   0   18 1086    4                 L             LLLLLLL    LL        LLLLLL              
   191   49 B S        +     0   0   87 1087   39                 S             SSSSSSS    SS        SSSSSS              
   192   50 B S  S >> S-     0   0   64 1089   48                 S             SSSSSSS    SS        SSSSSS              
   193   51 B A  H 3> S+     0   0   28 1160   49                 P             PPPPPPP    PP        PPPPPP              
   194   52 B S  H 3> S+     0   0  104 1382   69                 S             SSSSSSS    SS        SSSSSS              
   195   53 B A  H <4 S+     0   0   24 2309   70                 A             AAAAAAA    AA        AAAAAA              
   196   54 B I  H  < S+     0   0    2 2309   82                 I             IIIIIII    II        IIIIII              
   197   55 B M  H  < S+     0   0   39 2309   88                 M             MMMMMMM    MM        MMMMMM              
   198   56 B G  S  < S+     0   0   41 2311   27                 G             GGGGGGG    GG        GGGGGG              
   199   57 B N     >  -     0   0   13 2313   52                 N             NNNNNNN    NN        NNNNNN              
   200   58 B P  H  > S+     0   0   95 2311   53                 P             PPPPPPP    PP        PPPPPP              
   201   59 B K  H  > S+     0   0  126 2313   69                 K             KKKKKKK    KK        KKKKKK              
   202   60 B V  H  > S+     0   0    1 2312   13                 V             VVVVVVV    VV        VVVVVV              
   203   61 B K  H  X S+     0   0  112 2311   50                 K             KKKKKKK    KK        KKKKKK              
   204   62 B A  H  X S+     0   0   53 2312   51                 A             AAAAAAA    AA        AAAAAA              
   205   63 B H  H  X S+     0   0   62 2314    5                 H             HHHHHHH    HH        HHHHHH              
   206   64 B G  H  X S+     0   0    0 2314    1                 G             GGGGGGG    GG        GGGGGG              
   207   65 B K  H  X S+     0   0   94 2312   54                 V             AAVVVVV    VV        VAAVVV              
   208   66 B K  H  X S+     0   0  156 2313   28                 K             KKKKKKK    KK        KKKKKK              
   209   67 B V  H  X S+     0   0   40 2314    7                 V             VVVVVVV    VV        VVVVVV              
   210   68 B L  H  X S+     0   0    5 2314   63                 L             LLLLLLL    LL        LLLLLL              
   211   69 B T  H  X S+     0   0   52 2310   68                 T             TTTTTTT    TT        TTTTTT              
   212   70 B S  H  < S+     0   0   44 2314   47                 S             SSSSSSS    SS        SSSSSS              
   213   71 B L  H >X S+     0   0   17 2314   25                 L             LLLLLLL    LL        LLLLLL              
   214   72 B G  H >X S+     0   0   10 2314   68                 G             GGGGGGG    GG        GGGGGG              
   215   73 B D  H 3< S+     0   0   98 2312   70                 E             EEEEEEE    EE        EEEEEE              
   216   74 B A  H X4 S+     0   0    0 2314   20                 A             AAAAAAA    AA        AAAAAA              
   217   75 B I  H X< S+     0   0   14 2313   43                 I             IIIIIII    II        IIIIII              
   218   76 B K  T 3< S+     0   0  162 2315   65                 K             KKKKKKK    KK        KKKKKK              
   219   77 B H  T X   +     0   0   96 2315   51                 N             NNNNNNN    NN        NNNNNN              
   220   78 B L  T <   +     0   0   17 2315   32                 L             LLLLLLL    LL        LLLLLL              
   221   79 B D  T 3  S+     0   0  159 2315    5                 D             DDDDDDD    DD        DDDDDD              
   222   80 B D    <>  +     0   0   85 2315   35                 D             DDDDDDD    DD        DDDDDD              
   223   81 B L  H  > S+     0   0   17 2313   25                 L             LLLLLLL    LL        LLLLLL              
   224   82 B K  H  > S+     0   0  143 2307   71                 K             KKKKKKK    KK        KKKKKK              
   225   83 B G  H  4 S+     0   0   48 2312   51                 G             GGGGGGG    GG        GGGGGG              
   226   84 B T  H  < S+     0   0   55 2313   57                 T             TTTTTTT    TT        TTTTTT              
   227   85 B F  H  X S+     0   0    7 2314   23                 F             FFFFFFF    FF        FFFFFF              
   228   86 B A  H  X S+     0   0   21 2315   60                 G             GGGGGGG    GG        DGGGGG              
   229   87 B Q  H  > S+     0   0  150 2310   74                 Q             QQQQQQQ    QQ        QQQSSQ              
   230   88 B L  H  > S+     0   0   57 2316    0                 L             LLLLLLL    LL        LLLLLL              
   231   89 B S  H  X S+     0   0    0 2315    2                 S             SSSSSSS    SS        SSSSSS              
   232   90 B E  H  X S+     0   0   81 2316   47                 E             EEEEEEE    EE        EEEEEE              
   233   91 B L  H  X>S+     0   0   77 2316   21                 L             LLLLLLL    LL        LLLLLL              
   234   92 B H  I  <>S+     0   0   33 2316    0                 H             HHHHHHH    HH        HHHHHH              
   235   93 B C  I  X5S+     0   0   12 2316   54                 C             CCCCCCC    CC        CCCCCC              
   236   94 B D  I  <5S+     0   0   66 2315   78                 D             DDDDDDD    DD        DDDDDD              
   237   95 B K  I  <5S+     0   0  155 2316   36                 K             KKKKKKK    KK        KKKKKK              
   238   96 B L  I  4   -     0   0    3 2315    2                 D             DDDDDDD    DD        DDDDDD              
   242  100 B P  T >> S+     0   0   17 2316    1                 P             PPPPPPP    PP        PPPPPP              
   243  101 B E  H 3> S+     0   0   31 2316   76                 E             EEEEEEE    EE        EEEEEE              
   244  102 B N  H <> S+     0   0   13 2316    2                 N             NNNNNNN    NN        NNNNNN              
   245  103 B F  H <> S+     0   0   22 2316    1                 F             FFFFFFF    FF        FFFFFF              
   246  104 B K  H  X S+     0   0  120 2316   30                 R             RRRRRRR    RR        RRRRRR              
   247  105 B L  H  X S+     0   0   17 2300   17                 L             LLLLLLL    LL        LLLLLL              
   248  106 B L  H  X S+     0   0   38 2308    2                 L             LLLLLLL    LL        LLLLLL              
   249  107 B G  H  X S+     0   0    6 2310   44                 G             GGGGGGG    GG        GGGGGG              
   250  108 B N  H  X S+     0   0   34 2311   57                 N             NNNNNNN    NN        NNNNNN              
   251  109 B V  H  X S+     0   0    1 2310   66                 V             VVVVVVV    VV        VVVVVV              
   252  110 B L  H  X S+     0   0    9 2310   23                 L             LLLLLLL    LL        LLLLLL              
   253  111 B V  H  X S+     0   0    0 2312   56                 V             VVVVVVV    VV        VVVVVV              
   254  112 B T  H  X S+     0   0    1 2312   29                 T             TTTTTTT    TT        TTTTTT              
   255  113 B V  H  X S+     0   0    6 2315   53                 V             VVVVVVV    VV        VVVVVV              
   256  114 B L  H  X S+     0   0    4 2315   24                 L             LLLLLLL    LL        LLLLLL              
   257  115 B A  H  X S+     0   0    0 2315   11                 A             AAAAAAA    AA        AAAAAA              
   258  116 B I  H  < S+     0   0   27 2307   85                 I             IIIIIII    II        IVVIII              
   259  117 B H  H  < S+     0   0  114 2316   52                 L             HHLLLLL    LL        LHHLLL              
   260  118 B F  H >< S-     0   0   18 2316   62                 H             HHHHHHY    YY        HHHHHY              
   261  119 B G  G >< S+     0   0   17 2314   55                 G             GGGGGGG    GG        GGGGGG              
   262  120 B K  G 3  S+     0   0  193 2165   71                 K             KKKKKKK    KK        KKKKKK              
   263  121 B E  G <  S+     0   0   93 2313   44                 E             EEEEEEE    EE        EEEEEE              
   264  122 B F  S <  S-     0   0    0 2313    7                 F             FFFFFFF    FF        FFFFFF              
   265  123 B T    >>  -     0   0   53 2311   23                 T             TTTTTTT    TT        TTTTTT              
   266  124 B P  H 3> S+     0   0   23 2311   20                 P             PPPPPPP    PP        PPPPPP              
   267  125 B E  H 3> S+     0   0  105 2307   52                 E             EEEEEEE    EE        EEEEEE              
   268  126 B V  H <> S+     0   0   22 2310   50                 V             VVVVVVV    VV        VVVVVV              
   269  127 B Q  H  X S+     0   0    0 2291   35                 Q             QQQQQQQ    QQ        QQQQQQ              
   270  128 B A  H  X S+     0   0   15 2300   35                 A             AAAAAAA    AA        AAAAAA              
   271  129 B S  H  X S+     0   0    1 2302   49                 S             SSSSSSS    SS        SSSSSS              
   272  130 B W  H  X S+     0   0    1 2304   51                 W             WWWWWWW    WW        RWWWWW              
   273  131 B Q  H  X S+     0   0    5 2306   39                 Q             QQQQQQQ    QQ        QQQQQQ              
   274  132 B K  H  X S+     0   0  100 2304    1                 K             KKKKKKK    KK        KKKKKK              
   275  133 B M  H  X S+     0   0    1 2301   33                 M             MMMMMMM    MM        MMMMMM              
   276  134 B V  H  X S+     0   0    6 2303   34                 V             VVVVVVV     V        VVVVVV              
   277  135 B T  H  X S+     0   0   80 2301   65                 A             AAAAAAA     A        AAAAAA              
   278  136 B G  H  X S+     0   0   23 2301   71                 G             GGGGGGG     G        GGGGGG              
   279  137 B V  H  X S+     0   0   17 2298   15                 V             VVVVVVV     V        VVVVVV              
   280  138 B A  H  X S+     0   0    5 2297   60                 A             AAAAAAA     A        AAAAAA              
   281  139 B S  H  X S+     0   0   67 2291   79                 S             SSSSSSS     S        SSSSSS              
   282  140 B A  H  < S+     0   0    2 2289   52                 A             AAAAAAA     A        AAAAAA              
   283  141 B L  H  < S+     0   0   19 2272    1                 L             LLLLLLL     L        LLLLLL              
   284  142 B S  H >< S+     0   0   44 2267   58                 A             GGAAAAA     A        GGGAAA              
   285  143 B S  T 3< S+     0   0   57 2265   80                 S             SSSSSSS     S        SSSSSS              
   286  144 B R  T 3  S+     0   0  128 2255   28                 R             RRRRRRR     R        RRRRRR              
   287  145 B Y    <         0   0   31 2246    0                 Y             YYYYYYY     Y        YYYYYY              
   288  146 B H              0   0  136 2186   41                 H             HHHHHHH     H        HHHHHH              
## ALIGNMENTS  141 -  210
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....5....:....6....:....7....:....8....:....9....:....0....:....1
     1    1 A V              0   0  136  867   26  VVVV    VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVVVVV  VVVVVVVVVV
     2    2 A L        -     0   0   22 1663    3  LLLL    LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLL  LLLLLLLLLL
     3    3 A S     >  -     0   0   51 1663   48  SSSS    SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSS  SSSSSSSSSS
     4    4 A P  H  > S+     0   0   84 1664   53  APAP    APAAAAAAP APAAAAPAAPAPAAPPAGPPAAPSPSSPAGPA PSPAAGG  AAGAAAAAAA
     5    5 A A  H  > S+     0   0   62 1663   62  AAAA    ESAAAEDEA AAAAAAEAAAATANAAKDAAADATATTTATAA ATAAAEE  DDENDEAAAD
     6    6 A D  H  > S+     0   0    8 1667   20  DDDD    DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDD  DDDDDDDDDD
     7    7 A K  H  X S+     0   0   46 1668    8  KKKK    KKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKK  KKKKKKKKKK
     8    8 A T  H  X S+     0   0   95 1666   59  GSTT    ASSSSAAAT SSTGSSNSTTSTTSTATSTTSATSTSSTSSTG ASTTSSS  AASAAASSSA
     9    9 A N  H  X S+     0   0   43 1665   80  NNNN    NNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNH NNNNNNN  NNNNNNNNNN
    10   10 A V  H  X S+     0   0    2 1667   12  VVVV    VVVVVVIVV VVIVVVVIVVVVVVVVILVVVVVVVVVVVILV VVVVVII  VIIIIVVVVI
    11   11 A K  H  X S+     0   0   99 1668   70  KKKK    KKKKKKKKK KKKKQKKQKKKKKKKKSKKKKKKKKKKKKKKK KKKKKKK  KKKKKKKKKK
    12   12 A A  H  X S+     0   0   67 1669   58  AAAS    AAAAAAAAA AAAAAAAAAAATAASAETSSAAAAAAATAAAAAAASAAAA  AAAAAAAAAA
    13   13 A A  H  < S+     0   0    5 1672   61  AAAT    AAAAAAAAT AAAAAAAAATAAAATAAATTAATATAAAAAAAAAATAAAA  AAAAAAAAAA
    14   14 A W  H  X S+     0   0   22 1672    7  WWWW    WWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW  WWWWWWWWWW
    15   15 A G  H  < S+     0   0   51 1672   52  GDSD    SDGGGSGSD GDDGGGSGGDGGSGDDGGDDGGDDDDDSGDHGDGDGSGGG  GGGDGSGGGG
    16   16 A K  T  < S+     0   0  111 1673    8  KKKK    KKKKKKKKKKKKKKKKKKKKKHKKKKKKKKKKKKKKKHKKKKKKKKKKKK  KKKKKKKKKK
    17   17 A V  T >4 S+     0   0    1 1676   26  VVVI    IVVVVIIIIVVIVVVVVVVIVVVVIVILIIVLIVIVVVVVLVIVVIVVII  IIIVIIVVVI
    18   18 A G  T 3< S+     0   0   49 1676   66  GGGG    GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GGGGGGGGGG
    19   19 A A  T 3  S+     0   0   96 1676   70  GGGG    GGGGGGGGGTGGSGGGGGGGGAGNGGGGGGGGGGGGGAGAGSAGGGGGGG  GGGGGGGGSG
    20   20 A H  S <> S+     0   0   92 1674   65  HSHH    HNNNNHHHHHNHHHHNQHNHNQHHHQHHHHNHHHHNNHNHHHNHHHHNHH  HHHQHHNNNH
    21   21 A A  H  > S+     0   0    6 1158   58  AAAA    GAAAAGGGAAAGAAAAAAAAAAAAAAAAAAAGAVAVVAAAGAAAVAAAGG  GGGAGGAAAG
    22   22 A G  H  > S+     0   0   19 1159   49  AGGG    AGGGGAAAGGGAGAAGGAGGGGGPGGGGGGGAGGGGGGGGGAGGGGGGAA  AAAGAAGGGA
    23   23 A E  H  > S+     0   0  120 1676   42  EDEE    EEAAAEEEEEAQDEDADDEEAEEEEDEEEEAEEEEEEEAEEETEEEEAEE  EEENEEAAAE
    24   24 A Y  H  X S+     0   0   23 1676   70  YYYY    YYYYYYYYYYYYYYYYYYFYYYFYYYYYYYYYYYYYYYYYYYYYYYFYYY  YYYYYYYYYY
    25   25 A G  H  X S+     0   0    4 1676    6  GGGG    GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GGGGGGGGGG
    26   26 A A  H  X S+     0   0   15 1676   45  AAAG    AAAAAAAAGGAAAAAAAAAGAAAAGAAAGGAAGAGAAAAAAAAAAGAAAA  AAAAAAATAA
    27   27 A E  H  X S+     0   0   45 1676    7  EEEE    EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE  EEEEEEEEEE
    28   28 A A  H  X S+     0   0    0 1674   28  AAAA    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AAAAAAAAAA
    29   29 A L  H  X S+     0   0    4 1677    2  LLLL    LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLLLLLL
    30   30 A E  H  X S+     0   0   36 1677   56  EEEE    EEEEEEEEEEETEEEEEEEEEEEEEEEEEEEGEEEEEEEEEEEEEEEEEE  EEEEEEEEEE
    31   31 A R  H  X S+     0   0    3 1678    1  RRRR    RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRSRRRR  RRRRRRRRRR
    32   32 A M  H  X S+     0   0   11 1677   19  MMMT    MMMMMMMMTMMMTMMMMMMTMMMMTMMMTTMMTMTMMMMTMMTMMrMMMM  MMMTMMMMMM
    33   33 A F  H  < S+     0   0   11 1667   15  FFFF    FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFfFFFF  FFFFFFFFFF
    34   34 A L  H  < S+     0   0   58 1672   64  LLLA    SLLLLSSSAELLALLLLLLALLLLVLFVAALCTLALLLLTALALLALLAA  CCAACSLLLC
    35   35 A S  H  < S+     0   0   15 1674   70  SSGS    SSSSSSSSSSSSSSSSSSGSSSGSSSVASSSSASSSSSSSTSSSSSGSSS  SSSSSSSSSS
    36   36 A F    ><  +     0   0   36 1674   14  FFFF    FFFFFFFFFFFFFFFFFFFFFFFFFFYYFFFFFFFFFFFFFFFFFFFFFF  FFFFFFFFFF
    37   37 A P  G >  S+     0   0   44 1674    0  PPPP    PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  PPPPPPPPPP
    38   38 A T  G >  S+     0   0   37 1674  100  TTTT    TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TTTTTTTTTT
    39   39 A T  G X  S+     0   0    3 1674    2  TTTT    TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TTTTTTTTTT
    40   40 A K  G X  S+     0   0   64 1674   41  KKKK    KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KKKKKKKKKK
    41   41 A T  G <  S+     0   0    7 1675   64  TTTT    TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TTTTTTTTTT
    42   42 A Y  G <  S+     0   0   16 1675    3  YYYY    YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY  YYYYYYYYYY
    43   43 A F    X   +     0   0   31 1676    0  FFFF    FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FFFFFFFFFF
    44   44 A P  T 3  S+     0   0   70 1676   66  PPPP    PPPPPPPPPPPHPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  PPPPPPPPPP
    45   45 A H  T 3  S+     0   0  122 1676   59  HHHH    HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHTHHHHHH  HHHHHHHHHH
    46   46 A F  S <  S-     0   0   44 1676    8  FFFF    FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFWFFFFFF  FFFFFFFFFF
    47   47 A D        -     0   0   81 1676   46  DDDD    DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DDDDDDDDDD
    48   48 A L        +     0   0   55 1674   66  LLLL    VLLLLVVVLLLLLLLLLLLLLLLLLLVVLLLVLLLLLLLLLLLVLLLLVV  VVVLVVLLLV
    49   49 A S  S >  S-     0   0   58 1674   83  SSSS    SSSSSSSSSKSSNSSSSSSSSSSSSSSSSSSSSASAASSSSSNSASSSSS  SSSSSSSSSS
    50   50 A H  T 3  S+     0   0  150 1674   86  HHHH    HHHHHHHHPHHPPQHHHHHPHHHHHHHHHHHHHHPHHHHHHHPHHHHHHH  PHHPHHHHHH
    51   51 A G  T 3  S+     0   0   40 1676   21  GGGG    GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GGGGGGGGGG
    52   52 A S    X>  -     0   0   13 1677   46  SSSS    SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SSSSSSSSSS
    53   53 A A  H 3> S+     0   0   80 1675   50  AAAA    AAAAAAAAAAAAAAAAAAAAAAASAAAAAAAAASASSAAAAAAASAAAAA  AAAAAAAAAA
    54   54 A Q  H 3> S+     0   0   86 1677   56  QQQQ    QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ  QQQQQQQQQQ
    55   55 A V  H <> S+     0   0   12 1676   15  VVVV    VIVVVVVVVVVIVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVVVVVVVV
    56   56 A K  H  X S+     0   0  130 1677   25  KKKK    KKKKKKKKKKKQKKKKKKKKKKKKKKKKKKKKKKKKKKKKQKKKKKKKKK  KKKKKKKKKK
    57   57 A G  H  X S+     0   0   37 1678   52  GGAA    GGGGGGGGAAGGGGGGGGAAGAAAAAGGAAGGAAAAAAGAGGGAAAAGGG  GGGGGGGGGG
    58   58 A H  H  X S+     0   0   53 1678    7  HHHH    HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HHHHHHHHHH
    59   59 A G  H  X S+     0   0    0 1678    1  GGGG    GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GGGGGGGGGG
    60   60 A K  H  X S+     0   0  132 1677   49  AKKK    AKEEEAAAKNEKKAAEKAKKEKKKKKKKKKEAKKKKKKEKEAKKKKQEKK  AAKKAAEEEA
    61   61 A K  H  X S+     0   0  166 1677   22  KKKK    KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KKKKKKKKKK
    62   62 A V  H  X S+     0   0   31 1677    6  VVVV    VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVVVVVVVV
    63   63 A A  H  X S+     0   0    1 1677   69  AGGA    AGAAAAAAAAAAAAAAGAGAAGGAAGAAAAAAAGAGGGAAAAAAGAGAAA  AAAAAAAAAA
    64   64 A D  H  X S+     0   0   83 1677   63  ADDD    DDAAADDDDDADDAAAENDDADDDDDDDDDADDDDDDDADDADDDDDADD  GDDDGDAAAG
    65   65 A A  H  X S+     0   0   23 1678   36  AAAA    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AAAAAAAAAA
    66   66 A L  H  X S+     0   0   15 1678   27  LLLL    LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLLLLLL
    67   67 A T  H  X S+     0   0   52 1678   69  TGTT    ATTTTAAATTTTTTTTTTTTTTTTTSTTTTTTTTTTTTTTLTTTTTTTAA  AAATAATTTA
    68   68 A N  H  X S+     0   0   60 1678   62  KNLN    TKKKKTTTTNKTNKKKTKLTKQLKNNNTNNKTTNNNNQKNHKKHNNLKNN  TTSKTTKKKT
    69   69 A A  H  < S+     0   0    0 1678   26  AAAA    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AAAAAAAAAA
    70   70 A V  H >< S+     0   0   10 1678   47  VVVV    AVVVVAAAVVVVVVVVVVVVVVVVVAVVVVVAVVVVVVVVVVVVVVVVAA  AAAVAAVVVA
    71   71 A A  H 3< S+     0   0   71 1678   70  EAGA    GGGGGGGGGAGGAEGGNGGGGGGGAGGGAAGGAGAGGGGGGDGEGAGGGG  SGGGSGGGGS
    72   72 A H  T >< S+     0   0   84 1678   50  HHHH    HSHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHNHSHHHHHHH  HHHSHHHHHH
    73   73 A V  T <  S+     0   0   14 1678   26  LLLV    LILLLLLLLLLLLLLLMLLLLLLLMLLLMMLLMIMIMLLLLLLLIMLLLL  LLLLLLLLLL
    74   74 A D  T 3  S+     0   0  114 1678    3  DDDD    DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DDDDDDEDDD
    75   75 A D  S X> S+     0   0   85 1678   30  DDDD    DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DDDDDDDDDD
    76   76 A M  H 3>  +     0   0   13 1678   19  LLLL    LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLLLLLL
    77   77 A P  H 34 S+     0   0   69 1672   78  PPPP    PAPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  PPPPPPPPPP
    78   78 A N  H X4 S+     0   0   91 1678   38  GGGG    GGGGGAAGGGGSGGGGGGGGGGGGGGGGGGGGGGAGGGGGGGGGGGGGGG  AAGGAAGGGG
    79   79 A A  H 3< S+     0   0   34 1678   50  AAAA    AATTTAAAAATAAAATAAAATAAAAAAAAATAAAAAAATAAAAAAAATAA  AAAAAATTTA
    80   80 A L  T 3X S+     0   0    5 1678   14  LLLL    LLLLLLLLLLLLMLLLLLLLLLLLLLLLMLLLLLLLLLLMLLLLLLLLLL  LLLLLLLLLL
    81   81 A S  H <> S+     0   0   43 1678   57  SSSS    SSSSSSSSSNSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SSSSSSSSSS
    82   82 A A  H  > S+     0   0   77 1678   70  EANA    AADDDAAAATDAAEEDTENADANDAAAAAADAAAAAAADAADATAANDAA  AAAAAADDDA
    83   83 A L  H  > S+     0   0   54 1678    0  LLLL    LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLFLLLLLL  LLLLLLLLLL
    84   84 A S  H  X S+     0   0    3 1677    3  SSSS    SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SSSSSSSSSS
    85   85 A D  H  X S+     0   0   67 1678   28  DDDD    DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DDDDDDDDDD
    86   86 A L  H >X>S+     0   0   68 1678    8  LLLL    LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLLLLLL
    87   87 A H  I 3<>S+     0   0   41 1678    0  HHHH    HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HHHHHHHHHH
    88   88 A A  I 3<5S+     0   0    6 1678   45  AAAA    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AAAAAAAAAA
    89   89 A H  I <<5S+     0   0  111 1678   83  HHHY    HHHHHHHHHHHHHHHHYHHHHYHHYYHHYYHHHYYYYYHHHHHHYYHHHH  HHHHHHHHHH
    90   90 A K  I  <5S+     0   0  162 1678   37  KKKK    KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KKKKKKKKKK
    91   91 A L  I      -     0   0    3 1677    2  DDDD    DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DDDDDDDDDD
    95   95 A P  T >> S+     0   0   40 1677    0  PPPP    PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  PPPPPPPPPP
    96   96 A V  H 3> S+     0   0   56 1677   76  VVVV    VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVVVVVVVV
    97   97 A N  H <> S+     0   0   10 1676    1  NNNN    NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  NNNNNNNNNN
    98   98 A F  H <> S+     0   0   23 1678    0  FFFF    FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FFFFFFFFFF
    99   99 A K  H  X S+     0   0  129 1678   26  KKKK    KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KKKKKKKKKK
   100  100 A L  H  X S+     0   0   20 1675   16  LLLL    LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLLLLLL
   101  101 A L  H  X S+     0   0   40 1677    2  LLLL    LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLLLLLL
   102  102 A S  H  X S+     0   0   16 1677   44  SSSS    SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSASSSSSS  SSSSSSSSSS
   103  103 A H  H  X S+     0   0   16 1677   45  HHHH    HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HHHHHHHHHH
   104  104 A C  H  X S+     0   0    0 1676   70  SCCC    CCSTTCCCCCTCSSSSCSCCSCCCCCCCCCTCCCCCCCSCCSCCCCCTCC  CCCCCCSSSC
   105  105 A L  H  X S+     0   0   11 1676   23  LLLL    LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLLLLLL
   106  106 A L  H  X S+     0   0    2 1677   44  LLLL    LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLLLLLL
   107  107 A V  H  X S+     0   0    0 1677   30  VVSV    VVVVVVVVVVVVVVVVVVSVVVSVVVVVVVVVVVVVVVVVVVVVVVSVVV  VVVVVVVVVV
   108  108 A T  H  < S+     0   0    1 1677   51  TTTT    TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TTTTTTTTTT
   109  109 A L  H >X S+     0   0    4 1677   20  LVLL    LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLLLLLL
   110  110 A A  H 3< S+     0   0    0 1677   13  AAAA    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AAAAAAAAAA
   111  111 A A  T 3< S+     0   0   10 1675   90  SCVC    ACCCCAAASSCACSSCCSVSCLVACSNNCCCACSCSNLCCASSNSCVCRS  AASSAACCCA
   112  112 A H  T <4 S+     0   0   53 1678   39  HHHH    HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HHHHHHHHHH
   113  113 A L  S >X S-     0   0    3 1678   63  LHLH    HNLLLHHHHHLHHLLLNLLHLHLHHHHLHHLHHLHLLNLHHLHHLHLLHH  HHHHHLLLHH
   114  114 A P  T 34 S+     0   0   90 1678   50  PPPP    PPPPPPPPPPPPPPPPPPPPPPPPPAPPPPPPPPPPPPPPPPPPPPPPPP  PPPPPPPPPP
   115  115 A A  T 34 S+     0   0   80 1590   72  SNNA    AGNNNAAAAANAASNNGNNANQNSAAAAAANAASASNQNNAGANTANNAA  AAASASNNSA
   116  116 A E  T <4 S+     0   0   79 1678   38  DDDE    EEDDDEEEEDDEDDDDEDDEDDDDEEDDEEDEDDEDDDDDEDEEDEDDDD  EDDEEDDDDE
   117  117 A F     <  +     0   0    8 1678    7  FFFF    FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FFFFFFFFFF
   118  118 A T     >  -     0   0   62 1678   18  TTTT    TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TTTTTTTTTT
   119  119 A P  H  > S+     0   0   22 1678   12  PPPP    PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  PPPPPPPPPP
   120  120 A A  H  > S+     0   0   35 1677   58  AAAA    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AAAAAAAAAA
   121  121 A V  H  > S+     0   0   17 1677   38  VVVV    VIVVVVVVVMVVVVVVVVVVVVVAVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVVVVVVVV
   122  122 A H  H  X S+     0   0    2 1676   32  HHHH    HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HHHHHHHHHH
   123  123 A A  H  X S+     0   0   16 1676   34  AAAA    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AAAAAAAAAA
   124  124 A S  H  X S+     0   0    3 1676   45  SSSS    SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SSSSSSSSSS
   125  125 A L  H  X S+     0   0    3 1676   46  LLLL    LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLLLLLL
   126  126 A D  H  X S+     0   0   21 1676   30  DDDD    DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DDDDDDDDDD
   127  127 A K  H  X S+     0   0   36 1676    0  KKKK    KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KKKKKKKKKK
   128  128 A F  H  X S+     0   0    2 1676   41  FFFF    FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FFFFFFFFFF
   129  129 A L  H  X S+     0   0    7 1676   33  LLLF    LLLLLLLLFLLLLLLLLLLFLLLLFLFLFFLLFLFLLLLLLLMLLFLLLL  LLLLLLLLLL
   130  130 A A  H  X S+     0   0   39 1676   54  AASS    AAAAAAAASAAAAAAAAASSASSASAAASSAASASAASAAAAAAASSAAA  AAAAAAAAAA
   131  131 A S  H  X S+     0   0   29 1676   65  NNSA    SSNNNSSSATSTTNSNSSTANNSNASSSAASSASTSSNNTTNSNSASNSS  SSSSSSNNNS
   132  132 A V  H  X S+     0   0    9 1676   11  VVVV    VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVVVVVVVV
   133  133 A S  H  X S+     0   0   17 1675   49  SSSS    SSSSSSSSSSGSSSSSSSSSSSSSSGSSSSGSSSSSSSSSSSSSSSSSSS  SSSSSSSSSS
   134  134 A T  H  X S+     0   0   88 1674   74  TTTT    TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TTTTTTTTTT
   135  135 A V  H  < S+     0   0   21 1675   55  VVVV    VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVVVVVVVV
   136  136 A L  H  < S+     0   0   19 1674    0  LLLL    LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLLLLLL
   137  137 A T  H >< S+     0   0   42 1674   54  TVTT    TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TTTTTTTTTT
   138  138 A S  T 3< S+     0   0   57 1669   77  SSSS    SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSS  SSSSSSSSSS
   139  139 A K  T 3  S+     0   0   77 1669   12  KKKK    KKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKK  KKKKKKKKKK
   140  140 A Y    <         0   0   19 1666    0  YYYY    YYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY YYYYYYY  YYYYYYYYYY
   141  141 A R              0   0   75 1644   37  RRRR    RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRR  RRRRRRRRRR
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41      SSSS                                                  SS          
   144    2 B H        -     0   0  151 1032   46      NNNN                                                  NN          
   145    3 B F        -     0   0   37 2258   27      FFFF                                                  FF          
   146    4 B T    >>  -     0   0   75 2258   47      TTTT                                                  TT          
   147    5 B E  H 3> S+     0   0  133 2262   54      AAAA                                                  AA          
   148    6 B E  H 3> S+     0   0  151 2265   64      EEEE                                                  EE          
   149    7 B D  H X> S+     0   0   26 2283   21      DDDD                                                  DD          
   150    8 B K  H 3X S+     0   0   82 2285   24      KKKK                                                  KK          
   151    9 B A  H 3X S+     0   0   51 2283   64      AAAA                                                  AA          
   152   10 B T  H < S+     0   0    5 2293   58      LLLL                                                  LL          
   157   15 B W  G >< S+     0   0   32 2299    7      WWWW                                                  WW          
   158   16 B G  G 3  S+     0   0   69 2299   51      GAAA                                                  GA          
   159   17 B K  G <  S+     0   0  109 2303   19      KKKK                                                  KK          
   160   18 B V    <   -     0   0   19 2307   28      VVVV                                                  VV          
   161   19 B N     >  -     0   0   97 2308   63      NNNN                                                  NN          
   162   20 B V  H  > S+     0   0   26 2306   77      VVVV                                                  VV          
   163   21 B E  H  > S+     0   0   84 2303   46      EEEE                                                  EE          
   164   22 B D  H  4 S+     0   0   90 2307   47      DDDD                                                  DD          
   165   23 B A  H  X S+     0   0   13 2309   68      AAAA                                                  AA          
   166   24 B G  H  X S+     0   0    0 2309    5      GGGG                                                  GG          
   167   25 B G  H  X S+     0   0    5 2309   51      GGGG                                                  GG          
   168   26 B E  H  > S+     0   0   52 2309   25      EEEE                                                  EE          
   169   27 B T  H  X S+     0   0    4 2307   28      TTTT                                                  TT          
   170   28 B L  H  X S+     0   0    7 2310    2      LLLL                                                  LL          
   171   29 B G  H  X S+     0   0    0 2310   62      GGGG                                                  GG          
   172   30 B R  H  X S+     0   0    8 2309    2      RRRR                                                  RR          
   173   31 B L  H  X S+     0   0   12 2309   37      LLLL                                                  LL          
   174   32 B L  H  < S+     0   0    0 2309   14      LLLL                                                  LL          
   175   33 B V  H  < S+     0   0   26 2310   56      VVVV                                                  VV          
   176   34 B V  H  < S+     0   0    2 2312   61      VVVV                                                  VV          
   177   35 B Y  S >< S-     0   0   26 2312   13      YYYY                                                  YY          
   178   36 B P  T 3   +     0   0   29 2313    0      PPPP                                                  PP          
   179   37 B W  T 3  S+     0   0   22 2313   94      WWWW                                                  WW          
   180   38 B T  S X  S+     0   0    3 2313    3      TTTT                                                  TT          
   181   39 B Q  G >  S+     0   0   40 2313   46      QQQQ                                                  QQ          
   182   40 B R  G 3  S+     0   0   64 2316   69      RRRR                                                  RR          
   183   41 B F  G <  S+     0   0   60 2316    8      FFFF                                                  FF          
   184   42 B F    X   +     0   0   26 2316    0      FFFF                                                  FF          
   185   43 B D  T 3  S+     0   0  125 2315   68      DDDD                                                  DD          
   186   44 B S  T 3  S+     0   0  109 2316   73      SSSS                                                  SS          
   187   45 B F  S <  S-     0   0   34 2315    6      FFFF                                                  FF          
   188   46 B G        +     0   0   57 2304   43      GGGG                                                  GG          
   189   47 B N        +     0   0  101 1087   32      SSSS                                                  SS          
   190   48 B L        +     0   0   18 1086    4      LLLL                                                  LL          
   191   49 B S        +     0   0   87 1087   39      SSSS                                                  CS          
   192   50 B S  S >> S-     0   0   64 1089   48      SSSS                                                  SS          
   193   51 B A  H 3> S+     0   0   28 1160   49      PPPP                                                  PP          
   194   52 B S  H 3> S+     0   0  104 1382   69      SSSS                                                  SS          
   195   53 B A  H <4 S+     0   0   24 2309   70      AAAA                                                  AA          
   196   54 B I  H  < S+     0   0    2 2309   82      IIII                                                  II          
   197   55 B M  H  < S+     0   0   39 2309   88      MMMM                                                  MM          
   198   56 B G  S  < S+     0   0   41 2311   27      GGGG                                                  GG          
   199   57 B N     >  -     0   0   13 2313   52      NNNN                                                  NN          
   200   58 B P  H  > S+     0   0   95 2311   53      PPPP                                                  PP          
   201   59 B K  H  > S+     0   0  126 2313   69      KKKK                                                  KK          
   202   60 B V  H  > S+     0   0    1 2312   13      VVVV                                                  VV          
   203   61 B K  H  X S+     0   0  112 2311   50      KKKK                                                  KK          
   204   62 B A  H  X S+     0   0   53 2312   51      AAAA                                                  AA          
   205   63 B H  H  X S+     0   0   62 2314    5      HHHH                                                  HH          
   206   64 B G  H  X S+     0   0    0 2314    1      GGGG                                                  GG          
   207   65 B K  H  X S+     0   0   94 2312   54      VAVV                                                  VV          
   208   66 B K  H  X S+     0   0  156 2313   28      KKKK                                                  KK          
   209   67 B V  H  X S+     0   0   40 2314    7      VVVV                                                  VV          
   210   68 B L  H  X S+     0   0    5 2314   63      LLLL                                                  LL          
   211   69 B T  H  X S+     0   0   52 2310   68      TTTT                                                  TT          
   212   70 B S  H  < S+     0   0   44 2314   47      SSSS                                                  SS          
   213   71 B L  H >X S+     0   0   17 2314   25      LLLL                                                  LL          
   214   72 B G  H >X S+     0   0   10 2314   68      GGGG                                                  GG          
   215   73 B D  H 3< S+     0   0   98 2312   70      EEEE                                                  EE          
   216   74 B A  H X4 S+     0   0    0 2314   20      AAAA                                                  AA          
   217   75 B I  H X< S+     0   0   14 2313   43      IIII                                                  II          
   218   76 B K  T 3< S+     0   0  162 2315   65      KKKK                                                  KK          
   219   77 B H  T X   +     0   0   96 2315   51      NNNN                                                  NN          
   220   78 B L  T <   +     0   0   17 2315   32      LLLL                                                  LL          
   221   79 B D  T 3  S+     0   0  159 2315    5      DDDD                                                  DD          
   222   80 B D    <>  +     0   0   85 2315   35      DDDD                                                  DD          
   223   81 B L  H  > S+     0   0   17 2313   25      LLLL                                                  LL          
   224   82 B K  H  > S+     0   0  143 2307   71      KKKK                                                  KK          
   225   83 B G  H  4 S+     0   0   48 2312   51      GGGG                                                  GG          
   226   84 B T  H  < S+     0   0   55 2313   57      TTTT                                                  TT          
   227   85 B F  H  X S+     0   0    7 2314   23      FFFF                                                  FF          
   228   86 B A  H  X S+     0   0   21 2315   60      GGGG                                                  GG          
   229   87 B Q  H  > S+     0   0  150 2310   74      SQQQ                                                  QQ          
   230   88 B L  H  > S+     0   0   57 2316    0      LLLL                                                  LL          
   231   89 B S  H  X S+     0   0    0 2315    2      SSSS                                                  SS          
   232   90 B E  H  X S+     0   0   81 2316   47      EEEE                                                  EE          
   233   91 B L  H  X>S+     0   0   77 2316   21      LLLL                                                  LL          
   234   92 B H  I  <>S+     0   0   33 2316    0      HHHH                                                  HH          
   235   93 B C  I  X5S+     0   0   12 2316   54      CCCC                                                  CC          
   236   94 B D  I  <5S+     0   0   66 2315   78      DDDD                                                  DD          
   237   95 B K  I  <5S+     0   0  155 2316   36      KKKK                                                  KK          
   238   96 B L  I  4   -     0   0    3 2315    2      DDDD                                                  DD          
   242  100 B P  T >> S+     0   0   17 2316    1      PPPP                                                  PP          
   243  101 B E  H 3> S+     0   0   31 2316   76      EEEE                                                  EE          
   244  102 B N  H <> S+     0   0   13 2316    2      NNNN                                                  DN          
   245  103 B F  H <> S+     0   0   22 2316    1      FFFF                                                  FF          
   246  104 B K  H  X S+     0   0  120 2316   30      RRRR                                                  RR          
   247  105 B L  H  X S+     0   0   17 2300   17      LLLL                                                  LL          
   248  106 B L  H  X S+     0   0   38 2308    2      PLLL                                                  LL          
   249  107 B G  H  X S+     0   0    6 2310   44      GGGG                                                  GG          
   250  108 B N  H  X S+     0   0   34 2311   57      NNNN                                                  NN          
   251  109 B V  H  X S+     0   0    1 2310   66      VVVV                                                  VV          
   252  110 B L  H  X S+     0   0    9 2310   23      LLLL                                                  LL          
   253  111 B V  H  X S+     0   0    0 2312   56      VVVV                                                  VV          
   254  112 B T  H  X S+     0   0    1 2312   29      TTTT                                                  TT          
   255  113 B V  H  X S+     0   0    6 2315   53      VVVV                                                  VV          
   256  114 B L  H  X S+     0   0    4 2315   24      LLLL                                                  LL          
   257  115 B A  H  X S+     0   0    0 2315   11      AAAA                                                  AA          
   258  116 B I  H  < S+     0   0   27 2307   85      IVVV                                                  IV          
   259  117 B H  H  < S+     0   0  114 2316   52      LLLL                                                  LL          
   260  118 B F  H >< S-     0   0   18 2316   62      HHHH                                                  HH          
   261  119 B G  G >< S+     0   0   17 2314   55      GGGG                                                  GG          
   262  120 B K  G 3  S+     0   0  193 2165   71      KKKK                                                  KK          
   263  121 B E  G <  S+     0   0   93 2313   44      EEEE                                                  EE          
   264  122 B F  S <  S-     0   0    0 2313    7      FFFF                                                  FF          
   265  123 B T    >>  -     0   0   53 2311   23      TTTT                                                  TT          
   266  124 B P  H 3> S+     0   0   23 2311   20      PPPP                                                  PP          
   267  125 B E  H 3> S+     0   0  105 2307   52      EEEQ                                                  EQ          
   268  126 B V  H <> S+     0   0   22 2310   50      VVVV                                                  VM          
   269  127 B Q  H  X S+     0   0    0 2291   35      QQQQ                                                  QQ          
   270  128 B A  H  X S+     0   0   15 2300   35      AAAA                                                  AA          
   271  129 B S  H  X S+     0   0    1 2302   49      SSSS                                                  SS          
   272  130 B W  H  X S+     0   0    1 2304   51      WWWW                                                  RW          
   273  131 B Q  H  X S+     0   0    5 2306   39      QQQQ                                                  QQ          
   274  132 B K  H  X S+     0   0  100 2304    1      KKKK                                                  KK          
   275  133 B M  H  X S+     0   0    1 2301   33      MMMM                                                  MM          
   276  134 B V  H  X S+     0   0    6 2303   34      VVVV                                                  VV          
   277  135 B T  H  X S+     0   0   80 2301   65      AAAA                                                  AA          
   278  136 B G  H  X S+     0   0   23 2301   71      GGGG                                                  GG          
   279  137 B V  H  X S+     0   0   17 2298   15      VVVV                                                  SV          
   280  138 B A  H  X S+     0   0    5 2297   60      AAAA                                                  AA          
   281  139 B S  H  X S+     0   0   67 2291   79      SSSS                                                   S          
   282  140 B A  H  < S+     0   0    2 2289   52      AAAA                                                   A          
   283  141 B L  H  < S+     0   0   19 2272    1      LLLL                                                   L          
   284  142 B S  H >< S+     0   0   44 2267   58      AGGG                                                   G          
   285  143 B S  T 3< S+     0   0   57 2265   80      SSSS                                                   S          
   286  144 B R  T 3  S+     0   0  128 2255   28      RRRR                                                   R          
   287  145 B Y    <         0   0   31 2246    0      YYYY                                                   Y          
   288  146 B H              0   0  136 2186   41      HHHH                                                   H          
## ALIGNMENTS  211 -  280
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....2....:....3....:....4....:....5....:....6....:....7....:....8
     1    1 A V              0   0  136  867   26  VV  VVVVVVVVVVVV  VVVVVVVVVVVVVVVVVVVVVVV  VVVVVVVVVVVVVVVVVVVV VVVVVV
     2    2 A L        -     0   0   22 1663    3  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLL LLLLLL
     3    3 A S     >  -     0   0   51 1663   48  SS  SSSSSSSSSSSS  SSSSSSSSSSSSSSSSSSSSSSST SSSSSSSSSSSSSSSSSSSS SSSSSS
     4    4 A P  H  > S+     0   0   84 1664   53  AA  PPAAAPAAGPSP  AAGGAAAAAAAAAAAAAAAAAAAK PPPAPASAAAAPPPAPAAAA GAAAAA
     5    5 A A  H  > S+     0   0   62 1663   62  DD  AAAAAAAAEAAT  AAEEDDDEDDDDGAAEEDEDEEDT AAATADATAAAASAAAANAN EDDDDD
     6    6 A D  H  > S+     0   0    8 1667   20  DD  DDDDDDDDDDDD  DDDDDDDDDDDDDDDDDDDDDDDE DDDDDDDDDDDDDDDDDDDD DDDDDD
     7    7 A K  H  X S+     0   0   46 1668    8  KK  KKKKKKKKKKKK  KKKKKKKKKKKKKKKKKKKKKKKR KKKKKKKKKKKKKKKKKKKK KKKKKK
     8    8 A T  H  X S+     0   0   95 1666   59  AA  TTSTSTTTSTAT  SSSSAAAAAAAAASSAAAAAAAAT TTTSTSTSTSSTATNASATA SAAAAA
     9    9 A N  H  X S+     0   0   43 1665   80  NN  NNNNNNNNNNNN  NNNNNNNNNNNNNNNNNNNNNNNI NNNNNNNNNNNNNNNNNNNN NNNNNN
    10   10 A V  H  X S+     0   0    2 1667   12  II  IVVVVVVVIVIV  VVIIIIIVIVIIIVVVVIVIIVII VIIIIVIVVVVVVVVIVVVI IIIIII
    11   11 A K  H  X S+     0   0   99 1668   70  KK  KKKKQKKKKKKK  KKKKKKKKKKKKKKKKKKKKKKKV kKKKKKKKKKKKKKKKKKKK KKKKKK
    12   12 A A  H  X S+     0   0   67 1669   58  AA  TTAAASAAATAA  AAAAAAAAAAAAAAATAAAAAAAS gTTATATAAAASAAGAAASA AAAAAA
    13   13 A A  H  < S+     0   0    5 1672   61  AA  ATAAATAAATTA  AAAAAAAAAAAAAAAAAAAAAAAM PAAFTAAAACCTTAATAAAA AAAAAA
    14   14 A W  H  X S+     0   0   22 1672    7  WW  WWWWWWWWWWWW  WWWWWWWWWWWWWWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWW WWWWWW
    15   15 A G  H  < S+     0   0   51 1672   52  GG  EDGSGDSSGDDS  GDGGGGGGGGGGGGGSGGSGGGGA VEEGDGGGSGGDDAEDGDDD GGGGGG
    16   16 A K  T  < S+     0   0  111 1673    8  KK  KKKKKKKKKKKK  KKKKKKKKKKKKKKKKKKTKKKKK KKKKKKAKKKKKKKKKKKKK KKKKKK
    17   17 A V  T >4 S+     0   0    1 1676   26  II  ILVVVLVVILIV  VVIIIIIIIIIIIVVIIIIIIIII AIIILVIVVIIIIVVIVVLI IIIIII
    18   18 A G  T 3< S+     0   0   49 1676   66  GG  GGGGGGGGGGGG  GGGGGGGGGGGGGGGGGGGGGGGS LGGGGGGGGGGGGGGGGGGG GGGGGG
    19   19 A A  T 3  S+     0   0   96 1676   70  GG  SGSGGGGGGGGS  GGGGGGGGGGGGGSSGGGGGGGGT PSSDGGSGGSSGGNTGGGGA GGGGGG
    20   20 A H  S <> S+     0   0   92 1674   65  HH  HHNNHHNNHHHH  NNDHHHHHHHHHHNNHHHHHHHHQ YHHHHNHNNHHHHHHHNQHN HHHHHH
    21   21 A A  H  > S+     0   0    6 1158   58  GG  GAAAAAAAGAGA  AAGGGGGGGGGGGAAGGGGGGGGA AGGAAAAAAAAAAAAAAAGA GGGGGG
    22   22 A G  H  > S+     0   0   19 1159   49  AA  GGGGAGGGAGGG  GGAAAAAAAAAAAGGAAAAAAAAD GGGGGGAPGGGGGAGGPAAG AAAAAA
    23   23 A E  H  > S+     0   0  120 1676   42  EE  EEAEDEEEEEEE  AAEEEEEEEEEEEAADEEEEEEET DEEEEEDADEDEEDEEANET EEEEEE
    24   24 A Y  H  X S+     0   0   23 1676   70  YY  YYYFYYFFYYYY  YYYYYYYYYYYYYYYYYYYYYYYI HYYYYFHYFYYYYFYYYYYY YYYYYY
    25   25 A G  H  X S+     0   0    4 1676    6  GG  GGGGGGGGGGGG  GGGGGGGGGGGGGGGGGGGGGGGG IGGGGGGGGGGGGGGGGGGG VGGGGG
    26   26 A A  H  X S+     0   0   15 1676   45  AA  AGAAAGAAAGAA  AAAAAAAAAAAAAATAAAAAAAAT AAAAGAAAAATGGAAGAAAA AAAAAA
    27   27 A E  H  X S+     0   0   45 1676    7  EE  EEEEEEEEEEEE  EEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEE EEEEEE
    28   28 A A  H  X S+     0   0    0 1674   28  AA  AAAAAAAAAAAA  AAAAAAAAAAAAAAAAAAAAAAAT AAAAAAAAAAAAAAAAAAAA AAAAAA
    29   29 A L  H  X S+     0   0    4 1677    2  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLL LLLLLL
    30   30 A E  H  X S+     0   0   36 1677   56  EE  EEEEEEEEEEEE  EEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEGE EEEEEE
    31   31 A R  H  X S+     0   0    3 1678    1  RR  RRRRRRRRRRRR  RRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRR RRRRRR
    32   32 A M  H  X S+     0   0   11 1677   19  MM  MTMMMTMMMTTM  MMMMMMMMMMMMMMMMMMMMMMMM MMMTTMMMMTTTTMMTMTMT MMMMMM
    33   33 A F  H  < S+     0   0   11 1667   15  FF  FFFFFFFFFFFF  FFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFF FFFFFF
    34   34 A L  H  < S+     0   0   58 1672   64  CC  LTLLLALLAMLL  LLAACCCSCSCCCLLSSCSCCCCL LLLAMLLLLCCVAMLALALA ACCCCC
    35   35 A S  H  < S+     0   0   15 1674   70  SS  GASGSSGGSSCG  SSSSSSSSSSSSSSSSTSSSSSSS SGGASGSSGSSSSSSSSSSS SSSSSS
    36   36 A F    ><  +     0   0   36 1674   14  FF  FFFFFFFFFFFF  FFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFF FFFSFF
