Complet list of 1a0r hssp fileClick here to see the 3D structure Complete list of 1a0r.hssp file
HSSP       HOMOLOGY DERIVED SECONDARY STRUCTURE OF PROTEINS , VERSION 2.0 2011
PDBID      1A0R
THRESHOLD  according to: t(L)=(290.15 * L ** -0.562) + 5
REFERENCE  Sander C., Schneider R. : Database of homology-derived protein structures. Proteins, 9:56-68 (1991).
CONTACT    Maintained at http://www.cmbi.ru.nl/ by Maarten L. Hekkelman 
DATE       file generated on 2014-03-10
HEADER     COMPLEX (TRANSDUCER/TRANSDUCTION)       05-DEC-97   1A0R
COMPND     MOL_ID: 1; MOLECULE: TRANSDUCIN (BETA SUBUNIT); CHAIN: B; SYNONYM: GT 
SOURCE     MOL_ID: 1; ORGANISM_SCIENTIFIC: BOS TAURUS; ORGANISM_COMMON: CATTLE; O
AUTHOR     A.LOEW,Y.-K.HO,T.L.BLUNDELL,B.BAX
DBREF      1A0R B    2   340  UNP    P04901   GBB1_HUMAN       2    340
DBREF      1A0R G    2    66  UNP    P02698   GBG1_BOVIN       1     65
DBREF      1A0R P    1   245  UNP    P19632   PHOS_BOVIN       1    245
SEQLENGTH   592
NCHAIN        3 chain(s) in 1A0R data set
NALIGN      689
NOTATION : ID: EMBL/SWISSPROT identifier of the aligned (homologous) protein
NOTATION : STRID: if the 3-D structure of the aligned protein is known, then STRID is the Protein Data Bank identifier as taken
NOTATION : from the database reference or DR-line of the EMBL/SWISSPROT entry
NOTATION : %IDE: percentage of residue identity of the alignment
NOTATION : %SIM (%WSIM):  (weighted) similarity of the alignment
NOTATION : IFIR/ILAS: first and last residue of the alignment in the test sequence
NOTATION : JFIR/JLAS: first and last residue of the alignment in the alignend protein
NOTATION : LALI: length of the alignment excluding insertions and deletions
NOTATION : NGAP: number of insertions and deletions in the alignment
NOTATION : LGAP: total length of all insertions and deletions
NOTATION : LSEQ2: length of the entire sequence of the aligned protein
NOTATION : ACCNUM: SwissProt accession number
NOTATION : PROTEIN: one-line description of aligned protein
NOTATION : SeqNo,PDBNo,AA,STRUCTURE,BP1,BP2,ACC: sequential and PDB residue numbers, amino acid (lower case = Cys), secondary
NOTATION : structure, bridge partners, solvent exposure as in DSSP (Kabsch and Sander, Biopolymers 22, 2577-2637(1983)
NOTATION : VAR: sequence variability on a scale of 0-100 as derived from the NALIGN alignments
NOTATION : pair of lower case characters (AvaK) in the alignend sequence bracket a point of insertion in this sequence
NOTATION : dots (....) in the alignend sequence indicate points of deletion in this sequence
NOTATION : SEQUENCE PROFILE: relative frequency of an amino acid type at each position. Asx and Glx are in their
NOTATION : acid/amide form in proportion to their database frequencies
NOTATION : NOCC: number of aligned sequences spanning this position (including the test sequence)
NOTATION : NDEL: number of sequences with a deletion in the test protein at this position
NOTATION : NINS: number of sequences with an insertion in the test protein at this position
NOTATION : ENTROPY: entropy measure of sequence variability at this position
NOTATION : RELENT: relative entropy, i.e.  entropy normalized to the range 0-100
NOTATION : WEIGHT: conservation weight

## PROTEINS : identifier and alignment statistics
  NR.    ID         STRID   %IDE %WSIM IFIR ILAS JFIR JLAS LALI NGAP LGAP LSEQ2 ACCNUM     PROTEIN
    1 : A7E3V7_BOVIN        1.00  1.00    3  339    1  337  337    0    0  337  A7E3V7     Guanine nucleotide-binding protein, beta-1 subunit (Fragment) OS=Bos taurus GN=GNB1 PE=2 SV=1
    2 : F6Z808_CALJA        1.00  1.00    1  339    2  340  339    0    0  340  F6Z808     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Callithrix jacchus GN=GNB1 PE=2 SV=1