    37   37 A P  G >  S+     0   0   44 1674    0  PP  PPPPPPPPPPPP  PPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPP PPPPPP
    38   38 A T  G >  S+     0   0   37 1674  100  TT  TTTTTTTTTTTT  TTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTSTTTTTT TTTTTT
    39   39 A T  G X  S+     0   0    3 1674    2  TT  TTTTTTTTTTTT  TTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTT TTTTTT
    40   40 A K  G X  S+     0   0   64 1674   41  KK  KKKKKKKKKKKK  KKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKK KKKKKK
    41   41 A T  G <  S+     0   0    7 1675   64  TT  TTTTTTTTTTTT  TTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTT TTTTTT
    42   42 A Y  G <  S+     0   0   16 1675    3  YY  YYYYYYYYYYYY  YYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYY YYYYYY
    43   43 A F    X   +     0   0   31 1676    0  FF  FFFFFFFFFFFF  FFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFPF FFFFFF
    44   44 A P  T 3  S+     0   0   70 1676   66  PP  PPPPPPPPPPPP  PPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPSPPPPFP PPPPPP
    45   45 A H  T 3  S+     0   0  122 1676   59  HH  HHHHHHHHHHHH  HHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHH HHHHHH
    46   46 A F  S <  S-     0   0   44 1676    8  FF  FFFFFFFFFFFF  FFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFYFF FFFFFF
    47   47 A D        -     0   0   81 1676   46  DD  DDDDDDDDDDDD  DDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDD DDDDDD
    48   48 A L        +     0   0   55 1674   66  VV  LLLLLLLLVLLL  LLVVVVVVVVVVVLLVVVVVVVVL LLLLLLMLLLLLLLLLLLLL VVVVVV
    49   49 A S  S >  S-     0   0   58 1674   83  SS  SSSSSSSSSSSS  SSSSSSSSSSSSSSSSSSSSSSSS STTSSSSSSSSSSGTSSSSN SSSSSG
    50   50 A H  T 3  S+     0   0  150 1674   86  HH  HHHHHPHHHPHH  HHHHPHHPHPHHHHHHPHHPHPHH HHHHPHHHHHHPPHHPHPHP HPPPPP
    51   51 A G  T 3  S+     0   0   40 1676   21  GG  GGGGGGGGGGGG  GGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGGGGGGGNGGGGGG GGGGGG
    52   52 A S    X>  -     0   0   13 1677   46  SS  SSSSSSSSSSSS  SSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSS SSSSSS
    53   53 A A  H 3> S+     0   0   80 1675   50  AA  EAAAAAAAAAAA  AAAAAAAAAAAAAAAAAAAAAAAA AEEAAAGAAAAAATAAAAAA AAAAAA
    54   54 A Q  H 3> S+     0   0   86 1677   56  QQ  QQQQQQQQQQQQ  QQQQQQQQQQQQQQQQQQQQQQQQ QQQQQQQQQQQQQQQQQQQQ QQQQQQ
    55   55 A V  H <> S+     0   0   12 1676   15  VV  IVVVVVVVVVVV  VVVVVVVVVVVVVVVVVVVVVVVV VIVVVV.VVVVVVVVVVVPV VVVVVV
    56   56 A K  H  X S+     0   0  130 1677   25  KK  KKKKKKKKKKKQ  KKKKKKKKKKKKKKKKKKKKKKKK KKKKKKIKKKKKKKKKKKQK KKKKKK
    57   57 A G  H  X S+     0   0   37 1678   52  GG  TAGAGAAAGAAA  GGGGGAGGGGGAAGGGGAGGAGGG GTAGAAAAAAAAAGAAAAGG GGGGGG
    58   58 A H  H  X S+     0   0   53 1678    7  HH  HHHHHHHHHHHH  HHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHH HHHHHH
    59   59 A G  H  X S+     0   0    0 1678    1  GG  GGGGGGGGGGGG  GGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGG GGGGGG
    60   60 A K  H  X S+     0   0  132 1677   49  AA  KKEKAKKKKKKK  EEKKAGAAAAAGGEEAAGAAGAAK KKKKKKKEKQQKKKQKEKKK KAAAAA
    61   61 A K  H  X S+     0   0  166 1677   22  KK  KKKKKKKKKKKK  KKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKK KKKKKK
    62   62 A V  H  X S+     0   0   31 1677    6  VV  VVVVVVVVVVVV  VVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVV VVVVVV
    63   63 A A  H  X S+     0   0    1 1677   69  AA  AAAGAAGGAAAG  AAAAAAAAAAAAAAAAAAAAAAAA AAAAAGAAGAAAAAGAAAAA AAAAAA
    64   64 A D  H  X S+     0   0   83 1677   63  DD  EDADADDDDDDD  AADDGDGGGGGDDAADGDDGDGGD KEEDDDDNDDDDDDADNDED DGGGGG
    65   65 A A  H  X S+     0   0   23 1678   36  AA  AAAAAAAAAAAA  AAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA AAAAAA
    66   66 A L  H  X S+     0   0   15 1678   27  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLL LLLLLL
    67   67 A T  H  X S+     0   0   52 1678   69  AA  TTTTTTTTATAT  TTAAAAAAAAAAATTAAAAAAAAT TTTTTTTTTTTTTTTTTTAT AAAAAA
    68   68 A N  H  X S+     0   0   60 1678   62  TT  KTKLKLLLSTVQ  KKNNTTTTTTTTTKKTTTTTTTTN NKKNTLNKLQQLNKKLKKTK STTTTT
    69   69 A A  H  < S+     0   0    0 1678   26  AA  AAAAAAAAAAAA  AAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA AAAAAA
    70   70 A V  H >< S+     0   0   10 1678   47  AA  VVVVVVVVAVAV  VVAAAAAAAAAAAVVAAAAAAAAV VVVVVVVVVVVVVVVVVVAV AAAAAA
    71   71 A A  H 3< S+     0   0   71 1678   70  SG  GAGGGGGGGAAG  GGGGSGSSSSSSGGGSSGGGGSSA EGNNAGGGGAAGAGGGGGGG GSSSSS
    72   72 A H  T >< S+     0   0   84 1678   50  HH  HHHHHHHHHHHH  HHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHSHS HHHHHH
    73   73 A V  T <  S+     0   0   14 1678   26  LL  LMLLLLLLLILL  LLLLLLLLLLLLLLLLLLLLLLLV LLLLMLILLMILGLLLLMLL LLLLLL
    74   74 A D  T 3  S+     0   0  114 1678    3  DD  DDDDDDDDDDDD  DDDDDDDDDDDDDEDDDDDDDDDD DDDDDDDDDDDDDDDDDDDD DDDDDD
    75   75 A D  S X> S+     0   0   85 1678   30  DD  DDDDDDDDDDDD  DDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDDDDDDDTDDDDDD DDDDDD
    76   76 A M  H 3>  +     0   0   13 1678   19  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLM MLLLLLMLLLLLLLLLLLLL LLLLLL
    77   77 A P  H 34 S+     0   0   69 1672   78  PP  PPPPPPPPPPPP  PPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPAPPPPPPPP PPPPPP
    78   78 A N  H X4 S+     0   0   91 1678   38  AA  GGGGGGGGGGAG  GGGGAAAAGAGAAGGAAPAAAAAN NGTGKGGGGTNGMDNGGGGG GAAAAA
    79   79 A A  H 3< S+     0   0   34 1678   50  AA  AATAAAAAAAAA  TTAAAAAAAAAAATTAAAAAAAAA AAAAAAATAAAAAAAATAAA AAAAAA
    80   80 A L  T 3X S+     0   0    5 1678   14  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLMLLLLLLLLLL LLLLLL
    81   81 A S  H <> S+     0   0   43 1678   57  SS  SSSSSSSSSSSS  SSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSS SSSSSS
    82   82 A A  H  > S+     0   0   77 1678   70  AA  AADNEANNAAAA  DDAAAAAAAAAAADDAAAAAAAAA AANAANADNAAATDDADAAA AAAAAA
    83   83 A L  H  > S+     0   0   54 1678    0  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLL LLLLLL
    84   84 A S  H  X S+     0   0    3 1677    3  SS  SSSSSSSSSSSS  SSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSS SSSSSS
    85   85 A D  H  X S+     0   0   67 1678   28  DD  DDDDDDDDDDDD  DDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDD DDDDDD
    86   86 A L  H >X>S+     0   0   68 1678    8  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLL LLLLLL
    87   87 A H  I 3<>S+     0   0   41 1678    0  HH  HHHHHHHHHHHH  HHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHH HHHHHH
    88   88 A A  I 3<5S+     0   0    6 1678   45  AA  AAAAAAAAAAAA  AAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA AAAAAA
    89   89 A H  I <<5S+     0   0  111 1678   83  HH  HYHHHHHHHYYY  HHHHHHHHHHHHHHHHHHHHHHHH HHHHYHHHHYYHYHHYHHHH HHHHHH
    90   90 A K  I  <5S+     0   0  162 1678   37  KK  KKKKKKKKKKKK  KKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKK KKKKKK
    91   91 A L  I      -     0   0    3 1677    2  DD  DDDDDDDDDDDD  DDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDD DDDDDD
    95   95 A P  T >> S+     0   0   40 1677    0  PP  PPPPPPPPPPPP  PPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPP PPPPPP
    96   96 A V  H 3> S+     0   0   56 1677   76  VV  VVVVVVVVVVVV  VVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVV VVVVVV
    97   97 A N  H <> S+     0   0   10 1676    1  NN  NNNNNNNNNNNN  NNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNN NNNNNN
    98   98 A F  H <> S+     0   0   23 1678    0  FF  FFFFFFFFFFFF  FFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFF FFFFFF
    99   99 A K  H  X S+     0   0  129 1678   26  KK  KKKKKKKKKKKK  KKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKK KKKKKK
   100  100 A L  H  X S+     0   0   20 1675   16  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLFFLLLLLLLLL LLLLLL
   101  101 A L  H  X S+     0   0   40 1677    2  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLL LLLLLL
   102  102 A S  H  X S+     0   0   16 1677   44  SS  SSSSSSSSSSSS  SSSSSSSSSSSSSSSSSSSSSSSS NSSSSSSSSSSSSSSSSSSS SSSSSS
   103  103 A H  H  X S+     0   0   16 1677   45  HH  HHHHHHHHHHHH  HHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHH HHHHHH
   104  104 A C  H  X S+     0   0    0 1676   70  CC  CCSCSCCCCCCC  TTCCCCCCCCCCCSSCCCCCCCCC CCCCCCCTCCCCCCCCTCCC CCCCCC
   105  105 A L  H  X S+     0   0   11 1676   23  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLL LLLLLL
   106  106 A L  H  X S+     0   0    2 1677   44  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLL LLLLLL
   107  107 A V  H  X S+     0   0    0 1677   30  VV  VVVSVVSSVVVV  VVVVVVVVVVVVVVVVVVVVVVVV VVVVVSVVSVVVVVVVVVVV VVVVVV
   108  108 A T  H  < S+     0   0    1 1677   51  TT  TTTTTTTTTTTT  TTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTT TTTTTT
   109  109 A L  H >X S+     0   0    4 1677   20  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLL LLLLLL
   110  110 A A  H 3< S+     0   0    0 1677   13  AA  AAAAAAAAAAAA  AAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAASAAAAA AAAAAA
   111  111 A A  T 3< S+     0   0   10 1675   90  AA  NCCVSCVVSCAL  CCSSAAAAAAAAACCAAAAAAAAA ANNCCVSAVCCCCARCSAAS SAAAAA
   112  112 A H  T <4 S+     0   0   53 1678   39  HH  HHHHHHHHHHHH  HHHHHHHHHHHHHHHHHHHHHHHH NHHHHHHHHHHHHHHHHHHH HHHHHH
   113  113 A L  S >X S-     0   0    3 1678   63  HL  HHHLLHLLHHHH  HLHHHLHHLHHHLHHHHLLHLHLH FHHHHLHLLHHHHLLHLHMH HLHLHH
   114  114 A P  T 34 S+     0   0   90 1678   50  PP  PPPPPPPPPPPP  PPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPpPPPPP PPPPPP
   115  115 A A  T 34 S+     0   0   80 1590   72  AS  NASNNANNAAAD  NNAAASAASAAASSSAASSASASA SNNSANASNAAAAGqASAAA ASASAA
   116  116 A E  T <4 S+     0   0   79 1678   38  DD  EEDDDEDDDEED  DDDDEDDDDDDDDDDEEDDEDDDE QEEDEDEDDEEEEDEEDDEE DDDDEE
   117  117 A F     <  +     0   0    8 1678    7  FF  FFFFFFFFFFFF  FFFFFFFFFFFFFFFFFFFFFFFF FFFIFFFFFFFFFFFFFFFF FFFFFF
   118  118 A T     >  -     0   0   62 1678   18  TT  TTTTTTTTTTTT  TTTTTTTTTTTTTTTTTTTTTTTT TTTSTTTTTTTTTTTTTTTT TTTTTT
   119  119 A P  H  > S+     0   0   22 1678   12  PP  PPPPPPPPPPPP  PPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPP PPPPPP
   120  120 A A  H  > S+     0   0   35 1677   58  AA  AAAAAAAAAAAA  AAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAASAAAAAA AAAAAA
   121  121 A V  H  > S+     0   0   17 1677   38  VV  VVVVVVVVVVVI  VVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVV VVVVVV
   122  122 A H  H  X S+     0   0    2 1676   32  HH  HHHHHHHHHHHH  HHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHH HHHHHH
   123  123 A A  H  X S+     0   0   16 1676   34  AA  AAAAAAAAAAAA  AAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA AAAAAA
   124  124 A S  H  X S+     0   0    3 1676   45  SS  SSSSSSSSSSSS  SSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSS SSSSSS
   125  125 A L  H  X S+     0   0    3 1676   46  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL VLLLLLLLLLLLLLLLLLLL LLLLLL
   126  126 A D  H  X S+     0   0   21 1676   30  DD  DDDDDDDDDDDD  DDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDD DDDDDD
   127  127 A K  H  X S+     0   0   36 1676    0  KK  KKKKKKKKKKKK  KKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKK KKKKKK
   128  128 A F  H  X S+     0   0    2 1676   41  FF  FFFFFFFFFFFF  FFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFF FFFFFF
   129  129 A L  H  X S+     0   0    7 1676   33  LL  LFLLFFLLLFLL  LLLILLLLLLLLLLLLLLLLLLLL LLLLFLFLLFFFFLFFLLLM LLLLLL
   130  130 A A  H  X S+     0   0   39 1676   54  AA  ASASASSSASSS  AAAAAAAAAAAAAAAAAAAAAAAA AAAASSAASSSSSASTAAAA AAAAAA
   131  131 A S  H  X S+     0   0   29 1676   65  SS  NANTNATTSTSN  NNSSSSSSSSSSSNNSSSSSSSSS SNNTTTANTAATTSNSNSSS SSSSSS
   132  132 A V  H  X S+     0   0    9 1676   11  VV  VVVVVVVVVVVV  VVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVV VVVVVV
   133  133 A S  H  X S+     0   0   17 1675   49  SS  SSSSSSSSSSSS  SSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSS SSSSSS
   134  134 A T  H  X S+     0   0   88 1674   74  TT  TTTTTTTTTTTT  TTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTT TTTTTT
   135  135 A V  H  < S+     0   0   21 1675   55  VV  VVVVVVVVVVVV  VVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVV VVVVVV
   136  136 A L  H  < S+     0   0   19 1674    0  LL  LLLLLLLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLL LLLLLL
   137  137 A T  H >< S+     0   0   42 1674   54  TT  TTTTTTTTTTTT  TTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTT TTTTTT
   138  138 A S  T 3< S+     0   0   57 1669   77  SS  SSSSSSSSSSSS  SSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSS SSSSSS
   139  139 A K  T 3  S+     0   0   77 1669   12  KK  KKKKKKKKKKKK  KKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKK KKKKKK
   140  140 A Y    <         0   0   19 1666    0  YY  YYYYYYYYYYYY  YYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYY YYYYYY
   141  141 A R              0   0   75 1644   37  RR  RRRRRRRRRRRR  RRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRR RRRRRR
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41    SG                                                                  
   144    2 B H        -     0   0  151 1032   46    NH            HH                        H                    H      
   145    3 B F        -     0   0   37 2258   27    FF            FF                        F                    F      
   146    4 B T    >>  -     0   0   75 2258   47    TT            TT                        S                    T      
   147    5 B E  H 3> S+     0   0  133 2262   54    AE            VA                        P                    A      
   148    6 B E  H 3> S+     0   0  151 2265   64    EE            EE                        E                    E      
   149    7 B D  H X> S+     0   0   26 2283   21    DD            EE                        E                    E      
   150    8 B K  H 3X S+     0   0   82 2285   24    KK            KK                        K                    K      
   151    9 B A  H 3X S+     0   0   51 2283   64    AA            AA                        A                    A      
   152   10 B T  H < S+     0   0    5 2293   58    LL            LL                        L                    L      
   157   15 B W  G >< S+     0   0   32 2299    7    WW            WW                        W                    W      
   158   16 B G  G 3  S+     0   0   69 2299   51    AG            GG                        G                    G      
   159   17 B K  G <  S+     0   0  109 2303   19    KK            KK                        K                    K      
   160   18 B V    <   -     0   0   19 2307   28    VV            VV                        V                    M      
   161   19 B N     >  -     0   0   97 2308   63    NN            NN                        N                    N      
   162   20 B V  H  > S+     0   0   26 2306   77    VV            VV                        V                    V      
   163   21 B E  H  > S+     0   0   84 2303   46    EE            EE                        E                    E      
   164   22 B D  H  4 S+     0   0   90 2307   47    DD            EE                        E                    E      
   165   23 B A  H  X S+     0   0   13 2309   68    AA            AA                        A                    A      
   166   24 B G  H  X S+     0   0    0 2309    5    GG            GG                        G                    G      
   167   25 B G  H  X S+     0   0    5 2309   51    GG            GG                        G                    G      
   168   26 B E  H  > S+     0   0   52 2309   25    EE            EE                        E                    E      
   169   27 B T  H  X S+     0   0    4 2307   28    TT            AA                        A                    A      
   170   28 B L  H  X S+     0   0    7 2310    2    LL            LL                        L                    L      
   171   29 B G  H  X S+     0   0    0 2310   62    GG            GG                        G                    G      
   172   30 B R  H  X S+     0   0    8 2309    2    RR            RR                        R                    R      
   173   31 B L  H  X S+     0   0   12 2309   37    LL            LL                        L                    L      
   174   32 B L  H  < S+     0   0    0 2309   14    LL            LL                        L                    L      
   175   33 B V  H  < S+     0   0   26 2310   56    VV            VV                        V                    V      
   176   34 B V  H  < S+     0   0    2 2312   61    VV            VV                        V                    V      
   177   35 B Y  S >< S-     0   0   26 2312   13    YY            YY                        Y                    Y      
   178   36 B P  T 3   +     0   0   29 2313    0    PP            PP                        P                    P      
   179   37 B W  T 3  S+     0   0   22 2313   94    WW            WW                        W                    W      
   180   38 B T  S X  S+     0   0    3 2313    3    TT            TT                        T                    T      
   181   39 B Q  G >  S+     0   0   40 2313   46    QQ            QQ                        Q                    Q      
   182   40 B R  G 3  S+     0   0   64 2316   69    RR            RR                        R                    R      
   183   41 B F  G <  S+     0   0   60 2316    8    FF            FF                        F                    F      
   184   42 B F    X   +     0   0   26 2316    0    FF            FF                        F                    F      
   185   43 B D  T 3  S+     0   0  125 2315   68    DD            DD                        D                    D      
   186   44 B S  T 3  S+     0   0  109 2316   73    SS            NN                        S                    N      
   187   45 B F  S <  S-     0   0   34 2315    6    FF            FF                        F                    F      
   188   46 B G        +     0   0   57 2304   43    GG            GG                        G                    G      
   189   47 B N        +     0   0  101 1087   32    SN            NN                        N                    N      
   190   48 B L        +     0   0   18 1086    4    LL            LL                        L                    L      
   191   49 B S        +     0   0   87 1087   39    SS            SS                        S                    S      
   192   50 B S  S >> S-     0   0   64 1089   48    SS            SS                        S                    S      
   193   51 B A  H 3> S+     0   0   28 1160   49    PA            AA                        E                    P      
   194   52 B S  H 3> S+     0   0  104 1382   69    SS            SS                        S                    S      
   195   53 B A  H <4 S+     0   0   24 2309   70    AA            AA                        A                    A      
   196   54 B I  H  < S+     0   0    2 2309   82    II            II                        I                    I      
   197   55 B M  H  < S+     0   0   39 2309   88    MM            MM                        M                    L      
   198   56 B G  S  < S+     0   0   41 2311   27    GG            GG                        G                    G      
   199   57 B N     >  -     0   0   13 2313   52    NN            NN                        N                    N      
   200   58 B P  H  > S+     0   0   95 2311   53    PP            PP                        P                    P      
   201   59 B K  H  > S+     0   0  126 2313   69    KK            KK                        K                    K      
   202   60 B V  H  > S+     0   0    1 2312   13    VV            VV                        V                    V      
   203   61 B K  H  X S+     0   0  112 2311   50    KK            KK                        K                    K      
   204   62 B A  H  X S+     0   0   53 2312   51    AA            AA                        A                    A      
   205   63 B H  H  X S+     0   0   62 2314    5    HH            HH                        H                    H      
   206   64 B G  H  X S+     0   0    0 2314    1    GG            GG                        G                    G      
   207   65 B K  H  X S+     0   0   94 2312   54    VK            KK                        K                    K      
   208   66 B K  H  X S+     0   0  156 2313   28    KK            KK                        K                    K      
   209   67 B V  H  X S+     0   0   40 2314    7    VV            VV                        V                    V      
   210   68 B L  H  X S+     0   0    5 2314   63    LL            LL                        L                    L      
   211   69 B T  H  X S+     0   0   52 2310   68    TG            TT                        T                    T      
   212   70 B S  H  < S+     0   0   44 2314   47    SA            SS                        S                    S      
   213   71 B L  H >X S+     0   0   17 2314   25    LF            LL                        F                    F      
   214   72 B G  H >X S+     0   0   10 2314   68    GS            GG                        G                    G      
   215   73 B D  H 3< S+     0   0   98 2312   70    ED            ED                        N                    D      
   216   74 B A  H X4 S+     0   0    0 2314   20    AG            AA                        A                    A      
   217   75 B I  H X< S+     0   0   14 2313   43    IL            II                        V                    I      
   218   76 B K  T 3< S+     0   0  162 2315   65    KA            KK                        K                    K      
   219   77 B H  T X   +     0   0   96 2315   51    NH            NN                        H                    N      
   220   78 B L  T <   +     0   0   17 2315   32    LL            MM                        M                    M      
   221   79 B D  T 3  S+     0   0  159 2315    5    DD            DD                        D                    D      
   222   80 B D    <>  +     0   0   85 2315   35    DN            DD                        D                    N      
   223   81 B L  H  > S+     0   0   17 2313   25    LL            LL                        L                    L      
   224   82 B K  H  > S+     0   0  143 2307   71    KK            KK                        K                    K      
   225   83 B G  H  4 S+     0   0   48 2312   51    GG            GG                        D                    T      
   226   84 B T  H  < S+     0   0   55 2313   57    TT            TT                        T                    T      
   227   85 B F  H  X S+     0   0    7 2314   23    FF            FF                        F                    F      
   228   86 B A  H  X S+     0   0   21 2315   60    GS            AA                        A                    A      
   229   87 B Q  H  > S+     0   0  150 2310   74    QQ            HH                        E                    K      
   230   88 B L  H  > S+     0   0   57 2316    0    LL            LL                        L                    L      
   231   89 B S  H  X S+     0   0    0 2315    2    SS            SS                        S                    S      
   232   90 B E  H  X S+     0   0   81 2316   47    EE            EE                        E                    E      
   233   91 B L  H  X>S+     0   0   77 2316   21    LL            LL                        L                    L      
   234   92 B H  I  <>S+     0   0   33 2316    0    HH            HH                        H                    H      
   235   93 B C  I  X5S+     0   0   12 2316   54    CC            CC                        C                    C      
   236   94 B D  I  <5S+     0   0   66 2315   78    DD            DD                        D                    D      
   237   95 B K  I  <5S+     0   0  155 2316   36    KK            RR                        K                    K      
   238   96 B L  I  4   -     0   0    3 2315    2    DD            DD                        D                    D      
   242  100 B P  T >> S+     0   0   17 2316    1    PP            PP                        P                    P      
   243  101 B E  H 3> S+     0   0   31 2316   76    EE            EE                        E                    E      
   244  102 B N  H <> S+     0   0   13 2316    2    NN            NN                        N                    N      
   245  103 B F  H <> S+     0   0   22 2316    1    FF            FF                        F                    F      
   246  104 B K  H  X S+     0   0  120 2316   30    RR            KK                        K                    R      
   247  105 B L  H  X S+     0   0   17 2300   17    LL            LL                        L                    L      
   248  106 B L  H  X S+     0   0   38 2308    2    LL            LL                        L                    L      
   249  107 B G  H  X S+     0   0    6 2310   44    GG            GG                        G                    G      
   250  108 B N  H  X S+     0   0   34 2311   57    NN            NN                        N                    N      
   251  109 B V  H  X S+     0   0    1 2310   66    VV            EE                        V                    V      
   252  110 B L  H  X S+     0   0    9 2310   23    LL            LL                        L                    L      
   253  111 B V  H  X S+     0   0    0 2312   56    VV            VV                        V                    V      
   254  112 B T  H  X S+     0   0    1 2312   29    TC            II                        C                    I      
   255  113 B V  H  X S+     0   0    6 2315   53    VV            VV                        V                    I      
   256  114 B L  H  X S+     0   0    4 2315   24    LL            LL                        L                    L      
   257  115 B A  H  X S+     0   0    0 2315   11    AA            AA                        A                    A      
   258  116 B I  H  < S+     0   0   27 2307   85    IR            KK                        H                    T      
   259  117 B H  H  < S+     0   0  114 2316   52    LN            HY                        H                    H      
   260  118 B F  H >< S-     0   0   18 2316   62    YF            FF                        F                    F      
   261  119 B G  G >< S+     0   0   17 2314   55    GG            GG                        G                    G      
   262  120 B K  G 3  S+     0   0  193 2165   71    KK            KK                        K                    K      
   263  121 B E  G <  S+     0   0   93 2313   44    EE            EE                        E                    E      
   264  122 B F  S <  S-     0   0    0 2313    7    FF            FF                        F                    F      
   265  123 B T    >>  -     0   0   53 2311   23    TT            TT                        T                    T      
   266  124 B P  H 3> S+     0   0   23 2311   20    PP            PP                        P                    P      
   267  125 B E  H 3> S+     0   0  105 2307   52    EQ            QQ                        Q                           
   268  126 B V  H <> S+     0   0   22 2310   50    VA            VV                        V                           
   269  127 B Q  H  X S+     0   0    0 2291   35    QQ            QQ                        Q                           
   270  128 B A  H  X S+     0   0   15 2300   35    AA            AA                        A                           
   271  129 B S  H  X S+     0   0    1 2302   49    SA            AA                        A                           
   272  130 B W  H  X S+     0   0    1 2304   51    WY            WW                        Y                           
   273  131 B Q  H  X S+     0   0    5 2306   39    QQ            QQ                        Q                           
   274  132 B K  H  X S+     0   0  100 2304    1    KK            KK                        K                           
   275  133 B M  H  X S+     0   0    1 2301   33    MV            MM                        V                           
   276  134 B V  H  X S+     0   0    6 2303   34    WV            VV                        V                           
   277  135 B T  H  X S+     0   0   80 2301   65    SA            AA                        A                           
   278  136 B G  H  X S+     0   0   23 2301   71    GG            GG                        G                           
   279  137 B V  H  X S+     0   0   17 2298   15    QV            VV                                                    
   280  138 B A  H  X S+     0   0    5 2297   60    RA            AA                                                    
   281  139 B S  H  X S+     0   0   67 2291   79    PN            II                                                    
   282  140 B A  H  < S+     0   0    2 2289   52    GA            AA                                                    
   283  141 B L  H  < S+     0   0   19 2272    1    L             LL                                                    
   284  142 B S  H >< S+     0   0   44 2267   58                  AA                                                    
   285  143 B S  T 3< S+     0   0   57 2265   80                  HH                                                    
   286  144 B R  T 3  S+     0   0  128 2255   28                  KK                                                    
   287  145 B Y    <         0   0   31 2246    0                  YY                                                    
   288  146 B H              0   0  136 2186   41                  HH                                                    
## ALIGNMENTS  281 -  350
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....9....:....0....:....1....:....2....:....3....:....4....:....5
     1    1 A V              0   0  136  867   26  VVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VV V VVV
     2    2 A L        -     0   0   22 1663    3  LLLLLLLLLLLLLLLLLLLLLLPLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LL L LLL
     3    3 A S     >  -     0   0   51 1663   48  SSSSSSSSSSSSSSSSSSSSSSSSYS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SS S SSS
     4    4 A P  H  > S+     0   0   84 1664   53  AAAAAAGAAAAAAAAAAAAAAAAPDA PPPPPPPPPPPPPAASSPSPPAPGSSSSAPPPP  PA A GAA
     5    5 A A  H  > S+     0   0   62 1663   62  DDEDDDEDDDDDEEEDDDDDDDDATA AAAAAAAAAAAAATSKKAAAAAAEAAAAAEAAA  AA A EEE
     6    6 A D  H  > S+     0   0    8 1667   20  DDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DD D DDD
     7    7 A K  H  X S+     0   0   46 1668    8  KKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KK K KKK
     8    8 A T  H  X S+     0   0   95 1666   59  AAAAAASAAAAAAAAAAAAAAAATSA TTTTTTTTTTTTTSTTTTASTATNNNNNANTSS  TG S SAA
     9    9 A N  H  X S+     0   0   43 1665   80  NNNNNNNHNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNHNNN  NN N NNN
    10   10 A V  H  X S+     0   0    2 1667   12  IIVIIIIIIIIIVVVIIIIIIIIVIV IIIIIIITIITIIILVVIIVVVIIIVVVVVVVV  IV V IVV
    11   11 A K  H  X S+     0   0   99 1668   70  KKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKRKKK  KK K KKK
    12   12 A A  H  X S+     0   0   67 1669   58  AATAAAAAAAAATTAAAAAAAAAGAA TTTTTTTTTTTTTAATTSAATASTAAAAASGAA  ST A ATT
    13   13 A A  H  < S+     0   0    5 1672   61  AAAAAAAAAAAAAAAAAAAAAAATAA AAAAAAAAAAAAAFAAATTTTATATCCCATTTT  TA A AAV
    14   14 A W  H  X S+     0   0   22 1672    7  WWWWWWWWWWWWWWWWWWWWWWWWWW WWWWWWWWWWWWWWWFFWWWWFWWWWWWWWWWW  WW W WWW
    15   15 A G  H  < S+     0   0   51 1672   52  SGSGGGGGGGGGSSSGGGGGGGGAQG EEEEEEEEEEEEEGDGGDDDDDEGDGGGGDSDD  DD G GSS
    16   16 A K  T  < S+     0   0  111 1673    8  KKKKKKKKKKKKKKKKKKRKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KK K KKK
    17   17 A V  T >4 S+     0   0    1 1676   26  IIIIIIIIIIIIIIIIIIIIIIIIVV IIIIIIIIIIIIIILIIIIIIVIIIIIIVIIII  IV V III
    18   18 A G  T 3< S+     0   0   49 1676   66  GGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GG G GGG
    19   19 A A  T 3  S+     0   0   96 1676   70  GGGGGGGGGGGGGGGGGGGGGGGNTG SSSSSSSSSSSSSDGGGGGSGGSGSSSSGGNSS  GG G GGS
    20   20 A H  S <> S+     0   0   92 1674   65  HHHHHHHHHHHHHHHHHHHHHHHHHQ HHHHHHHHHHHHHHQHHHHHHQHHHHHHQHHHH  HQ N HHH
    21   21 A A  H  > S+     0   0    6 1158   58  GGGGGGGGGGGGGGGGGGGGGGGSAA GGGGGGGGGGGGGAAAAAGAAAAAAAAAAGSAA  AA A GGG
    22   22 A G  H  > S+     0   0   19 1159   49  AAAAAAAAAAAAAAAAAAAAAAAAGG GGGGGGGGGGGGGGAAAGGGGGSAGGGGGAAGG  GG P AAA
    23   23 A E  H  > S+     0   0  120 1676   42  EEEEEEEEEEKEDDEEEEEEEEEEEA EEEEEEEEEEEEEENEEDEEEDEEEEEEAEEEE  DN A EDE
    24   24 A Y  H  X S+     0   0   23 1676   70  YYYYYYYYYYYYYYYYYYYYYYYYYH YYYYYYYYYYYYYYYYYYYYYYYYYYYYHYYYY  YY F YYY
    25   25 A G  H  X S+     0   0    4 1676    6  GGGGGGVGGGGGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GG G GGG
    26   26 A A  H  X S+     0   0   15 1676   45  AAAAAAAAAAAAAAAAAAAAAAAAGA AAAAAAAAAAAAAAAAAGAGGAGAAAAAAAAGG  GA A AAA
    27   27 A E  H  X S+     0   0   45 1676    7  EEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE  EE E EEE
    28   28 A A  H  X S+     0   0    0 1674   28  AAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AA A AAA
    29   29 A L  H  X S+     0   0    4 1677    2  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LL L LLL
    30   30 A E  H  X S+     0   0   36 1677   56  EGEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEGEEEEEEDEEEEEEEEEEEEEEE  DE E EEG
    31   31 A R  H  X S+     0   0    3 1678    1  RRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  RR R RRR
    32   32 A M  H  X S+     0   0   11 1677   19  MMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMMMMMMMMTTMMTTTTMTMTTTTMMMTT  TM M MMM
    33   33 A F  H  < S+     0   0   11 1667   15  FFFFLFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FF F FFF
    34   34 A L  H  < S+     0   0   58 1672   64  CCSCCCACCCCCSCSCCCCCCCCIEL LLLLLLLLLLLLLAALLQLAMLAVICCCLTIAA  QL L ASC
    35   35 A S  H  < S+     0   0   15 1674   70  SSSSSSSSSSSSSSSSSSSSSSSNSG GGGGGGGGGGGGGASGGSCSASSVSSSSGSNSS  SG S SSS
    36   36 A F    ><  +     0   0   36 1674   14  FFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFYFFFFFFFFF  FF F FFF
    37   37 A P  G >  S+     0   0   44 1674    0  PPPPPSPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  PP P PPP
    38   38 A T  G >  S+     0   0   37 1674  100  TTTTTTTTTTTTTTTTTTTTTTTSTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTSTT  TT T TTT
    39   39 A T  G X  S+     0   0    3 1674    2  TTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TT T TTT
    40   40 A K  G X  S+     0   0   64 1674   41  KKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KK K KKK
    41   41 A T  G <  S+     0   0    7 1675   64  TTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TT T TTT
    42   42 A Y  G <  S+     0   0   16 1675    3  YYYYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY  YY Y YYY
    43   43 A F    X   +     0   0   31 1676    0  FFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FF F FFF
    44   44 A P  T 3  S+     0   0   70 1676   66  PPPPPPPPPPPPPPPPPPPPPPPSPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPSPP  PP P PPP
    45   45 A H  T 3  S+     0   0  122 1676   59  HHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HH H HHH
    46   46 A F  S <  S-     0   0   44 1676    8  FFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FF F FFF
    47   47 A D        -     0   0   81 1676   46  DDDDDDDDDDDDDDDDDDDDDDDDDN DDDDDDDDDDDDDDDDDDDDDDDDDDDDNDDDD  DD D DDD
    48   48 A L        +     0   0   55 1674   66  VVVVVVVVVVVVVVVVVVVVVVVLLL LLLLLLLLLLLLLLLLLLLLLLLVLLLLLVLLL  LM L VVV
    49   49 A S  S >  S-     0   0   58 1674   83  SSSSSSSSSSSSSSSSSSSSSSSGKS STTSSSSSSSSSTSSSSSSSSSSSSSSSSSGSS  SS S SSS
    50   50 A H  T 3  S+     0   0  150 1674   86  PHPHHHHPPPHHHHHPPPPHPHPHHH HHHHHHHHHHHHHHPHHPHPPHPHHHHHHHHPP  PH H HPH
    51   51 A G  T 3  S+     0   0   40 1676   21  GGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GD G GGG
    52   52 A S    X>  -     0   0   13 1677   46  SSSSSSSSSPSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SS S SSS
    53   53 A A  H 3> S+     0   0   80 1675   50  AAAAAAAAAAAAAAAAAAAAAAAAAD EEEEEEEEEEEEEAAAAAAAAAAGAAAADAAAA  AA A AAA
    54   54 A Q  H 3> S+     0   0   86 1677   56  QQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ  QQ Q QQQ
    55   55 A V  H <> S+     0   0   12 1676   15  VVVVVVVVVVVVVVVVVVVVVVVIVV IIIIIIIIIIIIIIVVVVVVVVVVVVVVVVIVV  VI V VVV
    56   56 A K  H  X S+     0   0  130 1677   25  KKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKQQQKKKKK  KK K KKK
    57   57 A G  H  X S+     0   0   37 1678   52  GGGGAGGGGGGTGGGGGGGGGGGGAA AATAAAAATTTTAGGAAAAATAAAAAATAAGAA  AG A GGA
    58   58 A H  H  X S+     0   0   53 1678    7  HHHHHHHHHHHQHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HH H HHH
    59   59 A G  H  X S+     0   0    0 1678    1  GGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GG G GGG
    60   60 A K  H  X S+     0   0  132 1677   49  AAAAGAKAAAAAAAAAAAAAAAAKNQ KKKKKKKKKKKKKKKKKKKKKKKKKQQQQKKKK  KK E KAG
    61   61 A K  H  X S+     0   0  166 1677   22  KKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KK K KKK
    62   62 A V  H  X S+     0   0   31 1677    6  VVVVVVIVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VV V VVV
    63   63 A A  H  X S+     0   0    1 1677   69  AAAAAAAAAAAAAAAAAAAAAAAAAA SSSSSSSSSSSSSAAGGAAAAGAAAAAAAAAAA  AA A AAA
    64   64 A D  H  X S+     0   0   83 1677   63  GGGGDGDGGGGDDDDGGGGGGGGDDD GEEEEEEEGEEEEDDDDDDDDDEDDDDDDDDDD  DD N DGD
    65   65 A A  H  X S+     0   0   23 1678   36  AAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AA A AAA
    66   66 A L  H  X S+     0   0   15 1678   27  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LL L LLL
    67   67 A T  H  X S+     0   0   52 1678   69  AAAAAAAAAAAAAAAAAAAAAAATTT TTTTTTTTTTTTTTTTTTATTVTTTTTTTATTT  TT T AAA
    68   68 A N  H  X S+     0   0   60 1678   62  TTTTTTSTTTTTTTTTTTTTTTTKNK KKKKKKKKKKKKKNKKKTLTTNNTLKKKKNKTT  TV K NTT
    69   69 A A  H  < S+     0   0    0 1678   26  AAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AA A AAA
    70   70 A V  H >< S+     0   0   10 1678   47  AAAAAAAAAAAAAAAAAAAAAAAVVV VVVVVVVVVVVVVVVAAVAAVVVVVVVVVAVAA  VV V AAA
    71   71 A A  H 3< S+     0   0   71 1678   70  SSSSGSGSSSSGSSGSSSSSSSSGAG GGGGGGGGGGGGGNGDDAAGSGAGGAAAGGGGG  AG G GSG
    72   72 A H  T >< S+     0   0   84 1678   50  HHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHSHHHHHHHHHHHHHHHHHH  HH H HHH
    73   73 A V  T <  S+     0   0   14 1678   26  LLLLLLLLLLLLLLLLLLLLLLLILL LLLLLLLLLLLLLLLLLLLLILLLLIIILLILL  LM L LLL
    74   74 A D  T 3  S+     0   0  114 1678    3  DDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDENNNDDDDD  DD D DDD
    75   75 A D  S X> S+     0   0   85 1678   30  DDDDDDDDDDDDDDDDDDDDDDDNDD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDNDD  DD D DDD
    76   76 A M  H 3>  +     0   0   13 1678   19  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LL L LLL
    77   77 A P  H 34 S+     0   0   69 1672   78  PPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  PP P PPP
    78   78 A N  H X4 S+     0   0   91 1678   38  AGAGAGGAAAAAAAAAVGAAAAADGG GGGGGGGGGGGGGGGSSGSGGGGGNNNNGGDGG  GS G GAA
    79   79 A A  H 3< S+     0   0   34 1678   50  AAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAEEEEAAAAAAAAAAAAAAAAAAAAA  AA T AAA
    80   80 A L  T 3X S+     0   0    5 1678   14  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LL L LLL
    81   81 A S  H <> S+     0   0   43 1678   57  SSSSSSSSSSSSSSSSSSSSSSSSNS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SS S SSS
    82   82 A A  H  > S+     0   0   77 1678   70  AAAAAAAAAAAAAAAAAAAAAAAETA TTATTTTTAAAAAAAAAAAAAATAADDDAAEAA  AG D AAA
    83   83 A L  H  > S+     0   0   54 1678    0  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LL L LLL
    84   84 A S  H  X S+     0   0    3 1677    3  SSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SS S SSS
    85   85 A D  H  X S+     0   0   67 1678   28  DDDDDDDDDDDDDDDDDDDDDGDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DD D DDD
    86   86 A L  H >X>S+     0   0   68 1678    8  LLLPLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LL L LLL
    87   87 A H  I 3<>S+     0   0   41 1678    0  HHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HH H HHH
    88   88 A A  I 3<5S+     0   0    6 1678   45  AAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AA A AAA
    89   89 A H  I <<5S+     0   0  111 1678   83  HHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHYYHYYYHYYYYHHHHH  YY H HHH
    90   90 A K  I  <5S+     0   0  162 1678   37  KKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KK K KKK
    91   91 A L  I      -     0   0    3 1677    2  DDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DD D DDD
    95   95 A P  T >> S+     0   0   40 1677    0  PPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  PP P PPP
    96   96 A V  H 3> S+     0   0   56 1677   76  VVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VV V VVV
    97   97 A N  H <> S+     0   0   10 1676    1  NNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  NN N NNN
    98   98 A F  H <> S+     0   0   23 1678    0  FFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FF F FFF
    99   99 A K  H  X S+     0   0  129 1678   26  KKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KK K KKK
   100  100 A L  H  X S+     0   0   20 1675   16  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLFLLFLLFFFLLLFF  LL L LLL
   101  101 A L  H  X S+     0   0   40 1677    2  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLPLLLLLLLLLLLLLLLALLLLLLLLLLL  LL L LLL
   102  102 A S  H  X S+     0   0   16 1677   44  SSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SG S SSS
   103  103 A H  H  X S+     0   0   16 1677   45  HHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHNHHHHHHHHHHH  HH H HHH
   104  104 A C  H  X S+     0   0    0 1676   70  CCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCVCCCCCCCCCCC  CC T CCC
   105  105 A L  H  X S+     0   0   11 1676   23  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LL L LLL
   106  106 A L  H  X S+     0   0    2 1677   44  LLLLLLLLLLLLLLQLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LL L LLL
   107  107 A V  H  X S+     0   0    0 1677   30  VVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VV V VVV
   108  108 A T  H  < S+     0   0    1 1677   51  TTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TT T TTT
   109  109 A L  H >X S+     0   0    4 1677   20  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLMLLMLLLLLVVLLLLLLLLLLLLLLLL  LL L LLL
   110  110 A A  H 3< S+     0   0    0 1677   13  AAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AA A AAA
   111  111 A A  T 3< S+     0   0   10 1675   90  AAAAAASAAAAAAASTAAAAAAALSA NNNNNNNNNNNNNCSAACASCVSNCCCCANLSS  CC S SAA
   112  112 A H  T <4 S+     0   0   53 1678   39  HHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HH H HHH
   113  113 A L  S >X S-     0   0    3 1678   63  HHLHLHHHHHHQHHQHLHLHHHHLHH HHHHHHHHHHHHHHHHHHHHHVHIHHHHHHLHH  HH L HLL
   114  114 A P  T 34 S+     0   0   90 1678   50  PPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPAPPPPPPPPPPP  PP P PPP
   115  115 A A  T 34 S+     0   0   80 1590   72  AASASAAAVAASAA..SASAAAAAAD SSNSSSSSNNNNSSAGGTAAAAAAAEEEDAAAA  TS N ASS
   116  116 A E  T <4 S+     0   0   79 1678   38  EDDDDDDDEEDDDDEEDDDDEDEDDD EEEEEEEEEEEEEDDDDEEEDGEDEEEEDEDEE  ED D DDD
   117  117 A F     <  +     0   0    8 1678    7  FFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFIFFFFFFFFFFFFFFFFFFF  FF F FFF
   118  118 A T     >  -     0   0   62 1678   18  TTTTTTTTTTTTTTTTATTTTTTTTN TTTTNTTTTTTTTSTTTTTTTTTTTTTTNTTTT  TT T TTT
   119  119 A P  H  > S+     0   0   22 1678   12  PPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  PP P PPP
   120  120 A A  H  > S+     0   0   35 1677   58  AAAAAAAAAAAAAAAAAAAAAAASAS AAAAAAAAAAAAAAASSAAAAAAAAAAASGSAA  AA A AAA
   121  121 A V  H  > S+     0   0   17 1677   38  VVVVVVVVVVVVVVVVVVVVVVVVMV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VV V VVV
   122  122 A H  H  X S+     0   0    2 1676   32  HHHHHHHHHHHHHHHHHHHHNHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HH H  HH
   123  123 A A  H  X S+     0   0   16 1676   34  AAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAASAAAAASAAAAAAAA  AA A  AA
   124  124 A S  H  X S+     0   0    3 1676   45  SSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSDSSSSSASSSSSSSS  SS S  SS
   125  125 A L  H  X S+     0   0    3 1676   46  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LL L  LL
   126  126 A D  H  X S+     0   0   21 1676   30  DDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DD D  DD
   127  127 A K  H  X S+     0   0   36 1676    0  KKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KK K  KK
   128  128 A F  H  X S+     0   0    2 1676   41  FFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FF F  FF
   129  129 A L  H  X S+     0   0    7 1676   33  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLFLFFLFLFFFFLLLFF  FL L  LL
   130  130 A A  H  X S+     0   0   39 1676   54  AAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAASSSASASSSSAAASS  AA A  AA
   131  131 A S  H  X S+     0   0   29 1676   65  SSSSSSSSSSSSSSSSSSSSSSSSTN NNNNNNNNNNNNNTTNNASAASSSAAAANSSAA  AS N  SS
   132  132 A V  H  X S+     0   0    9 1676   11  VVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VV V  VV
   133  133 A S  H  X S+     0   0   17 1675   49  SSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSGSSSSSSSSSSS  SS S  SS
   134  134 A T  H  X S+     0   0   88 1674   74  TTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TT T  TT
   135  135 A V  H  < S+     0   0   21 1675   55  VVVVVVVVVVVVVVVVVVVMVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VV V  VV
   136  136 A L  H  < S+     0   0   19 1674    0  LLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LL L  LL
   137  137 A T  H >< S+     0   0   42 1674   54  TTTTTTTTTTTTTTTTTTTTTSTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TT T  TT
   138  138 A S  T 3< S+     0   0   57 1669   77  SSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SS S  SS
   139  139 A K  T 3  S+     0   0   77 1669   12  KKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KK K  KK
   140  140 A Y    <         0   0   19 1666    0  YYYYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY  YY Y  YY
   141  141 A R              0   0   75 1644   37  RRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  RR R  RR
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41                                                                  G G   
   144    2 B H        -     0   0  151 1032   46                            H                                 HH  H N   
   145    3 B F        -     0   0   37 2258   27                            F                                 FF  F F   
   146    4 B T    >>  -     0   0   75 2258   47                            T                                 TT  T T   
   147    5 B E  H 3> S+     0   0  133 2262   54                            A                                 AA  E A   
   148    6 B E  H 3> S+     0   0  151 2265   64                            E                                 EE  E E   
   149    7 B D  H X> S+     0   0   26 2283   21                            E                                 EE  D D   
   150    8 B K  H 3X S+     0   0   82 2285   24                            K                                 KK  K K   
   151    9 B A  H 3X S+     0   0   51 2283   64                            A                                 AA  A A   
   152   10 B T  H < S+     0   0    5 2293   58                            L                                 LL  L L   
   157   15 B W  G >< S+     0   0   32 2299    7                            W                                 WW  W W   
   158   16 B G  G 3  S+     0   0   69 2299   51                            G                                 GG  G G   
   159   17 B K  G <  S+     0   0  109 2303   19                            Q                                 KQ  K K   
   160   18 B V    <   -     0   0   19 2307   28                            V                                 VV  V V   
   161   19 B N     >  -     0   0   97 2308   63                            N                                 NN  N N   
   162   20 B V  H  > S+     0   0   26 2306   77                            V                                 VV  V V   
   163   21 B E  H  > S+     0   0   84 2303   46                            E                                 EE  E E   
   164   22 B D  H  4 S+     0   0   90 2307   47                            E                                 EE  D D   
   165   23 B A  H  X S+     0   0   13 2309   68                            T                                 AT  V A   
   166   24 B G  H  X S+     0   0    0 2309    5                            G                                 GG  G G   
   167   25 B G  H  X S+     0   0    5 2309   51                            G                                 GG  G G   
   168   26 B E  H  > S+     0   0   52 2309   25                            E                                 EE  E E   
   169   27 B T  H  X S+     0   0    4 2307   28                            A                                 VA  T T   
   170   28 B L  H  X S+     0   0    7 2310    2                            L                                 LL  L L   
   171   29 B G  H  X S+     0   0    0 2310   62                            G                                 GG  G G   
   172   30 B R  H  X S+     0   0    8 2309    2                            R                                 RR  R R   
   173   31 B L  H  X S+     0   0   12 2309   37                            L                                 LL  L .   
   174   32 B L  H  < S+     0   0    0 2309   14                            L                                 LL  L .   
   175   33 B V  H  < S+     0   0   26 2310   56                            V                                 VV  V .   
   176   34 B V  H  < S+     0   0    2 2312   61                            V                                 VV  V .   
   177   35 B Y  S >< S-     0   0   26 2312   13                            Y                                 YY  Y .   
   178   36 B P  T 3   +     0   0   29 2313    0                            P                                 PP  P .   
   179   37 B W  T 3  S+     0   0   22 2313   94                            W                                 WW  W .   
   180   38 B T  S X  S+     0   0    3 2313    3                            T                                 TT  T .   
   181   39 B Q  G >  S+     0   0   40 2313   46                            Q                                 QQ  Q .   
   182   40 B R  G 3  S+     0   0   64 2316   69                            R                                 RR  R R   
   183   41 B F  G <  S+     0   0   60 2316    8                            F                                 FF  F F   
   184   42 B F    X   +     0   0   26 2316    0                            F                                 FF  F F   
   185   43 B D  T 3  S+     0   0  125 2315   68                            D                                 DD  D D   
   186   44 B S  T 3  S+     0   0  109 2316   73                            T                                 NT  S S   
   187   45 B F  S <  S-     0   0   34 2315    6                            F                                 FF  F F   
   188   46 B G        +     0   0   57 2304   43                            G                                 GG  G G   
   189   47 B N        +     0   0  101 1087   32                            N                                 NN  N S   
   190   48 B L        +     0   0   18 1086    4                            L                                 LL  L L   
   191   49 B S        +     0   0   87 1087   39                            S                                 SS  S S   
   192   50 B S  S >> S-     0   0   64 1089   48                            S                                 SS  S S   
   193   51 B A  H 3> S+     0   0   28 1160   49                            A                                 SA  A P   
   194   52 B S  H 3> S+     0   0  104 1382   69                            S                                 SS  S S   
   195   53 B A  H <4 S+     0   0   24 2309   70                            A                                 AA  A A   
   196   54 B I  H  < S+     0   0    2 2309   82                            I                                 II  I I   
   197   55 B M  H  < S+     0   0   39 2309   88                            M                                 MM  M M   
   198   56 B G  S  < S+     0   0   41 2311   27                            G                                 GG  G G   
   199   57 B N     >  -     0   0   13 2313   52                            N                                 NN  N N   
   200   58 B P  H  > S+     0   0   95 2311   53                            P                                 PP  P P   
   201   59 B K  H  > S+     0   0  126 2313   69                            R                                 KR  K K   
   202   60 B V  H  > S+     0   0    1 2312   13                            V                                 VV  V V   
   203   61 B K  H  X S+     0   0  112 2311   50                            K                                 KK  K K   
   204   62 B A  H  X S+     0   0   53 2312   51                            A                                 AA  A A   
   205   63 B H  H  X S+     0   0   62 2314    5                            H                                 HH  H H   
   206   64 B G  H  X S+     0   0    0 2314    1                            G                                 GG  G G   
   207   65 B K  H  X S+     0   0   94 2312   54                            K                                 KK  K V   
   208   66 B K  H  X S+     0   0  156 2313   28                            K                                 KK  K K   
   209   67 B V  H  X S+     0   0   40 2314    7                            V                                 VV  V V   
   210   68 B L  H  X S+     0   0    5 2314   63                            L                                 LL  L L   
   211   69 B T  H  X S+     0   0   52 2310   68                            T                                 TT  T T   
   212   70 B S  H  < S+     0   0   44 2314   47                            S                                 SS  S S   
   213   71 B L  H >X S+     0   0   17 2314   25                            F                                 FF  L L   
   214   72 B G  H >X S+     0   0   10 2314   68                            G                                 GG  G G   
   215   73 B D  H 3< S+     0   0   98 2312   70                            D                                 DD  G E   
   216   74 B A  H X4 S+     0   0    0 2314   20                            A                                 AA  A A   
   217   75 B I  H X< S+     0   0   14 2313   43                            V                                 VV  I I   
   218   76 B K  T 3< S+     0   0  162 2315   65                            K                                 KK  K K   
   219   77 B H  T X   +     0   0   96 2315   51                            N                                 HN  N N   
   220   78 B L  T <   +     0   0   17 2315   32                            L                                 ML  L L   
   221   79 B D  T 3  S+     0   0  159 2315    5                            D                                 DD  D D   
   222   80 B D    <>  +     0   0   85 2315   35                            N                                 DN  D D   
   223   81 B L  H  > S+     0   0   17 2313   25                            L                                 LL  L L   
   224   82 B K  H  > S+     0   0  143 2307   71                            K                                 KK  K K   
   225   83 B G  H  4 S+     0   0   48 2312   51                            G                                 GG  G G   
   226   84 B T  H  < S+     0   0   55 2313   57                            T                                 TT  T T   
   227   85 B F  H  X S+     0   0    7 2314   23                            F                                 FF  F F   
   228   86 B A  H  X S+     0   0   21 2315   60                            A                                 AA  A G   
   229   87 B Q  H  > S+     0   0  150 2310   74                            K                                 HK  Q Q   
   230   88 B L  H  > S+     0   0   57 2316    0                            L                                 LL  L L   
   231   89 B S  H  X S+     0   0    0 2315    2                            S                                 SS  S S   
   232   90 B E  H  X S+     0   0   81 2316   47                            E                                 EE  E E   
   233   91 B L  H  X>S+     0   0   77 2316   21                            L                                 LL  L L   
   234   92 B H  I  <>S+     0   0   33 2316    0                            H                                 HH  H H   
   235   93 B C  I  X5S+     0   0   12 2316   54                            C                                 CC  C C   
   236   94 B D  I  <5S+     0   0   66 2315   78                            D                                 DD  D D   
   237   95 B K  I  <5S+     0   0  155 2316   36                            K                                 KK  K K   
   238   96 B L  I  4   -     0   0    3 2315    2                            D                                 DD  D D   
   242  100 B P  T >> S+     0   0   17 2316    1                            P                                 PP  P P   
   243  101 B E  H 3> S+     0   0   31 2316   76                            E                                 EE  E E   
   244  102 B N  H <> S+     0   0   13 2316    2                            N                                 NN  N N   
   245  103 B F  H <> S+     0   0   22 2316    1                            F                                 FF  F F   
   246  104 B K  H  X S+     0   0  120 2316   30                            R                                 RR  R R   
   247  105 B L  H  X S+     0   0   17 2300   17                            L                                 LL  . L   
   248  106 B L  H  X S+     0   0   38 2308    2                            L                                 LL  V L   
   249  107 B G  H  X S+     0   0    6 2310   44                            G                                 GG  S G   
   250  108 B N  H  X S+     0   0   34 2311   57                            N                                 NN  T N   
   251  109 B V  H  X S+     0   0    1 2310   66                            V                                 VV  G V   
   252  110 B L  H  X S+     0   0    9 2310   23                            L                                 ML  D L   
   253  111 B V  H  X S+     0   0    0 2312   56                            V                                 VV  V V   
   254  112 B T  H  X S+     0   0    1 2312   29                            I                                 VI  S T   
   255  113 B V  H  X S+     0   0    6 2315   53                            V                                 VV  A V   
   256  114 B L  H  X S+     0   0    4 2315   24                            L                                 LL  L L   
   257  115 B A  H  X S+     0   0    0 2315   11                            A                                 AA  L A   
   258  116 B I  H  < S+     0   0   27 2307   85                            N                                 SN  P I   
   259  117 B H  H  < S+     0   0  114 2316   52                            H                                 HH  L L   
   260  118 B F  H >< S-     0   0   18 2316   62                            F                                 FF  V H   
   261  119 B G  G >< S+     0   0   17 2314   55                            G                                 GG  S G   
   262  120 B K  G 3  S+     0   0  193 2165   71                            K                                 KK  R K   
   263  121 B E  G <  S+     0   0   93 2313   44                            E                                 EE  Q E   
   264  122 B F  S <  S-     0   0    0 2313    7                            F                                 FF  L F   
   265  123 B T    >>  -     0   0   53 2311   23                            T                                 TT    T   
   266  124 B P  H 3> S+     0   0   23 2311   20                            P                                 PP    P   
   267  125 B E  H 3> S+     0   0  105 2307   52                            Q                                 EQ    E   
   268  126 B V  H <> S+     0   0   22 2310   50                            V                                 VV    V   
   269  127 B Q  H  X S+     0   0    0 2291   35                            Q                                 QQ    Q   
   270  128 B A  H  X S+     0   0   15 2300   35                            A                                 AA    A   
   271  129 B S  H  X S+     0   0    1 2302   49                            A                                 AA    S   
   272  130 B W  H  X S+     0   0    1 2304   51                            W                                 WW    W   
   273  131 B Q  H  X S+     0   0    5 2306   39                            Q                                 QQ    Q   
   274  132 B K  H  X S+     0   0  100 2304    1                            K                                 KK    K   
   275  133 B M  H  X S+     0   0    1 2301   33                            M                                 LM    M   
   276  134 B V  H  X S+     0   0    6 2303   34                            V                                 VV    V   
   277  135 B T  H  X S+     0   0   80 2301   65                            T                                 GT    A   
   278  136 B G  H  X S+     0   0   23 2301   71                            G                                 GG    G   
   279  137 B V  H  X S+     0   0   17 2298   15                            V                                 VV    V   
   280  138 B A  H  X S+     0   0    5 2297   60                            A                                 AA    A   
   281  139 B S  H  X S+     0   0   67 2291   79                            N                                 NN    S   
   282  140 B A  H  < S+     0   0    2 2289   52                            A                                 AA    A   
   283  141 B L  H  < S+     0   0   19 2272    1                            L                                 LL    L   
   284  142 B S  H >< S+     0   0   44 2267   58                            A                                 AA    G   
   285  143 B S  T 3< S+     0   0   57 2265   80                            Y                                 HY    S   
   286  144 B R  T 3  S+     0   0  128 2255   28                            K                                 KK    R   
   287  145 B Y    <         0   0   31 2246    0                            Y                                 YY    Y   
   288  146 B H              0   0  136 2186   41                            H                                 HH    H   
## ALIGNMENTS  351 -  420
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....6....:....7....:....8....:....9....:....0....:....1....:....2
     1    1 A V              0   0  136  867   26  VVVVVVV  VVVVVVVVVVVVV  V  VVVVVV  VVVVVLVVVVVV   VVVVVVVVVVVV        
     2    2 A L        -     0   0   22 1663    3  LLLLLLL  LLLLLLLLLLLLL  L  LLLLLL  LLLLLLLLLLLL   LLLLLLLLLLLL        
     3    3 A S     >  -     0   0   51 1663   48  SSSSSSS  SSSSSSSSSSSSS  S  SSSSSS  SSSSSSSSSSSS   SSSSSSSSSSSS        
     4    4 A P  H  > S+     0   0   84 1664   53  AAAPDDP  PPPPPDSSSSSAP  P  AAAAAA  PAAAAAAAAAPD   PPPPAAAASDPA        
     5    5 A A  H  > S+     0   0   62 1663   62  EEDAKNA  AATAAKKKKAAEA  A  DDDEDD  AEEDDDDDEEAN   AAAAADATKNAA        
     6    6 A D  H  > S+     0   0    8 1667   20  DDDDDDD  DDDDDDDDDDDDD  D  DDDDDD  DDDDDDDDDDDD   DDDDDDDDDDDD        
     7    7 A K  H  X S+     0   0   46 1668    8  KKKKKKK  KKKKKKKKKKKKK  K  KKKKKK  KKKKKKKNKKKK   KKKKKKKKKKKK        
     8    8 A T  H  X S+     0   0   95 1666   59  AAATTTT  TTSTTTAAANNAT  T  AAAAAA  TAAAAAAAAATT   TTTTTATAATTT        
     9    9 A N  H  X S+     0   0   43 1665   80  NNNNNNN  NNNNNNNNNNNNN  N  NNNNNN  NNNNNNNNNNNN   NNNNNNHNNNNN        
    10   10 A V  H  X S+     0   0    2 1667   12  VVIVVVI  IIVIIVIIVVVVI  I  IIIVII  IVVIIIIIVVVV   IIIIVIVVIVIV        
    11   11 A K  H  X S+     0   0   99 1668   70  KKKKKKK  KKKKKKKKKKKKK  K  KKKKKK  KKKKKKKKKKKK   KKKKKKKKKKKK        
    12   12 A A  H  X S+     0   0   67 1669   58  TAAGAAT  TTASSATTTAAAS  S  AAAAAA  TTTAAAAAATGA   TTTTAAATTATA        
    13   13 A A  H  < S+     0   0    5 1672   61  AAATTTA  AATTTTAAACCVT  T  AAAVAA  AAAAAAAAAVTT   AAAAATFFATAS        
    14   14 A W  H  X S+     0   0   22 1672    7  WLWWWWW  WWWWWWFFFWWWW  W  WWWWWW  WWWWWWWWWWWW   WWWWWWWWFWWW        
    15   15 A G  H  < S+     0   0   51 1672   52  GSGASSE  EEADDSGGGGGSD  D  SGGSSS  EGGGGSSSSSAS   EEEESEGGGSEE        
    16   16 A K  T  < S+     0   0  111 1673    8  KKKKKKK  KKKKKKKKKKKKK  K  KKKKKK  KKKKKKKKKKKK   KKKKKKKKKKKK        
    17   17 A V  T >4 S+     0   0    1 1676   26  IIIIVVI  IIIIIVIIIIILI  I  IIINII  IIIIIIIIIIIV   IIIIVIVLIVIL        
    18   18 A G  T 3< S+     0   0   49 1676   66  GGGGGGG  GGGGGGGGGGGGG  G  GGGGGG  GGGGGGGGGGGG   GGGGGGGGGGGG        
    19   19 A A  T 3  S+     0   0   96 1676   70  GGGNDDS  SSNGGDGGGSSGG  G  GGGGGV  SGGGGGGGGGND   SSSSGGGGGDSG        
    20   20 A H  S <> S+     0   0   92 1674   65  HHHHHHH  HHHHHHHHHHHHH  H  HHHHHH  HHHHHHHHHHHH   HHHHNHHHHHHH        
    21   21 A A  H  > S+     0   0    6 1158   58  RGGSAAG  GGGAAAAAAAAGA  A  HGGRHH  GGGGGHHHGRSA   GGGGAGAGAAGP        
    22   22 A G  H  > S+     0   0   19 1159   49  AAAASSG  GGAGGSAAAGGAG  G  AAAAAA  GAAAAAAAAAAS   GGGGGAAGASGG        
    23   23 A E  H  > S+     0   0  120 1676   42  EEEEDDE  EEEDDDDDDEEED  D  EEEEEE  EEEEEEEEEEED   EEEEEEEEDDEA        
    24   24 A Y  H  X S+     0   0   23 1676   70  YYYYYYY  YYYYYYYYYYYYY  Y  YYYYYY  YYYYYYYYYYYY   YYYYFYFYYYYF        
    25   25 A G  H  X S+     0   0    4 1676    6  GGGGVVG  GGGGGVGGGGGGG  G  GGGGGG  GGGGGGGGGGGV   GGGGGGGGGVGG        
    26   26 A A  H  X S+     0   0   15 1676   45  AAAAAAA  AAAGGAAAAAAAG  G  AAAAAA  AAAAAAAAAAAA   AAAAAAAGAAAG        
    27   27 A E  H  X S+     0   0   45 1676    7  EEEEEEE  EEEEEEEEEEEEE  E  EEEEEE  EEEEEEEEEEEE   EEEEEEEEEEEE        
    28   28 A A  H  X S+     0   0    0 1674   28  AAAAAAA  AAAAAAAAAAAAA  A  AAAAAA  AAAAAAAAAAAA   AAAAAAAAAAAA        
    29   29 A L  H  X S+     0   0    4 1677    2  LLLLLLV  LLLLLLLLLLLLL  L  LLLLLL  VLLLLLLLLLLL   VVLLLLLLLLVL        
    30   30 A E  H  X S+     0   0   36 1677   56  GEEEEEE  EEEDDEEEEEEGD  D  EEEGEG  EGGEEEEEEGEE   EEEEEEEDEEED        
    31   31 A R  H  X S+     0   0    3 1678    1  RRRRRRR  RRRRRRRRRRRRR  R  RRRRRR  RRRRRRRRRRRR   RRRRRRRRRRRR        
    32   32 A M  H  X S+     0   0   11 1677   19  MMMMMMM  MMMTTMMMMTTMT  T  MMMMMM  MMMMMMMMMMMM   MMMVMMMMMMMM        
    33   33 A F  H  < S+     0   0   11 1667   15  FFFFFFF  FFFFFFFFFFFFF  F  FFFFFF  FFFFFFFFFFFF   FFFFFFFFFFFF        
    34   34 A L  H  < S+     0   0   58 1672   64  ESCIFFL  LLMQQFLLLCCEQ  Q  SCECSC  LEEECSSSESIF   LLLLLAAQLFLL        
    35   35 A S  H  < S+     0   0   15 1674   70  SSSNSSG  GGNSSSGGGSSSS  S  SSSSSS  GSSSSSSSSSNS   GGGGGSSAGSGS        
    36   36 A F    ><  +     0   0   36 1674   14  HFFFFFF  FFFFFFFFFFFHF  F  FFHFFF  FHHHFFFFHFFF   FFFFFFFHFFFF        
    37   37 A P  G >  S+     0   0   44 1674    0  PPPPPPP  PPPPPPPPPPPPP  P  PPPPPP  PPPPPPPPPPPP   PPPPPPPPPPPP        
    38   38 A T  G >  S+     0   0   37 1674  100  TTTSTTT  TTSTTTTTTTTTT  T  TTTTTT  TTTTTTTTTTST   TTTTTTPTTTTT        
    39   39 A T  G X  S+     0   0    3 1674    2  TTTTTTT  TTTTTTTTTTTTT  T  TTTTTT  TTTTTTTTTTTT   TNTTTTTTTTTT        
    40   40 A K  G X  S+     0   0   64 1674   41  KKKKKKK  KKKKKKKKKKKKK  K  KKKKKK  KKKKKKKKKKKK   KKKKKKKKKKKK        
    41   41 A T  G <  S+     0   0    7 1675   64  TTTTTTT  TTTTTTTTTTTTT  T  TTTTTT  TTTTTTTTTTTT   TTTTTTTTTTTT        
    42   42 A Y  G <  S+     0   0   16 1675    3  YYYYYYY  YYYYYYYYYYYYY  Y  YYYYYY  YYYYYYYYYYYY   YYYYYYYYYYYY        
    43   43 A F    X   +     0   0   31 1676    0  FFFFFFF  FFFFFFFFFFFPF  F  FFFFFF  FFFFFFFFFFFF   FFFFFFFFFFFF        
    44   44 A P  T 3  S+     0   0   70 1676   66  PHPSPPP  PPPPPPPPPPPFP  P  PPPPPP  PPPPPPPPPPSP   PPPPPPSPPPPH        
    45   45 A H  T 3  S+     0   0  122 1676   59  HHHHHHH  HHHHHHHHHHHHH  H  HHHHHH  HHHHHHHHHHHH   HHHHHHHHHHHH        
    46   46 A F  S <  S-     0   0   44 1676    8  FFFFFFF  FFFFFFFFFFFFF  F  FFFFFF  FFFFFFFFFFFF   FFFFFFMFFFFF        
    47   47 A D        -     0   0   81 1676   46  DDDDDDD  DDDDDDDDDDDDD  D  DDDDDD  DDDDDDDDDDDD   DDDDDDDDDDDD        
    48   48 A L        +     0   0   55 1674   66  VVVLLLF  LLLLLLLLLLLVL  L  VVVVVV  FVVVVVVVVVLL   FFFLLVLLLLFL        
    49   49 A S  S >  S-     0   0   58 1674   83  SSSGSST  SSGSSSSSSSSSS  S  SSSSSS  TSSSSSSSSSGG   TTTTSSSNSGTS        
    50   50 A H  T 3  S+     0   0  150 1674   86  HHHHHHH  HHHPPHHHHHHHP  P  PHHHPH  HHHHHPPPHHHH   HHHHHHHPHHHP        
    51   51 A G  T 3  S+     0   0   40 1676   21  GGGGGGG  GGDGGGGGGGGGG  G  GGGGGG  GGGGGGGGGGGG   GGGGGGGGGGGG        
    52   52 A S    X>  -     0   0   13 1677   46  SSSSSSS  SSSSSSSSSSSSS  S  SSSSSS  SSSSSSSSSSSS   SSSSSSSSSSSS        
    53   53 A A  H 3> S+     0   0   80 1675   50  AAAAGGE  EEAAAGAAAAAAA  A  AAAAAA  EAAAAAAAAAAG   EEEEAAAAAGES        
    54   54 A Q  H 3> S+     0   0   86 1677   56  QQQQQQQ  QQQQQQQQQQQQQ  Q  QQQQQQ  QQQQQQQQQQQQ   QQQQQQQQQQQN        
    55   55 A V  H <> S+     0   0   12 1676   15  VLVIVVI  IIVVVVVVVVVVV  V  VVVVVV  IVVVVVAVVVIV   IIIIVVVVVVIL        
    56   56 A K  H  X S+     0   0  130 1677   25  KKKKKKK  KKKKKKKKKQQKK  K  KKKKKK  KKKKKKKKKKKK   KKKKKKKKKKKK        
    57   57 A G  H  X S+     0   0   37 1678   52  GGAGGGA  TAGAAGAAAATGA  A  TTTTTT  ATTTTTTTTGGA   AAATASAGAAAT        
    58   58 A H  H  X S+     0   0   53 1678    7  HHHHHHH  HHHHHHHHHHHHH  H  QQQQQQ  HQQQQQQQQHHH   HHHHHHHHHHHH        
    59   59 A G  H  X S+     0   0    0 1678    1  GVGGGGG  GGGGGGGGGGGGG  G  GGGGGG  GGGGGGGGGGGG   GGGGGGGGGGGG        
    60   60 A K  H  X S+     0   0  132 1677   49  AAGKKKK  KKKKKKKKKQQKK  K  AAAAAA  KAAAAAAAAAKK   KKKKKKKKKKKK        
    61   61 A K  H  X S+     0   0  166 1677   22  KKKKKKK  KKKKKKKKKKKKK  K  KKKKKK  KKKKKKKKKKKK   KKKKKKKKKKKK        
    62   62 A V  H  X S+     0   0   31 1677    6  VVVVVVV  VVVVVVVVVVVVV  V  VVVVVV  VVVVVVVVVVVV   VVVVVVVVVVVV        
    63   63 A A  H  X S+     0   0    1 1677   69  AAAAGGS  SSAAAGGGGAAAA  A  AAAAAA  SAAAAAAAAAAG   SSSSGAAAGGSA        
    64   64 A D  H  X S+     0   0   83 1677   63  DDDDEEE  EEDDDEDDDDDDD  D  DDDDDD  EDGDDDDDDDDE   EEEEDDDDDEED        
    65   65 A A  H  X S+     0   0   23 1678   36  AAAAAAA  AAAAAAAAAAAAA  A  AAAAAA  AAAAAAAAAAAA   AAAAAAAAAAAA        
    66   66 A L  H  X S+     0   0   15 1678   27  LLLLLLL  LLLLLLLLLLLLL  L  LLLLLL  LLLLLLLLLLLL   LLLLLLLLLLLL        
    67   67 A T  H  X S+     0   0   52 1678   69  AAATTTT  TTTTTTTTTTTAT  T  AAAAAA  TAAAAAAAAATT   TTTTTATTTTTA        
    68   68 A N  H  X S+     0   0   60 1678   62  TTTKQQK  KKKTTQKKKKKTT  T  TTTTTT  KTTTTTTTTTKQ   KKKKLNLTKQKN        
    69   69 A A  H  < S+     0   0    0 1678   26  AAAAAAA  AAAAAAAAAAAAA  A  AAAAAA  AAAAAAAAAAAA   AAAAAAAAAAAA        
    70   70 A V  H >< S+     0   0   10 1678   47  AAAVVVV  VVVVVVAAAVVAV  V  AAAAAA  VAAAAAAAAAVV   VVVVVAVVAVVA        
    71   71 A A  H 3< S+     0   0   71 1678   70  DGGGGGG  GGGAAGDDDVASA  A  DDDDDD  GSSDDDDDDGGG   GGGGGHGNDGGG        
    72   72 A H  T >< S+     0   0   84 1678   50  NHHHHHH  HHHHHHHHHHHHH  H  NNNNNN  HHHNNNNNNHHH   HHHHHHHNHHHH        
    73   73 A V  T <  S+     0   0   14 1678   26  LLLILLL  LLMLLLLLLIILL  L  LLLLLL  LLLLLLLLLLIL   LLLLLLLLLLLL        
    74   74 A D  T 3  S+     0   0  114 1678    3  DDDDDDD  DDDDDDDDDNNDD  D  DDDDDD  DDDDDDDDDDDD   DDDDDDDDDDDD        
    75   75 A D  S X> S+     0   0   85 1678   30  DDDNDDD  DDNDDDDDDDNDD  D  DDDEDD  DDDDDDDDDDND   DDDDDDDDDDDD        
    76   76 A M  H 3>  +     0   0   13 1678   19  LLLLLLL  LLLLLLLLLLLLL  L  LLLLLL  LLLLQLLLLLLL   LLLLLLLVLLLL        
    77   77 A P  H 34 S+     0   0   69 1672   78  PPPPPPP  PPLPPPPPPPPPP  P  PPPPPP  PPPPPPPPPPPP   PPPPPPPPPPPP        
    78   78 A N  H X4 S+     0   0   91 1678   38  GSADSSG  GGDGGSSSSNNGG  G  GAGGAG  GGGGGGGGGADS   GGGGGGGGSSGG        
    79   79 A A  H 3< S+     0   0   34 1678   50  AAAAAAA  AAAAAAAAAAAAA  A  AAAAAA  AAAAAAAAAAAA   AAAAAAAAAAAA        
    80   80 A L  T 3X S+     0   0    5 1678   14  LLLLLLL  PLLLLLLLLLLLL  L  LLLLLL  LLLLLLLLLLLL   LLLLLLLLLLLL        
    81   81 A S  H <> S+     0   0   43 1678   57  SSSSSSS  SFSSSSSSSSSSS  S  SSSSSS  SSSSSSSSSSSS   SSSSSSSSSSSS        
    82   82 A A  H  > S+     0   0   77 1678   70  AAAEAAA  TTDAAAAAADDAA  A  AAAAAA  TAAAAAAAAAEA   TTTANATAAATT        
    83   83 A L  H  > S+     0   0   54 1678    0  LLLLLLL  LLLLLLLLLLLLL  L  LLLLLL  LLLLLLLLLLLL   LLLLLLLLLLLL        
    84   84 A S  H  X S+     0   0    3 1677    3  SSSSSSS  SSSSSSSSSSSSS  S  SSSSSS  SSSSSSSSSSSS   SSSSSSSSSSSS        
    85   85 A D  H  X S+     0   0   67 1678   28  NDDDDDD  DDDDDDDDDDDDD  D  DDDDDD  DDDDDDDDDDDD   DDDGDDDDDDDD        
    86   86 A L  H >X>S+     0   0   68 1678    8  LLLLLLL  LLLLLLLLLLLLL  L  LLLLLL  LLLLLLLLLLPL   LLLLLLLLLLLL        
    87   87 A H  I 3<>S+     0   0   41 1678    0  HHHHHHH  HHHHHHHHHHHHH  H  HHHHHH  HHHHHHHHHHHH   HHHHHHHHHHHH        
    88   88 A A  I 3<5S+     0   0    6 1678   45  AAAAAAA  AAAAAAAAAAAAA  A  AAAAAA  AAAAAAAAAAAA   AAAAAAAAAAAA        
    89   89 A H  I <<5S+     0   0  111 1678   83  HHHHHHH  HHHYYHHHHYYHY  Y  HHHHHH  HHHHHHHHHHHH   HHHHHHHHHHHH        
    90   90 A K  I  <5S+     0   0  162 1678   37  KKKKKKK  KKKKKKKKKKKKK  K  KKKKKK  KKKKKKKKKKKK   KKKKKKKKKKKK        
    91   91 A L  I      -     0   0    3 1677    2  DDDDDDD  DDDDDDDDDDDDD  D  DDDDDD  DNDNDDDDDDDD   DDDDDDDDDDDD        
    95   95 A P  T >> S+     0   0   40 1677    0  PPPPPPP  PPPPPPPPPPPPP  P  PPPPPP  PPPPPPPPPPPP   PPPPPPPPPPPP        
    96   96 A V  H 3> S+     0   0   56 1677   76  VVVVVVV  VVAVVVVVVVVVV  V  VVVVVV  VVVVVVVVVVVV   VVVVVVVVVVVV        
    97   97 A N  H <> S+     0   0   10 1676    1  NNNNNNN  NNNNNNNNNNNNN  N  NNNNNN  NNNNNNNNNNNN   NNNNNNNNNNNN        
    98   98 A F  H <> S+     0   0   23 1678    0  FFFFFFF  FFFFFFFFFFFFF  F  FFFFFF  FFFFFFFFFFFF   FFFFFFFFFFFF        
    99   99 A K  H  X S+     0   0  129 1678   26  KKKKKKK  KKKKKKKKKKKKK  K  KKKKKK  KKKKKKKKKKKK   KKKKKKKKKKKK        
   100  100 A L  H  X S+     0   0   20 1675   16  LLLLLLL  LLLLLLLLLFFLL  L  LLLLLL  LLLLLLLLLLLL   LLLLVLFLLLLL        
   101  101 A L  H  X S+     0   0   40 1677    2  LLLLLLL  LLLLLLLLLLLLL  L  LLLLLL  LLLLLLLLLLLL   LLLLSLLLLLLL        
   102  102 A S  H  X S+     0   0   16 1677   44  SSSSSSS  SSSSSSSSSSSSS  S  SSSSSS  SSSSSSSSSSSS   SSSSPGSSSSSS        
   103  103 A H  H  X S+     0   0   16 1677   45  HHHHHHH  HHHHHHHHHHHHH  H  HHHHHH  HHHHHHHHHHHH   HHHHGHHHHHHH        
   104  104 A C  H  X S+     0   0    0 1676   70  CCCCCCC  CCCCCCCCCCCCC  C  CCCCCC  CCCCCCCCCCCC   CCCCACCCCCCC        
   105  105 A L  H  X S+     0   0   11 1676   23  LLLLLLL  LLLLLLLLLLLLL  L  LLLLLL  LLLLLLLLLLLL   LLLLGLLLLLLL        
   106  106 A L  H  X S+     0   0    2 1677   44  LLLLLLL  LLLLLLLLLLLLL  L  LQLLLL  LLLLQLLLQQLL   LLLLLLLLLLLL        
   107  107 A V  H  X S+     0   0    0 1677   30  VVVVVVV  VVVVVVVVVVVVV  V  VVVVVV  VVVVVVVVVVVV   VVVVSVVVVVVV        
   108  108 A T  H  < S+     0   0    1 1677   51  TTTTTTT  TTTTTTTTTTTTT  T  TTTTTT  TTTTTTTTTTTT   TTTTTTTTTTTT        
   109  109 A L  H >X S+     0   0    4 1677   20  LLLSLLL  LMLLLLVVVLLLL  L  LLLLLL  MLLLLLLLLLSL   LLMLLLLLVLLL        
   110  110 A A  H 3< S+     0   0    0 1677   13  AAAASSA  AAAAASAAAAAAA  A  AAAAAA  AAAAAAAAAAAS   AAAAAAAAASAA        
   111  111 A A  T 3< S+     0   0   10 1675   90  AAALSSN  NNLCCSAAACCAC  C  ARSAAA  NSSSSAAASSLS   NNNNVTCLASNA        
   112  112 A H  T <4 S+     0   0   53 1678   39  HHHHHHH  HHHHHHHHHHHHH  H  HHHHHH  HHHHHHHHHHHH   HHHHHHHHHHHH        
   113  113 A L  S >X S-     0   0    3 1678   63  HLQLQQH  HHLHHQHHHHHHH  H  QQQHLL  HQQQQQQQQQLQ   HHHHLLLHHQHM        
   114  114 A P  T 34 S+     0   0   90 1678   50  PPPPPPP  PPPPPPPPPPPPP  P  PPPPPP  PPPPPPPPPPPP   PPPPPQPPPPPP        
   115  115 A A  T 34 S+     0   0   80 1590   72  AS.ATTS  SSATTTGGGEEAN  T  ...ASS  S.........AT   SSSSNADAGTSA        
   116  116 A E  T <4 S+     0   0   79 1678   38  DDEDEEE  EEEEEEDDDEEEE  E  EEEDDD  EEEEEEEEEEDE   EEEEDGDDDEED        
   117  117 A F     <  +     0   0    8 1678    7  FFFFFFF  FFFFFFFFFFFFF  F  FFFFFF  FFFFFFFFFFFF   FFFFFLFFFFFF        
   118  118 A T     >  -     0   0   62 1678   18  TTTTTTT  TTTTTTTTTTTTT  T  TTTTTT  TTTTTTTTTTTT   TTTTTTTTTTTT        
   119  119 A P  H  > S+     0   0   22 1678   12  PPPPPPP  PPPPPPPPPPPPP  P  PPPPPP  PPPPPPPPPPPP   PPPPPPPPPPPP        
   120  120 A A  H  > S+     0   0   35 1677   58  AAASEEA  AASAAEAAAAAAA  A  AAAAAA  AAAAAAAAAASE   AAAAAAAAAEAA        
   121  121 A V  H  > S+     0   0   17 1677   38  VVGVVVV  VVVVVVVVVVVAV  V  VVVVVV  VVVVVVVVVVVV   VVVGVAVVVVVV        
   122  122 A H  H  X S+     0   0    2 1676   32  HHAHHHH  HHHHHHHHHHHHH  H  HHHHHH  HHHHHHHHHHHH   HHHHHHHHDHHH        
   123  123 A A  H  X S+     0   0   16 1676   34  AARAAAA  AAAAAAAAAAAAA  A  AAAAAA  AAAAAAAAAAAA   AAAVAAAAAAAA        
   124  124 A S  H  X S+     0   0    3 1676   45  SSSSSSS  SSSSSSSSSSSSS  S  SSSSSS  SSSSSSSSSSSS   SSSSSSSSSSSS        
   125  125 A L  H  X S+     0   0    3 1676   46  LLLLLLL  LLLLLLLLLLLLL  L  LLLLLL  LLLLLLLLLLLL   LLLLLLMLLLLL        
   126  126 A D  H  X S+     0   0   21 1676   30  DDDDDDD  DDDDDDDDDDDDD  D  DDDDDD  DDDDDDDDDDDD   DDDDDDDDDDDD        
   127  127 A K  H  X S+     0   0   36 1676    0  KKKKKKK  KKKKKKKKKKKKK  K  KKKKKK  KKKKKKKKKKKK   KKKKKKKKKKKK        
   128  128 A F  H  X S+     0   0    2 1676   41  FFFFFFF  FFFFFFFFFFFFF  F  FFFFFF  FFFFFFFFFFFF   FFFFFFFFFFFF        
   129  129 A L  H  X S+     0   0    7 1676   33  LLLLLLL  LLLFFLLLLFFLF  F  LLLLLL  LLLLLLLLLLLL   LLLLLLMLLLLL        
   130  130 A A  H  X S+     0   0   39 1676   54  AAAASSA  AAATTSAATSSAT  T  AAAAAA  AAAAAAAAAAAS   AAAASAAAASAA        
   131  131 A S  H  X S+     0   0   29 1676   65  SSSSNNN  NNSAANNNNAASA  A  SSSSSS  NSSSSSSSSSSN   NNNNTSGTNNNS        
   132  132 A V  H  X S+     0   0    9 1676   11  VVVVVVV  VVVVVVVVVVVVV  V  VVVVVV  VVVVVVVVVVVV   VVVVVVVVVVVV        
   133  133 A S  H  X S+     0   0   17 1675   49  SSSSSSS  GSSSSSSSSSSSS  S  SSSSSS  SSSSSSSSSSSS   SSSSSSSASSSS        
   134  134 A T  H  X S+     0   0   88 1674   74  TTTTTTT  TTTTTTTTTTTTT  T  TTTTTT  TTTTTTTTTTTT   TTTTTTTTTTTT        
   135  135 A V  H  < S+     0   0   21 1675   55  VVVVVVV  VVVVVVVVVVVVV  V  VVVVVV  VVVVVVVVVVVV   VVVVVVVVVVVV        
   136  136 A L  H  < S+     0   0   19 1674    0  LLLLLLL  LLLLLLLLLLLLL  L  LLLLLL  LLLLLLLLLLLL   LLLLLLLLLLLL        
   137  137 A T  H >< S+     0   0   42 1674   54  TTTTTTT  TTTTTTTTTTTTT  T  TTTTTT  TTTTTTTTTTTT   TTTTTTVTTTTT        
   138  138 A S  T 3< S+     0   0   57 1669   77  SSSSSSS  SSSSSSSSSSSSS  S  SSSSSS  SSSSSSSSSSSS   SSSSSSSSSSSS        
   139  139 A K  T 3  S+     0   0   77 1669   12  KKKKKKK  KKKKKKKKKKKKK  K  KKKKKK  KKKKKKKKKKKK   KKKKKKKKKKKK        
   140  140 A Y    <         0   0   19 1666    0  YYYYYYY  YYYYYYYYYYYYY  Y  YYYYYY  YYYYYYYYYYYY   YYYYYYYYYYYY        
   141  141 A R              0   0   75 1644   37  RRRRRRR  RRRRRRRRRRRRR  R  RRRRRR  RRRRRRRRRRRR   RRRRRRRRRRRR        
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41                                                                        
   144    2 B H        -     0   0  151 1032   46         NH             HH HH      HH            HHH            HHHHHHHH
   145    3 B F        -     0   0   37 2258   27         FF             FF FF      FF            FFF            FFFFFFFF
   146    4 B T    >>  -     0   0   75 2258   47         TT             TT ST      TT            TTT            TTTTTTTT
   147    5 B E  H 3> S+     0   0  133 2262   54         AA             AA AG      AA            AAS            AAAAAAAA
   148    6 B E  H 3> S+     0   0  151 2265   64         EE             EE EE      EE            EEE            EEEEEEEE
   149    7 B D  H X> S+     0   0   26 2283   21         ED             ED EE      EE            EEE            EEEEEEEE
   150    8 B K  H 3X S+     0   0   82 2285   24         KK             KK KK      KK            KKK            KKKKKKKK
   151    9 B A  H 3X S+     0   0   51 2283   64         GA             AA AA      NA            AAS            AASATSAA
   152   10 B T  H < S+     0   0    5 2293   58         LL             LM LV      LL            LLL            LLLLVLLL
   157   15 B W  G >< S+     0   0   32 2299    7         WW             WW WW      WW            WWW            WWWWWWWW
   158   16 B G  G 3  S+     0   0   69 2299   51         SR             GR GG      GG            GGG            GGGGGGGG
   159   17 B K  G <  S+     0   0  109 2303   19         KK             QK KK      KK            KKK            KKKKKKKK
   160   18 B V    <   -     0   0   19 2307   28         VV             VV VV      VV            VMA            VMVVVVVV
   161   19 B N     >  -     0   0   97 2308   63         NN             NN NN      NN            NNN            NNNNNNNN
   162   20 B V  H  > S+     0   0   26 2306   77         VV             VV VV      VV            VVV            VVVVVVVV
   163   21 B E  H  > S+     0   0   84 2303   46         EE             EE EE      EE            EEE            EEEEEEEE
   164   22 B D  H  4 S+     0   0   90 2307   47         DE             EE DE      EE            EEE            EEEEEEEE
   165   23 B A  H  X S+     0   0   13 2309   68         IT             TA AA      AD            AAM            AAAATADA
   166   24 B G  H  X S+     0   0    0 2309    5         GG             GG GG      GG            GGG            GGGGGGGG
   167   25 B G  H  X S+     0   0    5 2309   51         GG             GG GG      SG            GGG            GGGGGGGG
   168   26 B E  H  > S+     0   0   52 2309   25         EE             EE EE      EE            EEE            EEEEEEEE
   169   27 B T  H  X S+     0   0    4 2307   28         AT             AT AA      AA            AAT            AAAAAAAA
   170   28 B L  H  X S+     0   0    7 2310    2         LL             LL LL      LL            LLL            LLLLLLLL
   171   29 B G  H  X S+     0   0    0 2310   62         GG             GG GG      GG            GGG            GGGGGGGG
   172   30 B R  H  X S+     0   0    8 2309    2         RR             RR RR      RR            RRR            RRRRRRRR
   173   31 B L  H  X S+     0   0   12 2309   37         LL             LL LL      LL            LLL            LLLLLLLL
   174   32 B L  H  < S+     0   0    0 2309   14         LL             LL LL      LL            LLL            LLLLLLLL
   175   33 B V  H  < S+     0   0   26 2310   56         VV             VV VV      VV            VVV            VVVVVVVV
   176   34 B V  H  < S+     0   0    2 2312   61         VV             VV VV      VV            VVV            VVVVVVVV
   177   35 B Y  S >< S-     0   0   26 2312   13         YY             YY YY      YY            YYY            YYYYYYYY
   178   36 B P  T 3   +     0   0   29 2313    0         PP             PP PP      PP            PPP            PPPPPPPP
   179   37 B W  T 3  S+     0   0   22 2313   94         WW             WW WW      WW            WWW            WWWWWWWW
   180   38 B T  S X  S+     0   0    3 2313    3         TT             TT TT      TT            TTT            TTTTTTTT
   181   39 B Q  G >  S+     0   0   40 2313   46         QQ             QQ QQ      QQ            QQQ            QQQQQQQQ
   182   40 B R  G 3  S+     0   0   64 2316   69         RR             RR RR      RR            RRR            RRRRRRRR
   183   41 B F  G <  S+     0   0   60 2316    8         FF             FF FF      FF            FFF            FFFFFFFF
   184   42 B F    X   +     0   0   26 2316    0         FF             FF FF      FF            FFF            FFFFFFFF
   185   43 B D  T 3  S+     0   0  125 2315   68         DD             DD DD      DD            DDD            DDDDDDDD
   186   44 B S  T 3  S+     0   0  109 2316   73         SN             TS NN      ST            SNS            SNSNSSTS
   187   45 B F  S <  S-     0   0   34 2315    6         FF             FF FF      FF            FFF            FFFFFFFF
   188   46 B G        +     0   0   57 2304   43         GG             GG GG      GG            GGG            GGGGGGGG
   189   47 B N        +     0   0  101 1087   32         NN             NN NN      NN            NNN            NNNNNNNN
   190   48 B L        +     0   0   18 1086    4         LL             LL LL      LL            LLL            LLLLLLLL
   191   49 B S        +     0   0   87 1087   39         SS             SS SS      SS            SSS            SSSSSSSS
   192   50 B S  S >> S-     0   0   64 1089   48         SS             SS SS      SS            SSS            SSSSSSSS
   193   51 B A  H 3> S+     0   0   28 1160   49         AA             AA AA      PA            APP            APAAAAAA
   194   52 B S  H 3> S+     0   0  104 1382   69         SS             SS SS      SS            SSS            SSSSSSSS
   195   53 B A  H <4 S+     0   0   24 2309   70         AA             AA AA      AA            AAA            AAAAAAAA
   196   54 B I  H  < S+     0   0    2 2309   82         II             II II      II            III            IIIIIIII
   197   55 B M  H  < S+     0   0   39 2309   88         MM             MM MM      MM            MLM            MLMMLMMM
   198   56 B G  S  < S+     0   0   41 2311   27         GG             GG GG      GG            GGG            GGGGGGGG
   199   57 B N     >  -     0   0   13 2313   52         NN             NN NN      NN            NNN            NNNNNNNN
   200   58 B P  H  > S+     0   0   95 2311   53         PP             PP PP      PP            PPP            PPPPPPPP
   201   59 B K  H  > S+     0   0  126 2313   69         RK             RK KK      KK            KKK            KKKKKKKK
   202   60 B V  H  > S+     0   0    1 2312   13         VV             VV VV      VV            VVV            VVVVVVVV
   203   61 B K  H  X S+     0   0  112 2311   50         KK             KK KK      KK            KKK            KKKKKKKK
   204   62 B A  H  X S+     0   0   53 2312   51         AA             AA AA      AA            AAA            AAAAAAAA
   205   63 B H  H  X S+     0   0   62 2314    5         HH             HH HH      HH            HHH            HHHHHHHH
   206   64 B G  H  X S+     0   0    0 2314    1         GG             GG GG      GG            GGG            GGGGGGGG
   207   65 B K  H  X S+     0   0   94 2312   54         KK             KK KK      KK            KKK            KKKKKKKK
   208   66 B K  H  X S+     0   0  156 2313   28         KK             KK KK      KK            KKK            KKKKKKKK
   209   67 B V  H  X S+     0   0   40 2314    7         VV             VV VV      VV            VVV            VVVVVVVV
   210   68 B L  H  X S+     0   0    5 2314   63         LL             LL LL      LL            LLL            LLLLLLLL
   211   69 B T  H  X S+     0   0   52 2310   68         TT             TT TT      TS            TTT            TTTTTTST
   212   70 B S  H  < S+     0   0   44 2314   47         SS             SS SS      SS            SSS            SSSSSSSS
   213   71 B L  H >X S+     0   0   17 2314   25         LL             FL FF      FL            FFF            FFFFLFLF
   214   72 B G  H >X S+     0   0   10 2314   68         GG             GG GG      GG            GGG            GGGGGGGG
   215   73 B D  H 3< S+     0   0   98 2312   70         DQ             DN DD      EE            EDE            EDEDEEEE
   216   74 B A  H X4 S+     0   0    0 2314   20         AA             AA AA      AA            AAA            AAAAAAAA
   217   75 B I  H X< S+     0   0   14 2313   43         IL             VL VI      VI            III            IIVVVVII
   218   76 B K  T 3< S+     0   0  162 2315   65         KK             KR KK      KK            KKK            KKKKKKKK
   219   77 B H  T X   +     0   0   96 2315   51         NK             ND NN      NN            NNN            NNNNNNNN
   220   78 B L  T <   +     0   0   17 2315   32         LI             LM ML      LM            LML            LMMMLLML
   221   79 B D  T 3  S+     0   0  159 2315    5         DD             DD DD      DD            DDD            DDDDDDDD
   222   80 B D    <>  +     0   0   85 2315   35         ND             ND NN      ND            NNN            NNNNNNDN
   223   81 B L  H  > S+     0   0   17 2313   25         LL             LL LL      LL            LLL            LLLLLLLL
   224   82 B K  H  > S+     0   0  143 2307   71         KK             KK KK      KK            KKK            KKKKKKKK
   225   83 B G  H  4 S+     0   0   48 2312   51         AS             GG GS      AG            GTG            GTGGAPGG
   226   84 B T  H  < S+     0   0   55 2313   57         AI             TA TA      TT            ATT            ATAATATA
   227   85 B F  H  X S+     0   0    7 2314   23         LF             FF FF      FF            FFF            FFFFFFFF
   228   86 B A  H  X S+     0   0   21 2315   60         AA             AS AA      AS            AAA            AAAASASA
   229   87 B Q  H  > S+     0   0  150 2310   74         KQ             KQ KK      KH            KKK            KKKKKKHK
   230   88 B L  H  > S+     0   0   57 2316    0         LL             LL LL      LL            LLL            LLLLLLLL
   231   89 B S  H  X S+     0   0    0 2315    2         SS             SS SS      SS            SSS            SSSSSSSS
   232   90 B E  H  X S+     0   0   81 2316   47         EE             EE EE      EE            EEE            EEEEEEEE
   233   91 B L  H  X>S+     0   0   77 2316   21         LL             LL LL      LL            LLL            LLLLLLLL
   234   92 B H  I  <>S+     0   0   33 2316    0         HH             HH HH      HH            HHH            HHHHHHHH
   235   93 B C  I  X5S+     0   0   12 2316   54         CC             CC CC      CC            CCC            CCCCCCCC
   236   94 B D  I  <5S+     0   0   66 2315   78         DD             DE DD      DD            DDD            DDDDDDDD
   237   95 B K  I  <5S+     0   0  155 2316   36         KK             KR KK      KR            KKK            KKKKKKRK
   238   96 B L  I  4   -     0   0    3 2315    2         DD             DD DD      DD            DDD            DDDDDDDD
   242  100 B P  T >> S+     0   0   17 2316    1         PP             PP PP      PP            PPP            PPPPPPPP
   243  101 B E  H 3> S+     0   0   31 2316   76         EE             EE EE      EE            EEE            EEEEEEEE
   244  102 B N  H <> S+     0   0   13 2316    2         NN             NN NN      NN            NNN            NNNNNNNN
   245  103 B F  H <> S+     0   0   22 2316    1         FF             FF FF      FF            FFF            FFFFFFFF
   246  104 B K  H  X S+     0   0  120 2316   30         KK             RR RR      RR            RKR            RRKRRKRR
   247  105 B L  H  X S+     0   0   17 2300   17         LL             LL LL      LL            LLL            LLLLLLLL
   248  106 B L  H  X S+     0   0   38 2308    2         LL             LL LL      LL            LLL            LLLLLLLL
   249  107 B G  H  X S+     0   0    6 2310   44         GG             GG GG      GG            GGG            GGGGGGGG
   250  108 B N  H  X S+     0   0   34 2311   57         NN             NN NN      NN            NNN            NNNNNNNN
   251  109 B V  H  X S+     0   0    1 2310   66         VI             VM VV      VV            VVV            VVVVVVVV
   252  110 B L  H  X S+     0   0    9 2310   23         LL             LL LL      IL            ILL            ILMMLMLI
   253  111 B V  H  X S+     0   0    0 2312   56         VL             VV VV      VV            VVV            VVVVVVVV
   254  112 B T  H  X S+     0   0    1 2312   29         II             II II      II            III            IIIIVIII
   255  113 B V  H  X S+     0   0    6 2315   53         VV             VI II      VV            IIV            IIIIVIVI