    3 : G1M4Q5_AILME        1.00  1.00    1  339    2  340  339    0    0  340  G1M4Q5     Uncharacterized protein OS=Ailuropoda melanoleuca GN=GNB1 PE=4 SV=1
    4 : G1P1G1_MYOLU        1.00  1.00    1  339    2  340  339    0    0  340  G1P1G1     Uncharacterized protein OS=Myotis lucifugus GN=GNB1 PE=4 SV=1
    5 : G1QGZ6_NOMLE        1.00  1.00    1  339    2  340  339    0    0  340  G1QGZ6     Uncharacterized protein OS=Nomascus leucogenys GN=GNB1 PE=4 SV=1
    6 : G3TGH1_LOXAF        1.00  1.00    1  339    2  340  339    0    0  340  G3TGH1     Uncharacterized protein OS=Loxodonta africana GN=LOC100673391 PE=4 SV=1
    7 : G7NWS9_MACFA        1.00  1.00    1  339    2  340  339    0    0  340  G7NWS9     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_00128 PE=4 SV=1
    8 : GBB1_BOVIN  1XHM    1.00  1.00    1  339    2  340  339    0    0  340  P62871     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Bos taurus GN=GNB1 PE=1 SV=3
    9 : GBB1_CANFA          1.00  1.00    1  339    2  340  339    0    0  340  P62872     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Canis familiaris GN=GNB1 PE=2 SV=3
   10 : GBB1_HUMAN  1TBG    1.00  1.00    1  339    2  340  339    0    0  340  P62873     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Homo sapiens GN=GNB1 PE=1 SV=3
   11 : GBB1_RAT    3SN6    1.00  1.00    1  339    2  340  339    0    0  340  P54311     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Rattus norvegicus GN=Gnb1 PE=1 SV=4
   12 : GBG1_BOVIN  2TRC    1.00  1.00  341  405    2   66   65    0    0   74  P02698     Guanine nucleotide-binding protein G(T) subunit gamma-T1 OS=Bos taurus GN=GNGT1 PE=1 SV=2
   13 : H3BKR2_MOUSE        1.00  1.00    1  273    2  274  273    0    0  274  H3BKR2     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 (Fragment) OS=Mus musculus GN=Gnb1 PE=4 SV=1
   14 : K7CIH8_PANTR        1.00  1.00    1  339    2  340  339    0    0  340  K7CIH8     Guanine nucleotide binding protein (G protein), beta polypeptide 1 OS=Pan troglodytes GN=GNB1 PE=2 SV=1
   15 : K9IIE8_DESRO        1.00  1.00    1  339    2  340  339    0    0  340  K9IIE8     Putative g-protein beta subunit OS=Desmodus rotundus PE=2 SV=1
   16 : L8HQH7_9CETA        1.00  1.00  341  405    2   66   65    0    0   74  L8HQH7     Guanine nucleotide-binding protein subunit gamma OS=Bos mutus GN=M91_14199 PE=3 SV=1
   17 : M1ERZ7_MUSPF        1.00  1.00    1  338   11  348  338    0    0  348  M1ERZ7     Guanine nucleotide binding protein , beta polypeptide 1 (Fragment) OS=Mustela putorius furo PE=2 SV=1
   18 : Q3TQ70_MOUSE        1.00  1.00    1  339    2  340  339    0    0  340  Q3TQ70     Beta1 subnuit of GTP-binding protein OS=Mus musculus GN=Gnb1 PE=2 SV=1
   19 : B2R6K4_HUMAN        0.99  1.00    1  339    2  340  339    0    0  340  B2R6K4     cDNA, FLJ92996, highly similar to Homo sapiens guanine nucleotide binding protein (G protein), beta polypeptide 1 (GNB1), mRNA OS=Homo sapiens PE=2 SV=1
   20 : F6PVT7_MONDO        0.99  0.99    1  339    2  340  339    0    0  340  F6PVT7     Uncharacterized protein OS=Monodelphis domestica GN=GNB1 PE=4 SV=1
   21 : G3QVA4_GORGO        0.99  1.00   18  339    1  322  322    0    0  322  G3QVA4     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla GN=101154353 PE=4 SV=1
   22 : G3WGB1_SARHA        0.99  0.99    1  339    2  340  339    0    0  340  G3WGB1     Uncharacterized protein OS=Sarcophilus harrisii GN=GNB1 PE=4 SV=1
   23 : GBB1_CRIGR          0.99  0.99    1  339    2  340  339    0    0  340  Q6TMK6     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Cricetulus griseus GN=GNB1 PE=2 SV=3