   256  114 B L  H  X S+     0   0    4 2315   24         LL             LM LL      LL            LLL            LLLLLLLL
   257  115 B A  H  X S+     0   0    0 2315   11         AA             AA AA      AA            AAA            AAAAAAAA
   258  116 B I  H  < S+     0   0   27 2307   85         SK             NK SS      SK            TTT            TTTTVTKT
   259  117 B H  H  < S+     0   0  114 2316   52         HH             HH HH      HH            HHH            HHHHHHHH
   260  118 B F  H >< S-     0   0   18 2316   62         FA             FF FF      FF            FFF            FFFFFFFF
   261  119 B G  G >< S+     0   0   17 2314   55         GG             GG GG      GG            GGG            GGGGGGGG
   262  120 B K  G 3  S+     0   0  193 2165   71         KE             KK KK      KK            RKK            RKKKKKKR
   263  121 B E  G <  S+     0   0   93 2313   44         EE             EE EE      EE            EEE            EEEEEEEE
   264  122 B F  S <  S-     0   0    0 2313    7         FF             FF FF      FF            FFF            FFFFFFFF
   265  123 B T    >>  -     0   0   53 2311   23         TT             TT TT      TT            TTT            TTTTTTTT
   266  124 B P  H 3> S+     0   0   23 2311   20         PP             PP PP      PP            PPP            PPPPPPPP
   267  125 B E  H 3> S+     0   0  105 2307   52         EE             QE DE      EQ            DED            DEDDEDQD
   268  126 B V  H <> S+     0   0   22 2310   50         VV             VM VV      VI            VVV            VVVVVVIV
   269  127 B Q  H  X S+     0   0    0 2291   35         QQ             QQ QQ      QQ            QQQ            QQQQHQQQ
   270  128 B A  H  X S+     0   0   15 2300   35         AA             AA AA      AA            AAA            AAAAAAAA
   271  129 B S  H  X S+     0   0    1 2302   49         AS             AS AA      AA            AAA            AAAAAAAA
   272  130 B W  H  X S+     0   0    1 2304   51         WW             WW WW      WC            WWW            WSWWWWCW
   273  131 B Q  H  X S+     0   0    5 2306   39         QQ             QQ QQ      QQ            QQQ            QQQQQQQQ
   274  132 B K  H  X S+     0   0  100 2304    1         KK             KK KK      KK            KKK            KKKKKKKK
   275  133 B M  H  X S+     0   0    1 2301   33         LL             MM LL      LM            LLL            LLLLLLML
   276  134 B V  H  X S+     0   0    6 2303   34         VM             VV VV      VV            VVV            VVVVVVVV
   277  135 B T  H  X S+     0   0   80 2301   65         AA             TA AL      SA            SSS            SSSSASAS
   278  136 B G  H  X S+     0   0   23 2301   71         GG             GG GG      GG            GAG            GAGGGGGG
   279  137 B V  H  X S+     0   0   17 2298   15         VV             VV VV      VV            VVV            VVVVVVVV
   280  138 B A  H  X S+     0   0    5 2297   60         AA             AA AA      AA            AAA            AAAAAAAA
   281  139 B S  H  X S+     0   0   67 2291   79         TN             NS TN      TT            TII            TITTSTTT
   282  140 B A  H  < S+     0   0    2 2289   52         AA             AA AA      AA            AAA            AAAAAAAA
   283  141 B L  H  < S+     0   0   19 2272    1         LL             LL LL      LL            LLL            LLLLLLLL
   284  142 B S  H >< S+     0   0   44 2267   58         SA             AA AA      LA            AGA            A AAAAAA
   285  143 B S  T 3< S+     0   0   57 2265   80         HY             YH HH      HH            HHH            H HHHHHH
   286  144 B R  T 3  S+     0   0  128 2255   28         KK             KK KK       K            KKK            K KKKKKK
   287  145 B Y    <         0   0   31 2246    0         YY             YY YY       Y            YYY            Y YYYYYY
   288  146 B H              0   0  136 2186   41         HH             HH HH       H            HHH            H HHHHHH
## ALIGNMENTS  421 -  490
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....3....:....4....:....5....:....6....:....7....:....8....:....9
     1    1 A V              0   0  136  867   26   VVV      VVVVVVVVVVVV V   VV  VVVVV                   V    V VVVVVLV 
     2    2 A L        -     0   0   22 1663    3   LLL      LLLLLLLLLLLL L   LL  LLLLL                   L   LL LLLLLLL 
     3    3 A S     >  -     0   0   51 1663   48   SSP      SSSSSSSSSSSS Y   SS  SSSSS                   S   WS SSSSSSY 
     4    4 A P  H  > S+     0   0   84 1664   53   AAA      AAAAAAAAAAAA D   PP  ADADP                   P   GA AAAAAAD 
     5    5 A A  H  > S+     0   0   62 1663   62   DDD      EEEEEDDEDDEDTT   AA  AAAEG                   G   RE EEEEEDT 
     6    6 A D  H  > S+     0   0    8 1667   20   DDD      DDDDDDDDDDDDDD   DD  DDDDD                   D   QD DDDDDDD 
     7    7 A K  H  X S+     0   0   46 1668    8   KKK      KKKKKKKKKKKKKK   KK  KKKKK                   K   KK KKKKKKK 
     8    8 A T  H  X S+     0   0   95 1666   59   AAA      AAAAAAAAAAAASS   TT  ATGTS                   S   QA AAAAAAS 
     9    9 A N  H  X S+     0   0   43 1665   80   NNN      NNNNNNNNNNNNNN   NN  HHHNN                   N   HN NNNNNNN 
    10   10 A V  H  X S+     0   0    2 1667   12   III      VVVVVIIVIIVIII   II  VVVVI                   I   QV VVVVVII 
    11   11 A K  H  X S+     0   0   99 1668   70   KKK      KKKKKKKKKKKKKK   KK  KKKKK                   K   GK KKKKKKK 
    12   12 A A  H  X S+     0   0   67 1669   58   AAA      TTTTTAATAATAAA   TT  AAATA                   A   .TATTTTTAA 
    13   13 A A  H  < S+     0   0    5 1672   61   AAA      AAVAVAAAAAVAAA   AA  FIIFA                   A   CAVAAAAAAA 
    14   14 A W  H  X S+     0   0   22 1672    7   WWW      WWWWWWWWWWWWWW   WW  WWWWW                   W   LWWSWWWWWW 
    15   15 A G  H  < S+     0   0   51 1672   52   GGS      GGSSSSSSSSSGQQ   EE  TGGGG                   G   GSSGGGGGSQ 
    16   16 A K  T  < S+     0   0  111 1673    8   KKK      KKKKKKKKKKKKKK   KK  KKKKK                   K   KKKKKKKKKK 
    17   17 A V  T >4 S+     0   0    1 1676   26   III      IIIIIIIIIINIVV   II  IVVII                   I   IIIIIIIIIV 
    18   18 A G  T 3< S+     0   0   49 1676   66   GGG      GGGGGGGGGGGGGG   GG  GGGGG                   G   GGGGGGGGGG 
    19   19 A A  T 3  S+     0   0   96 1676   70   GGV      GGGGGGGGGGGGTT   SS  GGGTG                   G   GGGGGGGGGT 
    20   20 A H  S <> S+     0   0   92 1674   65   HHH      HHHHHHHHHHHHHH   HH  HHHHQ                   Q   HHHHHHHHHH 
    21   21 A A  H  > S+     0   0    6 1158   58   GGH      GGRGGGHHHRRGAA   GG  AAATA                   A   GRRGGGGGHA 
    22   22 A G  H  > S+     0   0   19 1159   49   AAA      AAAAAAAAAAAAGG   GG  GGGGP                   P   AAAAAAAAAG 
    23   23 A E  H  > S+     0   0  120 1676   42   EEE      EEEDDEEEEEEEEE   EE  EAEEQ                   Q   EEEEEEEEEE 
    24   24 A Y  H  X S+     0   0   23 1676   70   YYY      YYYYYYYYYYYYYY   YY  YYYYY                   Y   YYYYYYYYYY 
    25   25 A G  H  X S+     0   0    4 1676    6   GGG      GGGGGGGGGGGGGG   GG  GAAGG                   G   GGGGGGGGGG 
    26   26 A A  H  X S+     0   0   15 1676   45   AAA      AAAAAAAAAAAAGG   AA  GAAGA                   A   AAAAAAAAAG 
    27   27 A E  H  X S+     0   0   45 1676    7   EEE      EEEEEEEEEEEEEE   EE  EEEEE                   E   EEEEEEEEEE 
    28   28 A A  H  X S+     0   0    0 1674   28   AAA      AAAAAAAAAAAAAA   AA  AAGAA                   A   AAAAAAAAAA 
    29   29 A L  H  X S+     0   0    4 1677    2   LLL      LLLLLLLLLLLLLL   LL  LLLLL                   L   LLLLLLLLLL 
    30   30 A E  H  X S+     0   0   36 1677   56   EEG      GGGEEEEGEEGGEE   GE  EAEEE                   E   EGGGGGGGEE 
    31   31 A R  H  X S+     0   0    3 1678    1   RRR      RRRRRRRRRRRRRR   RR  RRRRR                   R   RRRRRGRRRR 
    32   32 A M  H  X S+     0   0   11 1677   19   MMM      MMMMMMMMMMMMMM   MV  TTTMM                   M   MMMMMMMMMM 
    33   33 A F  H  < S+     0   0   11 1667   15   FFF      FFFFFFFFFFFFFF   FF  FFFFF                   F   FFFFFFFFFF 
    34   34 A L  H  < S+     0   0   58 1672   64   EEC      EEESESSESECEDD   LL  LLHLL                   L   AEEEEEEESD 
    35   35 A S  H  < S+     0   0   15 1674   70   SSS      SSSSSSSSSSSSCC   GG  SSSSS                   S   SSSSSSSSSC 
    36   36 A F    ><  +     0   0   36 1674   14   HHF      HHHFHFFHFHFHFF   FF  FFFFF                   F   FHHHHHHHFF 
    37   37 A P  G >  S+     0   0   44 1674    0   PPP      PPPPPPPPPPPPPP   PP  PPPPP                   P   PPPPPPPPPP 
    38   38 A T  G >  S+     0   0   37 1674  100   TTT      TTTTTTTTTTTTTT   TT  TTTTT                   T   TTTTTTTTTT 
    39   39 A T  G X  S+     0   0    3 1674    2   TTT      TTTTTTTTTTTTTT   TT  TTTTT                   T   TTTTTTTTTT 
    40   40 A K  G X  S+     0   0   64 1674   41   KKK      KKKKKKKKKKKKKK   KK  KKKKK                   K   KKKKKKKKKK 
    41   41 A T  G <  S+     0   0    7 1675   64   TTT      TTTTTTTTTTTTTT   TT  TTTTT                   T   TTTTTTTTTT 
    42   42 A Y  G <  S+     0   0   16 1675    3   YYY      YYYYYYYYYYYYYY   YY  YYYYY                   Y   YYYYYYYYYY 
    43   43 A F    X   +     0   0   31 1676    0   FFF      FFFFFFFFFFFFFF   FF  FFFFF                   F   FFFFFFFFFF 
    44   44 A P  T 3  S+     0   0   70 1676   66   LPP      PPPPPPPPPPPPPP   PP  PPPPP                   P   PPPPPPPPPP 
    45   45 A H  T 3  S+     0   0  122 1676   59   HHH      HHHHHHHHHHHHHH   HH  HHHHH                   H   HHHHHHHHHH 
    46   46 A F  S <  S-     0   0   44 1676    8   FFF      FFFFFFFFFFFFFF   FF  FFFFF                   F   FFFFFFFFFF 
    47   47 A D        -     0   0   81 1676   46   DDD      DDDDDDDDDDDDDD   DD  DDDDD                   D   DDDDDDDDDD 
    48   48 A L        +     0   0   55 1674   66   VVV      VVVVVVVVVVVVLM   FL  LLLLM                   M   VVVVVVVVVL 
    49   49 A S  S >  S-     0   0   58 1674   83   SSS      SSSSSSSSSSSSKS   TT  SSSSS                   S   SSSSSSSSSK 
    50   50 A H  T 3  S+     0   0  150 1674   86   HHH      HHHHHPPHPPHHPP   HH  PPHHH                   H   HHHHHHHHPP 
    51   51 A G  T 3  S+     0   0   40 1676   21   GSG      GGGGGGGSGGGSGG   GG  GGGGG                   G   GGGGGGGGGG 
    52   52 A S    X>  -     0   0   13 1677   46   SSS      SSSSSSSSSSSSSS   SS  SSSSS                   S   SSSSSSSSSS 
    53   53 A A  H 3> S+     0   0   80 1675   50   AAA      AAAAAAAAAAAAAA   EE  AAAGA                   A   AAAAAAAAAA 
    54   54 A Q  H 3> S+     0   0   86 1677   56   QQQ      QQQQQQQQQQQQQQ   QQ  QQQQQ                   Q   QQQQQQQQQQ 
    55   55 A V  H <> S+     0   0   12 1676   15   VVV      VVVVVVVVVVVVVV   II  VIIII                   I   VVVVVVVVVV 
    56   56 A K  H  X S+     0   0  130 1677   25   KKK      KKKKKKKKKKKKKK   KK  KQQKQ                   Q   KKKKKKKKKK 
    57   57 A G  H  X S+     0   0   37 1678   52   TTT      TTTTTTTTTTTTAA   AT  AGAAA                   A   GTTTTTTTTA 
    58   58 A H  H  X S+     0   0   53 1678    7   QQQ      QQQQQQQQQQQQHH   HH  HHHHH                   H   HQQQQQQQQH 
    59   59 A G  H  X S+     0   0    0 1678    1   GGG      GGGGGGGGGGGGGG   GG  GGGGG                   G   GGGGGGGGGG 
    60   60 A K  H  X S+     0   0  132 1677   49   AAA      AAAAAAAAAAAASS   KK  KKKKK                   K   KAAAAAAAAS 
    61   61 A K  H  X S+     0   0  166 1677   22   KKK      KKKKKKKKKKKKKK   KK  KKKKK                   K   KKKKKKKKKK 
    62   62 A V  H  X S+     0   0   31 1677    6   VVV      VVVVVVVVVVVVVV   VV  VVIVV                   V   VVVVVVVVVV 
    63   63 A A  H  X S+     0   0    1 1677   69   TAA      AAAAAAAAAAAAAA   SS  GAAAA                   A   AAAAAAAAAA 
    64   64 A D  H  X S+     0   0   83 1677   63   DDD      GDDDDDDDDDDDEE   EE  DDDDD                   D   DDDGDDDGDE 
    65   65 A A  H  X S+     0   0   23 1678   36   AAA      AAAAAAAAAAAAAA   AA  AAAAA                   A   AAAAAAAAAA 
    66   66 A L  H  X S+     0   0   15 1678   27   LLL      LLLLLLLLLLLLLL   LL  LLLLL                   L   LLLLLLLLLL 
    67   67 A T  H  X S+     0   0   52 1678   69   AAA      AAAAAAAAAAAATT   TT  TSGTS                   S   AAAAAAAAAT 
    68   68 A N  H  X S+     0   0   60 1678   62   TTT      TTTTTTTTTTTTKK   KK  LQQRT                   T   NTTTTTTTTK 
    69   69 A A  H  < S+     0   0    0 1678   26   AAA      AAAAAAAAAAAAAA   AA  AAAAA                   A   AAAAAAAAAA 
    70   70 A V  H >< S+     0   0   10 1678   47   AAA      AAAAAAAAAAAAVV   VV  VVVVV                   V   AAAAAAAAAV 
    71   71 A A  H 3< S+     0   0   71 1678   70   DDD      SDDDDDDDNDDDDD   GG  GAEGG                   G   GDDSDDDSDD 
    72   72 A H  T >< S+     0   0   84 1678   50   NNN      HNNNNNNNNNNNHH   HH  HHHHH                   H   HNNHNNNHNH 
    73   73 A V  T <  S+     0   0   14 1678   26   LLL      LLLLLLLLLLLLLL   LL  LLILL                   L   LLLLLLLLLL 
    74   74 A D  T 3  S+     0   0  114 1678    3   DDD      DDDDDDDDDDDDDD   DD  DDDED                   D   DDDDDDDDDD 
    75   75 A D  S X> S+     0   0   85 1678   30   DDD      DDDDDDDDDDEDDD   DD  DDDDD                   D   DDDDDDDDDD 
    76   76 A M  H 3>  +     0   0   13 1678   19   QLL      LLLLLLLLLLLLLL   LL  LLLLL                   L   LLLLLLLLLL 
    77   77 A P  H 34 S+     0   0   69 1672   78   PPP      PPPPPPPPPPPPPP   PP  PPPPP                   P   PPPPPPPPPP 
    78   78 A N  H X4 S+     0   0   91 1678   38   GGG      GGGGGGGAGGGGGG   GG  GGGGT                   T   GAGGGGGGGG 
    79   79 A A  H 3< S+     0   0   34 1678   50   AAA      AAAAAAAAAAAAAA   AA  ATTTA                   A   AAAAAAAAAA 
    80   80 A L  T 3X S+     0   0    5 1678   14   LLL      LLLLLLLLLLLLLL   LL  LLLLL                   L   LLLLLLLLLL 
    81   81 A S  H <> S+     0   0   43 1678   57   SSS      SSSSSSSSSSSSNN   FS  SSSSS                   S   SSSSSSSSSN 
    82   82 A A  H  > S+     0   0   77 1678   70   DAA      AAAAAAAAAAAAVV   TA  DKKEA                   A   AAAAAAAAAV 
    83   83 A L  H  > S+     0   0   54 1678    0   LLL      LLLLLLLLLLLLLL   LL  LLLLL                   L   LLLLLLLLLL 
    84   84 A S  H  X S+     0   0    3 1677    3   SGS      SSSSSSSSSSSSSS   SS  SSSSS                   S   SSSSSSSSSS 
    85   85 A D  H  X S+     0   0   67 1678   28   DDD      DDDDDDDDDDDDDD   DG  DDDDD                   D   DDDDDDDDDD 
    86   86 A L  H >X>S+     0   0   68 1678    8   LLL      LLLLLLLLLLLLLL   LL  LLLLL                   L   LLLLLLLLLL 
    87   87 A H  I 3<>S+     0   0   41 1678    0   HHH      HHHHHHHHHHHHHH   HH  HHHHH                   H   HHHHHHHHHH 
    88   88 A A  I 3<5S+     0   0    6 1678   45   AAA      AAAAAAAAAAAAAA   AA  AAAAA                   A   AATAAAAAAA 
    89   89 A H  I <<5S+     0   0  111 1678   83   HHH      HHHHHHHHHHHHHH   HH  HHHHH                   H   HHHHHHHHHH 
    90   90 A K  I  <5S+     0   0  162 1678   37   KKK      KKKKKKKKKKKKKK   KK  KKKRK                   K   KKKKKKKKKK 
    91   91 A L  I      -     0   0    3 1677    2   DDD      NNDDDDDDDDDDDD   DD  DDDDD                   D   DDDNNNNNDD 
    95   95 A P  T >> S+     0   0   40 1677    0   PPP      PPPPPPPPPPPPPP   PP  PPPPP                   P   PPPPPPPPPP 
    96   96 A V  H 3> S+     0   0   56 1677   76   VVV      VVVVVVVVVVVVVV   VV  VVVVA                   A   VVVVVVVVVV 
    97   97 A N  H <> S+     0   0   10 1676    1   NNN      NNNNNNNNNNNNNN   NN  NNNNN                   N   NNNNNNNNNN 
    98   98 A F  H <> S+     0   0   23 1678    0   FFF      FFFFFFFFFFFFFF   FF  FFFFF                   F   FFFFFFFFFF 
    99   99 A K  H  X S+     0   0  129 1678   26   KKK      KKKKKKKKKKKKKK   KK  KKKKK                   K   KKKKMKKKKK 
   100  100 A L  H  X S+     0   0   20 1675   16   LLL      LLLLLLLLLLLLLL   LL  LLLLL                   L   LLLLLLLLLL 
   101  101 A L  H  X S+     0   0   40 1677    2   LLL      LLLLLLLLLLLLLL   LP  LLLLL                   L   LLLLLLLLLL 
   102  102 A S  H  X S+     0   0   16 1677   44   SSS      SSSSSSSSSSSSSS   SS  GSSSS                   S   SSSSSSSSSS 
   103  103 A H  H  X S+     0   0   16 1677   45   HHH      HHHHHHHHHHHHHH   HH  HHHHH                   H   HHHHHHHHHH 
   104  104 A C  H  X S+     0   0    0 1676   70   CCC      CCCCCCCCCCCCCC   CC  CCCCC                   C   CCCCCCCCCC 
   105  105 A L  H  X S+     0   0   11 1676   23   LLL      LLLLLLLLLLLLLL   LL  VLLLI                   I   LLLLLLLLLL 
   106  106 A L  H  X S+     0   0    2 1677   44   LLL      LLLQLQQLQLLLLL   LL  LILLL                   L   LQQLLLLLQL 
   107  107 A V  H  X S+     0   0    0 1677   30   VVV      VVVVVVVVVVVVVV   VV  VVVVV                   V   VVVVVVVVVV 
   108  108 A T  H  < S+     0   0    1 1677   51   TTT      TTTTTTTTTTTTTT   TT  TTTTT                   T   TTTTTTTTTT 
   109  109 A L  H >X S+     0   0    4 1677   20   LLL      LLLLLLLLLLLLLL   ML  LLFLL                   L   LLLLLLLLLL 
   110  110 A A  H 3< S+     0   0    0 1677   13   AAA      AAAAAAAAAAAAAA   AA  AAASA                   A   AAAAAAAAAA 
   111  111 A A  T 3< S+     0   0   10 1675   90   ASS      SSASARRARAASSS   NN  LAASC                   C   SRSSSSSSSS 
   112  112 A H  T <4 S+     0   0   53 1678   39   HHH      HHHHHHHHHHHHHH   HH  HHHHH                   H   HHHHHHHHHH 
   113  113 A L  S >X S-     0   0    3 1678   63   LQQ      QQHQHQQHQLLQLL   HH  HLLLH                   H   HQQQQQQQQL 
   114  114 A P  T 34 S+     0   0   90 1678   50   PPP      PPPPPPPPPPPPSS   PP  PSGRP                   P   PPPPPPPPPS 
   115  115 A A  T 34 S+     0   0   80 1590   72   S..      ..A.A..A.SS.AA   SS  DKDEG                   G   A........A 
   116  116 A E  T <4 S+     0   0   79 1678   38   DEE      EEDEDEEDEDDEDD   EE  ADADD                   D   DEEEEEEEED 
   117  117 A F     <  +     0   0    8 1678    7   FFF      FFFFFFFFFFFFFF   FF  FLFFF                   F   FFFFFFFFFF 
   118  118 A T     >  -     0   0   62 1678   18   TTT      TTTTTTTTTTTTTT   TT  TTTTT                   T   TTTTTTTITT 
   119  119 A P  H  > S+     0   0   22 1678   12   PPP      PPPPPPPPPPPPPP   PP  PPPPP                   P   PPPPPPPPPP 
   120  120 A A  H  > S+     0   0   35 1677   58   AAA      AAAAAAAAAAAAAA   AA  AEESE                   E   AAAAAAAAAA 
   121  121 A V  H  > S+     0   0   17 1677   38   VVV      VVVVVVVVVVVVMV   VG  VVVVI                   I   VVVVVVVVVM 
   122  122 A H  H  X S+     0   0    2 1676   32   HHH      HHHHHHHHHHHHHH   HH  HHHHH                   H   HHHHHHHHHH 
   123  123 A A  H  X S+     0   0   16 1676   34   AAA      AAAAAAAAAAAAAA   AV  AAAAA                   A   AAAAAAAAAA 
   124  124 A S  H  X S+     0   0    3 1676   45   SSS      SSSSSSSSSSSSSS   SS  SSSSS                   S   SSSSSSSSSS 
   125  125 A L  H  X S+     0   0    3 1676   46   LLL      LLLLLLLLLLLLLL   LL  LMLLL                   L   LLLLLLLLLL 
   126  126 A D  H  X S+     0   0   21 1676   30   DDD      DDDDDDDDDDDDDD   DD  DDDDD                   D   DDDDDDDDDD 
   127  127 A K  H  X S+     0   0   36 1676    0   KKK      KKKKKKKKKKKKKK   KK  KKKKK                   K   KKKKKKKKKK 
   128  128 A F  H  X S+     0   0    2 1676   41   FFF      FFFFFFFFFFFFFF   FF  FFFFF                   F   FFFFFFSFFF 
   129  129 A L  H  X S+     0   0    7 1676   33   LLL      LLLLLLLLLLLLFF   LL  IFLLL                   L   LLLLLLLLLF 
   130  130 A A  H  X S+     0   0   39 1676   54   AAA      AAAAAAAAAAAAAA   AA  TAASA                   A   AAAAAAAAAA 
   131  131 A S  H  X S+     0   0   29 1676   65   SSS      SSSSSSSSSSSSTT   NN  TSASN                   N   SSSSSSSSST 
   132  132 A V  H  X S+     0   0    9 1676   11   VVV      VVVVVVVVVVVVVV   VV  VVVVV                   V   VVVVVVVVVV 
   133  133 A S  H  X S+     0   0   17 1675   49   SSS      SSSSSSSSSSSSSS   SS  SASSS                   S   SSSSSSSSSS 
   134  134 A T  H  X S+     0   0   88 1674   74   TTT      TTTTTTTTTTTTTT   TT  TTTTT                   T   TTTTTTTTTT 
   135  135 A V  H  < S+     0   0   21 1675   55   VVV      VVVVVVVVVVVVVV   VV  VVVVV                   V   VVVVVVVVVV 
   136  136 A L  H  < S+     0   0   19 1674    0   LLL      LLLLLLLLLLLLLL   LL  LLLLL                   L   LLLLLLLLLL 
   137  137 A T  H >< S+     0   0   42 1674   54   TTT      TTTTTTTTTTTTTT   TT  TTTTT                   T   TTTTTTTTTT 
   138  138 A S  T 3< S+     0   0   57 1669   77   SSS      SSSSSSSSSSSSSS   SS  SSSSS                   S   SSSSSSSSSS 
   139  139 A K  T 3  S+     0   0   77 1669   12   KKK      KKKKKKKKKKKKKK   KK  KKKKK                   K   KKKKKKKKKK 
   140  140 A Y    <         0   0   19 1666    0   YYY      YYYYYYYYYYYYYY   YY  YYYYY                   Y   YYYYYYYYYY 
   141  141 A R              0   0   75 1644   37   RRR      RRRRRRRRR RRRR   RR  RRRRR                   R   RRRRRRRRRR 
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41                                                                        
   144    2 B H        -     0   0  151 1032   46  H   HHHHNN              HHH  HH     HHHHHHHHHHHHHHHHHH  HHH          H
   145    3 B F        -     0   0   37 2258   27  F   FFFFFF              FFF  FF     FFFFFFFFFFFFFFFFFFF FFF          F
   146    4 B T    >>  -     0   0   75 2258   47  T   TTTTTT              STT  TT     TTTTTTTTTTTTTTTTTTT TTT          T
   147    5 B E  H 3> S+     0   0  133 2262   54  A   AAGAAA              PAA  TA     AAAAAAAAAAAAAAAAAAA AAA          A
   148    6 B E  H 3> S+     0   0  151 2265   64  E   EEEEEE              EEE  EE     EEEEEEEEEEEEEEEEEEE EEE          E
   149    7 B D  H X> S+     0   0   26 2283   21  E   EEEEEE              EEE  EE     EEEEEEEEEEEEEEEEEEE EEE          E
   150    8 B K  H 3X S+     0   0   82 2285   24  K   KKKKKK              KKK  KK     KKKKKKKKKKKKKKKKKKK KKK          K
   151    9 B A  H 3X S+     0   0   51 2283   64  A   AAAAGG              AAS  SA     AAAAAAAAAAAASAAAANA AAA          A
   152   10 B T  H < S+     0   0    5 2293   58  L   LLMLLL              LLL  LL     LLLLLLLLLLLLLLLLLIL LLL          L
   157   15 B W  G >< S+     0   0   32 2299    7  W   WWWWWW              WWW  WW     WWWWWWWWWWWWWWWWWWW WWW          W
   158   16 B G  G 3  S+     0   0   69 2299   51  G   GGGGSS              GNG  GS     GGGGGGGGGGGGGNGSGGG GGG          S
   159   17 B K  G <  S+     0   0  109 2303   19  K   KKKKKK              KKK  KK     KKKKKKKKKKKKKKKKKKK KKK          K
   160   18 B V    <   -     0   0   19 2307   28  V   MMMVVV              VMV  VM     MMMMMMMMMMMMVMMMMVV VVV          M
   161   19 B N     >  -     0   0   97 2308   63  N   NNNNNN              NNN  NN     NNNNNNNNNNNNNNNNNNN HNN          N
   162   20 B V  H  > S+     0   0   26 2306   77  V   VVVIVV              VVV  VV     VVVVVVVVVVVVVVVVVVV VVV          V
   163   21 B E  H  > S+     0   0   84 2303   46  E   EEEEEE              EEE  EE     EEEEEEEEEEEEEEEEEEE DEE          E
   164   22 B D  H  4 S+     0   0   90 2307   47  E   EEEEDD              EEE  EE     EEEEEEEEEEEEEEEEEEE EEE          E
   165   23 B A  H  X S+     0   0   13 2309   68  A   AAAAII              AAA  TA     AAAAAAAAAAAAAAAAATA AAA          A
   166   24 B G  H  X S+     0   0    0 2309    5  G   GGGGGG              GGG  GG     GGGGGGGGGGGGGGGGGGG GGG          G
   167   25 B G  H  X S+     0   0    5 2309   51  H   GGGGGG              GGG  GG     GGGGGGGGGGGGGGGGGGG GGG          G
   168   26 B E  H  > S+     0   0   52 2309   25  E   EEEEEE              EEE  EE     EEEEEEEEEEEEEEEEEEK EEE          E
   169   27 B T  H  X S+     0   0    4 2307   28  A   AAAAAA              AAA  TA     AAAAAAAAAAAAAASAAAA AAA          A
   170   28 B L  H  X S+     0   0    7 2310    2  L   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLLL LLL          L
   171   29 B G  H  X S+     0   0    0 2310   62  G   GGGGGG              GGG  GG     GGGGGGGGGGGGGGGGGGG GGG          G
   172   30 B R  H  X S+     0   0    8 2309    2  R   RRRRRR              RRR  RR     RRRRRRRRRRRRRRRRRRR RRR          R
   173   31 B L  H  X S+     0   0   12 2309   37  L   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLLL LLL          L
   174   32 B L  H  < S+     0   0    0 2309   14  L   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLLL LLL          L
   175   33 B V  H  < S+     0   0   26 2310   56  V   VVVVVV              VVV  VV     VVVVVVVVVVVVVVVVVVI VVV          V
   176   34 B V  H  < S+     0   0    2 2312   61  V   VVVVVV              VVV  VV     VVVVVVVVVVVVVVVVVVV VVV          V
   177   35 B Y  S >< S-     0   0   26 2312   13  Y   YYYYYY              YYY  YY     YYYYYYYYYYYYYYYYYYY YYY          Y
   178   36 B P  T 3   +     0   0   29 2313    0  P   PPPPPP              PPP  PP     PPPPPPPPPPPPPPPPPPP PPP          P
   179   37 B W  T 3  S+     0   0   22 2313   94  W   WWWWWW              WWW  WW     WWWWWWWWWWWWWWWWWWW WWW          W
   180   38 B T  S X  S+     0   0    3 2313    3  T   TTTTTT              TTT  TT     TTTTTTTTTTTTTTTTTTT TTT          T
   181   39 B Q  G >  S+     0   0   40 2313   46  Q   QQQQQQ              QQQ  QQ     QQQQQQQQQQQQQQQQQQQ QQQ          Q
   182   40 B R  G 3  S+     0   0   64 2316   69  R   RRRRRR              RRR  RR     RRRRRRRRRRRRRRRRRRR RRR          R
   183   41 B F  G <  S+     0   0   60 2316    8  F   FFFFFF              FFF  FF     FFFFFFFFFFFFFFFFFFF FFF          F
   184   42 B F    X   +     0   0   26 2316    0  F   FFFFFF              FFF  FF     FFFFFFFFFFFFFFFFFFF FFF          F
   185   43 B D  T 3  S+     0   0  125 2315   68  D   DDDDDD              DDD  DD     DDDDDDDDDDDDDDDDDDD DDD          D
   186   44 B S  T 3  S+     0   0  109 2316   73  S   NNSTSS              NSS  NS     NNNNNNNNNNNNNSNSNSK TNT          S
   187   45 B F  S <  S-     0   0   34 2315    6  F   FFFFFF              FFF  FF     FFFFFFFFFFFFFFFFFFF FFF          F
   188   46 B G        +     0   0   57 2304   43  G   GGGGGG              GGG  GG     GGGGGGGGGGGGGGGGGGG GGG          G
   189   47 B N        +     0   0  101 1087   32  N   NNNNNN              NNN  NN     NNNNNNNNNNNNNNNNNNN NNN          N
   190   48 B L        +     0   0   18 1086    4  L   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLLL LLL          L
   191   49 B S        +     0   0   87 1087   39  S   SSSSSS              SSS  SS     SSSSSSSSSSSSSSSSSSS SSS          S
   192   50 B S  S >> S-     0   0   64 1089   48  S   SSSSSS              SSS  SS     SSSSSSSSSSSSSSSSFSS SSS          S
   193   51 B A  H 3> S+     0   0   28 1160   49  P   PPSAAA              APA  PP     PPPPPPPPPPPPAPPPPAA ATA          P
   194   52 B S  H 3> S+     0   0  104 1382   69  S   SSSSSS              SSS  SS     SSSSSSSSSSSSSSSSSSS SSS          S
   195   53 B A  H <4 S+     0   0   24 2309   70  A   AAAAAA              AAA  AA     AAAAAAAAAAAAAAAAAAA AAA          A
   196   54 B I  H  < S+     0   0    2 2309   82  I   IIIIII              III  II     IIIIIIIIIIIIIIIIIII III          I
   197   55 B M  H  < S+     0   0   39 2309   88  M   LLMMMM              LLM  ML     LLLLLLLLLLLLLLLLLLM MMM          L
   198   56 B G  S  < S+     0   0   41 2311   27  G   GGGGGG              GGG  GG     GGGGGGGGGGGGGGGGGGG GGG          G
   199   57 B N     >  -     0   0   13 2313   52  N   NNNNNN              NNN  NN     NNNNNNNNNNNNNNNNNNN NNN          N
   200   58 B P  H  > S+     0   0   95 2311   53  P   PPPPPP              PPP  PP     PPPPPPPPPPPPPPPPPPP PPP          P
   201   59 B K  H  > S+     0   0  126 2313   69  K   KKKKRR              KKK  KK     KKKKKKKKKKKKKKKKKKK KKK          K
   202   60 B V  H  > S+     0   0    1 2312   13  V   VVVVVV              VVV  VV     VVVVVVVVVVVVVVVVVVI VVV          V
   203   61 B K  H  X S+     0   0  112 2311   50  K   KKKKKK              KKK  KK     KKKKKKKKKKKKKKKKKKK KKK          K
   204   62 B A  H  X S+     0   0   53 2312   51  A   AAAAAA              AAA  AA     AAAAAAAAAAAAAAAAAAA AAA          A
   205   63 B H  H  X S+     0   0   62 2314    5  H   HHHHHH              HHH  HH     HHHHHHHHHHHHHHHHHHH HHH          H
   206   64 B G  H  X S+     0   0    0 2314    1  G   GGGGGG              GGG  GG     GGGGGGGGGGGGGGGGGGG GGG          G
   207   65 B K  H  X S+     0   0   94 2312   54  K   KKKKKK              KKK  KK     KKKKKKKKKKKKKKKKKKK KKK          K
   208   66 B K  H  X S+     0   0  156 2313   28  K   KKKKKK              KKK  KK     KKKKKKKKKKKKKKKKKKK KKK          K
   209   67 B V  H  X S+     0   0   40 2314    7  V   VVVVVV              VVV  VV     VVVVVVVVVVVVVVVVVVV VVV          V
   210   68 B L  H  X S+     0   0    5 2314   63  L   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLLL LLL          L
   211   69 B T  H  X S+     0   0   52 2310   68  T   TTTTTT              TTT  TT     TTTTTTTTTTTTTTTTTTN TTT          T
   212   70 B S  H  < S+     0   0   44 2314   47  S   SSSSSS              SSS  SS     SSSSSSSSSSSSSSSSSSS SSS          S
   213   71 B L  H >X S+     0   0   17 2314   25  F   FFFFLL              FFF  FF     FFFFFFFFFFFFFFFFFFF FFF          F
   214   72 B G  H >X S+     0   0   10 2314   68  G   GGGGGG              GGG  GG     GGGGGGGGGGGGGGGGGGG GGG          G
   215   73 B D  H 3< S+     0   0   98 2312   70  D   DDDEED              EDD  ED     DDDDDDDDDDDDEDDDDDD EDE          D
   216   74 B A  H X4 S+     0   0    0 2314   20  A   AAAAAA              AAA  AA     AAAAAAAAAAAAAAAAAAA AAA          A
   217   75 B I  H X< S+     0   0   14 2313   43  I   IIIVII              IIV  II     IIIIIIIIIIIIVIIIIVV VIV          I
   218   76 B K  T 3< S+     0   0  162 2315   65  K   KKKKKK              KKK  KK     KKKKKKKKKKKKKKKKKKE KKK          K
   219   77 B H  T X   +     0   0   96 2315   51  N   NNNNNN              NNN  NN     NNNNNNNNNNNNNNNNNNN NNN          N
   220   78 B L  T <   +     0   0   17 2315   32  M   MMMMLL              MMM  LM     MMMMMMMMMMMMMMMMMLP LMM          M
   221   79 B D  T 3  S+     0   0  159 2315    5  D   DDDDDD              DDD  DD     DDDDDDDDDDDDDDDDDDD DDD          D
   222   80 B D    <>  +     0   0   85 2315   35  N   NNNNNN              NNN  NN     NNNNNNNNNNNNNNNNNNN DNN          N
   223   81 B L  H  > S+     0   0   17 2313   25  L   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLLL LLL          L
   224   82 B K  H  > S+     0   0  143 2307   71  K   KKKKKK              KKK  KK     KKKKKKKKKKKKKKKKKKK KKK          K
   225   83 B G  H  4 S+     0   0   48 2312   51  S   TTGGSS              GTG  GT     TTTTTTTTTTTTGTTTTGG SGG          P
   226   84 B T  H  < S+     0   0   55 2313   57  A   TTTAAA              TTA  TT     TTTTTTTTTTTTATTTTTT SAA          A
   227   85 B F  H  X S+     0   0    7 2314   23  F   FFFFLL              FFF  FF     FFFFFFFFFFFFFFFFFFF FFC          F
   228   86 B A  H  X S+     0   0   21 2315   60  A   AAAAAA              AAA  AA     AAAAAAAAAAAAAAAAASA AAA          A
   229   87 B Q  H  > S+     0   0  150 2310   74  K   KKKKKK              KKK  KK     KKKKKKKKKKKKKKKKKKK HKK          K
   230   88 B L  H  > S+     0   0   57 2316    0  L   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLLL LLL          L
   231   89 B S  H  X S+     0   0    0 2315    2  S   SSSSSS              SSS  SS     SSSSSSSSSSSSSSSSSSS SSS          S
   232   90 B E  H  X S+     0   0   81 2316   47  E   EEEEEE              EEE  EE     EEEEEEEEEEEEEEEEEEE EEE          E
   233   91 B L  H  X>S+     0   0   77 2316   21  L   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLLL LLL          L
   234   92 B H  I  <>S+     0   0   33 2316    0  H   HHHHHH              HHH  HH     HHHHHHHHHHHHHHHHHHH HHH          H
   235   93 B C  I  X5S+     0   0   12 2316   54  C   CCCCCC              CCC  CC     CCCCCCCCCCCCCCCCCCC CCC          C
   236   94 B D  I  <5S+     0   0   66 2315   78  D   DDDDDD              DDD  DD     DDDDDDDDDDDDDDDDDDD DDD          D
   237   95 B K  I  <5S+     0   0  155 2316   36  K   KKKKKK              KKK  KK     KKKKKKKKKKKKKKKKKKK RKK          K
   238   96 B L  I  4   -     0   0    3 2315    2  D   DDDDDD              DDD  DD     DDDDDDDDDDDDDDDDDDD DDD          D
   242  100 B P  T >> S+     0   0   17 2316    1  P   PPPPPP              PPP  PP     PPPPPPPPPPPPPPPPPPP PPP          P
   243  101 B E  H 3> S+     0   0   31 2316   76  E   EEEEEE              EEE  EE     EEEEEEEEEEEEEEEEEEE EEE          E
   244  102 B N  H <> S+     0   0   13 2316    2  N   NNNNNN              NNN  NN     NNNNNNNNNNNNNNNNNND NNN          N
   245  103 B F  H <> S+     0   0   22 2316    1  F   FFFFFF              FFF  FF     FFFFFFFFFFFFFFFFFFF FFF          F
   246  104 B K  H  X S+     0   0  120 2316   30  K   RRRKKK              RKR  RK     RRRRRRRRRRRRKKRKRRR RrK          K
   247  105 B L  H  X S+     0   0   17 2300   17  L   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLLL LlL          L
   248  106 B L  H  X S+     0   0   38 2308    2  L   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLLL LLL          L
   249  107 B G  H  X S+     0   0    6 2310   44  G   GGGGGG              GGG  GG     GGGGGGGGGGGGGGGGGGG GGG          G
   250  108 B N  H  X S+     0   0   34 2311   57  N   NNNNNN              NNN  NN     NNNNNNNNNNNNNNNNNNN NNN          N
   251  109 B V  H  X S+     0   0    1 2310   66  M   VVVVVV              VVV  VV     VVVVVVVVVVVVVVVVVVV VVV          V
   252  110 B L  H  X S+     0   0    9 2310   23  L   LMLMLL              LML  LM     MMMMMMMLMLMMMMMMLLI LLI          M
   253  111 B V  H  X S+     0   0    0 2312   56  V   VVVVVV              VVV  LV     VVVVVVVVVVVVVVVVVVV LVV          V
   254  112 B T  H  X S+     0   0    1 2312   29  I   IIIIII              III  II     IIIIIIIIIIIIIIIIIII VII          I
   255  113 B V  H  X S+     0   0    6 2315   53  V   IIIIVV              III  VI     IIIIIIIIIIIIIIIIIVV VII          I
   256  114 B L  H  X S+     0   0    4 2315   24  M   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLML LLL          L
   257  115 B A  H  X S+     0   0    0 2315   11  A   AAAAAA              AAA  AA     AAAAAAAAAAAAAAAAAAA AAA          A
   258  116 B I  H  < S+     0   0   27 2307   85  S   TTSTGG              STS  TT     TTTTTTTTTTTTTTTTTAN NST          T
   259  117 B H  H  < S+     0   0  114 2316   52  H   HHHHHH              HHH  HH     HHHHHHHHHHHHHHHHHHH HHH          H
   260  118 B F  H >< S-     0   0   18 2316   62  F   FFFFFF              FFF  FF     FFFFFFFFFFFFFFFFFFF FFF          F
   261  119 B G  G >< S+     0   0   17 2314   55  G   GGGGGG              GGG  GG     GGGGGGGGGGGGGGGGGNG GGG          G
   262  120 B K  G 3  S+     0   0  193 2165   71  K   KKKKKK              KKR  KK     KKKKKKKKKKKKKKKKKKK KKK          K
   263  121 B E  G <  S+     0   0   93 2313   44  E   EEEEEE              EEE  EE     EEEEEEEEEEEEEEEEEEE EEE          E
   264  122 B F  S <  S-     0   0    0 2313    7  F   FFFFFF              FFF  FF     FFFFFFFFFFFFFFFFFFF FFF          F
   265  123 B T    >>  -     0   0   53 2311   23  N   TTTTTT              TTT  TT     TTTTTTTTTTTTTTTTTTT TTT          T
   266  124 B P  H 3> S+     0   0   23 2311   20  P   PPPPPP              PPP  PP     PPPPPPPPPPPPPPPPPPP PPP          P
   267  125 B E  H 3> S+     0   0  105 2307   52  E   EEEDEE              SED  DE     EEEEEEEEEEEEDEEEEEQ QDD          E
   268  126 B V  H <> S+     0   0   22 2310   50  V   VVVVMM              VVM  VV     VVVVVVVVVVVVVVVVVVV VMV          V
   269  127 B Q  H  X S+     0   0    0 2291   35  Q   QQQQQQ              QQQ  QQ     QQQQQQQQQQQQQQQQQQQ QQQ          Q
   270  128 B A  H  X S+     0   0   15 2300   35  A   AAAAAA              AAA  AA     AAAAAAAAAAAAAAAAAAA AAA          A
   271  129 B S  H  X S+     0   0    1 2302   49  A   AAAAAA              AAA  AA     AAAAAAAAAAAAAAAAAAA AMA          A
   272  130 B W  H  X S+     0   0    1 2304   51  W   WWWWWW              WWW  WW     WWWWWWWWWWWWWWWWWFW WWW          W
   273  131 B Q  H  X S+     0   0    5 2306   39  Q   QQQQQQ              QQQ  QQ     QQQQQQQQQQQQQQQQQQQ QQQ          Q
   274  132 B K  H  X S+     0   0  100 2304    1  K   KKKKKK              KKK  KK     KKKKKKKKKKKKKKKKKKK KKK          K
   275  133 B M  H  X S+     0   0    1 2301   33  L   LLLLVV              LLL  LL     LLLLLLLLLLLLLLLLLLM MLL          L
   276  134 B V  H  X S+     0   0    6 2303   34  V   VVVVVV              MVV  VV     VVVVVVVVVVVVVVVVVVV VVV          V
   277  135 B T  H  X S+     0   0   80 2301   65  A   SSASAA              ASS  SS     SSSSSSSSSSSSSSSSSTT SAS          S
   278  136 B G  H  X S+     0   0   23 2301   71  G   AASGGG              GAG  GA     AAAAAAAAAAAAGAAAAGG GGG          A
   279  137 B V  H  X S+     0   0   17 2298   15  V   VVVVVV              VVV  VV     VVVVVVVVVVVVVVVVVVV VVV          V
   280  138 B A  H  X S+     0   0    5 2297   60  A   AAAAAA              AAA  AA     AAAAAAAAAAAAAAAAAAA AAA          A
   281  139 B S  H  X S+     0   0   67 2291   79  I   IINTNN              TIN  II     IIIIIIIIIIIITIIIINS TTT          I
   282  140 B A  H  < S+     0   0    2 2289   52  A   AAAAAA              AAA  AA     AAAAAAAAAAAAAAAAAAA AAA          A
   283  141 B L  H  < S+     0   0   19 2272    1  L   LLLLLL              LLL  LL     LLLLLLLLLLLLLLLLLLL LLL          L
   284  142 B S  H >< S+     0   0   44 2267   58  A   GGAASS              AAS  AA     GGGGGGGGGGGGAAGAGAA AA           A
   285  143 B S  T 3< S+     0   0   57 2265   80  H   HHHHHH              HHH  HH     HHHHHHHHHHHHHHHHHHR HH           H
   286  144 B R  T 3  S+     0   0  128 2255   28  K   KKKKKK              KKK  KK     KKKKKKKKKKKKKKKKKKK KK           K
   287  145 B Y    <         0   0   31 2246    0  Y   YYYYYY              YYY  YY     YYYYYYYYYYYYYYYYYYY YY           Y
   288  146 B H              0   0  136 2186   41  H   HHHHHH              HHH  HH     HHHHHHHHHHHHHHHHHHH HH           H
## ALIGNMENTS  491 -  560
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....0....:....1....:....2....:....3....:....4....:....5....:....6
     1    1 A V              0   0  136  867   26    V     V           VVVVVVVVVVVVVVVVVVVVVVVVV VV   VVVVVVVVVVVMVVVV   
     2    2 A L        -     0   0   22 1663    3    L     L           VLLLLVLLLLLVLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
     3    3 A S     >  -     0   0   51 1663   48    S     S           SSSSFSSSSSSSSSSSSSSSSSSSS SS   SSSSSSSSSSSSSFSS   
     4    4 A P  H  > S+     0   0   84 1664   53    A     A           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
     5    5 A A  H  > S+     0   0   62 1663   62    D     A           EEDEEEEEEEDEDDEEEEEEEEDEE EE   EEEEEDEEEEEDEEEE   
     6    6 A D  H  > S+     0   0    8 1667   20    D     D           DDDDDDDDDDDDDDDDDDDDDDDDD DD   DDDDDDDDDDDDDDDD   
     7    7 A K  H  X S+     0   0   46 1668    8    K     K           KKKKKKKKKKKKKKKKKKKKKKKKK KK   KKKKKKKKKKKKKKKK   
     8    8 A T  H  X S+     0   0   95 1666   59    N     G           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
     9    9 A N  H  X S+     0   0   43 1665   80    N     H           NNNNNNNNNNNNNNNNNNNNNNNNK NN   NNNNNNNNNNNNNNNN   
    10   10 A V  H  X S+     0   0    2 1667   12    I     V           VVIVVVVVVVVVIIVVVVVVVVIVV VV   VVVVVIVVVVVVVAVV   
    11   11 A K  H  X S+     0   0   99 1668   70    K     K           KKKKKKKKKKKKKKKKKKKKKKKKK KK   KKKKKKKKKKKKKKKK   
    12   12 A A  H  X S+     0   0   67 1669   58    G     G           TTTTTTTTTTTTTTTATTTTTTATT TT   TTTTTTTTTTTTTTTT   
    13   13 A A  H  < S+     0   0    5 1672   61    A     I           VVVVVVVVVVVVVVVVAVVVVVAVV VV   VVVVVVVVVVVVVVVV   
    14   14 A W  H  X S+     0   0   22 1672    7    W     W           WWWWWWWWWWWWWWWWWWWWWWWWW WW   WWWWWWWWWWWWWWWW   
    15   15 A G  H  < S+     0   0   51 1672   52    G     G           SSSSSSSSSSNSSSSSSSSSSSGSS SS   SSSSSSSSSSSSSSSS   
    16   16 A K  T  < S+     0   0  111 1673    8    K     K           KKKKKKKKKKKKKKKKKKKKKKKKK KK   KKKKKKKKKKKKKKKK   
    17   17 A V  T >4 S+     0   0    1 1676   26    I     V           IIIIIIIIIIIIIIIIIIIIIIIII II   IIIIIIIIIIIIIIII   
    18   18 A G  T 3< S+     0   0   49 1676   66    G     G           GGGGGGGGGGGGGGGGGGGDGGGGG GG   GGGGGGGGGGGGGGGG   
    19   19 A A  T 3  S+     0   0   96 1676   70    G     G           DGGGGDGGGGGDGGGGGGDGGDGGG GG   GGGGDGGGDGGGGGGG   
    20   20 A H  S <> S+     0   0   92 1674   65    H     H           HHHHHHHHHHHHHHHHHHHHHHHHH HH   HHHHHHHHHHHHHHHH   
    21   21 A A  H  > S+     0   0    6 1158   58    G     A           HRGRGHRRGGHHGGRGGGHGRHGRG RH   RRRRHGGRHRRGGGRG   
    22   22 A G  H  > S+     0   0   19 1159   49    A     G           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
    23   23 A E  H  > S+     0   0  120 1676   42    E     E           EEEEEEEEEEEEEEEEEEEEEEEED EE   EDDEEEDEEEEEEEEE   
    24   24 A Y  H  X S+     0   0   23 1676   70    Y     Y           YYYYYYYYYYYYYYYYYYYYYYYYY YY   YYYYYYYYYYYYYYYY   
    25   25 A G  H  X S+     0   0    4 1676    6    G     A           GGGGGGGGGGGGGGGGGGGGGGGGG GG   GGGGGGGGGGGGGGGG   
    26   26 A A  H  X S+     0   0   15 1676   45    A     A           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
    27   27 A E  H  X S+     0   0   45 1676    7    E     E           EEEEEEEEEEEEEEEEEEEEEEEEE EE   EEEEEEEEEEEEEEEE   
    28   28 A A  H  X S+     0   0    0 1674   28    A     G           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
    29   29 A L  H  X S+     0   0    4 1677    2    L     L           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
    30   30 A E  H  X S+     0   0   36 1677   56    E     E           GGGGGGGGGGGGGGGGGGGGGGGGG GG   GGEGGGGGGGGGGGGG   
    31   31 A R  H  X S+     0   0    3 1678    1    R     R           RRRRRRRRRRRRRRRRRRRRRRRRR RR   RRRRRRRRRRRRRRRR   
    32   32 A M  H  X S+     0   0   11 1677   19    M     T           MMMMMMMMMMMMMMMMMMMMTMMMM MM   MMMMMMMMMMMMMMMM   
    33   33 A F  H  < S+     0   0   11 1667   15    F     F           FFFFFFFLFFFFFFFFFLLFFLFFF FF   FFFFLFFFFFFFFFFF   
    34   34 A L  H  < S+     0   0   58 1672   64    V     H           EEEEEEEEEEEEEEEEEEEEEEEEE EE   EEEEEEEEEEEEEECE   
    35   35 A S  H  < S+     0   0   15 1674   70    T     S           SSSSSSSSSSSSSSSSSSSSSSSSS SS   SSSSSSSSSSSSSSSS   
    36   36 A F    ><  +     0   0   36 1674   14    Y     F           HHHHHHHHHHHHHHHHHHHHHHHHH HH   HHHHHHHHHHHHHHFH   
    37   37 A P  G >  S+     0   0   44 1674    0    P     P           PPPPPPPPPPPPPPPPPPPPPPPPP PP   PPPPPPPPPPPPPPPP   
    38   38 A T  G >  S+     0   0   37 1674  100    T     T           TTTTTTTTTTTTTTTTTTTTTTTNT TT   TTTTTTTTTTTTTTTT   
    39   39 A T  G X  S+     0   0    3 1674    2    T     T           TTTTTTTTTTTTTTTTTTTTTTITT TT   TTTTTTTTTTTTTTTT   
    40   40 A K  G X  S+     0   0   64 1674   41    K     K           KKKKKKKKKKKKKKKKKKKKKKKKK KK   KKKKKKKKKKKKKKKK   
    41   41 A T  G <  S+     0   0    7 1675   64    T     T           TTTTTTTTTTTTTTTTTTTTTTTTT TT   TTTTTTTTTTTTTTTT   
    42   42 A Y  G <  S+     0   0   16 1675    3    Y     Y           YYYYYYYYYYYYYYYYYYYYYYYYY YY   YYYYYYYYYYYYYYYY   
    43   43 A F    X   +     0   0   31 1676    0    F     F           FFFFFFLFFFFFFFFFFFFFFFFFF FF   FFFFFFFFFFFFFFFF   
    44   44 A P  T 3  S+     0   0   70 1676   66    P     P           PLPPPPPPPPPPPPLPPPPPPPLPP PP   PPPPPPPPPPPPPPPP   
    45   45 A H  T 3  S+     0   0  122 1676   59    H     H           HHHHHHHHHHHHHHHHHHHHHHHHH HH   HHHHHHHHHHHHHHHH   
    46   46 A F  S <  S-     0   0   44 1676    8    F     F           FFFFFFFFFFFFFFFFFFFFFFFFF FF   FFFFFFFFFFFFFFFF   
    47   47 A D        -     0   0   81 1676   46    D     D           DDDDDDDDDDDDDDDDDDDDDDDDH DD   DDDDDDDDDDDDDDDD   
    48   48 A L        +     0   0   55 1674   66    V     L           VVVVVVVVVVVVVVVVVVVVVVVVV VV   VVVVVVVVVVVVVVVV   
    49   49 A S  S >  S-     0   0   58 1674   83    S     S           SSSSSSSSSSSSSSSSSSSSSSSSS SS   SSSSSSSSSSSSSSSS   
    50   50 A H  T 3  S+     0   0  150 1674   86    H     H           HHHHPHHHHHHHHHHHHHHHHHHHP HH   HHHHHHHHHHHHHPHH   
    51   51 A G  T 3  S+     0   0   40 1676   21    G     G           GGSGGGGGSSSGSSGSSSGGGGGGG GS   GGGGGSGGGGGSGGGG   
    52   52 A S    X>  -     0   0   13 1677   46    S     S           SSSSSSSSSSSSSSSSSSSSSSSSS SS   SSSSSSSSSSSSSSSS   
    53   53 A A  H 3> S+     0   0   80 1675   50    A     A           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
    54   54 A Q  H 3> S+     0   0   86 1677   56    Q     Q           QQQQQQQQQQQQQQQQQQQQQQQQQ QQ   QQQQQQQQQQQQQQQQ   
    55   55 A V  H <> S+     0   0   12 1676   15    V     I           VVVVVVVVVVVVVVVVVVVVVVVVV VV   VVVVVVVVVVVVVVVV   
    56   56 A K  H  X S+     0   0  130 1677   25    K     Q           KKKKKKKKKKKKKKKKKKKKKKKKK KK   KKKKKKKKKKKKKKKK   
    57   57 A G  H  X S+     0   0   37 1678   52    A     A           TTTTTTTTTTTTTTTTTTTTTTTTA TT   TTTTTTTTTTTTNTTT   
    58   58 A H  H  X S+     0   0   53 1678    7    H     H           QQQQQQQQQQQQQQQQQQQQQQQQH QQ   QQQQQQQQQQQQQQQQ   
    59   59 A G  H  X S+     0   0    0 1678    1    G     G           GGGGGGGGGGGGGGGGGGDGGDGGG GG   GGGGGGGGGGGGGGGG   
    60   60 A K  H  X S+     0   0  132 1677   49    A     K           AAAAAAAAAASAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
    61   61 A K  H  X S+     0   0  166 1677   22    K     K           KKKKKKKKKKKKKKKKKKKKEKKKK KK   KKKKKKKKKKKKKKKK   
    62   62 A V  H  X S+     0   0   31 1677    6    V     I           VVVVVVVVVVVVVVVVVVVVVVVVV VV   VVVVVVVVVVVVVVVV   
    63   63 A A  H  X S+     0   0    1 1677   69    A     A           ATAAAAAAAAAAAATAAAAAAATAA AA   AAAAAAAAAAAAAAAA   
    64   64 A D  H  X S+     0   0   83 1677   63    D     D           DDDDDDDDDDDDDDDDDDDDDDDDD DD   DDDDDDDGDDDDDDDD   
    65   65 A A  H  X S+     0   0   23 1678   36    A     A           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
    66   66 A L  H  X S+     0   0   15 1678   27    L     L           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
    67   67 A T  H  X S+     0   0   52 1678   69    A     G           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
    68   68 A N  H  X S+     0   0   60 1678   62    K     Q           TTTTTTTTTTTTTTTTTTTTTTTTT TT   TTTTTTTTTTTTTTTT   
    69   69 A A  H  < S+     0   0    0 1678   26    A     A           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
    70   70 A V  H >< S+     0   0   10 1678   47    A     V           AAAAPAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAADPAA   
    71   71 A A  H 3< S+     0   0   71 1678   70    S     E           DDDDDDDDDDDDDDDDDDDDDDDDN DD   DDDDDDDDDDDDDDDD   
    72   72 A H  T >< S+     0   0   84 1678   50    H     H           NNNNNNNNNNNNNNNNNNNNNNNNN NN   NNNNNNNNNNNNNNNN   
    73   73 A V  T <  S+     0   0   14 1678   26    L     I           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
    74   74 A D  T 3  S+     0   0  114 1678    3    D     D           DDDDDDDDDDDDDDDDDDDDDDDDD DD   DDDDDDDDDDDDDDDD   
    75   75 A D  S X> S+     0   0   85 1678   30    D     D           DDDDDDDDDDDDDDDDDDDDDDDDD DD   DDDDDDDDDDEDEDDD   
    76   76 A M  H 3>  +     0   0   13 1678   19    L     L           LQLLLLLLLLLLLLQLLLLLLLQLL LL   LLLLLLLLLLLLLLLL   
    77   77 A P  H 34 S+     0   0   69 1672   78    P     P           PPPPPPPPPPPPPPPPPPPPPPPPP PP   PPPPPPPPPPPPPPPP   
    78   78 A N  H X4 S+     0   0   91 1678   38    G     G           GGGAGGAAGGGGAAGGGGGGGAGGG AG   GGGGGGGGGGGGGGGA   
    79   79 A A  H 3< S+     0   0   34 1678   50    T     T           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAVAAAAA   
    80   80 A L  T 3X S+     0   0    5 1678   14    L     L           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
    81   81 A S  H <> S+     0   0   43 1678   57    S     S           SSSSSSSSSSSSSSSSSSSSSSSSS SS   SSSSSSSSSSSSSSSS   
    82   82 A A  H  > S+     0   0   77 1678   70    S     K           ADAAAAAAAAAAAADAAAAAAADAA AA   AAAAAAAAAAGAAAAA   
    83   83 A L  H  > S+     0   0   54 1678    0    L     L           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
    84   84 A S  H  X S+     0   0    3 1677    3    S     S           SSSSSSSSSSSSSSSSSSSSSSSSS SS   SSSSSSSSSSSSSSSS   
    85   85 A D  H  X S+     0   0   67 1678   28    D     D           DDDDDDDDDDDDDDDDDDDDDDDDD DD   DDDDDDDDDDDDDDDD   
    86   86 A L  H >X>S+     0   0   68 1678    8    L     L           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
    87   87 A H  I 3<>S+     0   0   41 1678    0    H     H           HHHHHHHHHHPHHHHHHHHHHHHHQ HH   HHHHHHHHHHHHHHHH   
    88   88 A A  I 3<5S+     0   0    6 1678   45    A     A           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAATAAAAAA   
    89   89 A H  I <<5S+     0   0  111 1678   83    H     H           HHHHHHHHHHHHHHHHHHHHHHHHH HH   HHHHHHHHHHHHHHHH   
    90   90 A K  I  <5S+     0   0  162 1678   37    E     K           KKKKKKKKKKKKKKKKKKKKKKKKK KK   KKKKKKKKKKKKKKKK   
    91   91 A L  I      -     0   0    3 1677    2    D     D           DDDDDDDDDDDDDDDNNDDDDDDDD DD   DDDDDDDDDDDDDDND   
    95   95 A P  T >> S+     0   0   40 1677    0    P     P           PPPPPPPPPPPPPPPPPPPPPPPPP PP   PPPPPPPPPPPPPPPP   
    96   96 A V  H 3> S+     0   0   56 1677   76    V     V           VVVVVVVVVVVVVVVVVVVVVVVVV VV   VVVVVVVVVVVVVVVV   
    97   97 A N  H <> S+     0   0   10 1676    1    N     N           NNNNNNNNNNNNNNNNNNNNNNNNN NN   NNNNNNNNNNNNNNNN   
    98   98 A F  H <> S+     0   0   23 1678    0    F     F           FFFFFFFFFFFFFFFFFFFFFFFFF FF   FFFFFFFFFFFFFFFF   
    99   99 A K  H  X S+     0   0  129 1678   26    K     K           KKKKKKKKKKKKKKKKKKKKKKKKK KK   KKKKKKKKKKKKKKKK   
   100  100 A L  H  X S+     0   0   20 1675   16    L     L           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
   101  101 A L  H  X S+     0   0   40 1677    2    L     L           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
   102  102 A S  H  X S+     0   0   16 1677   44    S     S           SSSSSSSSSSSSSSSSSSSSSSSSS SS   SSSSSSSSSSSSSSSS   
   103  103 A H  H  X S+     0   0   16 1677   45    H     H           HHHHHHHHHHHHHHHHHHHHHHHHH HH   HHHHHHHHHHHHHHHH   
   104  104 A C  H  X S+     0   0    0 1676   70    C     C           CCCCCCCCCCCCCCCCCCCCCCCCC CC   CCCCCCCCCCCCCCCC   
   105  105 A L  H  X S+     0   0   11 1676   23    L     L           LLLLLLLLLPLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
   106  106 A L  H  X S+     0   0    2 1677   44    L     L           QLLQLQQQLLLLLLLLLLLLLLLQL QL   HQQQLLLQQQLLLLQQ   
   107  107 A V  H  X S+     0   0    0 1677   30    V     V           VVVVVVVVVVVVVVVVVVVVVVVVV VV   VVVVVVVVVVVVVVVV   
   108  108 A T  H  < S+     0   0    1 1677   51    T     T           TTTTTTTTTTTTTTTTTTTTTTTTT TT   TTTTTTTTTTTTTTTT   
   109  109 A L  H >X S+     0   0    4 1677   20    L     F           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
   110  110 A A  H 3< S+     0   0    0 1677   13    A     A           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
   111  111 A A  T 3< S+     0   0   10 1675   90    N     A           SASRASSRSSASSAASSSSSSSSSA RS   SSSSSASSSSAASASR   
   112  112 A H  T <4 S+     0   0   53 1678   39    H     H           HHHHHHHHHHHHHHHHHHHHHHHHH HH   HHHHHHHHHHHHHHHH   
   113  113 A L  S >X S-     0   0    3 1678   63    H     L           QLQQLQQQQQQQQHQQQQQQQQQQH QQ   QQQQQQQQQQHHQLQQ   
   114  114 A P  T 34 S+     0   0   90 1678   50    P     G           PPPPPPPPPPPPPPPPPPPPPPPPP PP   PPPPPPPPPPPPPPPP   
   115  115 A A  T 34 S+     0   0   80 1590   72    A     D           .S..S........A..........A ..   ..........AA.S..   
   116  116 A E  T <4 S+     0   0   79 1678   38    D     A           EDEEDEEEEEEEEDEEEEEEEEEEE EE   EEEEEEEEEEDDEDEE   
   117  117 A F     <  +     0   0    8 1678    7    F     F           FFFFFFFFFFFFFFFFFFFFFFFFF FF   FFFFFFFFFFFFFFFF   
   118  118 A T     >  -     0   0   62 1678   18    T     T           TTTTTTTTTTTTTTTTTTTTTTTTT TT   TTTTTTTTTTTTTTTT   
   119  119 A P  H  > S+     0   0   22 1678   12    P     P           PPPPPPPPPPPPPPPPPPPPPPPPP PP   PPPPPPPPPPPPPPPP   
   120  120 A A  H  > S+     0   0   35 1677   58    A     E           AAAAAAAAAAVAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
   121  121 A V  H  > S+     0   0   17 1677   38    V     V           VVVVVVVVVVVVVVVVVVVVVVVVV VV   VVVVVVVVVVVVVVVV   
   122  122 A H  H  X S+     0   0    2 1676   32    H     H           HHHHHHHHHHHHHHHHHHHHHHHHH HH   HHHHHHHHHHHHHHHH   
   123  123 A A  H  X S+     0   0   16 1676   34    A     A           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
   124  124 A S  H  X S+     0   0    3 1676   45    S     S           SSSSSSSSSSSSSSSSSSSSSSSSS SS   SSSSSSSSSSSSSSSS   
   125  125 A L  H  X S+     0   0    3 1676   46    L     L           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
   126  126 A D  H  X S+     0   0   21 1676   30    D     D           DDDDDDDDDDDDDDDDDDDDDDDDD DD   DDDDDDDDDDDDDDDD   
   127  127 A K  H  X S+     0   0   36 1676    0    K     K           KKKKKKKKKKKKKKKKKKKKKKKKK KK   KKKKKKKKKKKKKKKK   
   128  128 A F  H  X S+     0   0    2 1676   41    F     F           FFFFFFFFFFFFFFFFFFFFFFFFF FF   FFFFFFFFFFFFFFFF   
   129  129 A L  H  X S+     0   0    7 1676   33    L     L           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
   130  130 A A  H  X S+     0   0   39 1676   54    A     A           AAAAAAAAAAAAAAAAAAAAAAAAA AA   AAAAAAAAAAAAAAAA   
   131  131 A S  H  X S+     0   0   29 1676   65    S     A           SSSSSSSSSSSSSSSSSSSSSSSSS SS   SSSSSSSSSSSSSSSS   
   132  132 A V  H  X S+     0   0    9 1676   11    V     V           VVVVVVVVVVVVVVVVVVVVVVVVV VV   VVVVVVVVVVVVVVVV   
   133  133 A S  H  X S+     0   0   17 1675   49    S     S           SSSSSSSSSSSSSSSSSSSSSSSSS SS   SSSSSSSSSSSSSSSS   
   134  134 A T  H  X S+     0   0   88 1674   74    T     T           TTTTTTTTTTTTTTTTTTTTTTTTT TT   TTTTTTTTTTTTTTTT   
   135  135 A V  H  < S+     0   0   21 1675   55    V     V           VVVVVVVVVVVVVVVVVVVVVVVVV VV   VVVVVVVVVVVVVVVV   
   136  136 A L  H  < S+     0   0   19 1674    0    L     L           LLLLLLLLLLLLLLLLLLLLLLLLL LL   LLLLLLLLLLLLLLLL   
   137  137 A T  H >< S+     0   0   42 1674   54    T     T           TTTTTTTTTTTTTTTTTTTTTTTTT TT   TTTTTTTTTTTTTTTT   
   138  138 A S  T 3< S+     0   0   57 1669   77    S     S           SSSSSSSSSSSSSSSSSSSSSSSSS SS   SSSSSSSSSSSSSSSS   
   139  139 A K  T 3  S+     0   0   77 1669   12    K     K           KKKKKKKKKKKKKKKKKKKKKKKKK KK   KKKKKKKKKKKKKKKK   
   140  140 A Y    <         0   0   19 1666    0    Y     Y           YYYYYYYYYYYYYYYYYYYYYYYYY YY   YYYYYYYYYYYYYYYY   
   141  141 A R              0   0   75 1644   37    R     R           RRRRR  RRRRRRRRRRRRRRRRRR  R   RRRRRRRRRRRRRRRR   
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41                                                                        
   144    2 B H        -     0   0  151 1032   46  HH HHHHN HHHHHHHHHHH                         H  HHH                HRH
   145    3 B F        -     0   0   37 2258   27  FF FFFFF LFFFFFFFFFF                         F  FFF                FLF
   146    4 B T    >>  -     0   0   75 2258   47  TT TTTTT TTTTTTTTTTT                         T  TTT                TST
   147    5 B E  H 3> S+     0   0  133 2262   54  AP AAAAA APAAAAAAAAA                         A  APA                AAG
   148    6 B E  H 3> S+     0   0  151 2265   64  EE EEEEE EEEEEEEEEEE                         E  EEE                EEE
   149    7 B D  H X> S+     0   0   26 2283   21  EE EEEEE EDEEEEEEEEE                         E  EEE                EEE
   150    8 B K  H 3X S+     0   0   82 2285   24  KK KKKKK KKKKKKKKKKK                         K  KKK                KKK
   151    9 B A  H 3X S+     0   0   51 2283   64  AS ATAAG ATAAAAAAAAA                         A  ACA                SSA
   152   10 B T  H < S+     0   0    5 2293   58  AI LTLLL LVLLLLLLLLL                         L  TQL                LLV
   157   15 B W  G >< S+     0   0   32 2299    7  WW WWWWW WWWWWWWWWWW                         W  WWW                WWW
   158   16 B G  G 3  S+     0   0   69 2299   51  GG SASSS GTSSGSGSGSS                         S  KGG                GGS
   159   17 B K  G <  S+     0   0  109 2303   19  KK KKKKK KKKKKKKKKKK                         K  LQK                KKK
   160   18 B V    <   -     0   0   19 2307   28  VV MVMMV MVMMMMVMMMM                         I  VVV                VVV
   161   19 B N     >  -     0   0   97 2308   63  ND NNNNN NDNNNNNNNNN                         N  DNN                NNN
   162   20 B V  H  > S+     0   0   26 2306   77  VV VVVVV VVVVVVIVVVV                         V  VIV                VPV
   163   21 B E  H  > S+     0   0   84 2303   46  EE EEEEX EEEEEEEEEEE                         E  EDE                EEE
   164   22 B D  H  4 S+     0   0   90 2307   47  EA EEEED EDEEEEEEEEE                         E  DEE                EEE
   165   23 B A  H  X S+     0   0   13 2309   68  AI ATTTI AVAAATAAAAA                         T  ATT                THA
   166   24 B G  H  X S+     0   0    0 2309    5  GG GGGGG GGGGGGGGGGG                         G  GGG                GGG
   167   25 B G  H  X S+     0   0    5 2309   51  GG GGGGG GGGGGGGGGGG                         G  AGG                GGG
   168   26 B E  H  > S+     0   0   52 2309   25  EE EEEEE EEEEEEEEEEE                         E  EEE                EEE
   169   27 B T  H  X S+     0   0    4 2307   28  AA AAAAA ASAAAAAAAAA                         A  AAA                AAV
   170   28 B L  H  X S+     0   0    7 2310    2  LL LLLLL LLLLLLLLLLL                         L  LLL                VLL
   171   29 B G  H  X S+     0   0    0 2310   62  GG GGGGG GAGGGGGGGGG                         G  GGG                GAG
   172   30 B R  H  X S+     0   0    8 2309    2  RR RRRRR RRRRRRRRRRR                         R  RRR                RRR
   173   31 B L  H  X S+     0   0   12 2309   37  LL LLLLL LLLLLLLLLLL                         L  LLL                LLL
   174   32 B L  H  < S+     0   0    0 2309   14  LL LLLLL LLLLLLLLLLL                         L  LLL                LLL
   175   33 B V  H  < S+     0   0   26 2310   56  VV VVVVV VVVVVVVVVVV                         V  VVV                VVV
   176   34 B V  H  < S+     0   0    2 2312   61  VV VVVVV VVVVVVVVVVV                         V  VVV                VVV
   177   35 B Y  S >< S-     0   0   26 2312   13  YY YYYYY YYYYYYYYYYY                         Y  YYY                YYY
   178   36 B P  T 3   +     0   0   29 2313    0  PP PPPPP PPPPPPPPPPP                         P  PPP                PPP
   179   37 B W  T 3  S+     0   0   22 2313   94  WW WWWWW WWWWWWWWWWW                         W  WWW                WWW
   180   38 B T  S X  S+     0   0    3 2313    3  TT TTTTT TTTTTTTTTTT                         T  TTT                TTT
   181   39 B Q  G >  S+     0   0   40 2313   46  QQ QQQQQ QQQQQQQQQQQ                         Q  QQQ                QQQ
   182   40 B R  G 3  S+     0   0   64 2316   69  RR RRRRR RRRRRRRRRRR                         R  RRR                RRR
   183   41 B F  G <  S+     0   0   60 2316    8  FF FFFFF FFFFFFFFFFF                         F  FFF                FFF
   184   42 B F    X   +     0   0   26 2316    0  FF FFFFF FFFFFFFFFFF                         F  FFF                FFF
   185   43 B D  T 3  S+     0   0  125 2315   68  DD DDDDD DDDDDDEDDDD                         D  DDD                DDD
   186   44 B S  T 3  S+     0   0  109 2316   73  NS SSSSS NSSSNSTSNNN                         S  SNN                SSN
   187   45 B F  S <  S-     0   0   34 2315    6  FF FFFFF FFFFFFFFFFF                         F  FFF                FFF
   188   46 B G        +     0   0   57 2304   43  GG GGGGG GGGGGGGGGGG                         G  GGG                GGG
   189   47 B N        +     0   0  101 1087   32  NN NNNNN NNNNNNNNNNN                         N  NNN                NNN
   190   48 B L        +     0   0   18 1086    4  LL LLLLL LLLLLLLLLLL                         L  LLL                MLL
   191   49 B S        +     0   0   87 1087   39  SS SSSSS SSSSSSSSSSS                         S  SSS                SSS
   192   50 B S  S >> S-     0   0   64 1089   48  SS SSSSS SSSSSSSSSSS                         S  SSS                SSS
   193   51 B A  H 3> S+     0   0   28 1160   49  SP PAPPA PAPPPPAPPPP                         P  SSP                PAS
   194   52 B S  H 3> S+     0   0  104 1382   69  SS SSSSS SSSSSSSSSSS                         S  SSS                SSS
   195   53 B A  H <4 S+     0   0   24 2309   70  AA AAAAA AAAAAAAAAAA                         A  AAA                AAA
   196   54 B I  H  < S+     0   0    2 2309   82  II IIIII IVIIIIIIIII                         I  III                IVI
   197   55 B M  H  < S+     0   0   39 2309   88  MM LLLLM LMLLLLMLLLL                         L  MMM                MLM
   198   56 B G  S  < S+     0   0   41 2311   27  GG GGGGG GGGGGGGGGGG                         G  GGG                GGG
   199   57 B N     >  -     0   0   13 2313   52  NN NNNNN NNNNNNNNNNN                         N  NNN                NNN
   200   58 B P  H  > S+     0   0   95 2311   53  PP PPPPP PPPPPPPPLPP                         P  PPP                PPP
   201   59 B K  H  > S+     0   0  126 2313   69  KK KKKKR KKKKKKKKKKK                         K  KKK                KKK
   202   60 B V  H  > S+     0   0    1 2312   13  VV VVVVV VVVVVVVVVVV                         V  VVV                VVV
   203   61 B K  H  X S+     0   0  112 2311   50  KK KKKKK KKKKKKKKKKK                         K  KKK                KKK
   204   62 B A  H  X S+     0   0   53 2312   51  AT AAAAA AAAAAAAAAAA                         A  AAA                AAA
   205   63 B H  H  X S+     0   0   62 2314    5  HH HHHHH HHHHHHHHHHH                         H  HHH                HHH
   206   64 B G  H  X S+     0   0    0 2314    1  GG GGGGG GGGGGGGGGGG                         G  GGG                GGG
   207   65 B K  H  X S+     0   0   94 2312   54  KK KKKKK KKKKKKKKKKK                         K  KKK                KKK
   208   66 B K  H  X S+     0   0  156 2313   28  KK KKKKK KKKKKKKKKKK                         K  KKK                KKK
   209   67 B V  H  X S+     0   0   40 2314    7  VV VVVVV VVVVVVVVVVV                         V  VVV                VVV
   210   68 B L  H  X S+     0   0    5 2314   63  LL LLLLL LLLLLLLLLLL                         L  LLL                LLL
   211   69 B T  H  X S+     0   0   52 2310   68  TT TTTTT TTTTTTTTTTT                         T  TTS                TTT
   212   70 B S  H  < S+     0   0   44 2314   47  SS SSSSS SSSSSSSSSSS                         S  ASS                SSS
   213   71 B L  H >X S+     0   0   17 2314   25  FL FFFFL FFFFFFFFFFF                         F  FFF                FFF
   214   72 B G  H >X S+     0   0   10 2314   68  GG GGGGG GGGGEGGGGGG                         G  GGG                GGG
   215   73 B D  H 3< S+     0   0   98 2312   70  DD DDDDE DEDDDDEDDDD                         D  DDE                DDD
   216   74 B A  H X4 S+     0   0    0 2314   20  AA AAAAA AGAAAAAAAAA                         A  AAA                AAA
   217   75 B I  H X< S+     0   0   14 2313   43  VV IVIII IVIIIIVIIII                         I  VII                VVI
   218   76 B K  T 3< S+     0   0  162 2315   65  KK KKKKK KKKKKKKKKKK                         K  KKK                KKK
   219   77 B H  T X   +     0   0   96 2315   51  NN NNNNN NNNNNNNNNNN                         N  NNH                NNN
   220   78 B L  T <   +     0   0   17 2315   32  ML MLMML MMMMMMMMMMM                         M  VMM                MLM
   221   79 B D  T 3  S+     0   0  159 2315    5  DD DDDDD DDDDDDDDDDD                         D  DDD                DDD
   222   80 B D    <>  +     0   0   85 2315   35  NN NNNNN NNNNNNNNNNN                         N  DND                NNN
   223   81 B L  H  > S+     0   0   17 2313   25  LL LLLLL LLLLLLLLLLL                         L  LLL                LLL
   224   82 B K  H  > S+     0   0  143 2307   71  KK KKKKK KKKKKKKKKKK                         K  KKK                KKK
   225   83 B G  H  4 S+     0   0   48 2312   51  AG PAIIS TGPPTIGPTTT                         T  NGT                GGS
   226   84 B T  H  < S+     0   0   55 2313   57  AT ATTTA TTAATTAATTT                         A  TAT                TTA
   227   85 B F  H  X S+     0   0    7 2314   23  FF FFFFL FFFFFFFFFFF                         F  FFF                FFF
   228   86 B A  H  X S+     0   0   21 2315   60  AS ASAAA AAAAAAAAAAA                         A  AAA                ASA
   229   87 B Q  H  > S+     0   0  150 2310   74  KK KKKKK KKKKKKKKKKK                         K  HKK                KKK
   230   88 B L  H  > S+     0   0   57 2316    0  LL LLLLL LLLLLLLLLLL                         L  LLL                LLL
   231   89 B S  H  X S+     0   0    0 2315    2  SS SSSSS SSSSSSSSSSS                         S  SSS                SSS
   232   90 B E  H  X S+     0   0   81 2316   47  EE EEEEE EEEEEEEEEEE                         E  EEE                EEE
   233   91 B L  H  X>S+     0   0   77 2316   21  LL LLLLL LLLLLLLLLLL                         L  LLL                LLL
   234   92 B H  I  <>S+     0   0   33 2316    0  HH HHHHH HHHHHHHHHHH                         H  HHH                HHH
   235   93 B C  I  X5S+     0   0   12 2316   54  CC CCCCC CCCCCCCCCCC                         C  CCC                CCC
   236   94 B D  I  <5S+     0   0   66 2315   78  DD DDDDD DDDDDDDDDDD                         D  DDD                DDD
   237   95 B K  I  <5S+     0   0  155 2316   36  KK KKKKK KKKKKKKKKKK                         K  RKK                KKK
   238   96 B L  I  4   -     0   0    3 2315    2  DD DDDDD DDDDDDDDDDD                         D  DDD                DDD
   242  100 B P  T >> S+     0   0   17 2316    1  PP PPPPP PPPPPPPPPPP                         P  PPP                PPP
   243  101 B E  H 3> S+     0   0   31 2316   76  EE EEEEE EEEEEEEEEEE                         E  EEE                EEE
   244  102 B N  H <> S+     0   0   13 2316    2  NN NNNNN NNNNNNNNNNN                         N  NNN                NNN
   245  103 B F  H <> S+     0   0   22 2316    1  FF FFFFF FFFFFFFFFFF                         F  FFF                FFF
   246  104 B K  H  X S+     0   0  120 2316   30  RR KRKKK RRKKRKKKRRR                         K  KKR                RRR
   247  105 B L  H  X S+     0   0   17 2300   17  LL LLLLL LLLLLLLLLLL                         L  LLL                LLL
   248  106 B L  H  X S+     0   0   38 2308    2  LL LLLLL LLLLLLLLLLL                         L  LLL                LLL
   249  107 B G  H  X S+     0   0    6 2310   44  GG GGGGG GGGGGGGGGGG                         G  GGG                GGG
   250  108 B N  H  X S+     0   0   34 2311   57  NN NNNNN NNNNNNNNNNN                         N  NNN                NNN
   251  109 B V  H  X S+     0   0    1 2310   66  VV VVVVV VVVVVVVVVVV                         V  VVV                MVV
   252  110 B L  H  X S+     0   0    9 2310   23  LL MLMML MLMMMMMMMMM                         M  LLM                ILM
   253  111 B V  H  X S+     0   0    0 2312   56  VI VIVVV VIVVVVVVVVV                         V  VLV                VVV
   254  112 B T  H  X S+     0   0    1 2312   29  II IIIII IIIIIIIIIII                         I  IIV                IVI
   255  113 B V  H  X S+     0   0    6 2315   53  IV IVIIV IVIIIIIIIII                         I  VVV                IVV
   256  114 B L  H  X S+     0   0    4 2315   24  LL LLLLL LLLLLLLLLLL                         L  LLL                LLL
   257  115 B A  H  X S+     0   0    0 2315   11  AG AAAAA AAAAAAAAAAA                         A  AAA                AAA
   258  116 B I  H  < S+     0   0   27 2307   85  SA TGTTG TSTTTTTTTTT                         T  KTS                SRS
   259  117 B H  H  < S+     0   0  114 2316   52  HE HHHHH HRHHHHHHHHH                         H  YHH                HHH
   260  118 B F  H >< S-     0   0   18 2316   62  FF FFFFF FFFFFFFFFFF                         F  FFF                FFF
   261  119 B G  G >< S+     0   0   17 2314   55  GG GTGGG GGGGGGGGGGG                         G  GGG                GGG
   262  120 B K  G 3  S+     0   0  193 2165   71  KK KKKKK KKKKKKKKKKK                         R  KKK                GKK
   263  121 B E  G <  S+     0   0   93 2313   44  EE EEEEE EEEEEEEEEEE                         E  EEE                EDE
   264  122 B F  S <  S-     0   0    0 2313    7  FF FFFFF FFFFFFFFFFF                         F  FFF                FFF
   265  123 B T    >>  -     0   0   53 2311   23  TT TTTTT TTTTTTTTTTT                         T  TTS                TTT
   266  124 B P  H 3> S+     0   0   23 2311   20  PP PPPPP PPPPPPPPPPP                         P  PPP                PPP
   267  125 B E  H 3> S+     0   0  105 2307   52  DE EEEEE EEEEEEDEEEE                         E  QED                EED
   268  126 B V  H <> S+     0   0   22 2310   50  VV VVVVM VVVVVVVVVVV                         V  VVV                VVV
   269  127 B Q  H  X S+     0   0    0 2291   35  QQ QQQQQ QQQQQQQQQQQ                         Q  QQQ                QQQ
   270  128 B A  H  X S+     0   0   15 2300   35  AA AAAAA AAAAAAAAAAA                         A  SAA                AAA
   271  129 B S  H  X S+     0   0    1 2302   49  AA AAAAA ASAAAAAAAAA                         A  AAA                AAA
   272  130 B W  H  X S+     0   0    1 2304   51  WS WWWWW WWWWWWWWWWW                         W  WWW                WWW
   273  131 B Q  H  X S+     0   0    5 2306   39  QQ QQQQQ QQQQQQQQQQQ                         Q  QQQ                QQQ
   274  132 B K  H  X S+     0   0  100 2304    1  KK KKKKK KKKKKKKKKKK                         K  KKK                KKK
   275  133 B M  H  X S+     0   0    1 2301   33  LL LLLLV LLLLLLLLLLL                         L  LLL                LLL
   276  134 B V  H  X S+     0   0    6 2303   34  VV VVVVV VVVVVVVVVVV                         V  VVV                VVV
   277  135 B T  H  X S+     0   0   80 2301   65  SS STSSA SSSSSSSSSSS                         S  ASA                AAA
   278  136 B G  H  X S+     0   0   23 2301   71  GG AGAAG AGAAAAGAAAA                         A  GGG                GGG
   279  137 B V  H  X S+     0   0   17 2298   15  VV VVVVV VVVVVVVVVVV                         V  VVV                VVV
   280  138 B A  H  X S+     0   0    5 2297   60  AA AAAAA ASAAAAAAAAA                         A  AAA                AAA
   281  139 B S  H  X S+     0   0   67 2291   79  NS INIIN ISIIIITIIII                         I  TIN                TSN
   282  140 B A  H  < S+     0   0    2 2289   52  AA AAAAA AAAAAAAAAAA                         A  AAA                AAA
   283  141 B L  H  < S+     0   0   19 2272    1  LL LLLLL LLLLLLLLLLL                         L  LLL                LLM
   284  142 B S  H >< S+     0   0   44 2267   58  AA AAAAS GGAAGAAAGGG                         A  AAA                AAA
   285  143 B S  T 3< S+     0   0   57 2265   80  HH HHHHH HHHHHHHHHHH                         H  HHH                HHH
   286  144 B R  T 3  S+     0   0  128 2255   28  KK KKKKK KKKKKKKKKKK                         K  KKK                KKK
   287  145 B Y    <         0   0   31 2246    0  YY YYYYY YYYYYYYYYYY                         Y  YYY                YYY
   288  146 B H              0   0  136 2186   41  HH HHHHH HHHHHHHHHHH                         H  HHH                HHH
## ALIGNMENTS  561 -  630
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....7....:....8....:....9....:....0....:....1....:....2....:....3
     1    1 A V              0   0  136  867   26    VV          VVVVVVVVVVVVVV     V        VV    V            VV       
     2    2 A L        -     0   0   22 1663    3    LL          LLLLLLLLLLLLLL     L        FV    L            LL       
     3    3 A S     >  -     0   0   51 1663   48    SS          SSSSSSSSSSSSSS     S        SS    S            SS       
     4    4 A P  H  > S+     0   0   84 1664   53    PP          AAAAAAAAAAAAAA     A        AA    A            AA       
     5    5 A A  H  > S+     0   0   62 1663   62    AT          EEDEEDEEEEEDED     D        EE    E            AA       
     6    6 A D  H  > S+     0   0    8 1667   20    DD          DDDDDDDDDDDDDD     D        DD    D            DB       
     7    7 A K  H  X S+     0   0   46 1668    8    KK          KKKKKKKKKKKKKK     K        KK    K            KK       
     8    8 A T  H  X S+     0   0   95 1666   59    TS          AAAAATAAAAAAAA     T        AA    A            AS       
     9    9 A N  H  X S+     0   0   43 1665   80    SN          NNNNNNNNNNNNNN     N        NN    N            NB       
    10   10 A V  H  X S+     0   0    2 1667   12    IV          VVIVVIVVVVVVVI     I        VV    V            VV       
    11   11 A K  H  X S+     0   0   99 1668   70    KK          KKKKNKKKKKKKKK     K        KK    K            KK       
    12   12 A A  H  X S+     0   0   67 1669   58    TA          TTTTTNTTTTTTTT     N        TT    T            AA       
    13   13 A A  H  < S+     0   0    5 1672   61    AA          VVVVVCVVVVVVVV     C        VV    V            VA       
    14   14 A W  H  X S+     0   0   22 1672    7    WW          WWWWWWWWWWWWWW     W        WW    W            WW       
    15   15 A G  H  < S+     0   0   51 1672   52    EE          SSSSSGSSSSSSSS     G        SS    S            EG       
    16   16 A K  T  < S+     0   0  111 1673    8    KK          KKKKKKKKKKKKKK     K        KK    K            KK       
    17   17 A V  T >4 S+     0   0    1 1676   26    IV          IIIIIIIIIIIIII     I        II    I            AV       
    18   18 A G  T 3< S+     0   0   49 1676   66    GG          GGGGGGGGGGGGGG     G        GG    G            GG       
    19   19 A A  T 3  S+     0   0   96 1676   70    SG          GGGGGGGGGGGDDG     G        GD    G            GG       
    20   20 A H  S <> S+     0   0   92 1674   65    HH          HHHHHHHHHHHHHQ     H        HH    H            NN       
    21   21 A A  H  > S+     0   0    6 1158   58    GA          RRGRGGHRRRRHHG     G        RH    R            VA       
    22   22 A G  H  > S+     0   0   19 1159   49    GG          AAAAAGAAAAAAAA     G        AA    A            GA       
    23   23 A E  H  > S+     0   0  120 1676   42    ED          EEEEEEEEDEEEEE     E        EE    E            KP       
    24   24 A Y  H  X S+     0   0   23 1676   70    YY          YYYYYYYYYYYYYY     Y        YY    Y            YY       
    25   25 A G  H  X S+     0   0    4 1676    6    GG          GGGGGGGGGGGGGG     G        GG    G            GG       
    26   26 A A  H  X S+     0   0   15 1676   45    AA          AAAAAEAAAAAAAA     E        AA    A            GA       
    27   27 A E  H  X S+     0   0   45 1676    7    EE          EEEEEEEEEEEEEE     E        EE    E            EZ       
    28   28 A A  H  X S+     0   0    0 1674   28    AA          AAAAAAAAAAAAAA     A        AA    A            AA       
    29   29 A L  H  X S+     0   0    4 1677    2    LL          LLLLLLLLLLLLLL     L        LL    L            LL       
    30   30 A E  H  X S+     0   0   36 1677   56    EE          GGGGGQGGGGGGGG     Q        GG    G            DZ       
    31   31 A R  H  X S+     0   0    3 1678    1    RR          RRRRRRRRRRRRRR     R        RR    R            RR       
    32   32 A M  H  X S+     0   0   11 1677   19    VM          MMMMMMDMMMMMMM     M        MM    M            TM       
    33   33 A F  H  < S+     0   0   11 1667   15    FF          FFFFFFVFFFFFLF     F        FF    F            FF       
    34   34 A L  H  < S+     0   0   58 1672   64    LL          EEEEEAREEEEEEE     A        EE    E            LL       
    35   35 A S  H  < S+     0   0   15 1674   70    GS          SSSSSAKSSSSSSS     A        SS    S            SS       
    36   36 A F    ><  +     0   0   36 1674   14    FF          HHHHHFPHHHHHHH     F        HH    H            FF       
    37   37 A P  G >  S+     0   0   44 1674    0    PP          PPPPPPLPPPPPPP     P        PP    P            PP       
    38   38 A T  G >  S+     0   0   37 1674  100    TT          TTTTTTTTTTTTTT     T        TT    T            TT       
    39   39 A T  G X  S+     0   0    3 1674    2    TT          TTTTTTTTTTTTTT     T        TT    T            TT       
    40   40 A K  G X  S+     0   0   64 1674   41    KK          KKKKKKKKKKKKKK     K        KK    K            KK       
    41   41 A T  G <  S+     0   0    7 1675   64    TT          TTTTTTTTTTTTTT     T        TT    T            TT       
    42   42 A Y  G <  S+     0   0   16 1675    3    YY          YYYYYYYYYYYYYY     Y        YY    Y            YY       
    43   43 A F    X   +     0   0   31 1676    0    FF          LFFFFFFLFFFFFF     F        FF    F            FF       
    44   44 A P  T 3  S+     0   0   70 1676   66    PP          PPPLPSPPPLPPPP     S        PL    L            PP       
    45   45 A H  T 3  S+     0   0  122 1676   59    HH          HHHHHHHHHHHHHH     H        HH    H            HH       
    46   46 A F  S <  S-     0   0   44 1676    8    FF          FFFFFIFFFFFFFF     I        FF    F            MF       
    47   47 A D        -     0   0   81 1676   46    DD          DDDDDDDDDDDDDD     D        DD    D            DB       
    48   48 A L        +     0   0   55 1674   66    LL          VVVVVVVVVVVVVV     V        VV    V            LL       
    49   49 A S  S >  S-     0   0   58 1674   83    TS          SSSSSSSSSSSSSS     S        SS    S            TS       
    50   50 A H  T 3  S+     0   0  150 1674   86    HH          HHHHHPHHHHHHHH     P        HH    H            PH       
    51   51 A G  T 3  S+     0   0   40 1676   21    GG          GGSGGGGGGGGSGS     G        GG    G            GG       
    52   52 A S    X>  -     0   0   13 1677   46    SS          SSSSSSSSSSSSSS     S        SS    S            SS       
    53   53 A A  H 3> S+     0   0   80 1675   50    EA          AAAAAAAAAAAAAA     A        AA    A            AA       
    54   54 A Q  H 3> S+     0   0   86 1677   56    QQ          QQQQQQQQQQQQQQ     Q        QQ    Q            DZ       
    55   55 A V  H <> S+     0   0   12 1676   15    IV          VVVVVVVVVVVVVV     V        VV    V            IV       
    56   56 A K  H  X S+     0   0  130 1677   25    EK          KKKKKKKKKKKKKK     K        KK    K            MK       
    57   57 A G  H  X S+     0   0   37 1678   52    TA          TTTTTATTTTTTTT     A        TT    T            AA       
    58   58 A H  H  X S+     0   0   53 1678    7    HH          QQQQQHQQQQQQQQ     H        QQ    Q            HH       
    59   59 A G  H  X S+     0   0    0 1678    1    GG          GGGGGGGGGGGGDG     G        GG    G            GG       
    60   60 A K  H  X S+     0   0  132 1677   49    KK          AAAAAKAAAAAAAA     K        AA    A            KZ       
    61   61 A K  H  X S+     0   0  166 1677   22    KK          KKKKKKKKKKKKKK     K        KK    K            KK       
    62   62 A V  H  X S+     0   0   31 1677    6    VV          VVVVVVVVVVVVVV     V        VV    V            VV       
    63   63 A A  H  X S+     0   0    1 1677   69    SA          AAATAAAAATATAA     A        AT    T            AA       
    64   64 A D  H  X S+     0   0   83 1677   63    EA          DDDDDDDDDDDDDD     D        DD    D            DB       
    65   65 A A  H  X S+     0   0   23 1678   36    AA          AAAAAAAAAAAAAA     A        AA    A            AA       
    66   66 A L  H  X S+     0   0   15 1678   27    LL          LLLLLLLLLLLLLL     L        LL    L            LL       
    67   67 A T  H  X S+     0   0   52 1678   69    TT          AAAAAAAAAAAAAA     A        AA    A            TT       
    68   68 A N  H  X S+     0   0   60 1678   62    KL          TTTTTKTTTTTTTT     K        TT    T            LK       
    69   69 A A  H  < S+     0   0    0 1678   26    AA          AAAAAAAAAAAAAA     A        AA    A            AA       
    70   70 A V  H >< S+     0   0   10 1678   47    VV          AAAAAAAAAAAAAA     A        AA    A            VV       
    71   71 A A  H 3< S+     0   0   71 1678   70    GY          DDDDDDGDDDDDDD     D        DD    D            GG       
    72   72 A H  T >< S+     0   0   84 1678   50    HH          NNNNNHHNNNNNNN     H        NN    N            HH       
    73   73 A V  T <  S+     0   0   14 1678   26    LL          LLLLLVLLLLLLLL     V        LL    L            ML       
    74   74 A D  T 3  S+     0   0  114 1678    3    DD          DDDDDEDDDDDDDD     E        DD    D            DB       
    75   75 A D  S X> S+     0   0   85 1678   30    DD          DDDDDDDDDDVDDD     D        DD    D            DB       
    76   76 A M  H 3>  +     0   0   13 1678   19    QL          LLLQLLLLLQLHLL     L        LQ    Q            LL       
    77   77 A P  H 34 S+     0   0   69 1672   78    PP          PPPPPPPPPPPPPP     P        PP    P            PP       
    78   78 A N  H X4 S+     0   0   91 1678   38    GD          AGGGGGGAGGGGAG     G        GG    G            GG       
    79   79 A A  H 3< S+     0   0   34 1678   50    AT          AAAAAAAAAAAAAA     A        AA    A            AT       
    80   80 A L  T 3X S+     0   0    5 1678   14    LL          LLLLLLLLLLLLLL     L        LL    L            LL       
    81   81 A S  H <> S+     0   0   43 1678   57    SS          SSSSSSSSSSSSSS     S        SS    S            SS       
    82   82 A A  H  > S+     0   0   77 1678   70    AA          AAADATAAVDAAAA     T        AD    A            KB       
    83   83 A L  H  > S+     0   0   54 1678    0    LL          LLLLLLLLLLLLLL     L        LL    L            LL       
    84   84 A S  H  X S+     0   0    3 1677    3    SS          SSSSSSSSSSSSSS     S        SS    S            SS       
    85   85 A D  H  X S+     0   0   67 1678   28    GD          DDDDDDDDDDDDDD     D        DD    D            DB       
    86   86 A L  H >X>S+     0   0   68 1678    8    LL          LLLLLLLLLLLLLL     L        LL    L            LL       
    87   87 A H  I 3<>S+     0   0   41 1678    0    HH          HHHHHHHHHHHHHH     H        HH    H            HH       
    88   88 A A  I 3<5S+     0   0    6 1678   45    AA          ATAAAAAAAAAAAA     A        TA    A            AA       
    89   89 A H  I <<5S+     0   0  111 1678   83    HC          HHHHHHHHHHHHHH     H        HH    H            YH       
    90   90 A K  I  <5S+     0   0  162 1678   37    KK          KKKKKKKKKKKKNK     K        KK    K            KK       
    91   91 A L  I      -     0   0    3 1677    2    DD          DDDDDDDDDDDDDD     D        DD    D            DB       
    95   95 A P  T >> S+     0   0   40 1677    0    PP          PPPPPPPPPPPPPP     P        PP    P            PP       
    96   96 A V  H 3> S+     0   0   56 1677   76    VA          VVVVVVVVVVVVVV     V        VV    V            VV       
    97   97 A N  H <> S+     0   0   10 1676    1    NN          NNNNNNNNNNNNNN     N        NN    N            NB       
    98   98 A F  H <> S+     0   0   23 1678    0    FF          FFFFFFFFFFFFFF     F        FF    F            FF       
    99   99 A K  H  X S+     0   0  129 1678   26    KK          KKKKKKKKKKKKKK     K        KK    K            KK       
   100  100 A L  H  X S+     0   0   20 1675   16    LL          LLHLLFLLLLLLLL     F        LL    L            LL       
   101  101 A L  H  X S+     0   0   40 1677    2    LL          LLLLLLLLLLLLLL     L        LL    L            LL       
   102  102 A S  H  X S+     0   0   16 1677   44    SG          SSSSSSSSSSSSSS     S        SS    S            SS       
   103  103 A H  H  X S+     0   0   16 1677   45    HH          HHHHHHHHHHHHHH     H        HH    H            HH       
   104  104 A C  H  X S+     0   0    0 1676   70    CC          CCCCCCCCCCCCCC     C        CC    C            CS       
   105  105 A L  H  X S+     0   0   11 1676   23    LL          LLLLLLLLLLLLLL     L        LL    L            LL       
   106  106 A L  H  X S+     0   0    2 1677   44    LL          QQLLQLLQQLQQLL     L        QL    Q            LL       
   107  107 A V  H  X S+     0   0    0 1677   30    VV          VVVVVVVVVVVVVV     V        VV    V            VV       
   108  108 A T  H  < S+     0   0    1 1677   51    TT          TTTTTTTTTTTTTT     T        TT    T            TT       
   109  109 A L  H >X S+     0   0    4 1677   20    LL          LLLLLLLLLLLLLL     L        LL    L            LL       
   110  110 A A  H 3< S+     0   0    0 1677   13    AA          AAAAAAAAAAAAAA     A        AA    A            AA       
   111  111 A A  T 3< S+     0   0   10 1675   90    NR          SSSSSCARSASSSS     C        SS    S            CT       
   112  112 A H  T <4 S+     0   0   53 1678   39    HH          HHHHHHHHHHHHHH     H        HH    H            HH       
   113  113 A L  S >X S-     0   0    3 1678   63    HY          QQQQQHLQQLQQQQ     H        QQ    H            LL       
   114  114 A P  T 34 S+     0   0   90 1678   50    PP          PPPPPPPPPPPPPP     P        PP    L            GP       
   115  115 A A  T 34 S+     0   0   80 1590   72    SG          .....GS..S....     G        ..    P            GB       
   116  116 A E  T <4 S+     0   0   79 1678   38    ED          EEEEEDDEEDEEEE     D        EE    E            DB       
   117  117 A F     <  +     0   0    8 1678    7    FF          FFFFFFFFFFFFFF     F        FF    F            FF       
   118  118 A T     >  -     0   0   62 1678   18    TS          TTTTTTTTTTTTTT     T        TT    T            TT       
   119  119 A P  H  > S+     0   0   22 1678   12    PP          PPPPPPSPPSPPPP     P        PP    P            PP       
   120  120 A A  H  > S+     0   0   35 1677   58    AA          AAAAAAAAAAAAAA     A        AA    A            AA       
   121  121 A V  H  > S+     0   0   17 1677   38    GL          VVVVVMVVVVVVVV     M        VV    V            AV       
   122  122 A H  H  X S+     0   0    2 1676   32    HQ          HHHHHHHHHHHHHH     H        HH    H            HH       
   123  123 A A  H  X S+     0   0   16 1676   34    VA          AAAAAAAAAAAAAA     A        AA    A            AA       
   124  124 A S  H  X S+     0   0    3 1676   45    SS          SSSSSSSSSSSSSS     S        SS    S            SS       
   125  125 A L  H  X S+     0   0    3 1676   46    LL          LLLLLLLLLLLLLL     L        LL    L            LL       