   24 : H9EMX0_MACMU        0.99  1.00    1  339    2  340  339    0    0  340  H9EMX0     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Macaca mulatta GN=GNB1 PE=2 SV=1
   25 : Q3U1B1_MOUSE        0.99  1.00    1  339    2  340  339    0    0  340  Q3U1B1     Putative uncharacterized protein OS=Mus musculus GN=Gnb1 PE=2 SV=1
   26 : A5LG10_CYPCA        0.98  0.99    1  339    2  340  339    0    0  340  A5LG10     G-protein beta subunit 1 OS=Cyprinus carpio GN=Gbeta1 PE=2 SV=1
   27 : B3DLQ7_XENTR        0.98  0.99    1  339    2  340  339    0    0  340  B3DLQ7     LOC100170528 protein OS=Xenopus tropicalis GN=LOC100170528 PE=2 SV=1
   28 : D2H8V1_AILME        0.98  0.98  341  405    2   66   65    0    0   74  D2H8V1     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_006703 PE=3 SV=1
   29 : F1P2J5_CHICK        0.98  0.99    1  339    2  340  339    0    0  340  F1P2J5     Uncharacterized protein OS=Gallus gallus GN=GNB1 PE=4 SV=1
   30 : F7B1I8_HORSE        0.98  0.98  341  405    2   66   65    0    0   74  F7B1I8     Guanine nucleotide-binding protein subunit gamma OS=Equus caballus GN=GNGT1 PE=3 SV=1
   31 : F7CWN9_MACMU        0.98  0.98  341  405    2   66   65    0    0   89  F7CWN9     Guanine nucleotide-binding protein subunit gamma OS=Macaca mulatta GN=GNGT1 PE=3 SV=1
   32 : G1MHA4_AILME        0.98  0.98  341  405    3   67   65    0    0   75  G1MHA4     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=GNGT1 PE=3 SV=1
   33 : G1RZQ2_NOMLE        0.98  0.98  341  405    2   66   65    0    0   74  G1RZQ2     Guanine nucleotide-binding protein subunit gamma OS=Nomascus leucogenys GN=LOC100592009 PE=3 SV=1
   34 : G3RGF1_GORGO        0.98  0.98  341  405    4   68   65    0    0   76  G3RGF1     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Gorilla gorilla gorilla GN=101139212 PE=3 SV=1
   35 : G5ANK5_HETGA        0.98  0.98  341  405    2   66   65    0    0   74  G5ANK5     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_02184 PE=3 SV=1
   36 : G7MLV8_MACMU        0.98  0.98  341  405    2   66   65    0    0   74  G7MLV8     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Macaca mulatta GN=EGK_13933 PE=3 SV=1
   37 : G7P1D2_MACFA        0.98  0.98  341  405    2   66   65    0    0   74  G7P1D2     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Macaca fascicularis GN=EGM_12770 PE=3 SV=1
   38 : GBG1_CANFA          0.98  0.98  341  405    2   66   65    0    0   74  P63210     Guanine nucleotide-binding protein G(T) subunit gamma-T1 OS=Canis familiaris GN=GNGT1 PE=2 SV=2
   39 : GBG1_HUMAN          0.98  0.98  341  405    2   66   65    0    0   74  P63211     Guanine nucleotide-binding protein G(T) subunit gamma-T1 OS=Homo sapiens GN=GNGT1 PE=2 SV=2
   40 : H2PMW9_PONAB        0.98  0.98  341  405    2   66   65    0    0   74  H2PMW9     Guanine nucleotide-binding protein subunit gamma OS=Pongo abelii GN=GNGT1 PE=3 SV=1
   41 : H2QUX9_PANTR        0.98  0.98  341  405    2   66   65    0    0   74  H2QUX9     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNGT1 PE=3 SV=1
   42 : H2RNG1_TAKRU        0.98  0.99    1  339    2  340  339    0    0  340  H2RNG1     Uncharacterized protein OS=Takifugu rubripes GN=LOC101066479 PE=4 SV=1
   43 : K7FS67_PELSI        0.98  0.99    1  339    2  340  339    0    0  340  K7FS67     Uncharacterized protein OS=Pelodiscus sinensis GN=GNB1 PE=4 SV=1
   44 : M3WUX9_FELCA        0.98  0.98  341  405    2   66   65    0    0   74  M3WUX9     Guanine nucleotide-binding protein subunit gamma OS=Felis catus GN=GNGT1 PE=3 SV=1
   45 : M3XRD5_MUSPF        0.98  0.98  341  405    2   66   65    0    0   74  M3XRD5     Guanine nucleotide-binding protein subunit gamma OS=Mustela putorius furo GN=GNGT1 PE=3 SV=1