   126  126 A D  H  X S+     0   0   21 1676   30    DD          DDDDNDDDDDDDDD     D        DD    D            DB       
   127  127 A K  H  X S+     0   0   36 1676    0    KK          KKKKKKKKKKKKKK     K        KK    K            KK       
   128  128 A F  H  X S+     0   0    2 1676   41    SF          FFFFFFFFFFFFFF     F        FF    F            FF       
   129  129 A L  H  X S+     0   0    7 1676   33    LL          LLLLLLLLLLLLLL     L        LL    L            LL       
   130  130 A A  H  X S+     0   0   39 1676   54    AS          AAAAAAAAAAAAAA     A        AA    A            SA       
   131  131 A S  H  X S+     0   0   29 1676   65    NH          SSSSSSSSSSSSSS     S        SS    S            SB       
   132  132 A V  H  X S+     0   0    9 1676   11    VV          VVVVVVVVVVVVVV     V        VV    V            VV       
   133  133 A S  H  X S+     0   0   17 1675   49    SI          SSSSSSSSSSSSSS     S        SS    S            SS       
   134  134 A T  H  X S+     0   0   88 1674   74    TL          TTTTTTTTTTTTTT     T        TT    T            TT       
   135  135 A V  H  < S+     0   0   21 1675   55    VA          VVVVVVVVVVAVVV     V        VV    V            VV       
   136  136 A L  H  < S+     0   0   19 1674    0    LL          LLLLLLLLLLLLLL     L        LL    L            LL       
   137  137 A T  H >< S+     0   0   42 1674   54    TA          TTTTTTTTTTTTTT     T        TT    T            TT       
   138  138 A S  T 3< S+     0   0   57 1669   77    SS            SSSSSSSSSSSS     S         S    S            SS       
   139  139 A K  T 3  S+     0   0   77 1669   12    KK            KKKKKKKKKKKK     K         K    K            KK       
   140  140 A Y    <         0   0   19 1666    0    YY            YYYYYSYYYYYY     Y         Y    Y            YY       
   141  141 A R              0   0   75 1644   37    RR            RRRRRRRRRRRR     R         R    R            RR       
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41                                                                        
   144    2 B H        -     0   0  151 1032   46  H   HHHHHHHDHH               HHHH HHHHHHHN  HHHH HHHHHHHHHHHH  HHHHHHH
   145    3 B F        -     0   0   37 2258   27  F   FFFFFFFFFL               FFFF LLLLFFFF  FFFL FFLFFFFFFFFF  FLLLLLL
   146    4 B T    >>  -     0   0   75 2258   47  T   TTTTTTTTTT               STST TTTTTTST  TTTT TTTTTTTTTTTT  TTTTTTT
   147    5 B E  H 3> S+     0   0  133 2262   54  P   AAAAAPAAAA               AAAA AGGAAGAA  AAAP GAGAAAAAAAAA  AAGGPGA
   148    6 B E  H 3> S+     0   0  151 2265   64  E   DEEEEEEEEE               EEEE EEEEEEEE  EEEE EEEEEEEEEEEE  EDEEEEE
   149    7 B D  H X> S+     0   0   26 2283   21  E   EEEEEEEEEE               EEEE EEEEEEEE  EEEE EEEEEEEEEEEE  EEEEEEE
   150    8 B K  H 3X S+     0   0   82 2285   24  K   KKKKKKKKKK               KKKK KKKKKKKK  KKKK KKKKKKKKKKKK  KKKKKKK
   151    9 B A  H 3X S+     0   0   51 2283   64  C   VVVASCAASN               AAAA SASSATAS  AAAT AAAAAAAAAAAA  AASATAA
   152   10 B T  H < S+     0   0    5 2293   58  Q   LLLLVQTLLL              LLLLI LLLLLVLL  IIIL LLLIIIIIIIII  ILLLLLL
   157   15 B W  G >< S+     0   0   32 2299    7  W   WWWWWWWWWW              WWWWW WWWWWWWW  WWWW WWWWWWWWWWWW  WWWWWWW
   158   16 B G  G 3  S+     0   0   69 2299   51  G   SSSSGGKGGG              GGAGD GGGGASGS  DDDG GAGDDDDDDDDD  DGGGGGG
   159   17 B K  G <  S+     0   0  109 2303   19  Q   KKKKKQLKKK              KKRKK KKKKKKKK  KKKK KRKKKKKKKKKK  KKKKKKK
   160   18 B V    <   -     0   0   19 2307   28  V   MMMMVVVMVL              VVVVV VVVMVVVV  VVVV MVVVVVVVVVVV  VVVVVVV
   161   19 B N     >  -     0   0   97 2308   63  N   NNNNNNDNNN              NNNHD NNNNNNHN  DDDN NNNDDDDDDDDD  DNNNNNN
   162   20 B V  H  > S+     0   0   26 2306   77  I   VVVVVIVVVV              VVVVV VVVVVVVV  VVVV MVVVVVVVVVVV  LVVVVVV
   163   21 B E  H  > S+     0   0   84 2303   46  D   EEEEEDEEEE              DEEEE EEDDEEEE  EEED EEDEEEEEEEEE  EDDDDDD
   164   22 B D  H  4 S+     0   0   90 2307   47  E   EEEEEEDEEE              DDLEK EEEEEEEE  KKKE ELEKKKKKKKKK  KEEEEEE
   165   23 B A  H  X S+     0   0   13 2309   68  T   AAAAATAATT              VAVAI AVVATAAV  IIIV AVVIIIIIIIII  VVVVVVV
   166   24 B G  H  X S+     0   0    0 2309    5  G   GGGGGGGGGG              GGGGG GGGGGGGG  GGGG GGGGGGGGGGGG  GGGGGGG
   167   25 B G  H  X S+     0   0    5 2309   51  G   GGGGGGAGGG              AGGGG GGGGGGGG  GGGG GGGGGGGGGGGG  GGGGGGG
   168   26 B E  H  > S+     0   0   52 2309   25  E   EEEEEEEKEE              EEEEE EEEEEEEE  EEEE EEEEEEEEEEEE  EEEEEEE
   169   27 B T  H  X S+     0   0    4 2307   28  A   AAAAAAAAAA              AAVAT AAAAAVAA  TTTA AVTTTTTTTTTT  TAAAAAA
   170   28 B L  H  X S+     0   0    7 2310    2  L   LLLLLLLLVL              LLLLL LLLLLLLL  LLLL LLLLLLLLLLLL  LLLLLLL
   171   29 B G  H  X S+     0   0    0 2310   62  G   GGGGGGGGGG              GGGGG GGGGGGGG  GGGG GGGGGGGGGGGG  GGGGGGG
   172   30 B R  H  X S+     0   0    8 2309    2  RR  RRRRRRRRRR              RRRRR RRRRRRRR  RRRR RRRRRRRRRRRR  RRRRRRR
   173   31 B L  H  X S+     0   0   12 2309   37  LL  LLLLLLLLLV              LLLLL LLLLLLLL  LLLL LLLLLLLLLLLL  LLLLLLL
   174   32 B L  H  < S+     0   0    0 2309   14  LL  LLLLLLLLLL              LLLLL LLLLLLLL  LLLL LLLLLLLLLLLL  LLLLLLL
   175   33 B V  H  < S+     0   0   26 2310   56  VV  VVVIVVVIVV              VIVVI VVVVVVVV  IIIV VVVIIIIIIIII  IVVVVVV
   176   34 B V  H  < S+     0   0    2 2312   61  VV  VVVVVVVVVV              VVVVV VVVVVVVV  VVVV FVVVVVVVVVVV  VVVVVVV
   177   35 B Y  S >< S-     0   0   26 2312   13  YY  YYYYYYYYYY              YYYYY YYYYYYYY  YYYY YYYYYYYYYYYY  YYYYYYY
   178   36 B P  T 3   +     0   0   29 2313    0  PP  PPPPPPPPPP              PPPPP PPPPPPPP  PPPP PPPPPPPPPPPP  PPPPPPP
   179   37 B W  T 3  S+     0   0   22 2313   94  WW  WWWWWWWWWW              WWWWW WWWWWWWW  WWWW WWWWWWWWWWWW  WWWWWWW
   180   38 B T  S X  S+     0   0    3 2313    3  TT  TTTTTTTTTT              TTTTT TTTTTTTT  TTTT TTTTTTTTTTTT  TTTTTTT
   181   39 B Q  G >  S+     0   0   40 2313   46  QQ  QQQQQQQQQQ              QQQQQ QQQQQQQQ  QQQQ QQQQQQQQQQQQ  QQQQQQQ
   182   40 B R  G 3  S+     0   0   64 2316   69  RR  RRRRRRRRRR              RRRRR RRRRRRRR  RRRR RRRRRRRRKRRR  RRRRRRR
   183   41 B F  G <  S+     0   0   60 2316    8  FF  FFFFFFFFFF              FFFFF FFFFFFFF  FFFF FFFFFFFFFFFF  FFFFFFF
   184   42 B F    X   +     0   0   26 2316    0  FF  FFFFFFFFFF              FFFFF FFFFFFFF  FFFF FFFFFFFFFFFF  FFFFFFF
   185   43 B D  T 3  S+     0   0  125 2315   68  DE  DDDDDDDDDD              DDDDD DDDDDDDD  DDDD DDDDDDDDDDDD  DDDDDDD
   186   44 B S  T 3  S+     0   0  109 2316   73  NS  NNNSNNSNSS              SSSNK SSSNNNSS  KKKS SNSKKKKKKKKK  KSSSSSS
   187   45 B F  S <  S-     0   0   34 2315    6  FF  FFFFFFFFFF              FFFFF FFFFFFFF  FFFF FFFFFFFFFFFF  FFFFFFF
   188   46 B G        +     0   0   57 2304   43  GG  GGGGGGGGGG              GGGGG GGGGGGGG  GGGG GGGGGGGGGGGG  GGGGGGG
   189   47 B N        +     0   0  101 1087   32  ND  NNNNNNNNNN              DDNNN DDDNNNNN  NNND NNDNNNNNNNNN  NDDDDDD
   190   48 B L        +     0   0   18 1086    4  LL  LLLLLLLLMM              LLLLL LLLLLLLL  LLLL LLLLLLLLLLLL  LLLLLLL
   191   49 B S        +     0   0   87 1087   39  SS  SSSSSSSSSS              SSSSS SSSSSSSS  SSSS SSSSSSSSSSSS  SSSSSSS
   192   50 B S  S >> S-     0   0   64 1089   48  SS  SSSSSSSSSS              STSSS SSSSSSSS  SSSS SSSSSSSSSSSS  SSSSSSS
   193   51 B A  H 3> S+     0   0   28 1160   49  SA  PPPPPSSAPP              APEAA APASASEA  AAAP AEPAAAAAAAAA  APAPPPP
   194   52 B S  H 3> S+     0   0  104 1382   69  SD  SSSSSSSSSS              GDSSS SSDSSSSS  PPPD SSDPPPPPPPPP  LDDDDDD
   195   53 B A  H <4 S+     0   0   24 2309   70  AA  AAAAAAAAAA              AAAAA AAAAAAAA  AAAA AAAAAAAAAAAA  AAAAAAA
   196   54 B I  H  < S+     0   0    2 2309   82  II  IIIIIIIIII              IVIII VVIIIIII  IVIV IIVIIIIIIIII  IVIVVVV
   197   55 B M  H  < S+     0   0   39 2309   88  ML  LLLLMMMMMM              MMMMM MMMMMMMM  MMMM MMMMMMMMMMMM  MMMMMMM
   198   56 B G  S  < S+     0   0   41 2311   27  GG  GGGGGGGGGG              GSGGG GGGGGGGG  GGGG GGSGGGGGGGGG  GGNGGGG
   199   57 B N     >  -     0   0   13 2313   52  NN  NNNNNNNNNN              NNNNN NNNNNNNN  NNNN NNNNNNNNNNNN  NNNNNNN
   200   58 B P  H  > S+     0   0   95 2311   53  PP  PPPPPPPPPP              PAPPP PPPPPPPP  PPPP PPPPPPPPPPPP  PPPPPPP
   201   59 B K  H  > S+     0   0  126 2313   69  KK  KKKKKKKKKR              KKKKR KKKKKKKR  RRRK KKKRRRRRRRRR  RKKKKKK
   202   60 B V  H  > S+     0   0    1 2312   13  VV  VVVVVVVVVV              VVVVI VVVVVVVV  IIIV VVVIIIIIIIII  IVVVVVV
   203   61 B K  H  X S+     0   0  112 2311   50  KK  KKKKKKKKKK              KKKKR KKKKKKKK  RRRK KKKRRRRRRRRR  RKKKKKK
   204   62 B A  H  X S+     0   0   53 2312   51  AA  AAAAAAAAAA              AAAAA AAAAAAAA  AAAA AAAAAAAAAAAA  AAAAAAA
   205   63 B H  H  X S+     0   0   62 2314    5  HH  HHHHHHHHHH              HHHHH HHHHHHHH  HHHH HHHHHHHHHHHH  HHHHHHH
   206   64 B G  H  X S+     0   0    0 2314    1  GG  GGGGGGGGGG              GGGGG GGGGGGGG  GGGG GGGGGGGGGGGG  GGGGGGG
   207   65 B K  H  X S+     0   0   94 2312   54  KK  KKKKKKKKKK              KKKKK KKKKKKKK  KKKK KKKKKKKKKKKK  KKKKKKK
   208   66 B K  H  X S+     0   0  156 2313   28  KK  KKKKKKKKKK              KKKKK KKKKKKKK  KKKK KKKKKKKKKKKK  KKKKKKK
   209   67 B V  H  X S+     0   0   40 2314    7  VV  VVVVVVVVVV              VVVVV VVVVVVVV  VVVV VVVVVVVVVVVV  VVVVVVV
   210   68 B L  H  X S+     0   0    5 2314   63  LL  LLLLLLLLLL              ALLLL LLLLLLLL  LLLL LLLLLLLLLLLL  LLLLLLL
   211   69 B T  H  X S+     0   0   52 2310   68  TD  TTTTTTTNTT              NNTTT QNNTSTTT  ATTG TTNXAXXXTTTT  TNNNGNN
   212   70 B S  H  < S+     0   0   44 2314   47  SS  SSSSSSASSS              SSSSS SSSSSSSA  SSSA SSSSSSSSSSSS  SSSSASS
   213   71 B L  H >X S+     0   0   17 2314   25  FF  FFFFFFFFFF              IFFFL MFFFLFFF  LLLF FFFLLLLLLLLL  LFFFFFF
   214   72 B G  H >X S+     0   0   10 2314   68  GC  GGGGGGGGGG              SSGGG GSSGGGGG  GGGS GGSGGGGGGGGG  GSSSSSS
   215   73 B D  H 3< S+     0   0   98 2312   70  DE  DDDDEDDDDE              DDNNL DDDDEDNE  LLLD ENELLLLLLLLL  LDDEDEE
   216   74 B A  H X4 S+     0   0    0 2314   20  AG  AAAAAAAAAA              GGAAA GGGAAAAT  AAAG AAGAAAAAAAAA  GGGGGGG
   217   75 B I  H X< S+     0   0   14 2313   43  IL  IIIIVIVVVI              ILVVV LLLIVIVI  VVVL MILVVVVVVVVV  VLLLLLL
   218   76 B K  T 3< S+     0   0  162 2315   65  KK  KKKKKKKKKK              KKKKK AKKKTKKK  KKKN KKKKKKKKKKKK  KKKKNKK
   219   77 B H  T X   +     0   0   96 2315   51  NQ  NNNNNNNNNN              NNHHN NNNNHNHN  NNNH NHNNNNNNNNNN  NNNNHNN
   220   78 B L  T <   +     0   0   17 2315   32  ML  MMMMMMVPML              LLMMM LLLMMMML  MMML SMLMMMMMMMMM  MLLLLLL
   221   79 B D  T 3  S+     0   0  159 2315    5  DD  DDDDDDDDDD              DDDDD DDDDDDDD  DDDD DDDDDDDDDDDD  DDDDDDD
   222   80 B D    <>  +     0   0   85 2315   35  ND  NNNNNNDNNN              NNDDN NNNNDNDN  NNNN NDNNNNNNNNNN  NNNNNNN
   223   81 B L  H  > S+     0   0   17 2313   25  LL  LLLLLLLLLL              LLLLL LLLLLLLL  LLLL LLLLLLLLLLLL  LLLLLLL
   224   82 B K  H  > S+     0   0  143 2307   71  KK  KKKKKKKKKK              KKKKK KKKKKKKK  KKKK KKKKKKKKKKKK  KKKKKKK
   225   83 B G  H  4 S+     0   0   48 2312   51  GG  TTTPGGNGGG              GGDDE GGGGDGDS  EEEG GDGEEEEEEEEE  EGGGGGG
   226   84 B T  H  < S+     0   0   55 2313   57  AA  TTTAAATTTT              TTTTV TTTAAATA  VVVT ATTVVVVVVVVV  TTTTTTT
   227   85 B F  H  X S+     0   0    7 2314   23  FF  FFFFFFFFFF              YFFFF FFFFFFFL  FFFF FFFFFFFFFFFF  FFFFFFF
   228   86 B A  H  X S+     0   0   21 2315   60  AA  AAAAAAAAAA              AAAAA AAAAAAAA  AAAA AAAAAAAAAAAA  AAAAAAA
   229   87 B Q  H  > S+     0   0  150 2310   74  KS  KKKKKKHKKK              KKEEH KKKKHKEK  QHHQ KEKXXXXXHHHH  HKKKQKK
   230   88 B L  H  > S+     0   0   57 2316    0  LL  LLLLLLLLLL              LLLLL LLLLLLLL  LLLL LLLLLLLLLLLL  LLLLLLL
   231   89 B S  H  X S+     0   0    0 2315    2  SS  SSSSSSSSSS              SSSSS SSSSSSSS  SSSS SSSSSSSSSSSS  SSSSSSS
   232   90 B E  H  X S+     0   0   81 2316   47  EE  EEEEEEEEEE              EEEEE EEEEEEEE  EEEE EEEEEEEEEEEE  EEEEEEE
   233   91 B L  H  X>S+     0   0   77 2316   21  LL  LLLLLLLLLL              LLLLL LLLLLLLL  LLLL LLLLLLLLLLLL  LLLLLLL
   234   92 B H  I  <>S+     0   0   33 2316    0  HH  HHHHHHHHHH              HHHHH HHHHHHHH  HHHH HHHHHHHHHHHH  HHHHHHH
   235   93 B C  I  X5S+     0   0   12 2316   54  CC  CCCCCCCCCC              CCCCC CCCCCCCC  CCCC CCCCCCCCCCCC  CCCCCCC
   236   94 B D  I  <5S+     0   0   66 2315   78  DD  DDDDDDDDDD              DDDDD DDDDDDDD  DDDD DDDDDDDDDDDD  DDDDDDD
   237   95 B K  I  <5S+     0   0  155 2316   36  KK  KKKKKKRKKK              KKKKK KKKKRKKK  KKKK KKKKKKKKKNKK  KKKKKKK
   238   96 B L  I  4   -     0   0    3 2315    2  DD  DDDDDDDDDD              DDDDD DDDDDDDD  DDDD DDDDDDDDDDDD  DDDDDDD
   242  100 B P  T >> S+     0   0   17 2316    1  PP  PPPPPPPSPP              PPPPP PPPPPPPP  PPPP PPPPPPPPPPPP  PPPPPPP
   243  101 B E  H 3> S+     0   0   31 2316   76  EE  EEEEEEEEEE              EEEEE EEEEEEEE  EEEE EEEEEEEEEEEE  EEEEEEE
   244  102 B N  H <> S+     0   0   13 2316    2  NN  NNNNNNNNNN              NNNNN NNNNNNNN  NNNN NNNNNNNNNNNN  NNNNNNN
   245  103 B F  H <> S+     0   0   22 2316    1  FF  FFFFFFFFFF              FFFFF FFFFFFFF  FFFF FFFFFFFFFFFF  FFFFFFF
   246  104 B K  H  X S+     0   0  120 2316   30  KR  RRRKKKKRRK              RKKKK RRKRRRKK  KKKK RKKKKKKKKKKK  KKKKKKK
   247  105 B L  H  X S+     0   0   17 2300   17  LL  LLLLLLLLLL              LLLLL LLLLLLLL  LLLL LLLLLLLLLLLL  LLLLLLL
   248  106 B L  H  X S+     0   0   38 2308    2  LL  LLLLLLLLLL              LLLLL LLLLLLLL  LLLL LLLLLLLLLLLL  LLLLLLL
   249  107 B G  H  X S+     0   0    6 2310   44  GG  GGGGGGGGGG              GGGGG GGGGGGGG  GGGG GGGGGGGGGGGG  GGGGGGG
   250  108 B N  H  X S+     0   0   34 2311   57  NN  NNNNNNNNNN              NNNNN NNNNNNNN  NNNN DNNNNNNNNNNN  NNNNNNN
   251  109 B V  H  X S+     0   0    1 2310   66  VV  VVVVAVVVMV              VVMMM VVVVVVMV  MMMV VMVMMMMMMMMM  MVVVVVV
   252  110 B L  H  X S+     0   0    9 2310   23  LL  MMMMMLLLIL              LLIIL LLLLLMIL  LLLL IILLLLLLLLLL  LLLLLLL
   253  111 B V  H  X S+     0   0    0 2312   56  LV  VVVVVLVVVV              VVLLV VVVVVVLV  VVVV VLVVVVVVVVVV  VVVVVVV
   254  112 B T  H  X S+     0   0    1 2312   29  IV  IIIIIIIIII              CCIII VCCIIIII  IIIC IICIIIIIIIII  ICCCCCC
   255  113 B V  H  X S+     0   0    6 2315   53  VV  IIIIIVVVIV              VVVVV VVVIVIVV  VVVV VVVVVVVVVVVV  VVVVVVV
   256  114 B L  H  X S+     0   0    4 2315   24  LL  LLLLLLLLLL              MLLLL LLLLLLLL  LLLL LLLLLLLLLLLL  LLLLLLL
   257  115 B A  H  X S+     0   0    0 2315   11  AA  AAAAAAAAAS              AAAAS AAAVAAAA  SSSA AAASSSSSSSSS  SAAAAAA
   258  116 B I  H  < S+     0   0   27 2307   85  TR  TTTTTTKNSA              RHTTT RRHTHSTS  STTH TTHSSSSSTTTT  THHHHHH
   259  117 B H  H  < S+     0   0  114 2316   52  HC  HHHHHHYHHH              THHHH HHHHHHHH  HHHH HHHHHHHHHHHH  HHHHHHH
   260  118 B F  H >< S-     0   0   18 2316   62  FF  FFFFFFFFFF              LFFFF FFFFFFFF  FFFF SFFFFFFFFFFF  FFFFFFF
   261  119 B G  G >< S+     0   0   17 2314   55  GG  GGGGGGGGGG              GGTSV GGGGGGSG  GVVG GSGGGGGGVVVV  AGGGGGG
   262  120 B K  G 3  S+     0   0  193 2165   71  KS  KKKKKKKKGK              KKKKK KKKKRKKN  KKKK RKKKKKKKKKKK  KKKKKKK
   263  121 B E  G <  S+     0   0   93 2313   44  EE  EEEEEEEEEE              EEEEE EEEDEEEE  EEEE EEEEEEEEEEEE  EEEEEEE
   264  122 B F  S <  S-     0   0    0 2313    7  FF  FFFFFFFFFF              FFFFF FFFFFFFF  FFFF FFFFFFFFFFFF  FFFFFFF
   265  123 B T    >>  -     0   0   53 2311   23  TS  TTTTTTTTTT              TTTTT TTTTTTTT  TTTT TTTTTTTTTTTT  TTTTTTT
   266  124 B P  H 3> S+     0   0   23 2311   20  PP  PPPPPPPPPP              PPPPP PPPPPPPA  APPP PPPAAAAAPPPP  PPPPPPP
   267  125 B E  H 3> S+     0   0  105 2307   52  EE  EEEEDEQQEE              HQQQE PQQEQDQE  EEEQ DQQEEEEEEEEE  EQQQQQQ
   268  126 B V  H <> S+     0   0   22 2310   50  VL  VVVVVVVVVM              AVVMV VVVVVVMV  VVVV MTVVVVVVVVVV  VVVVVVV
   269  127 B Q  H  X S+     0   0    0 2291   35  QQ  QQQQQQQQQQ              QQQQQ QQQQQQQQ  QQQQ QQQQQQQQQQQQ  QQQQQQQ
   270  128 B A  H  X S+     0   0   15 2300   35  AA  AAAAAASAAA              AAAAA AAAVAAAA  AAAA AAAAAAAAAAAA  AAAAAAA
   271  129 B S  H  X S+     0   0    1 2302   49  AS  AAAAAAAAAA              AAAAA AAAAAAAA  AAAA AAAAAAAAAAAA  AAAAAAA
   272  130 B W  H  X S+     0   0    1 2304   51  WF  WWWWWWWWWW              FYWWW FYYWWWWW  WWWY WWYWWWWWWWWW  WYYYYYY
   273  131 B Q  H  X S+     0   0    5 2306   39  QQ  QQQQQQQQQQ              QQQQQ QQQQKQQQ  QQQQ QQQQQQQQQQQQ  QQQQQQQ
   274  132 B K  H  X S+     0   0  100 2304    1  KK  KKKKKKKKKK              KKKKK KKKKKKKK  KKKK KKKKKKKKKKKK  KKKKKKK
   275  133 B M  H  X S+     0   0    1 2301   33  LV  LLLLLLLMLL              MVLLL VVVLLLLL  LLLV LLVLLLLLLLLL  LVVVVVV
   276  134 B V  H  X S+     0   0    6 2303   34  VV  VVVVVVVAVV              VVTTV VVVVMVTV  VVVV VTVVVVVVVVVV  VVVVVVV
   277  135 B T  H  X S+     0   0   80 2301   65  ST  SSSSSSATAS              LATTM AAASSATA  AMMA STTAAAAAMMMM  IAAAAAA
   278  136 B G  H  X S+     0   0   23 2301   71  GG  AAAAGGGGGG              GGAAG GGGGAGAG  GGGG GAGGGGGGGGGG  GGGGGGG
   279  137 B V  H  X S+     0   0   17 2298   15  VV  VVVVVVVVVV              VVVVV VVVVVVVV  VVVV VVVVVVVVVVVV  VVVVVVV
   280  138 B A  H  X S+     0   0    5 2297   60  AA  AAAAAAAAAA              AAAAA AAAAAAAA  AAAA AAAAAAAAAAAA  AAAAAAA
   281  139 B S  H  X S+     0   0   67 2291   79  IN  IIIITITSTN              TNNNN TTNTINNT  NNNN TNNNNNNNNNNN  NNNNNNN
   282  140 B A  H  < S+     0   0    2 2289   52  AA  AAAAAAAAAA              AAAAA AAAAAAAA  AAAA AAAAAA  AAAA  AAAAAAA
   283  141 B L  H  < S+     0   0   19 2272    1  LL  LLLLLLLVLL              LLLLL LLLLLMLL  LLLL LLLLL   LLLL  LLLLLLL
   284  142 B S  H >< S+     0   0   44 2267   58  AA  GGGAAAAAAG               ATAS AAAAGAAS  SSSA AAASS   SSSS  SAAAAAA
   285  143 B S  T 3< S+     0   0   57 2265   80  HH  HHHHHHHRHH               HRHH HHHHHHHH  HHHH HHHHH   HHHH  HHHHHHH
   286  144 B R  T 3  S+     0   0  128 2255   28  KR  KKKKKKKKKK               KKKK KKKKKKKK  KKKK KKKKK   KNNK  KKKKKKK
   287  145 B Y    <         0   0   31 2246    0  YY  YYYYYYYYYY               YYYY YYYYYYYY  YYYY YYYYY   YYYY  YYYYYYY
   288  146 B H              0   0  136 2186   41  HH  HHHHHHHHHH               HH H  HHHHH H  HHHH H  HH   HHHH  HHHHHHH
## ALIGNMENTS  631 -  700
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....4....:....5....:....6....:....7....:....8....:....9....:....0
     1    1 A V              0   0  136  867   26                               V                                  V     
     2    2 A L        -     0   0   22 1663    3                               L                                  L     
     3    3 A S     >  -     0   0   51 1663   48                               S                                  S     
     4    4 A P  H  > S+     0   0   84 1664   53                               A                                  G     
     5    5 A A  H  > S+     0   0   62 1663   62                               A                                  A     
     6    6 A D  H  > S+     0   0    8 1667   20                               D                                  D     
     7    7 A K  H  X S+     0   0   46 1668    8                               K                                  K     
     8    8 A T  H  X S+     0   0   95 1666   59                               N                                  T     
     9    9 A N  H  X S+     0   0   43 1665   80                               N                                  N     
    10   10 A V  H  X S+     0   0    2 1667   12                               V                                  V     
    11   11 A K  H  X S+     0   0   99 1668   70                               K                                  K     
    12   12 A A  H  X S+     0   0   67 1669   58                               T                                  A     
    13   13 A A  H  < S+     0   0    5 1672   61                               T                                  V     
    14   14 A W  H  X S+     0   0   22 1672    7                               W                                  W     
    15   15 A G  H  < S+     0   0   51 1672   52                               D                                  S     
    16   16 A K  T  < S+     0   0  111 1673    8                               K                                  K     
    17   17 A V  T >4 S+     0   0    1 1676   26                               I                                  V     
    18   18 A G  T 3< S+     0   0   49 1676   66                               G                                  G     
    19   19 A A  T 3  S+     0   0   96 1676   70                               G                                  G     
    20   20 A H  S <> S+     0   0   92 1674   65                               H                                  N     
    21   21 A A  H  > S+     0   0    6 1158   58                               A                                  A     
    22   22 A G  H  > S+     0   0   19 1159   49                               A                                  G     
    23   23 A E  H  > S+     0   0  120 1676   42                               E                                  A     
    24   24 A Y  H  X S+     0   0   23 1676   70                               Y                                  Y     
    25   25 A G  H  X S+     0   0    4 1676    6                               V                                  A     
    26   26 A A  H  X S+     0   0   15 1676   45                               A                                  G     
    27   27 A E  H  X S+     0   0   45 1676    7                               E                                  E     
    28   28 A A  H  X S+     0   0    0 1674   28                          A    G                                  A     
    29   29 A L  H  X S+     0   0    4 1677    2                          L    L                                  L     
    30   30 A E  H  X S+     0   0   36 1677   56                          S    T                                  T     
    31   31 A R  H  X S+     0   0    3 1678    1                          R    R                                  S     
    32   32 A M  H  X S+     0   0   11 1677   19                          r    M                                  r     
    33   33 A F  H  < S+     0   0   11 1667   15                          f    F                                  f     
    34   34 A L  H  < S+     0   0   58 1672   64                          Q    T                                  L     
    35   35 A S  H  < S+     0   0   15 1674   70                          A    S                                  S     
    36   36 A F    ><  +     0   0   36 1674   14                          F    F                                  F     
    37   37 A P  G >  S+     0   0   44 1674    0                          P    P                                  P     
    38   38 A T  G >  S+     0   0   37 1674  100                          T    T                                  T     
    39   39 A T  G X  S+     0   0    3 1674    2                          T    T                                  T     
    40   40 A K  G X  S+     0   0   64 1674   41                          K    K                                  K     
    41   41 A T  G <  S+     0   0    7 1675   64                          T    T                                  T     
    42   42 A Y  G <  S+     0   0   16 1675    3                          Y    Y                                  Y     
    43   43 A F    X   +     0   0   31 1676    0                          F    F                                  F     
    44   44 A P  T 3  S+     0   0   70 1676   66                          S    H                                  P     
    45   45 A H  T 3  S+     0   0  122 1676   59                          H    H                                  H     
    46   46 A F  S <  S-     0   0   44 1676    8                          F    I                                  F     
    47   47 A D        -     0   0   81 1676   46                          D    D                                  D     
    48   48 A L        +     0   0   55 1674   66                          L    V                                  L     
    49   49 A S  S >  S-     0   0   58 1674   83                          S    S                                  S     
    50   50 A H  T 3  S+     0   0  150 1674   86                          H    P                                  P     
    51   51 A G  T 3  S+     0   0   40 1676   21                          G    G                                  G     
    52   52 A S    X>  -     0   0   13 1677   46                          S    S                                  S     
    53   53 A A  H 3> S+     0   0   80 1675   50                          A    G                                  Q     
    54   54 A Q  H 3> S+     0   0   86 1677   56                          Q    D                                  D     
    55   55 A V  H <> S+     0   0   12 1676   15                          I    I                                  V     
    56   56 A K  H  X S+     0   0  130 1677   25                          K    K                                  K     
    57   57 A G  H  X S+     0   0   37 1678   52                          A    A                                  G     
    58   58 A H  H  X S+     0   0   53 1678    7                          H    H                                  H     
    59   59 A G  H  X S+     0   0    0 1678    1                          G    G                                  G     
    60   60 A K  H  X S+     0   0  132 1677   49                          K    K                                  Q     
    61   61 A K  H  X S+     0   0  166 1677   22                          K    K                                  K     
    62   62 A V  H  X S+     0   0   31 1677    6                          V    V                                  V     
    63   63 A A  H  X S+     0   0    1 1677   69                          A    A                                  A     
    64   64 A D  H  X S+     0   0   83 1677   63                          D    D                                  D     
    65   65 A A  H  X S+     0   0   23 1678   36                          A    A                                  A     
    66   66 A L  H  X S+     0   0   15 1678   27                          L    L                                  L     
    67   67 A T  H  X S+     0   0   52 1678   69                          S    T                                  S     
    68   68 A N  H  X S+     0   0   60 1678   62                          T    T                                  Q     
    69   69 A A  H  < S+     0   0    0 1678   26                          A    A                                  A     
    70   70 A V  H >< S+     0   0   10 1678   47                          A    V                                  V     
    71   71 A A  H 3< S+     0   0   71 1678   70                          G    G                                  A     
    72   72 A H  T >< S+     0   0   84 1678   50                          H    H                                  N     
    73   73 A V  T <  S+     0   0   14 1678   26                          F    L                                  L     
    74   74 A D  T 3  S+     0   0  114 1678    3                          D    D                                  D     
    75   75 A D  S X> S+     0   0   85 1678   30                          D    D                                  D     
    76   76 A M  H 3>  +     0   0   13 1678   19                          M    L                                  L     
    77   77 A P  H 34 S+     0   0   69 1672   78                          D    P                                  P     
    78   78 A N  H X4 S+     0   0   91 1678   38                          S    T                                  G     
    79   79 A A  H 3< S+     0   0   34 1678   50                          A    A                                  T     
    80   80 A L  T 3X S+     0   0    5 1678   14                          L    L                                  L     
    81   81 A S  H <> S+     0   0   43 1678   57                          S    S                                  S     
    82   82 A A  H  > S+     0   0   77 1678   70                          A    T                                  K     
    83   83 A L  H  > S+     0   0   54 1678    0                          L    L                                  L     
    84   84 A S  H  X S+     0   0    3 1677    3                          S    S                                  S     
    85   85 A D  H  X S+     0   0   67 1678   28                          D    D                                  D     
    86   86 A L  H >X>S+     0   0   68 1678    8                          L    V                                  L     
    87   87 A H  I 3<>S+     0   0   41 1678    0                          H    H                                  H     
    88   88 A A  I 3<5S+     0   0    6 1678   45                          A    A                                  A     
    89   89 A H  I <<5S+     0   0  111 1678   83                          H    H                                  H     
    90   90 A K  I  <5S+     0   0  162 1678   37                          K    K                                  K     
    91   91 A L  I      -     0   0    3 1677    2                          D    D                                  D     
    95   95 A P  T >> S+     0   0   40 1677    0                          P    P                                  P     
    96   96 A V  H 3> S+     0   0   56 1677   76                          V    V                                  V     
    97   97 A N  H <> S+     0   0   10 1676    1                          N    N                                  N     
    98   98 A F  H <> S+     0   0   23 1678    0                          F    F                                  F     
    99   99 A K  H  X S+     0   0  129 1678   26                          K    K                                  K     
   100  100 A L  H  X S+     0   0   20 1675   16                          L    F                                  L     
   101  101 A L  H  X S+     0   0   40 1677    2                          L    L                                  L     
   102  102 A S  H  X S+     0   0   16 1677   44                          A    N                                  S     
   103  103 A H  H  X S+     0   0   16 1677   45                          H    H                                  H     
   104  104 A C  H  X S+     0   0    0 1676   70                          C    C                                  C     
   105  105 A L  H  X S+     0   0   11 1676   23                          I    L                                  L     
   106  106 A L  H  X S+     0   0    2 1677   44                          L    L                                  I     
   107  107 A V  H  X S+     0   0    0 1677   30                          V    V                                  V     
   108  108 A T  H  < S+     0   0    1 1677   51                          V    T                                  T     
   109  109 A L  H >X S+     0   0    4 1677   20                          L    L                                  L     
   110  110 A A  H 3< S+     0   0    0 1677   13                          A    A                                  A     
   111  111 A A  T 3< S+     0   0   10 1675   90                          R    A                                  C     
   112  112 A H  T <4 S+     0   0   53 1678   39                          H    H                                  H     
   113  113 A L  S >X S-     0   0    3 1678   63                          C    L                                  L     
   114  114 A P  T 34 S+     0   0   90 1678   50                          P    G                                  S     
   115  115 A A  T 34 S+     0   0   80 1590   72                          G    A                                  K     
   116  116 A E  T <4 S+     0   0   79 1678   38                          E    D                                  D     
   117  117 A F     <  +     0   0    8 1678    7                          F    F                                  L     
   118  118 A T     >  -     0   0   62 1678   18                          T    T                                  T     
   119  119 A P  H  > S+     0   0   22 1678   12                          P    P                                  P     
   120  120 A A  H  > S+     0   0   35 1677   58                          S    S                                  E     
   121  121 A V  H  > S+     0   0   17 1677   38                          A    I                                  A     
   122  122 A H  H  X S+     0   0    2 1676   32                          H    H                                  H     
   123  123 A A  H  X S+     0   0   16 1676   34                          A    A                                  A     
   124  124 A S  H  X S+     0   0    3 1676   45                          A    S                                  S     
   125  125 A L  H  X S+     0   0    3 1676   46                          M    L                                  M     
   126  126 A D  H  X S+     0   0   21 1676   30                          D    D                                  D     
   127  127 A K  H  X S+     0   0   36 1676    0                          K    K                                  K     
   128  128 A F  H  X S+     0   0    2 1676   41                          F    F                                  F     
   129  129 A L  H  X S+     0   0    7 1676   33                          L    F                                  F     
   130  130 A A  H  X S+     0   0   39 1676   54                          S    A                                  A     
   131  131 A S  H  X S+     0   0   29 1676   65                          K    S                                  S     
   132  132 A V  H  X S+     0   0    9 1676   11                          V    V                                  V     
   133  133 A S  H  X S+     0   0   17 1675   49                          A    S                                  A     
   134  134 A T  H  X S+     0   0   88 1674   74                          T    T                                  T     
   135  135 A V  H  < S+     0   0   21 1675   55                          V    V                                  V     
   136  136 A L  H  < S+     0   0   19 1674    0                          L    L                                  L     
   137  137 A T  H >< S+     0   0   42 1674   54                          T    T                                  T     
   138  138 A S  T 3< S+     0   0   57 1669   77                          S    S                                  S     
   139  139 A K  T 3  S+     0   0   77 1669   12                          K    K                                  K     
   140  140 A Y    <         0   0   19 1666    0                          Y    Y                                  Y     
   141  141 A R              0   0   75 1644   37                          R    R                                  R     
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41      G                                                                 
   144    2 B H        -     0   0  151 1032   46  HHHHFHHHHHHNHHHHHNN HHH  H HH HHH  HHHHHHHHHHHHHHHH    H HH   HH H HH 
   145    3 B F        -     0   0   37 2258   27  LLLLLLLLLLLFFMFLFFFLLLLL L LF FLLLLLLLLLLLLLLLLLLLLLL  FLFLLLLLF LLLLL
   146    4 B T    >>  -     0   0   75 2258   47  TTTTTTTTTTTTTSTTTTTTTTTT T TT TTTTTTTTTTTTTTTSSSTTTTT  TTTTTTTTT TTTTT
   147    5 B E  H 3> S+     0   0  133 2262   54  AGGAAPPGPGGAAGAGAAAAGPGA P PA AGGAAPPAAPPPPPAGGGGPAAA  AAAGAAAPA GAGAA
   148    6 B E  H 3> S+     0   0  151 2265   64  EEEDEEEEEEEEEEEEEEEEEEEE E EE EEEEEEDEEEEEEDDEEEEEDEE  EEEEEEEEE EEEEE
   149    7 B D  H X> S+     0   0   26 2283   21  EEEEEEEEEEEEEEEEEEGEEEEE E EE EEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEE EEEEE
   150    8 B K  H 3X S+     0   0   82 2285   24  KKKKKKKKKKKKKKKKKKKKKKKK K KK KKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKK KKKKK
   151    9 B A  H 3X S+     0   0   51 2283   64  AAAAGNNANSSTSSAAATTAANSA N NA AAAAATAASNNNNNTAAASAAAA AAAASAAATA AAASA
   152   10 B T  H < S+     0   0    5 2293   58  LLLLLLLLLLLLLLLLILLFLLLF L LI ILLFFLLLLLLLLLLLLLLLLFF IIFLLFFFLL LFLLF
   157   15 B W  G >< S+     0   0   32 2299    7  WWWWWWWWWWWWWWWWWWWWWWWW W WW WWWWWWWWWWWWWWWWWWWWWWW WWWWWWWWWW WWWWW
   158   16 B G  G 3  S+     0   0   69 2299   51  GGGGGGGGGGGSGGAGDSSGGGGG G GD DSGGGGGGGGGGGGGGGGGGGGG DDGAGGGGGA GGGAG
   159   17 B K  G <  S+     0   0  109 2303   19  KKKKKKKKKKKKKKKKKKKKKKKK K KK KKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKK KKKKK
   160   18 B V    <   -     0   0   19 2307   28  VVVVVVVVVVVVVVVVVVVVVVVV V VV VVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVV VVVVV
   161   19 B N     >  -     0   0   97 2308   63  NNNNNNNNNNNNNNNNDNNHNNNK N ND DNNHKNNKNNNNNNNKKKNNNKK DDHNNHHHNN NHNNH
   162   20 B V  H  > S+     0   0   26 2306   77  VVVVVVVVVVVVVVVVLVVVVVVV V VV LVVVVVVVVVVVVVVVVVVVVVV LLVVVVVVVV VVVVV
   163   21 B E  H  > S+     0   0   84 2303   46  DDDDDDDDDDDEEDEDEEEDDDED D DE EDDDDDDEDDDDDDEDDEEDDDD EEDEEDDDDE EDDED
   164   22 B D  H  4 S+     0   0   90 2307   47  EEEEEEEEEEEEEDLEKEEEEEEE E EK KEEEEEEEEEEEEEEEEEEEEEE KKEVEEEEAV EEEEE
   165   23 B A  H  X S+     0   0   13 2309   68  VVVVVVVVVVVVTVVVVVVVVVVV V VI VVVVVVVFVVVVVVVVVVVVVVV VVVAVVVVVA VVVVV
   166   24 B G  H  X S+     0   0    0 2309    5  GGGGGGGGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGG GGGGGGGGGG GGGGG
   167   25 B G  H  X S+     0   0    5 2309   51  GGGGGGGGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGG GGGGGGGGGG GGGGG
   168   26 B E  H  > S+     0   0   52 2309   25  EEEEEEEEEEEEQEEEEEEEEEEE E EE EEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEE EEEEE
   169   27 B T  H  X S+     0   0    4 2307   28  ATTAAAAAAAAAAAVTTAAAAAAA A AT TAAAAAAAAAAAAAAAAAAAAAA TTAIAAAAAV AAAAA
   170   28 B L  H  X S+     0   0    7 2310    2  LLLLLLLLLLLLVLLLLLLLLLLL L LL LLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLL LLLLL
   171   29 B G  H  X S+     0   0    0 2310   62  GGGGGGGGGGGGGGGGGGGGGGGG G GG GGGGGGGGGGGGGGGGGGGGGGG GGGGGGGGGG GGGGG
   172   30 B R  H  X S+     0   0    8 2309    2  RRRRRRRRRRRRRRRRRRRRRRRR RRRR RRRRRRRRRRRRRRRRRRRRRRR RRRRRRRRRR RRRRR
   173   31 B L  H  X S+     0   0   12 2309   37  LLLLLLLLLLLLLLLLLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLL
   174   32 B L  H  < S+     0   0    0 2309   14  LLLLLLLLLLLLLLLLLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLL
   175   33 B V  H  < S+     0   0   26 2310   56  VVVVVVVVVVVVVVVVIVVVVVVV VVVI IVVVVVVVVVVVVVVVVVVVVVVVIIVVVVVVVV VVVVV
   176   34 B V  H  < S+     0   0    2 2312   61  VVVVVVVVVVVVVVVVVVVVVVVV VVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVV
   177   35 B Y  S >< S-     0   0   26 2312   13  YYYYYYYYYYYYYYYYYYYYYYYY YYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY YYYYY
   178   36 B P  T 3   +     0   0   29 2313    0  PPPPPPPPPPPPPPPPPPPPPPPP PPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPP
   179   37 B W  T 3  S+     0   0   22 2313   94  WWWWWWWWWWWWWWWWWWWWWWWW WWWW WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW WWWWW
   180   38 B T  S X  S+     0   0    3 2313    3  TTTTTTTTTTTTTTTTTTTTTTTT TTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTT
   181   39 B Q  G >  S+     0   0   40 2313   46  QQQQQQQQQQQQQQQQQHHQQQQQ QQQQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQ
   182   40 B R  G 3  S+     0   0   64 2316   69  RRRRRRRRRRRRRRRRRRRRRRRR RRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRR
   183   41 B F  G <  S+     0   0   60 2316    8  FFFFFFFFFFFFFFFFFFFFFFFF FFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFF
   184   42 B F    X   +     0   0   26 2316    0  FFFFFFFFFFFFFFFFFFFFFFFF FFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFF
   185   43 B D  T 3  S+     0   0  125 2315   68  DDDDQDDDDDDDDDDDDDDEEEEE EEED DDDEEEEDDEEEEDEDDDDEDEEEDDEDEEEEED DEDEE
   186   44 B S  T 3  S+     0   0  109 2316   73  SSSSSSSSSSSSSSNSKSSSSSSS SSSK KSSSSSSSSSSSSSSSSSSSSSSHKKSSSSSSST SSSAS
   187   45 B F  S <  S-     0   0   34 2315    6  FFFFFFFFFFFFFFFFFFFFFFFF FFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFF
   188   46 B G        +     0   0   57 2304   43  GGGGGGGGGGGGGGGGGGGGGGGG GGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGG
   189   47 B N        +     0   0  101 1087   32  DDDDDDDDDDDNNDNDNNNDDDDD DDDN NDDDDDDDDDDDDDDDDDDDDDDDNNDNDDDDDN DDDDD
   190   48 B L        +     0   0   18 1086    4  LLLLLLLLLLLLMLLLLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLL
   191   49 B S        +     0   0   87 1087   39  SSSSSSSSSSSSSSSSSSSSSSSS SSSS SSSSSSSSSSSSSSSSSSSSSSSFSSSSSSSSSS SSSSS
   192   50 B S  S >> S-     0   0   64 1089   48  SSSSSSSSSSSSSSSSSSSTSSTS SSSS SSSSSSSSSSSSSTSSSSSSATSSSSTSTTTSSS NTSTT
   193   51 B A  H 3> S+     0   0   28 1160   49  PPPPAPPPPAAAPAEPAAAAPPAA PPPA APPAAPPAPPPPPAAAAAPPAAAAAAAEAAAAPE AAPAA
   194   52 B S  H 3> S+     0   0  104 1382   69  DDDDDAADADDSSSSDLSSDADDD DDDP QDDDDDDDNDDDDDDSSSDDSDDDLLDTDDDDDT GDDDD
   195   53 B A  H <4 S+     0   0   24 2309   70  AAAAAAAAAAAAAAAAAAAAAAAA AAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAA
   196   54 B I  H  < S+     0   0    2 2309   82  VVVVIVVVVIIIIVIVIIIVVVVV VVVI IVVVVVVVIVVVVVIVVVVVVVVIIIVIVVVVVI VVVVV
   197   55 B M  H  < S+     0   0   39 2309   88  MMMMMMMMMMMMMMMMMMMMMMMM MMMM MMMMMMMMMMMMMMMMMMMMMMMLMMMMMMMMMM MMMMM
   198   56 B G  S  < S+     0   0   41 2311   27  GSSGHGGGGNNGGGGSGGGNGGKN GGGG GGNNNGGGSGGGGGGGGSNGGNNGGGNGKNNNGG GNNKN
   199   57 B N     >  -     0   0   13 2313   52  NNNNNNNNNNNNNNNNNNNNNNNN NNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNN
   200   58 B P  H  > S+     0   0   95 2311   53  PPPPSPPPPPPPPPPPPPPPPPPP PPPP PPPAPPPPPPPPPPPPPPPPPPPPPPPPPPPAPP APPPP
   201   59 B K  H  > S+     0   0  126 2313   69  KKKKKKKKKKKRKKKKRRRKKKNK KKKR RKKKKKKKKKKKKKKKKKKKKKKKRRKKNKKKKK KKKKK
   202   60 B V  H  > S+     0   0    1 2312   13  VVVVVVVVVVVVVVVVIVVVVVVV VVVI IVVVVVVVVVVVVVVVVVVVVVVVIIVVVVVVVV VVVVV
   203   61 B K  H  X S+     0   0  112 2311   50  KKKKKKKKKKKKKKKKRKKKKKKK KKKR KKKKKKKKKKKKKKKKKKKKKKKKRRKKKKKKKK KKKKK
   204   62 B A  H  X S+     0   0   53 2312   51  AAAAAAAAAAAAAAAAAAAAAAKA AAAA AAAAAAAAAAAAAAAAAAAAAAAGAAAAKAAAAA AAAAA
   205   63 B H  H  X S+     0   0   62 2314    5  HHHHHHHHHHHHHHHHHHHHHHHH HHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHH
   206   64 B G  H  X S+     0   0    0 2314    1  GGGGGGGGGGGGGGGGGGGGGGGG GGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGG
   207   65 B K  H  X S+     0   0   94 2312   54  KKKKKKKKKKKKKKKKKKKKKKKK KKKK KKKKKKKAKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKK
   208   66 B K  H  X S+     0   0  156 2313   28  KKKKKKKKKKKKKKKKKKKKKKKK KKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKK
   209   67 B V  H  X S+     0   0   40 2314    7  VVVVVVVVVVVVVVVVVVVVVVVV VVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVV
   210   68 B L  H  X S+     0   0    5 2314   63  LLLLLLLLLLLLLLLLLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLL
   211   69 B T  H  X S+     0   0   52 2310   68  NNNNNGGNGNNTTMTNTTTDGGAD GGGA TNGDDGGQNGGGGGNDDDGGNDDNTTDNADDDGT NDGAD
   212   70 B S  H  < S+     0   0   44 2314   47  SSSSSAASASSAASSSSAASAASS AAAS SSASSAASSAAAAASSSSAASSSSSSSSSSSSAS SSASS
   213   71 B L  H >X S+     0   0   17 2314   25  FFFFFFFFFFFFFMFFLFFFFFFF FFFL LFFFFFFMFFFFFFFFFFFFFFFFLLFFFFFFFF FFFFF
   214   72 B G  H >X S+     0   0   10 2314   68  SSSSSSSSSSSGGAGSGGGSSSGS SSSG GSSSSSSGSSSSSSSSSSSSSSSSGGSGGSSSSG GSSSS
   215   73 B D  H 3< S+     0   0   98 2312   70  EEEDDDDEDDDEDDNELEENDDEN DDDL LEDNNDDDDDDDDDEEEEDDDNNELLNNENNNDN EDDDN
   216   74 B A  H X4 S+     0   0    0 2314   20  GGGGGGGGGGGSAGAGGSSGGGGG GGGA AGGGGGGGGGGGGGGGGGGGGGGGGGGAGGGGGA GGGGG
   217   75 B I  H X< S+     0   0   14 2313   43  LLLLLLLLLLLIVVVLVIIMLLLM LLLV VLLMMLLILLLLLLLLLLLLLMMLVVMVLMMMLV LMLLM
   218   76 B K  T 3< S+     0   0  162 2315   65  KKKKKNNKNKKKKNKKKKKKANKK NANK KKAKKAAKKNNNNAKQQQAAKKKKKKKKKKKKNK KKAKK
   219   77 B H  T X   +     0   0   96 2315   51  NNNNHHHNHNNNNNHNNNNHHHHH HHHN NNHHHHHNNHHHHHNHHHHHNHHQNNHHHHHHHH NHHHH
   220   78 B L  T <   +     0   0   17 2315   32  LLLLVLLLLLLLMMMLMLLLLLLL LLLM MLLLLLLLLLLLLLLLLLLLLLLLMMLMLLLLLM LLLLL
   221   79 B D  T 3  S+     0   0  159 2315    5  DDDDDDDDDDDDDDDDDDDDDDDD DDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDD
   222   80 B D    <>  +     0   0   85 2315   35  NNNNDNNNNNNNNNDNNNNDNNDD NNNN NNNDDNNNNNNNNNNNNSNNNDDDNNDDDDDDND NDNDD
   223   81 B L  H  > S+     0   0   17 2313   25  LLLLLLLLLLLLLLLLLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLL
   224   82 B K  H  > S+     0   0  143 2307   71  KKKKKKKKKKKKKKKKKKKKKKKK KKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKK
   225   83 B G  H  4 S+     0   0   48 2312   51  GGGGGGGGGGGSGGDGESSGGGGG GGGE EGGGGGGGGGGGGGGGGGGGGGGGEEGGGGGGGS GGGGG
   226   84 B T  H  < S+     0   0   55 2313   57  TTTTTTTTTTTATTTTTAATTTTT TTTV TTTTTTTTTTTTTTTTTTTTTTTATTTTTTTTTT TTTTT
   227   85 B F  H  X S+     0   0    7 2314   23  FFFFFFFFFFFLFFFFFLLFFFFF FFFF FFFFFFFFFFFFFFFFFFFFYFFFIFFFFFFFFY FFFFF
   228   86 B A  H  X S+     0   0   21 2315   60  AAAAAAAAAAAAAAAAAAAAAAAA ASAA AAAAAAASAAAAAAAAAAAAAAAAAAASAAAAAS AAAAA
   229   87 B Q  H  > S+     0   0  150 2310   74  KKKKKQQKQKKKKKEKHKKAQQAA QQQX HKQAAQQKKQQQQQKKKKQQKAASHHAHAAAAQQ KAQTA
   230   88 B L  H  > S+     0   0   57 2316    0  LLLLLLLLLLLLLLLLLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLL
   231   89 B S  H  X S+     0   0    0 2315    2  SSSSSSSSSSSSSSSSSSSSSSSS SSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSS
   232   90 B E  H  X S+     0   0   81 2316   47  EEEEEEEEEEEEEEEEEEEEEEEE EEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEE
   233   91 B L  H  X>S+     0   0   77 2316   21  LLLLLLLLLLLLLLLLLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLL
   234   92 B H  I  <>S+     0   0   33 2316    0  HHHHHHHHHHHHHHHHHHHHHHHH HHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHH
   235   93 B C  I  X5S+     0   0   12 2316   54  CCCCCCCCCCCCCCCCCCCCCCCC CCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCC
   236   94 B D  I  <5S+     0   0   66 2315   78  DDDDDDDDDDDDDDDDDDDDDDDD DDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDD
   237   95 B K  I  <5S+     0   0  155 2316   36  KKKKKKKKKKKKKKKKKKKKKKKK KKKK KKKKKKKKQKKKKKKKKKKKKKKKKKKRKKKKKR KKKKK
   238   96 B L  I  4   -     0   0    3 2315    2  DDDDDDDDDDDDDDDDDDDDDDDD DDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD DDXDD
   242  100 B P  T >> S+     0   0   17 2316    1  PPPPPPPPPPPPPPPPPPPPPPPP PPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPP
   243  101 B E  H 3> S+     0   0   31 2316   76  EEEEEEEEEEEEEEEEEEEEEEEE EEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEE
   244  102 B N  H <> S+     0   0   13 2316    2  NNNNNNNNNNNNNNNNNNNNNNNN NNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNN
   245  103 B F  H <> S+     0   0   22 2316    1  FFFFFFFFFFFFFFFFFFFFFFFF FFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFF
   246  104 B K  H  X S+     0   0  120 2316   30  KKKKKKKKKKKKRRKKKKKKRKRK KRKK KKRKKKKRKKKKKKRRRRRRRKKRKKKKRKKKKK RKRRK
   247  105 B L  H  X S+     0   0   17 2300   17  LLLLLLLLLLLLLLLLLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLL
   248  106 B L  H  X S+     0   0   38 2308    2  LLLLLLLLLLLLLLLLLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLL
   249  107 B G  H  X S+     0   0    6 2310   44  GGGGGGGGGGGGGGGGGGGGGGGG GGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGG
   250  108 B N  H  X S+     0   0   34 2311   57  NNNNNNNNNNNNNNNNNNNNNNNN NNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNN
   251  109 B V  H  X S+     0   0    1 2310   66  VVVVVVVVVVVVMVMVMVVVVVVV VVVM MVVVVVVVVVVVVVVVVVVVVVVVMMVMVVVVVM VVVVV
   252  110 B L  H  X S+     0   0    9 2310   23  LLLLLLLLLLLLILILLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLILLLLLI LLLLL
   253  111 B V  H  X S+     0   0    0 2312   56  VVVVVVVVVVVVVVLVVVVVVVVV VVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVL VVVVV
   254  112 B T  H  X S+     0   0    1 2312   29  CCCCCCCCCCCIIVICIIIVCCVV CCCI ICCVVCCCCCCCCCCCCCCCCVVVIIVIVVVVCI VVCIV
   255  113 B V  H  X S+     0   0    6 2315   53  VVVVVVVVVVVVIVVVVVVVVVVV VVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVV
   256  114 B L  H  X S+     0   0    4 2315   24  LLLLLLLLLLLLLLLLLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLL
   257  115 B A  H  X S+     0   0    0 2315   11  AAAAAAAAAAAAAAAASAAAAAAA AAAS SAAAAAAAAAAAAAAAAAAAAAAASSAAAAAAAA AAAAA
   258  116 B I  H  < S+     0   0   27 2307   85  HHHHHHHHHHHSSRTHTSSRRHRR HRHS SHHRRHHRHHHHHHHRRRHHRRRRTTRTRRRRHT RRHRR
   259  117 B H  H  < S+     0   0  114 2316   52  HHHHHHHHHHHHHHHHHHHHKHHH HNHH YHHHHHHHHHHHHHHHHHHHHHHRHHHQHHHHHQ HNHHH
   260  118 B F  H >< S-     0   0   18 2316   62  FFFFFFFFFFFFFFFFFFFFFFFF FFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFF
   261  119 B G  G >< S+     0   0   17 2314   55  GGGGGGGGGGGGGGSGAGGGGGGG GGGX GGGGGGGGGGGGGGGGGGGGGGGGAAGNGGGGGG GGGGG
   262  120 B K  G 3  S+     0   0  193 2165   71  KKKKKKKKKKKNGKKKKNNKKKKK KKKK KKKKKKKKKKKKKKKKKKKKKKKGKKKRKKKKKR KKKKK
   263  121 B E  G <  S+     0   0   93 2313   44  EEEEEEEEEEEEEEEEEEEEEEEE EEEE EEEEEEEDEEEEEEEEEEEEEEEEEGEEEEEEEE DEEEE
   264  122 B F  S <  S-     0   0    0 2313    7  FFFFFFFFFFFFFFFFFFFFFFFF FFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFF
   265  123 B T    >>  -     0   0   53 2311   23  TTTTTTTTTTTTTTTTTTTTTTTT TTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTT
   266  124 B P  H 3> S+     0   0   23 2311   20  PPPPPPPPPPPAPPPPPAAPPPPP PPPA APPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPP
   267  125 B E  H 3> S+     0   0  105 2307   52  QQQQQQQQQQQEETQQEEEVQQEV QQQE EQQVVQQAQQQQQQPQQQQQQEVEEEVQEVVVQQ PVQEV
   268  126 B V  H <> S+     0   0   22 2310   50  VVVVVVVVVVVMVVVVVMMLVVVL VAVV AVVLLVVAVVVVVVVVVVVVVLLLVVLMVLLLVM VLVLL
   269  127 B Q  H  X S+     0   0    0 2291   35  QQQQQQQQQQQQQQQQQQQQQQQQ QQQQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQ
   270  128 B A  H  X S+     0   0   15 2300   35  AAAAAAAAAAAAAAAAAAAAAASA AAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAASAATAA AAAAA
   271  129 B S  H  X S+     0   0    1 2302   49  AAAAAAAAAAAAAAAAAAADAAAD AAAA AAADDAAAAAAAAAAAAAAAADDNAADAADDDAA ADAAD
   272  130 B W  H  X S+     0   0    1 2304   51  YYYYYYYYYYYWWFWYWWWFFYYF YYYW WYYFFYYFYYYYYYYYYYYYYYFFWWFWYFFFYW FFYYF
   273  131 B Q  H  X S+     0   0    5 2306   39  QQQQQQQQQQQQQQQQQQQQQQQQ QQQQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQ
   274  132 B K  H  X S+     0   0  100 2304    1  KKKKKKKKKKKKKKKKKKKKKKKK KKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKK
   275  133 B M  H  X S+     0   0    1 2301   33  VVVVVVVVVVVLLLLVLLLVVVVV VVVL LVVVVVVVVVVVVVVVVVVVVVVVLLVLVVVVVL LVVVV
   276  134 B V  H  X S+     0   0    6 2303   34  VVVVVVVVVVVVVVTVVVVVVVVV VVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVTVVVVVT AVVVV
   277  135 B T  H  X S+     0   0   80 2301   65  AAAAAAAAAAAAAAAAIAATAAAN AAAA VAATVAAAAAAAAAAAAAAASTNTIIATAAATAT QAAAA
   278  136 B G  H  X S+     0   0   23 2301   71  GGGGGGGGGGGGGGAGGGGGGGGG GGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGAGGGGGA GGGGG
   279  137 B V  H  X S+     0   0   17 2298   15  VVVVVVVVVVVVVVVVVVVVVVVV VVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVV
   280  138 B A  H  X S+     0   0    5 2297   60  AAAAAAAAAAAAAAAAAAAAAAAA AAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAA
   281  139 B S  H  X S+     0   0   67 2291   79  TNNNSNNNNNNTTTNNNTTNTNTN NNNN TNNNNNNNNNNNNNNNNTNNTNNNNNNNTNNNNN TNNNN
   282  140 B A  H  < S+     0   0    2 2289   52  AAAAAAAAAAAAAAAAAAAAAAAA AAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAA
   283  141 B L  H  < S+     0   0   19 2272    1  LLLLLLLLLLLLLLLLLLLLLLLL LLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLL
   284  142 B S  H >< S+     0   0   44 2267   58  AAAAAAAAAAASAAAASSSAAAAA AAAS SAAAAAAAAAAAAAAAAAAAAAAASSAAAAAAAA AAAAA
   285  143 B S  T 3< S+     0   0   57 2265   80  HHHHHHHHHHHHHHHHHHHHHHHH HHHH HHHHHHHAHHHHHHHHHHHHHHHHHHHYHHHHHY HHHHH
   286  144 B R  T 3  S+     0   0  128 2255   28  KKKKRKKKKKKKKKRKKKKRRKKR KKKK KKKRRKKKKKKKKKKKKKKKKRRRKKRKKRRRKK KRKKR
   287  145 B Y    <         0   0   31 2246    0  YYYYYYYYYYYYYYYYYYYYYYYY YYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY YYYYY
   288  146 B H              0   0  136 2186   41  HHHHHHHHHHHHHH HHHHHHHHH HHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHH
## ALIGNMENTS  701 -  770
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1    1 A V              0   0  136  867   26                                               VV    V                  
     2    2 A L        -     0   0   22 1663    3                                               LL    L                  
     3    3 A S     >  -     0   0   51 1663   48                                               SS    T                  
     4    4 A P  H  > S+     0   0   84 1664   53                                               AA    D                  
     5    5 A A  H  > S+     0   0   62 1663   62                                               AA    A                  
     6    6 A D  H  > S+     0   0    8 1667   20                                               DD    E                  
     7    7 A K  H  X S+     0   0   46 1668    8                                               KK    K                  
     8    8 A T  H  X S+     0   0   95 1666   59                                               TT    K                  
     9    9 A N  H  X S+     0   0   43 1665   80                                               NN    E                  
    10   10 A V  H  X S+     0   0    2 1667   12                                               VV    V                  
    11   11 A K  H  X S+     0   0   99 1668   70                                               KK    T                  
    12   12 A A  H  X S+     0   0   67 1669   58                                               AA    S                  
    13   13 A A  H  < S+     0   0    5 1672   61                                               AA    L                  
    14   14 A W  H  X S+     0   0   22 1672    7                                               WW    W                  
    15   15 A G  H  < S+     0   0   51 1672   52                                               SS    G                  
    16   16 A K  T  < S+     0   0  111 1673    8                                               KK    K                  
    17   17 A V  T >4 S+     0   0    1 1676   26                                               VV    A                  
    18   18 A G  T 3< S+     0   0   49 1676   66                                               GG    S                  
    19   19 A A  T 3  S+     0   0   96 1676   70                                               GG    G                  
    20   20 A H  S <> S+     0   0   92 1674   65                                               NN    H                  
    21   21 A A  H  > S+     0   0    6 1158   58                                               SS    A                  
    22   22 A G  H  > S+     0   0   19 1159   49                                               GG    E                  
    23   23 A E  H  > S+     0   0  120 1676   42                                               AA    E                  
    24   24 A Y  H  X S+     0   0   23 1676   70                                               YY    Y                  
    25   25 A G  H  X S+     0   0    4 1676    6                                               MM    G                  
    26   26 A A  H  X S+     0   0   15 1676   45                                               GG    A                  
    27   27 A E  H  X S+     0   0   45 1676    7                                               EE    E                  
    28   28 A A  H  X S+     0   0    0 1674   28                                               AA    A                  
    29   29 A L  H  X S+     0   0    4 1677    2                                               LL    L                  
    30   30 A E  H  X S+     0   0   36 1677   56                                               YY    E                  
    31   31 A R  H  X S+     0   0    3 1678    1                                               RR    R                  
    32   32 A M  H  X S+     0   0   11 1677   19                                               TT    L                  
    33   33 A F  H  < S+     0   0   11 1667   15                                               FF    F                  
    34   34 A L  H  < S+     0   0   58 1672   64                                               LL    L                  
    35   35 A S  H  < S+     0   0   15 1674   70                                               SS    S                  
    36   36 A F    ><  +     0   0   36 1674   14                                               FF    F                  
    37   37 A P  G >  S+     0   0   44 1674    0                                               PP    P                  
    38   38 A T  G >  S+     0   0   37 1674  100                                               PP    T                  
    39   39 A T  G X  S+     0   0    3 1674    2                                               TT    T                  
    40   40 A K  G X  S+     0   0   64 1674   41                                               KK    K                  
    41   41 A T  G <  S+     0   0    7 1675   64                                               TT    T                  
    42   42 A Y  G <  S+     0   0   16 1675    3                                               YY    Y                  
    43   43 A F    X   +     0   0   31 1676    0                                               FF    F                  
    44   44 A P  T 3  S+     0   0   70 1676   66                                               PP    S                  
    45   45 A H  T 3  S+     0   0  122 1676   59                                               HH    H                  
    46   46 A F  S <  S-     0   0   44 1676    8                                               FF    M                  
    47   47 A D        -     0   0   81 1676   46                                               DD    D                  
    48   48 A L        +     0   0   55 1674   66                                               FF    L                  
    49   49 A S  S >  S-     0   0   58 1674   83                                               SS    S                  
    50   50 A H  T 3  S+     0   0  150 1674   86                                               AA    K                  
    51   51 A G  T 3  S+     0   0   40 1676   21                                               GG    G                  
    52   52 A S    X>  -     0   0   13 1677   46                                               SS    S                  
    53   53 A A  H 3> S+     0   0   80 1675   50                                               AA    A                  
    54   54 A Q  H 3> S+     0   0   86 1677   56                                               QQ    Q                  
    55   55 A V  H <> S+     0   0   12 1676   15                                               II    V                  
    56   56 A K  H  X S+     0   0  130 1677   25                                               KK    K                  
    57   57 A G  H  X S+     0   0   37 1678   52                                               GG    A                  
    58   58 A H  H  X S+     0   0   53 1678    7                                               QQ    H                  
    59   59 A G  H  X S+     0   0    0 1678    1                                               GG    G                  
    60   60 A K  H  X S+     0   0  132 1677   49                                               QQ    K                  
    61   61 A K  H  X S+     0   0  166 1677   22                                               KK    R                  
    62   62 A V  H  X S+     0   0   31 1677    6                                               II    V                  
    63   63 A A  H  X S+     0   0    1 1677   69                                               AA    A                  
    64   64 A D  H  X S+     0   0   83 1677   63                                               DD    D                  
    65   65 A A  H  X S+     0   0   23 1678   36                                               AA    A                  
    66   66 A L  H  X S+     0   0   15 1678   27                                               VV    L                  
    67   67 A T  H  X S+     0   0   52 1678   69                                               SS    T                  
    68   68 A N  H  X S+     0   0   60 1678   62                                               LL    T                  
    69   69 A A  H  < S+     0   0    0 1678   26                                               AA    A                  
    70   70 A V  H >< S+     0   0   10 1678   47                                               VV    A                  
    71   71 A A  H 3< S+     0   0   71 1678   70                                               AA    G                  
    72   72 A H  T >< S+     0   0   84 1678   50                                               HH    H                  
    73   73 A V  T <  S+     0   0   14 1678   26                                               MM    F                  
    74   74 A D  T 3  S+     0   0  114 1678    3                                               DD    N                  
    75   75 A D  S X> S+     0   0   85 1678   30                                               DD    D                  
    76   76 A M  H 3>  +     0   0   13 1678   19                                               LL    M                  
    77   77 A P  H 34 S+     0   0   69 1672   78                                               AA    D                  
    78   78 A N  H X4 S+     0   0   91 1678   38                                               TT    S                  
    79   79 A A  H 3< S+     0   0   34 1678   50                                               AA    A                  
    80   80 A L  T 3X S+     0   0    5 1678   14                                               LL    L                  
    81   81 A S  H <> S+     0   0   43 1678   57                                               SS    S                  
    82   82 A A  H  > S+     0   0   77 1678   70                                               AA    A                  
    83   83 A L  H  > S+     0   0   54 1678    0                                               LL    L                  
    84   84 A S  H  X S+     0   0    3 1677    3                                               SS    S                  
    85   85 A D  H  X S+     0   0   67 1678   28                                               DD    D                  
    86   86 A L  H >X>S+     0   0   68 1678    8                                               LL    L                  
    87   87 A H  I 3<>S+     0   0   41 1678    0                                               HH    H                  
    88   88 A A  I 3<5S+     0   0    6 1678   45                                               AA    A                  
    89   89 A H  I <<5S+     0   0  111 1678   83                                               HH    H                  
    90   90 A K  I  <5S+     0   0  162 1678   37                                               NN    K                  
    91   91 A L  I      -     0   0    3 1677    2                                               DD    D                  
    95   95 A P  T >> S+     0   0   40 1677    0                                               PP    P                  
    96   96 A V  H 3> S+     0   0   56 1677   76                                               VV    V                  
    97   97 A N  H <> S+     0   0   10 1676    1                                               NN    N                  
    98   98 A F  H <> S+     0   0   23 1678    0                                               FF    F                  
    99   99 A K  H  X S+     0   0  129 1678   26                                               KK    K                  
   100  100 A L  H  X S+     0   0   20 1675   16                                               LL    L                  
   101  101 A L  H  X S+     0   0   40 1677    2                                               LL    L                  
   102  102 A S  H  X S+     0   0   16 1677   44                                               CC    A                  
   103  103 A H  H  X S+     0   0   16 1677   45                                               HH    H                  
   104  104 A C  H  X S+     0   0    0 1676   70                                               NN    C                  
   105  105 A L  H  X S+     0   0   11 1676   23                                               VV    F                  
   106  106 A L  H  X S+     0   0    2 1677   44                                               LL    L                  
   107  107 A V  H  X S+     0   0    0 1677   30                                               VV    V                  
   108  108 A T  H  < S+     0   0    1 1677   51                                               TT    V                  
   109  109 A L  H >X S+     0   0    4 1677   20                                               LL    L                  
   110  110 A A  H 3< S+     0   0    0 1677   13                                               AA    A                  
   111  111 A A  T 3< S+     0   0   10 1675   90                                               GG    R                  
   112  112 A H  T <4 S+     0   0   53 1678   39                                               HH    H                  
   113  113 A L  S >X S-     0   0    3 1678   63                                               LL    H                  
   114  114 A P  T 34 S+     0   0   90 1678   50                                               GG    P                  
   115  115 A A  T 34 S+     0   0   80 1590   72                                               KK    A                  
   116  116 A E  T <4 S+     0   0   79 1678   38                                               DD    E                  
   117  117 A F     <  +     0   0    8 1678    7                                               FF    F                  
   118  118 A T     >  -     0   0   62 1678   18                                               TT    T                  
   119  119 A P  H  > S+     0   0   22 1678   12                                               PP    P                  
   120  120 A A  H  > S+     0   0   35 1677   58                                               EE    S                  
   121  121 A V  H  > S+     0   0   17 1677   38                                               II    A                  
   122  122 A H  H  X S+     0   0    2 1676   32                                               HH    H                  
   123  123 A A  H  X S+     0   0   16 1676   34                                               AA    A                  
   124  124 A S  H  X S+     0   0    3 1676   45                                               SS    A                  
   125  125 A L  H  X S+     0   0    3 1676   46                                               LL    M                  
   126  126 A D  H  X S+     0   0   21 1676   30                                               DD    D                  
   127  127 A K  H  X S+     0   0   36 1676    0                                               KK    K                  
   128  128 A F  H  X S+     0   0    2 1676   41                                               FF    F                  
   129  129 A L  H  X S+     0   0    7 1676   33                                               LL    L                  
   130  130 A A  H  X S+     0   0   39 1676   54                                               AA    S                  
   131  131 A S  H  X S+     0   0   29 1676   65                                               LL    R                  
   132  132 A V  H  X S+     0   0    9 1676   11                                               LL    V                  
   133  133 A S  H  X S+     0   0   17 1675   49                                               SS    A                  
   134  134 A T  H  X S+     0   0   88 1674   74                                               TT    T                  
   135  135 A V  H  < S+     0   0   21 1675   55                                               VV    V                  
   136  136 A L  H  < S+     0   0   19 1674    0                                               LL    L                  
   137  137 A T  H >< S+     0   0   42 1674   54                                               TT    T                  
   138  138 A S  T 3< S+     0   0   57 1669   77                                               SS    S                  
   139  139 A K  T 3  S+     0   0   77 1669   12                                               KK    K                  
   140  140 A Y    <         0   0   19 1666    0                                               YY    Y                  
   141  141 A R              0   0   75 1644   37                                               RR    R                  
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41    G     G                                                             
   144    2 B H        -     0   0  151 1032   46   HFHHHHHFHHHHHHHHHHH HHHHHHHH            HH H  HHHH H      HHHHHH HHHH
   145    3 B F        -     0   0   37 2258   27  LLLLLLLLLLLLLLLLFFFF LLLLLLLLLLLLLLLLLLLLLL L  LLLL L    LLFLLLLLLLLLL
   146    4 B T    >>  -     0   0   75 2258   47  TTTTTTTTTSTTTTSTTTTT TTTTTTTTTTTTTTTTTTTTST T  TTST T    STTTTTTTTTTTT
   147    5 B E  H 3> S+     0   0  133 2262   54  APAGGPAGAGGGGGGGAAAA GGPPPGGGAAAAAAAAAAAAAP G  PPGP G    AAAGGGGGAGGAA
   148    6 B E  H 3> S+     0   0  151 2265   64  EEEEEEEEEEEEEDEEEEEE DEDDEEEEEEEEEEEEEEEEEE D  EEEE E    EEEEDEEEEEEEE
   149    7 B D  H X> S+     0   0   26 2283   21  EEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEENE  EEEE ENNNNEEEEEEEEEEEEE
   150    8 B K  H 3X S+     0   0   82 2285   24  KKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKK  KKKK KKKKKKKKKKKKKKKKKK
   151    9 B A  H 3X S+     0   0   51 2283   64  AVSASNSASASSSAAAAAAA AGNNSASSAAAAAAAAAAAAGSAS  SSGS AAAAAAAAAAAASASASS
   152   10 B T  H < S+     0   0    5 2293   58  FLLLLLLLLLLLLLLLIIII LLLLLLLLFFFFFFFFFFFFLLFL  LLML LFFFFLLILLLLLFLLLL
   157   15 B W  G >< S+     0   0   32 2299    7  WWWWWWWWWWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWW  WWWW WWWWWFFWWWWWWWWWWW
   158   16 B G  G 3  S+     0   0   69 2299   51  GGSGGGGGSGGGGGGGEEEE GGGGGSGGGGGGSGGGGGGGGGSS  GGGG GSSSSAADSGGGGGGGGG
   159   17 B K  G <  S+     0   0  109 2303   19  KKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKK  KKKK KKKKKKKKKKKKKKKKKK
   160   18 B V    <   -     0   0   19 2307   28  VVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVV  VVVV VVVVVVVVVVVVVVVVVV
   161   19 B N     >  -     0   0   97 2308   63  HNNNNNNNNKNNNNNNDDDDNNNNNNNNNKKHKHHHKKHKKNNKN  KNNN NKKKKKNDNNNNNKNNNN
   162   20 B V  H  > S+     0   0   26 2306   77  VVVVVVVVVVVVVVEVLLLLVVVVVVVVVVVVVVVVVVVVVVVVV  VVVV VVVVVVVLVVVVVVVVVV
   163   21 B E  H  > S+     0   0   84 2303   46  DDDDEDDDDDEEEEDDEEEEDDDEEDDEEDDDDDDDDDDDDDDDD  DDDD DDDDDDEEDDDDDDDXDD
   164   22 B D  H  4 S+     0   0   90 2307   47  EEEEDEEEEEEEEDEDKKKKEEEEEEEEEEEEEEEEEEEEEDEEE  EEEE EEEEEEEKEEEEEEEEEE
   165   23 B A  H  X S+     0   0   13 2309   68  VVVVVVVVVVVVVVVVLIILVVVVVVVVVVVVVVVVVVVVVVVVV  VVVV VVVVVVVAVVVVVVVVVV
   166   24 B G  H  X S+     0   0    0 2309    5  GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GGGG GGGGGGGGGGGGGGGGGG
   167   25 B G  H  X S+     0   0    5 2309   51  GGGGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGAGAG  GGGG GAAAAGGGGGGGGGGGGG
   168   26 B E  H  > S+     0   0   52 2309   25  EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE  EEEE EEEEEEEEEEEEEEEEEE
   169   27 B T  H  X S+     0   0    4 2307   28  AAAAAAAAAAAAAAATTTTTAAAAAAAAAAAAAAAAAAAAAAAAA  AAAA AAAAAAATAAAAAAAAAA
   170   28 B L  H  X S+     0   0    7 2310    2  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLL LLLLLLLLLLLLLLLLLL
   171   29 B G  H  X S+     0   0    0 2310   62  GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GGGG GGGGGGGGGGGGGGGGGG
   172   30 B R  H  X S+     0   0    8 2309    2  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  RRRR RRRRRRRRRRRRRRRRRR
   173   31 B L  H  X S+     0   0   12 2309   37  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLL LLLLLLLLLLLLLLLLLL
   174   32 B L  H  < S+     0   0    0 2309   14  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLL LLLLLLLLLLLLLLLLLL
   175   33 B V  H  < S+     0   0   26 2310   56  VVVVVLVVVVVVVVVVIIIIVVVVVVVVVVVVVVVVVVVVVVVVV  VVVV VVVVVVVIVVVVVVVVVV
   176   34 B V  H  < S+     0   0    2 2312   61  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVV VVVVVVVVVVVVVVVVVV
   177   35 B Y  S >< S-     0   0   26 2312   13  YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY  YYYY YYYYYYYYYYYYYYYYYY
   178   36 B P  T 3   +     0   0   29 2313    0  PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  PPPP PPPPPPPPPPPPPPPPPP
   179   37 B W  T 3  S+     0   0   22 2313   94  WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW  WWWW WWWWWWWWWWWWWWWWWW
   180   38 B T  S X  S+     0   0    3 2313    3  TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TTTT TTTTTTTTTTTTTTTTTT
   181   39 B Q  G >  S+     0   0   40 2313   46  QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ  QQQQ QQQQQQQQQQQQQQQQQQ
   182   40 B R  G 3  S+     0   0   64 2316   69  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  RRRR RRRRRRRRRRRRRRRRRR
   183   41 B F  G <  S+     0   0   60 2316    8  FFFFFFYFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FFFF FFFFFFFFFFFFFFFFFF
   184   42 B F    X   +     0   0   26 2316    0  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FFFF FFFFFFFFFFFFFFFFFF
   185   43 B D  T 3  S+     0   0  125 2315   68  EEQDEEDEQDEEEEDDDDDDEEDDDKDEEEEEEEEEEEEEEDEEE  EEDE DEEEEEEEDEEEEEEEDD
   186   44 B S  T 3  S+     0   0  109 2316   73  SSSSSSSSSSSSSSSTKKKKSSSSSSSSSSSSTSSSTSSTSSSHF  SSSS SHHHHSHKSSSSSSSSSS
   187   45 B F  S <  S-     0   0   34 2315    6  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FFFF FFFFFFFFFFFFFFFFFF
   188   46 B G        +     0   0   57 2304   43  GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GGGG GGGGGGGGGGGGGGGGGG
   189   47 B N        +     0   0  101 1087   32  DDDDDDDDDDDDDDDDNNNNDDDDDDDDDDDDDDDDDDDDDDDDD  DDDD DDDDDDDNDDDDDDDDDD
   190   48 B L        +     0   0   18 1086    4  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLL LLLLLLLLLLLLLLLLLL
   191   49 B S        +     0   0   87 1087   39  SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SSSS SSSSSSSSSSSSSSSSSS
   192   50 B S  S >> S-     0   0   64 1089   48  TNSTSSTSSSSSSTSSSSSSTSSSSTTTTTTTTTTTTTTTTSTSS  TTST NTSTTSSPTTTTSTSSTT
   193   51 B A  H 3> S+     0   0   28 1160   49  APAPPPPPAAPPPPAPAAPAPPAPPPPAAAAAAAAAAAAAAAPPP  PPAP AAAAAAAPPPPPPAPPPP
   194   52 B S  H 3> S+     0   0  104 1382   69  DDDDSDDDDPDDDDSSPLLPDDASSDDDDDDDDDDDDDDDDGDDA  DDSD GDDDDDDQDDDDDDDDDD
   195   53 B A  H <4 S+     0   0   24 2309   70  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AAAA AAAAAAAAAAAAAAAAAA
   196   54 B I  H  < S+     0   0    2 2309   82  VVIVVVVVIVVVVVVVIIIIVVVVVVVVVVVVVVVVVVVVVIVIV  VVIV VVVVVIIIVVVVVVVVVV
   197   55 B M  H  < S+     0   0   39 2309   88  MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMLM  MMMM MLLLLLLMMMMMMMMMMM
   198   56 B G  S  < S+     0   0   41 2311   27  NGGSGGGNGGGNNNGGGGGGGNGGGGNKKNNNNNNNNNNNNGGGG  GGGG GGGGGGGGNHSSGNNSNN
   199   57 B N     >  -     0   0   13 2313   52  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  NNNN NNNNNNNNNNNNNNNNNN
   200   58 B P  H  > S+     0   0   95 2311   53  PPSPPPPPGPPPPPPTPPPPPPAPPPPPPPPPPPPPPPPPPPPPP  PPAP AAAAAPPPPPPPPPPXPP
   201   59 B K  H  > S+     0   0  126 2313   69  KKKKKKKKKKKKKKKKQRRQKKKKKKKNNKKKKKKKKKKKKKKKK  KKKK KKKKKKKRKKKKKKKKKK
   202   60 B V  H  > S+     0   0    1 2312   13  VVVVVVVVVVVVVVVVIIIIVVVVVVVVVVVVVVVVVVVVVVVVV  VVVV VVVVVVVIVVVVVVVVVV
   203   61 B K  H  X S+     0   0  112 2311   50  KKKKKKKKKKKKKKKKRRRRKKKKKKKKKKKKKKKKKKKKKKKKK  KKKK KKKKKKKRKKKKKKKKKK
   204   62 B A  H  X S+     0   0   53 2312   51  AAAAAAAAAAAAAAAAAAAAAAAAAAAKKAAAAAAAAAAAAAAAA  AAAA AAAAAAGAAAAAAAAAAA
   205   63 B H  H  X S+     0   0   62 2314    5  HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HHHH HHHHHHHHHHHHHHHHHH
   206   64 B G  H  X S+     0   0    0 2314    1  GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GGGG GGGGGGGGGGGGGGGGGG
   207   65 B K  H  X S+     0   0   94 2312   54  KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KKKK KKKKKKKKKKKKKKKKKK
   208   66 B K  H  X S+     0   0  156 2313   28  KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KKKK KKKKKKKKKKKKKKKKKK
   209   67 B V  H  X S+     0   0   40 2314    7  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVV VVVVVVVVVVVVVVVVVV
   210   68 B L  H  X S+     0   0    5 2314   63  LLLLLLLLLLLLLLLMLLLLLLLLLLLLLLLLLLLLLLLLLALLL  LLAL LLLLLLLLLLLLLLLLLL
   211   69 B T  H  X S+     0   0   52 2310   68  DGNGSGNGNDGGGGHNVTTVGGDSSGNAADDDDDDDDDDDDNGDG  GGHG NDDDDDNTNGGGGDGGGG
   212   70 B S  H  < S+     0   0   44 2314   47  SASAAASASSAAAASASSSSAASAAASSSSSSSSSSSSSSSSASA  AASA ASSSSSSSSAAAASAAAA
   213   71 B L  H >X S+     0   0   17 2314   25  FFFFFFFFFFFFFFLFLLLLFFFFFFFFFFFFFFFFFFFFFIFFF  FFIF FFFFFFFLFFFFFFFFFF
   214   72 B G  H >X S+     0   0   10 2314   68  SSSSSSSSSSSSSSGSGGGGSSSSSSSGGSSSSSSSSSSSSSSSS  SSTS GSSSSCSGSSSSSSSSSS
   215   73 B D  H 3< S+     0   0   98 2312   70  NDDDDDEDDEDDDDEELSSLDDNEEDEEENNNNNNNNNNNNDDND  DDDD EZNNNEELEDDDDNDDDD
   216   74 B A  H X4 S+     0   0    0 2314   20  GGGGGGGGGGGGGGGGAAAAGGGGGGGGGGGGGGGGGGGGGGGGG  GGGG GGGGGGGAGGGGGGGGGG
   217   75 B I  H X< S+     0   0   14 2313   43  MLLLLLLLLLLLLLVLVVVVLLMLLLLLLMMMMMMMMMMMMILVL  LLIL LVVVVLLVLLLLLMLLLL
   218   76 B K  T 3< S+     0   0  162 2315   65  KNKANNKAKQAAAAAHEEEEAAKNNAKKKKKKKKKKKKKKKKAQA  AAKA KQQQQKKQKAAAAKTATT
   219   77 B H  T X   +     0   0   96 2315   51  HHHHHHNHHHHHHHNHNNNNHHNHHHNHHHHHHHHHHHHHHNHHH  HHNH NHHHHQQNNHHHHHHHHH
   220   78 B L  T <   +     0   0   17 2315   32  LLILLLLLILLLLLLLMMMMLLLLLLLLLLLLLLLLLLLLLLLLL  LLLL LLLLLLLMLLLLLLLLLL
   221   79 B D  T 3  S+     0   0  159 2315    5  DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DDDD DDDDDDDDDDDDDDDDDD
   222   80 B D    <>  +     0   0   85 2315   35  DNDNNNNNDNNNNNNSNNNNNNNNNNNDDDDDDDDDDDDDDNNDN  NNNN NDDDDDDNNNNNNDNNNN
   223   81 B L  H  > S+     0   0   17 2313   25  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLL LLLLLLLLLLLLLLLLLL
   224   82 B K  H  > S+     0   0  143 2307   71  KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KKKK KKKKKKKKKKKKKKKKKK
   225   83 B G  H  4 S+     0   0   48 2312   51  GGGGGGGGGGGGGGGGEEEEGGGGGGGGGGGGGGGGGGGGGGGGG  GGGG GGGGGGGEGGGGGGGSGG
   226   84 B T  H  < S+     0   0   55 2313   57  TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TTTT TTTTTAATTTTTTTTTTT
   227   85 B F  H  X S+     0   0    7 2314   23  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFYFFF  FFYF FFFFFFFFFFFFFFFFFF
   228   86 B A  H  X S+     0   0   21 2315   60  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  AAAA AAAAAAAAAAAAAAAAAA
   229   87 B Q  H  > S+     0   0  150 2310   74  AQKQKQKQKKQQQQKKHHHHTQKKKTKAAAAAAAAAAAAAAKTSQ  QTKK KQEQQSSHKQQQQAQQQQ
   230   88 B L  H  > S+     0   0   57 2316    0  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLL LLLLLLLLLLLLLLLLLL
   231   89 B S  H  X S+     0   0    0 2315    2  SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  SSSS SSSSSSSSSSSSSSSSSS
   232   90 B E  H  X S+     0   0   81 2316   47  EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE  EEEE EEEEEEEEEEEEEEEEEE
   233   91 B L  H  X>S+     0   0   77 2316   21  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLL LLLLLLLLLLLLLLLLLL
   234   92 B H  I  <>S+     0   0   33 2316    0  HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH  HHHH HHHHHHHHHHHHHHHHHH
   235   93 B C  I  X5S+     0   0   12 2316   54  CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC  CCCC CCCCCCCCCCCCCCCCCC
   236   94 B D  I  <5S+     0   0   66 2315   78  DDDDDDDDDDNDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DDDD DDDDDDDDDDDDDDDDDD
   237   95 B K  I  <5S+     0   0  155 2316   36  KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KKKK KKKKKKKKKKKKKKKKKK
   238   96 B L  I  4   -     0   0    3 2315    2  DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD  DDDD DDDDDDDDDDDDDDDDDD
   242  100 B P  T >> S+     0   0   17 2316    1  PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP  PPPP PPPPPPPPPPPPPPPPPP
   243  101 B E  H 3> S+     0   0   31 2316   76  EEEEEEEEEEEEEEEEEQQEEEEEEEEEEEEEEEEEEEEEEEEEE  EEEE EEEEEEEEEEEEEEEEEE
   244  102 B N  H <> S+     0   0   13 2316    2  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  NNNN NNNNNNNNNNNNNNNNNN
   245  103 B F  H <> S+     0   0   22 2316    1  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FFFF FFFFFFFFFFFFFFFFFF
   246  104 B K  H  X S+     0   0  120 2316   30  KKKRRKKRKRRRRRRKKKKKRRRRRRKRRKKKKKKKKKKKKRRRR  RKRR RRRRRRRKKRRRRKRRRR
   247  105 B L  H  X S+     0   0   17 2300   17  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLL LLLLLLLLLLLLLLLLLL
   248  106 B L  H  X S+     0   0   38 2308    2  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLL LLLLLLLLLLLLLLLLLL
   249  107 B G  H  X S+     0   0    6 2310   44  GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG  GGGG GGGGGGGGGGGGGGGGGG
   250  108 B N  H  X S+     0   0   34 2311   57  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  NNNN NNNNNNNNNNNNNNNNNN
   251  109 B V  H  X S+     0   0    1 2310   66  VVVVVVVVVVVVVVVVVMMVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVV VVVVVVVMVVVVVVVVVV
   252  110 B L  H  X S+     0   0    9 2310   23  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLL LLLLLLLLLLLLLLLLLL
   253  111 B V  H  X S+     0   0    0 2312   56  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVV VVVVVVVVVVVVVVVVVV
   254  112 B T  H  X S+     0   0    1 2312   29  VCCCVCCCCCCCCCVVIIIICCCVVCCVVVVVVVVVVVVVVCCVC  CCCC VVIVVVVICCCCCVCCCC
   255  113 B V  H  X S+     0   0    6 2315   53  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV  VVVV VVVVVVVVVVVVVVVVVV
   256  114 B L  H  X S+     0   0    4 2315   24  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLMLLL  LLLL LLLLLLLLLLLLLLLLLL
   257  115 B A  H  X S+     0   0    0 2315   11  AAAAAAAAAAAAAAASSSSFDAAAAAAAAAAAAAAAAAAAAAAAA  AAAA AAAAAAASAAAAAAAAAA
   258  116 B I  H  < S+     0   0   27 2307   85  RHHHHHHHHRHHHHSHSTTSHHRHHHHRRRRRRRRRRRRRRRHRR  HHRH RRRRRRRSHQHHHRHHHH
   259  117 B H  H  < S+     0   0  114 2316   52  HHHHHHHHHHHHHHKHYHHYHHNHHHHHHNNNNNNNNNNNNTHHN  HHNH HHHHHRRHHHHHHNHHHH
   260  118 B F  H >< S-     0   0   18 2316   62  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFLFFF  FFLF FFFFFFFLFFFFFFFFFF
   261  119 B G  G >< S+     0   0   17 2314   55  GGGGGGGGGGGGGGGGGAAGGGGGGGGGGGGGGGGGGGGGGGGGG  GGGG GGGGGGGGGGGGGGGGGG
   262  120 B K  G 3  S+     0   0  193 2165   71  KKNKKKKKNKKKKKKGKKKKKKKKKKKKKKKKKKKKKKKKKKKKK  KKKK KKKKKSGKKKKKKKKKKK
   263  121 B E  G <  S+     0   0   93 2313   44  EEEEDEEEEEEEEEEEEEEEEEDDDEEEEEEEEEEEEEEEEEEEE  EEEE DEEEEEEEEEEEEEEEEE
   264  122 B F  S <  S-     0   0    0 2313    7  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  FFFF FFFFFFFFFFFFFFFFFF
   265  123 B T    >>  -     0   0   53 2311   23  TTTTTTTTTTTTTTTSTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  TTTT TTTTTSTTTTTTTTTTTT
   266  124 B P  H 3> S+     0   0   23 2311   20  PPPPPPPPPPPPPPPPAPPAPPPPPPPPPPPPPPPPPPPPPPPPP  PPPP PPPPPPPAPPPPPPPPPP
   267  125 B E  H 3> S+     0   0  105 2307   52  VQPQQQQQPQQQQQPQEEEEPQQQEPQEEVVVVVVVVVVVVHPE   QPQQ PEEEEEEEQQQQQVTQQQ
   268  126 B V  H <> S+     0   0   22 2310   50  LVVVVVVVVVVVVVVVVVVVVVVVVVVLLLLLLLLLLLLLLAVL   VVAV VLLLLLLVVVLLLLVVVV
   269  127 B Q  H  X S+     0   0    0 2291   35  QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ   QQQQ QQQQQQQQQQQQQQQQQQ
   270  128 B A  H  X S+     0   0   15 2300   35  AAAASAAAAAAAAAAAAAAAAAAAAAASSAAAAAAAAAAAAAAS   AAAA AAAAAAAAAAAAAAAAAA
   271  129 B S  H  X S+     0   0    1 2302   49  DAAAAAAAAAAAAAAAAAAAAAAAAAAAADDDDDDDDDDDDAAE   AAAA AEEEESNAAAAAADAAAA
   272  130 B W  H  X S+     0   0    1 2304   51  FYYYYYYYYYYYYYFWWWWWYYYYYYYYYFFFFFFFFFFFFFYF   YYFY FFFFFFFWYYYYYFYYYY
   273  131 B Q  H  X S+     0   0    5 2306   39  QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ   QQQQ QQQQQQQQQQQQQQQQQQ
   274  132 B K  H  X S+     0   0  100 2304    1  KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK   KKKK KKKKKKKKKKKKKKKKKK
   275  133 B M  H  X S+     0   0    1 2301   33  VVVVVVVVVVVVVVVVLLLLVVVVVVVVVVVVVVVVVVVVVMVV   VVVV LVVVVVVLVVVVVVVVVV
   276  134 B V  H  X S+     0   0    6 2303   34  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV   VVVV AVVVVVVVVVVVVVVVVV
   277  135 B T  H  X S+     0   0   80 2301   65  AAAAAAAAAAAAAAASAM AAAAAAAAAAAAAAAAAAAAAALAA   AALA LAAAATTAAAAAAAAAAA
   278  136 B G  H  X S+     0   0   23 2301   71  GGGGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG   GGGG GGGGGGGAGGGGGGGGGG
   279  137 B V  H  X S+     0   0   17 2298   15  VVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV   VVVV VVVVVVVVVVVVVVVVVV
   280  138 B A  H  X S+     0   0    5 2297   60  AAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA   AAAA AAAAAAAAAAAAAAAAAA
   281  139 B S  H  X S+     0   0   67 2291   79  NNNNNNNNNNNNNNNNTN TNNTTTNNTTNNNNNNNNNNNNTNS   NNTN TSSSSNNNNNNNNNNNTN
   282  140 B A  H  < S+     0   0    2 2289   52  AAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA   AAAA AAAAAAAAAAAAAAAAAA
   283  141 B L  H  < S+     0   0   19 2272    1  LLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL   LALL LLLLLLLLLLLLLLLLLL
   284  142 B S  H >< S+     0   0   44 2267   58  AAAAAAAAAAAAAAAASS SAAAAAAAAAAAAAAAAAAAAAAAA   ASAA AAAAAAASAAAAAAAAAA
   285  143 B S  T 3< S+     0   0   57 2265   80  HHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHH   HQHH HHHHHHHLHHHHHHHHHH
   286  144 B R  T 3  S+     0   0  128 2255   28  RKKKKKKKKKKKKKKKKK KKKKKKKKKKRRRRRRRRRRRRKKR   KSKK KRRRRRRKKKKKKRKKKK
   287  145 B Y    <         0   0   31 2246    0  YYYYYYYYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYY   YFYY YYYYYYYYYYYYYYYYYY
   288  146 B H              0   0  136 2186   41  HHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHH   HHHH HHHHHHHHHHHHHHHHHH
## ALIGNMENTS  771 -  840
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....8....:....9....:....0....:....1....:....2....:....3....:....4
     1    1 A V              0   0  136  867   26                                         V                              
     2    2 A L        -     0   0   22 1663    3                                         L                              
     3    3 A S     >  -     0   0   51 1663   48                                         S                              
     4    4 A P  H  > S+     0   0   84 1664   53                                         E                              
     5    5 A A  H  > S+     0   0   62 1663   62                                         E                              
     6    6 A D  H  > S+     0   0    8 1667   20                                         D                              
     7    7 A K  H  X S+     0   0   46 1668    8                                         K                              
     8    8 A T  H  X S+     0   0   95 1666   59                                         N                              
     9    9 A N  H  X S+     0   0   43 1665   80                                         N                              
    10   10 A V  H  X S+     0   0    2 1667   12                                         I                              
    11   11 A K  H  X S+     0   0   99 1668   70                                         K                              
    12   12 A A  H  X S+     0   0   67 1669   58                                         K                              
    13   13 A A  H  < S+     0   0    5 1672   61                                         A                              
    14   14 A W  H  X S+     0   0   22 1672    7                                         W                              
    15   15 A G  H  < S+     0   0   51 1672   52                                         V                              
    16   16 A K  T  < S+     0   0  111 1673    8                                         K                              
    17   17 A V  T >4 S+     0   0    1 1676   26                                         I                              
    18   18 A G  T 3< S+     0   0   49 1676   66                                         G                              
    19   19 A A  T 3  S+     0   0   96 1676   70                                         N                              
    20   20 A H  S <> S+     0   0   92 1674   65                                         H                              
    21   21 A A  H  > S+     0   0    6 1158   58                                         A                              
    22   22 A G  H  > S+     0   0   19 1159   49                                         A                              
    23   23 A E  H  > S+     0   0  120 1676   42                                         E                              
    24   24 A Y  H  X S+     0   0   23 1676   70                                         I                              
    25   25 A G  H  X S+     0   0    4 1676    6                                         G                              
    26   26 A A  H  X S+     0   0   15 1676   45                                         A                              
    27   27 A E  H  X S+     0   0   45 1676    7                                         E                              
    28   28 A A  H  X S+     0   0    0 1674   28                                         T                              
    29   29 A L  H  X S+     0   0    4 1677    2                                         I                              
    30   30 A E  H  X S+     0   0   36 1677   56                                         G                              
    31   31 A R  H  X S+     0   0    3 1678    1                                         R                              
    32   32 A M  H  X S+     0   0   11 1677   19                                         L                              
    33   33 A F  H  < S+     0   0   11 1667   15                                         F                              
    34   34 A L  H  < S+     0   0   58 1672   64                                         I                              
    35   35 A S  H  < S+     0   0   15 1674   70                                         V                              
    36   36 A F    ><  +     0   0   36 1674   14                                         F                              
    37   37 A P  G >  S+     0   0   44 1674    0                                         P                              
    38   38 A T  G >  S+     0   0   37 1674  100                                         S                              
    39   39 A T  G X  S+     0   0    3 1674    2                                         S                              
    40   40 A K  G X  S+     0   0   64 1674   41                                         K                              
    41   41 A T  G <  S+     0   0    7 1675   64                                         T                              
    42   42 A Y  G <  S+     0   0   16 1675    3                                         Y                              
    43   43 A F    X   +     0   0   31 1676    0                                         F                              
    44   44 A P  T 3  S+     0   0   70 1676   66                                         P                              
    45   45 A H  T 3  S+     0   0  122 1676   59                                         H                              
    46   46 A F  S <  S-     0   0   44 1676    8                                         F                              
    47   47 A D        -     0   0   81 1676   46                                         N                              
    48   48 A L        +     0   0   55 1674   66                                         T                              
    49   49 A S  S >  S-     0   0   58 1674   83                                         S                              
    50   50 A H  T 3  S+     0   0  150 1674   86                                         E                              
    51   51 A G  T 3  S+     0   0   40 1676   21                                         G                              
    52   52 A S    X>  -     0   0   13 1677   46                                         S                              
    53   53 A A  H 3> S+     0   0   80 1675   50                                         D                              
    54   54 A Q  H 3> S+     0   0   86 1677   56                                         Q                              
    55   55 A V  H <> S+     0   0   12 1676   15                                         V                              
    56   56 A K  H  X S+     0   0  130 1677   25                                         K                              
    57   57 A G  H  X S+     0   0   37 1678   52                                         A                              
    58   58 A H  H  X S+     0   0   53 1678    7                                         H                              
    59   59 A G  H  X S+     0   0    0 1678    1                                         G                              
    60   60 A K  H  X S+     0   0  132 1677   49                                         K                              
    61   61 A K  H  X S+     0   0  166 1677   22                                         K                              
    62   62 A V  H  X S+     0   0   31 1677    6                                         V                              
    63   63 A A  H  X S+     0   0    1 1677   69                                         A                              
    64   64 A D  H  X S+     0   0   83 1677   63                                         D                              
    65   65 A A  H  X S+     0   0   23 1678   36                                         A                              
    66   66 A L  H  X S+     0   0   15 1678   27                                         L                              
    67   67 A T  H  X S+     0   0   52 1678   69                                         T                              
    68   68 A N  H  X S+     0   0   60 1678   62                                         N                              
    69   69 A A  H  < S+     0   0    0 1678   26                                         A                              
    70   70 A V  H >< S+     0   0   10 1678   47                                         A                              
    71   71 A A  H 3< S+     0   0   71 1678   70                                         S                              
    72   72 A H  T >< S+     0   0   84 1678   50                                         H                              
    73   73 A V  T <  S+     0   0   14 1678   26                                         L                              
    74   74 A D  T 3  S+     0   0  114 1678    3                                         D                              
    75   75 A D  S X> S+     0   0   85 1678   30                                         D                              
    76   76 A M  H 3>  +     0   0   13 1678   19                                         L                              
    77   77 A P  H 34 S+     0   0   69 1672   78                                         P                              
    78   78 A N  H X4 S+     0   0   91 1678   38                                         G                              
    79   79 A A  H 3< S+     0   0   34 1678   50                                         A                              
    80   80 A L  T 3X S+     0   0    5 1678   14                                         L                              
    81   81 A S  H <> S+     0   0   43 1678   57                                         S                              
    82   82 A A  H  > S+     0   0   77 1678   70                                         T                              
    83   83 A L  H  > S+     0   0   54 1678    0                                         L                              
    84   84 A S  H  X S+     0   0    3 1677    3                                         S                              
    85   85 A D  H  X S+     0   0   67 1678   28                                         D                              
    86   86 A L  H >X>S+     0   0   68 1678    8                                         L                              
    87   87 A H  I 3<>S+     0   0   41 1678    0                                         H                              
    88   88 A A  I 3<5S+     0   0    6 1678   45                                         A                              
    89   89 A H  I <<5S+     0   0  111 1678   83                                         H                              
    90   90 A K  I  <5S+     0   0  162 1678   37                                         K                              
    91   91 A L  I      -     0   0    3 1677    2                                         D                              
    95   95 A P  T >> S+     0   0   40 1677    0                                         P                              
    96   96 A V  H 3> S+     0   0   56 1677   76                                         V                              
    97   97 A N  H <> S+     0   0   10 1676    1                                         N                              
    98   98 A F  H <> S+     0   0   23 1678    0                                         F                              
    99   99 A K  H  X S+     0   0  129 1678   26                                         K                              
   100  100 A L  H  X S+     0   0   20 1675   16                                         F                              
   101  101 A L  H  X S+     0   0   40 1677    2                                         L                              
   102  102 A S  H  X S+     0   0   16 1677   44                                         S                              
   103  103 A H  H  X S+     0   0   16 1677   45                                         H                              
   104  104 A C  H  X S+     0   0    0 1676   70                                         C                              
   105  105 A L  H  X S+     0   0   11 1676   23                                         L                              
   106  106 A L  H  X S+     0   0    2 1677   44                                         L                              
   107  107 A V  H  X S+     0   0    0 1677   30                                         V                              
   108  108 A T  H  < S+     0   0    1 1677   51                                         T                              
   109  109 A L  H >X S+     0   0    4 1677   20                                         L                              
   110  110 A A  H 3< S+     0   0    0 1677   13                                         A                              
   111  111 A A  T 3< S+     0   0   10 1675   90                                         S                              
   112  112 A H  T <4 S+     0   0   53 1678   39                                         H                              
   113  113 A L  S >X S-     0   0    3 1678   63                                         H                              
   114  114 A P  T 34 S+     0   0   90 1678   50                                         P                              
   115  115 A A  T 34 S+     0   0   80 1590   72                                         G                              
   116  116 A E  T <4 S+     0   0   79 1678   38                                         D                              
   117  117 A F     <  +     0   0    8 1678    7                                         F                              
   118  118 A T     >  -     0   0   62 1678   18                                         T                              
   119  119 A P  H  > S+     0   0   22 1678   12                                         P                              
   120  120 A A  H  > S+     0   0   35 1677   58                                         A                              
   121  121 A V  H  > S+     0   0   17 1677   38                                         M                              
   122  122 A H  H  X S+     0   0    2 1676   32                                         H                              
   123  123 A A  H  X S+     0   0   16 1676   34                                         A                              
   124  124 A S  H  X S+     0   0    3 1676   45                                         S                              
   125  125 A L  H  X S+     0   0    3 1676   46                                         L                              
   126  126 A D  H  X S+     0   0   21 1676   30                                         D                              
   127  127 A K  H  X S+     0   0   36 1676    0                                         K                              
   128  128 A F  H  X S+     0   0    2 1676   41                                         F                              
   129  129 A L  H  X S+     0   0    7 1676   33                                         F                              
   130  130 A A  H  X S+     0   0   39 1676   54                                         A                              
   131  131 A S  H  X S+     0   0   29 1676   65                                         S                              
   132  132 A V  H  X S+     0   0    9 1676   11                                         V                              
   133  133 A S  H  X S+     0   0   17 1675   49                                         S                              
   134  134 A T  H  X S+     0   0   88 1674   74                                         T                              
   135  135 A V  H  < S+     0   0   21 1675   55                                         V                              
   136  136 A L  H  < S+     0   0   19 1674    0                                         L                              
   137  137 A T  H >< S+     0   0   42 1674   54                                         T                              
   138  138 A S  T 3< S+     0   0   57 1669   77                                         S                              
   139  139 A K  T 3  S+     0   0   77 1669   12                                         K                              
   140  140 A Y    <         0   0   19 1666    0                                         Y                              
   141  141 A R              0   0   75 1644   37                                         R                              
   142      ! !              0   0    0   0     0  
   143    1 B G              0   0  113   82   41                                                                       G
   144    2 B H        -     0   0  151 1032   46  HHHQQHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHNHH   HHQ     HQHHHHHEH  HHHHH Q F
   145    3 B F        -     0   0   37 2258   27  LWLLLLLLLLLLLLLLLLLWLLLLLLLLLLLLFFLLFLL LLLWLLLLLLLLLLLLLLLLLLLLLLLLLL
   146    4 B T    >>  -     0   0   75 2258   47  TSSSSTTTTSTTTTTTTTSSSTTTTTTTTTTTTTSTTTT TTSTSTTTTTTSTTTTTTHTSTTTTTTSTT
   147    5 B E  H 3> S+     0   0  133 2262   54  AAGGGPAPPGGNGGPPDGAAGAAAPGPAGPPPTTGGAPA AASAGAAAAAAGPPPGDGGAAGGAAAPGPA
   148    6 B E  H 3> S+     0   0  151 2265   64  EEEEEEEEEEEEEEEEAEEEEEDEEEEEEEDEEEEEEDE EEEEEEEEEEEEEEEDAEDEEEEEEEEEEE
   149    7 B D  H X> S+     0   0   26 2283   21  EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
   150    8 B K  H 3X S+     0   0   82 2285   24  KKKKKKKKKKKKKKKKKKKKKKKKKKNKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKNKNK
   151    9 B A  H 3X S+     0   0   51 2283   64  SQSAASDSSSSTTSSSAGGQGSAAASNSAANAAAASANS AASQAAAAAASATTTSAAAAASSSSSGAGG
   152   10 B T  H < S+     0   0    5 2293   58  LILLLLLLLLLLLLLLLLLILLLLLLLLLLLLLLLLLLL FFLLLFFFFFLLLLLLLLLFLLLLLLLLLL
   157   15 B W  G >< S+     0   0   32 2299    7  WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWWFWWWWWWWWW
   158   16 B G  G 3  S+     0   0   69 2299   51  GGGDDGGGGGGGAGGGGGGGGGGGAGGGSGGAAAGGAGG GGGGDSSGSSGDGGGGGDDGAGGGGGGDGG
   159   17 B K  G <  S+     0   0  109 2303   19  KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK RRKKKKKKKKKKKKKKKKKKKKKKKKKKKK
   160   18 B V    <   -     0   0   19 2307   28  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV
   161   19 B N     >  -     0   0   97 2308   63  NNKNNNNNNNNNNNNNKNNNNNDDNNNNNNNNNNNNNNK HHNNNHHKHHNNNNNNNDDKNNNNNNDNNN
   162   20 B V  H  > S+     0   0   26 2306   77  VVVEEVVVVVVVVVVVVVVVQTVVVVVVVVVVVVVVVVV VVVVEVVVVVVEVVVVPEEVVVVVVVVEVV
   163   21 B E  H  > S+     0   0   84 2303   46  DADEEDQDDEEEDDDDDDDAEDEEKEEDDDEKEEDEEED DDEAEDDDDDDEDDDDDDEDEDDDDDEEED
   164   22 B D  H  4 S+     0   0   90 2307   47  EDEEEEEEEEEEEDEEEEDDEEDDEEKEEEEEVVEEVEE EEEDEEEEEEEEAAADDKKEEEEEEEKEKE
   165   23 B A  H  X S+     0   0   13 2309   68  VCVVVVVVVVIVVVVVYVVCVVVVYVVVVVVYVVVIAVV IIVCVVVVVVVVVVVIVVVVVVVVVVVVVV
   166   24 B G  H  X S+     0   0    0 2309    5  GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG SSGGGGGGGGGGGGGGGGGGGGGGGGGGGG
   167   25 B G  H  X S+     0   0    5 2309   51  GAGGGGGGGGGGGGGGGGAAGGGGGGGGGGGGGGGGGGG GGGAGGGGGGGGGGGAGGGAGGGGGGGGGG
   168   26 B E  H  > S+     0   0   52 2309   25  EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
   169   27 B T  H  X S+     0   0    4 2307   28  AAAAAAAAATAAAAAAAAAAAAAAAAAAAAAASSTAIAA VVAAAAAAAAAAAAAAAAAAAAAAAAAAAA
   170   28 B L  H  X S+     0   0    7 2310    2  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   171   29 B G  H  X S+     0   0    0 2310   62  GAGGGGGGGGGGGGGGGGGAGGGGGGGGGGGGAAGGGGG GGGAGGGGGGGGGGGGGGGGGGGGGGGGGG
   172   30 B R  H  X S+     0   0    8 2309    2  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRR
   173   31 B L  H  X S+     0   0   12 2309   37  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   174   32 B L  H  < S+     0   0    0 2309   14  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   175   33 B V  H  < S+     0   0   26 2310   56  VIVVVVVVVVVVVVVVVVVIVVVVVVVIVVVVIIVVVVV VVVIVVVVVVIVVVVVVVVVVVVIIIVVVV
   176   34 B V  H  < S+     0   0    2 2312   61  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV
   177   35 B Y  S >< S-     0   0   26 2312   13  YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYYYY
   178   36 B P  T 3   +     0   0   29 2313    0  PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPP
   179   37 B W  T 3  S+     0   0   22 2313   94  WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWWWWWWW
   180   38 B T  S X  S+     0   0    3 2313    3  TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
   181   39 B Q  G >  S+     0   0   40 2313   46  QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ
   182   40 B R  G 3  S+     0   0   64 2316   69  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRR
   183   41 B F  G <  S+     0   0   60 2316    8  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFYFFFFFFFFFFFFF
   184   42 B F    X   +     0   0   26 2316    0  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
   185   43 B D  T 3  S+     0   0  125 2315   68  DSDDDEEEEEDEEEEEEDDADDDDEEEDDEDEDDEDDDD EEEADEEEEEDDEEEDDDDEEEEDDDEDEQ
   186   44 B S  T 3  S+     0   0  109 2316   73  SSSSSSSSSSSSSSSSHSSSSSSSHSSSSSSHSSSSNSS SSSSSSSTSSSSSSSSSSSHHSSSSSSSSS
   187   45 B F  S <  S-     0   0   34 2315    6  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
   188   46 B G        +     0   0   57 2304   43  GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
   189   47 B N        +     0   0  101 1087   32  DNDDDDDDDDDDDDDDDDDNDDDDDDDDDDDDNNDDNDD DDDNDDDDDDDDDDDDDDDDDDDDDDDDDD
   190   48 B L        +     0   0   18 1086    4  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   191   49 B S        +     0   0   87 1087   39  SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSCYSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
   192   50 B S  S >> S-     0   0   64 1089   48  TSSNNTSTTTSSSSTTNSSSSSTTSTSTTTSSSSFSSSS TTSSNTTTTTTNSSSSSTTSSTTTTTTNSS
   193   51 B A  H 3> S+     0   0   28 1160   49  PAAPPPAPPAPPPPPPAAAAAAPPAAPPPPPAEEAPEPP AAAPPAAAAAPPPPPAAAAAAPPPPPPPPA
   194   52 B S  H 3> S+     0   0  104 1382   69  DTSAADDDDSSSDSDDDAGTSSAASDDDDASSSSFSTSN DDNTGDDDDDDGDDDSSAADDDDDDDSGDD
   195   53 B A  H <4 S+     0   0   24 2309   70  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
   196   54 B I  H  < S+     0   0    2 2309   82  VIVVVVVVVVVIIVVVIVIIVVVVIVIVVVVIIIIVIVI IIVIVVVVVVVVVVVIIVVVIVVVVVIVII
   197   55 B M  H  < S+     0   0   39 2309   88  MSMMMMMMMMFMMMMMMMMSMMMMMMMMMMMMMMMFMMM MMMLMMMMMMMMMMMMMMMMLMMMMMMMMM
   198   56 B G  S  < S+     0   0   41 2311   27  NGGGGGNGGGGGGGGGHGGGGSGSNKGGNGGNGGGGGGS NNNGGNNNNNSGGGGGGGGNGNNSSSGGGG
   199   57 B N     >  -     0   0   13 2313   52  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
   200   58 B P  H  > S+     0   0   95 2311   53  PPAPPPPPPPAPPPPPPAPPAPAAPPPAPPPPPPPPPPP AAPPPPPPPPAPPPPAPPPAPPPAAAPPPS
   201   59 B K  H  > S+     0   0  126 2313   69  KNKKKKKKKKKKKKKKKKKNKKKKKNKKKKKKKKKKKKK KKKMKKKKKKKKKKKKKKKKKKKKKKKKKK
   202   60 B V  H  > S+     0   0    1 2312   13  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV
   203   61 B K  H  X S+     0   0  112 2311   50  KKKKKKKKKKKKKKKKLKKKKKKKKKKKKKKKKKSKKKK KKKRKKKKKKKKKKKKKKKKKKKKKKKKKK
   204   62 B A  H  X S+     0   0   53 2312   51  AAAAAAAAAASAAAAAAAAAAAAAAKAAAAAAAAASVAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
   205   63 B H  H  X S+     0   0   62 2314    5  HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
   206   64 B G  H  X S+     0   0    0 2314    1  GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
   207   65 B K  H  X S+     0   0   94 2312   54  KKKKKKKKKKKKKKKKKKKKKKKKEQKKKKKERRKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
   208   66 B K  H  X S+     0   0  156 2313   28  KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
   209   67 B V  H  X S+     0   0   40 2314    7  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV
   210   68 B L  H  X S+     0   0    5 2314   63  LLLLLLLLLLLLLLLLLLALLFLLFLLLLLLFLLLLLLL LLLLLLLLLLLLLLLAILLLLLLLLLLLLL
   211   69 B T  H  X S+     0   0   52 2310   68  GTDHHGDGGADNNSGGSDNTNDNNTATNNGSTNNNDTSN DDATHDDDDDNHGGGNNHHDDGGNNNSHSN
   212   70 B S  H  < S+     0   0   44 2314   47  ASSSSASAAASSSAAASSSSSSAASSASSAASSSSSSAS SSASSSSSSSSSAAASASSSTAASSSASAS
   213   71 B L  H >X S+     0   0   17 2314   25  FFFFFFFFFFFFFFFFFFIFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFIFFFFFFFFFFFFFF
   214   72 B G  H >X S+     0   0   10 2314   68  SGSGGSASSSSSSSSSGSSGSSSSGGSSSSSGGGSSGSS SSSGGSSSSSSGSSSSNGGSSSSSSSSGSS
   215   73 B D  H 3< S+     0   0   98 2312   70  DDEEEDDDDENEEDDDDEDDDNEDDEEDEDEDNNDNNED NNEDENNNNNDEDDDDDDENEDDDDDEEED
   216   74 B A  H X4 S+     0   0    0 2314   20  GAGGGGGGGGGGGGGGGGGAGGGGGGGGGGGGAAGGAGG GGGAGGGGGGGGGGGGGGGGGGGGGGGGGG
   217   75 B I  H X< S+     0   0   14 2313   43  LVLVVLLLLLMLLLLLLLIVLLMMLLLLLLLLIILLILL MMLVVMMMMMLVLLLVLVVMLLLLLLLVLL
   218   76 B K  T 3< S+     0   0  162 2315   65  TKQHHAKAASQKKNAANKKKKKAAKKHKKANKKEKQKNK KKSKHKKKKKKHAAAKKHHKKTTKKKHHHK
   219   77 B H  T X   +     0   0   96 2315   51  HNHHHHHHHHHNNHHHHNNNNHHHHHHNNHHHHHHHHHN HHHNHHHHHHNHHHHNHHHHQHHNNNHHHN
   220   78 B L  T <   +     0   0   17 2315   32  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLMMLLMLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLI
   221   79 B D  T 3  S+     0   0  159 2315    5  DDDDDDDDDDDDDDDDDDDDDDDDEDDDDDDEDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDD
   222   80 B D    <>  +     0   0   85 2315   35  NNSNNNNNNNNNNNNNNNNNNNNNDDNNNNNDDDNNDNN DDNNNDDDDDNNNNNNNDDDDNNNNNNNND
   223   81 B L  H  > S+     0   0   17 2313   25  LILLLLLLLLLLLLLLLLLILLLLLLLLLLLLLLLLLLL LLLILLLLLLLLLLLLLLLLLLLLLLLLLL
   224   82 B K  H  > S+     0   0  143 2307   71  KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
   225   83 B G  H  4 S+     0   0   48 2312   51  GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGNGGGGGGGGGGGGGVVGGGGGGGGGGG
   226   84 B T  H  < S+     0   0   55 2313   57  TTTTTTTTTTTTTTTTTTTTATTTATTTTTTATTTTTTT TTTTTTTTTTTTTTTTTTTTATTTTTTTTA
   227   85 B F  H  X S+     0   0    7 2314   23  FFFFFFFFFFFFFFFFFFYFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFYFFFFFFFFFFFFFF
   228   86 B A  H  X S+     0   0   21 2315   60  AAAAAAAAAAAAAAAAAAAAAAAAAAAAVAAAAASASAA AAAAAAAAAAAASSSAAAAAAAAAAAAAAA
   229   87 B Q  H  > S+     0   0  150 2310   74  QQKQQTATQKKKKKTTQKKQKSKKEAQKKQKEDDHKHKK AAKQAAAAAAKAQQQKHQQQSHHKKKQAQK
   230   88 B L  H  > S+     0   0   57 2316    0  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   231   89 B S  H  X S+     0   0    0 2315    2  SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
   232   90 B E  H  X S+     0   0   81 2316   47  EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
   233   91 B L  H  X>S+     0   0   77 2316   21  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   234   92 B H  I  <>S+     0   0   33 2316    0  HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
   235   93 B C  I  X5S+     0   0   12 2316   54  CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
   236   94 B D  I  <5S+     0   0   66 2315   78  DDDDDDDDDDDDDDDDDDDNDDDDDDDDDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDDVD
   237   95 B K  I  <5S+     0   0  155 2316   36  KKKKKKQKKKKKKKKKKKKKKKKKKKKKKKKKKKKKRKQ KKKKKKKKKKKKKKKKKKKKKKKKKKKKAK
   238   96 B L  I  4   -     0   0    3 2315    2  DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDEDDDDDDDDDDDDDDDDDDDDDD
   242  100 B P  T >> S+     0   0   17 2316    1  PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPP
   243  101 B E  H 3> S+     0   0   31 2316   76  EEEEEEEEEEEEEEEEEEEEEEEEEEQEEEEEPEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEQEEE
   244  102 B N  H <> S+     0   0   13 2316    2  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN YNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
   245  103 B F  H <> S+     0   0   22 2316    1  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
   246  104 B K  H  X S+     0   0  120 2316   30  RRRRRKRRRRRRRRRRRRRKKKRRRRKKKRRRRRKRKRK NNRRRKKKKKKRRRRRRRRKRRRKKKTRKR
   247  105 B L  H  X S+     0   0   17 2300   17  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   248  106 B L  H  X S+     0   0   38 2308    2  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   249  107 B G  H  X S+     0   0    6 2310   44  GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
   250  108 B N  H  X S+     0   0   34 2311   57  NDNNNNNNNNNYNNNNNNNDNNNNNNNNNNNNNNNNNNN NNNDNNNNNNNNNNNNNNNNNNNNNNNNNN
   251  109 B V  H  X S+     0   0    1 2310   66  VIVVVVEVVVVIVVVVVVVIVVVVVVVVVVVVMMVVMVV VVVIVVVVVVVVVVVVMVVVVVVVVVVVVV
   252  110 B L  H  X S+     0   0    9 2310   23  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLIIILILL LLLLLLLLLLLLLLLLILLLLLLLLLLLLL
   253  111 B V  H  X S+     0   0    0 2312   56  VVVVVVVVVVVLVVVVVVVVVVVVVVVVVVVVLLVVLVV VVVIVVVVVVVVVVVVVVVVVVVVVVVVVV
   254  112 B T  H  X S+     0   0    1 2312   29  CIVVVCVCCIVCCVCCVCCIVVCCCVICCCVCIIIVIVC VVIIVVVVVVCVCCCCIVVVVCCCCCIVIC
   255  113 B V  H  X S+     0   0    6 2315   53  VIVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVAVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV
   256  114 B L  H  X S+     0   0    4 2315   24  LLLLLLLLLLLLLLLLLLMLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   257  115 B A  H  X S+     0   0    0 2315   11  AAAAAAAAASAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AASAAAAAAAAAAAAAGAAAAAAAAAAAAA
   258  116 B I  H  < S+     0   0   27 2307   85  HARRRHRHHHRRHHHHRRRARHHHRRHHHRHRTTHRTHR HRHSRRRRRRHRRRRRHQQRRHHHHHERHH
   259  117 B H  H  < S+     0   0  114 2316   52  HHHHHHTHHHNHHHHHHNTHTHHHHHHHHNHHHHHNQHH HHHHHNNNNNHHNNNNHQQHRHHHHHHHHH
   260  118 B F  H >< S-     0   0   18 2316   62  FFFFFFFFFFFFFFFFFFLFFLFFFFFFFFFFFFLFFFF FFFFFFFFFFFFFFFLLFFHFFFFFFFFFF
   261  119 B G  G >< S+     0   0   17 2314   55  GGGGGGGGGGGGGGGGHGGGGGGGGGGGGGGGSSGGSGG GGGTGGGGGGGGGGGGGGGGGGGGGGGGGG
   262  120 B K  G 3  S+     0   0  193 2165   71  KKKKKKKKKKKKKKKKEKKKKKKKKKNKKKKKKKKKRKK KKKKKNNKNNKKKKKKKKKSGKKKKKNKNH
   263  121 B E  G <  S+     0   0   93 2313   44  EDEDDEEEEEEEEDEEEEEDEEEEEEDEEEDEEEDEEDE EEEDDEEEEEEDEEEEEAAEEEEEEEADDE
   264  122 B F  S <  S-     0   0    0 2313    7  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
   265  123 B T    >>  -     0   0   53 2311   23  TTTTTTTTTTTTTTTTTTTTTTTTSTSTTTTSTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTSTSN
   266  124 B P  H 3> S+     0   0   23 2311   20  PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPP
   267  125 B E  H 3> S+     0   0  105 2307   52  QEQEEPEPQQQQQQPPDQHEPQQQEEQQQQEEQQAQQQQ VVQEEVVVVVQEQQQQCEELEVVQQQPEQQ
   268  126 B V  H <> S+     0   0   22 2310   50  VCLLLVLVVVVVVVVVVVACVVVVALTVVVVAMMAVMVM LLVCLLLLLLVLVAAAALLLLVVVVVVLTV
   269  127 B Q  H  X S+     0   0    0 2291   35  QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ
   270  128 B A  H  X S+     0   0   15 2300   35  AAAAAAAAAAAAASAAAAAASSAAASAAAAAAAAAAAAG AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
   271  129 B S  H  X S+     0   0    1 2302   49  AAASSAAAAAAAAAAAAAAAAAAAAAAAAAAAASAAAAA TDAASDDDDDASAAAAAAAENAAAAAASAA
   272  130 B W  H  X S+     0   0    1 2304   51  YWYYYYYYYYYYYYYYFYFWFFYYYYFYYFYYWWFYWYF FFYWYFFFFFYYYYYFFYYFFYYYYYFYFF
   273  131 B Q  H  X S+     0   0    5 2306   39  QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQQQQQQQQQQRQQQQQQQQQQQQQQQ
   274  132 B K  H  X S+     0   0  100 2304    1  KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKKKKKKKK KKKKKKKKKKKKKKK
   275  133 B M  H  X S+     0   0    1 2301   33  VLVVVVVVVVVVVVVVVVMLVVVVVVVVVVVVLLVVLVV VVVMVVVVVVVVVV VVVVVVVVVVVVVVV
   276  134 B V  H  X S+     0   0    6 2303   34  VVVVVVVVVVVVVVVVVVVVAVVVVVVVVVVVTTVVTVV VVVVVVVVVVVVVV VVVVVVVVVVVVVVV
   277  135 B T  H  X S+     0   0   80 2301   65  ARAAAAAAAAAAAAAATVLRATAAAATAAAAANNAAAAA TAARAAAAAAAAAA LAAAATAAAAATATA
   278  136 B G  H  X S+     0   0   23 2301   71  GVGGGGGGGGGGGGGGGGGVGGGGGGGGGGGGAAGGAGG GGGVGGGGGGGGGG GGGGGGGGGGGGGGG
   279  137 B V  H  X S+     0   0   17 2298   15  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVV VVVVVVVVVVVVVVV
   280  138 B A  H  X S+     0   0    5 2297   60  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA AAAAAAAAAAAAAAA
   281  139 B S  H  X S+     0   0   67 2291   79  THTNNNNNNNTTNNNNNTTHTNTTNTNNNTTNNNTTNTN NNNHNNNNNNNNNN TSNSNNNNNNNNNNN
   282  140 B A  H  < S+     0   0    2 2289   52  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA AAAAAAAAAAAAAAA
   283  141 B L  H  < S+     0   0   19 2272    1  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLL  LLLLLLLLLLLLLLL
   284  142 B S  H >< S+     0   0   44 2267   58  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAA  AAAAAAAAAAAAAAA
   285  143 B S  T 3< S+     0   0   57 2265   80  HRHHHHHHHHHHHHHHHHHRHHHHHHHHHHHHHHHHYHH HHHRHHHHHHHHH  HHHHHHHHHHHHHHH
   286  144 B R  T 3  S+     0   0  128 2255   28  KKKKKKRKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK RRKKKRRRRRKKK  KKKKRRKKKKKKKKK
   287  145 B Y    <         0   0   31 2246    0  YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYYYYYYY  YYYYYYYYYYYYYYY
   288  146 B H              0   0  136 2186   41  HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHH HH  HHHHHHHHHHHHHHH
## ALIGNMENTS  841 -  910
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....5....:....6....:....7....:....8....:....9....:....0....:....1
     1    1 A V              0   0  136  867   26                                       VVVVVVVV                         
     2    2 A L        -     0   0   22 1663    3                                       LLLLLLLL                         
     3    3 A S     >  -     0   0   51 1663   48                                       SSSSSSSS                         
     4    4 A P  H  > S+     0   0   84 1664   53                                       AAAAAAAA                         
     5    5 A A  H  > S+     0   0   62 1663   62                                       AAAAAAAA                         
     6    6 A D  H  > S+     0   0    8 1667   20                                       DDDDDDDD                         
     7    7 A K  H  X S+     0   0   46 1668    8                                       KKKKKKKK                         
     8    8 A T  H  X S+     0   0   95 1666   59                                       TTTTTTTT                         
     9    9 A N  H  X S+     0   0   43 1665   80                                       NNNNNNNN                         
    10   10 A V  H  X S+     0   0    2 1667   12                                       VVVVVVVV                         
    11   11 A K  H  X S+     0   0   99 1668   70                                       KKKKKKKK                         
    12   12 A A  H  X S+     0   0   67 1669   58                                       GGGGGGGG                         
    13   13 A A  H  < S+     0   0    5 1672   61                                       VVVVVVVV                         
    14   14 A W  H  X S+     0   0   22 1672    7                                       FFFFFFFF                         
    15   15 A G  H  < S+     0   0   51 1672   52                                       SSSSSSSS                         
    16   16 A K  T  < S+     0   0  111 1673    8                                       KKKKKKKK                         
    17   17 A V  T >4 S+     0   0    1 1676   26                                       IIIIIIII                         
    18   18 A G  T 3< S+     0   0   49 1676   66                                       GGGGGGGG                         
    19   19 A A  T 3  S+     0   0   96 1676   70                                       GGGGGGGG                         
    20   20 A H  S <> S+     0   0   92 1674   65                                       HHHHHHHH                         
    21   21 A A  H  > S+     0   0    6 1158   58                                       AAAAAAAA                         
    22   22 A G  H  > S+     0   0   19 1159   49                                       EDDDEEEE                         
    23   23 A E  H  > S+     0   0  120 1676   42                                       EEEEEEEE                         
    24   24 A Y  H  X S+     0   0   23 1676   70                                       YYYYYYYY                         
    25   25 A G  H  X S+     0   0    4 1676    6                                       GGGGGGGG                         
    26   26 A A  H  X S+     0   0   15 1676   45                                       AAAAAAAA                         
    27   27 A E  H  X S+     0   0   45 1676    7                                       EEEEEEEE                         
    28   28 A A  H  X S+     0   0    0 1674   28                                       AAAAAAAA                         
    29   29 A L  H  X S+     0   0    4 1677    2                                       LLLLLLLL                         
    30   30 A E  H  X S+     0   0   36 1677   56                                       EEEEEEEE                         
    31   31 A R  H  X S+     0   0    3 1678    1                                       RRRRRRRR                         
    32   32 A M  H  X S+     0   0   11 1677   19                                       MMMMMMMM                         
    33   33 A F  H  < S+     0   0   11 1667   15                                       FFFFFFFF                         
    34   34 A L  H  < S+     0   0   58 1672   64                                       IIIIIIII                         
    35   35 A S  H  < S+     0   0   15 1674   70                                       ATTTAAAA                         
    36   36 A F    ><  +     0   0   36 1674   14                                       YYYYYYYY                         
    37   37 A P  G >  S+     0   0   44 1674    0                                       PPPPPPPP                         
    38   38 A T  G >  S+     0   0   37 1674  100                                       QQQQQQQQ                         
    39   39 A T  G X  S+     0   0    3 1674    2                                       TTTTTTTT                         
    40   40 A K  G X  S+     0   0   64 1674   41                                       KKKKKKKK                         
    41   41 A T  G <  S+     0   0    7 1675   64                                       TTTTTTTT                         
    42   42 A Y  G <  S+     0   0   16 1675    3                                       YYYYYYYY                         
    43   43 A F    X   +     0   0   31 1676    0                                       FFFFFFFF                         
    44   44 A P  T 3  S+     0   0   70 1676   66                                       PPPPPPPP                         
    45   45 A H  T 3  S+     0   0  122 1676   59                                       HHHHHHHH                         
    46   46 A F  S <  S-     0   0   44 1676    8                                       FFFFFFFF                         
    47   47 A D        -     0   0   81 1676   46                                       DDDDDDDD                         
    48   48 A L        +     0   0   55 1674   66                                       LLLLLLLL                         
    49   49 A S  S >  S-     0   0   58 1674   83                                       SQQQSSSS                         
    50   50 A H  T 3  S+     0   0  150 1674   86                                       HHHHHHHH                         
    51   51 A G  T 3  S+     0   0   40 1676   21                                       GGGGGGGG                         
    52   52 A S    X>  -     0   0   13 1677   46                                       SSSSSSSS                         
    53   53 A A  H 3> S+     0   0   80 1675   50                                       AAAAAAAA                         
    54   54 A Q  H 3> S+     0   0   86 1677   56                                       QQQQQQQQ                         
    55   55 A V  H <> S+     0   0   12 1676   15                                       IVVVIIII                         
    56   56 A K  H  X S+     0   0  130 1677   25                                       KKKKKKKK                         
    57   57 A G  H  X S+     0   0   37 1678   52                                       AAAAAAAA                         
    58   58 A H  H  X S+     0   0   53 1678    7                                       HHHHHHHH                         
    59   59 A G  H  X S+     0   0    0 1678    1                                       GGGGGGGG                         
    60   60 A K  H  X S+     0   0  132 1677   49                                       KKKKKKKK                         
    61   61 A K  H  X S+     0   0  166 1677   22                                       KKKKKKKK                         
    62   62 A V  H  X S+     0   0   31 1677    6                                       VVVVVVVV                         
    63   63 A A  H  X S+     0   0    1 1677   69                                       AAAAAAAA                         
    64   64 A D  H  X S+     0   0   83 1677   63                                       AAAAAAAA                         
    65   65 A A  H  X S+     0   0   23 1678   36                                       AAAAAAAA                         
    66   66 A L  H  X S+     0   0   15 1678   27                                       LLLLLLLL                         
    67   67 A T  H  X S+     0   0   52 1678   69                                       VVVVVVVV                         
    68   68 A N  H  X S+     0   0   60 1678   62                                       EEEEEEEE                         
    69   69 A A  H  < S+     0   0    0 1678   26                                       AAAAAAAA                         
    70   70