   46 : Q803H5_DANRE        0.98  0.99    1  339    2  340  339    0    0  340  Q803H5     Gnb1l protein OS=Danio rerio GN=gnb1b PE=2 SV=1
   47 : Q805B3_ORYLA        0.98  0.99    1  339    2  340  339    0    0  340  Q805B3     Guanine nucleotide-binding protein beta subunit OS=Oryzias latipes GN=Ol-Gb1 PE=2 SV=1
   48 : U3K477_FICAL        0.98  0.99    1  339    2  340  339    0    0  340  U3K477     Uncharacterized protein OS=Ficedula albicollis GN=GNB1 PE=4 SV=1
   49 : B5X1F5_SALSA        0.97  0.99    1  339    2  340  339    0    0  340  B5X1F5     Guanine nucleotide-binding protein GI/GS/GT subunit beta-1 OS=Salmo salar GN=GBB1 PE=2 SV=1
   50 : D6R719_HYPMO        0.97  0.99    1  339    2  340  339    0    0  340  D6R719     Guanine nucleotide-binding protein beta polypeptide 1 OS=Hypophthalmichthys molitrix PE=2 SV=1
   51 : F1SFB0_PIG          0.97  0.98  341  405    2   66   65    0    0   74  F1SFB0     Guanine nucleotide-binding protein subunit gamma OS=Sus scrofa GN=LOC100626889 PE=3 SV=1
   52 : G1TCV6_RABIT        0.97  0.98  341  405    2   66   65    0    0   74  G1TCV6     Guanine nucleotide-binding protein subunit gamma OS=Oryctolagus cuniculus GN=GNGT1 PE=3 SV=1
   53 : H0VCC3_CAVPO        0.97  0.98  341  405    2   66   65    0    0   74  H0VCC3     Guanine nucleotide-binding protein subunit gamma OS=Cavia porcellus GN=LOC100733904 PE=3 SV=1
   54 : L5KMI1_PTEAL        0.97  0.98  341  405    2   66   65    0    0   74  L5KMI1     Guanine nucleotide-binding protein subunit gamma OS=Pteropus alecto GN=PAL_GLEAN10021738 PE=3 SV=1
   55 : Q5ZL15_CHICK        0.97  0.99    1  325    2  326  325    0    0  404  Q5ZL15     Putative uncharacterized protein OS=Gallus gallus GN=RCJMB04_8d24 PE=2 SV=1
   56 : Q6DF33_XENTR        0.97  0.99    1  339    2  340  339    0    0  340  Q6DF33     Guanine nucleotide binding protein (G protein), beta polypeptide 2 OS=Xenopus tropicalis GN=gnb1 PE=2 SV=1
   57 : T1DKZ6_CROHD        0.97  0.99    1  339    2  340  339    0    0  340  T1DKZ6     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Crotalus horridus PE=2 SV=1
   58 : U3ESX1_MICFL        0.97  0.99    1  339    2  340  339    0    0  340  U3ESX1     Guanine nucleotide-binding protein subunit beta-1 OS=Micrurus fulvius PE=2 SV=1
   59 : S9WWT7_9CETA        0.96  0.99  444  595   29  180  152    0    0  195  S9WWT7     Phosducin OS=Camelus ferus GN=CB1_000818014 PE=4 SV=1
   60 : F6WMN3_CALJA        0.95  0.98  341  405    2   66   65    0    0   74  F6WMN3     Guanine nucleotide-binding protein subunit gamma OS=Callithrix jacchus GN=GNGT1 PE=3 SV=1
   61 : G3U0Q7_LOXAF        0.95  0.98  341  405    2   66   65    0    0   74  G3U0Q7     Guanine nucleotide-binding protein subunit gamma OS=Loxodonta africana GN=LOC100677258 PE=3 SV=1
   62 : GBG1_MOUSE          0.95  0.98  341  405    2   66   65    0    0   74  Q61012     Guanine nucleotide-binding protein G(T) subunit gamma-T1 OS=Mus musculus GN=Gngt1 PE=1 SV=3
   63 : H0WR88_OTOGA        0.95  0.97  341  405    2   66   65    0    0   74  H0WR88     Guanine nucleotide-binding protein subunit gamma OS=Otolemur garnettii GN=GNGT1 PE=3 SV=1
   64 : U3C6F8_CALJA        0.95  0.99    1  339    2  340  339    0    0  340  U3C6F8     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Callithrix jacchus GN=GNB1 PE=2 SV=1
   65 : F7I491_CALJA        0.93  0.98  436  595   19  178  160    0    0  195  F7I491     Uncharacterized protein OS=Callithrix jacchus GN=PDC PE=4 SV=1
   66 : D4AAI1_RAT          0.92  0.97  341  405    2   66   65    0    0   74  D4AAI1     Guanine nucleotide-binding protein subunit gamma OS=Rattus norvegicus GN=Gngt1 PE=3 SV=1
   67 : F7AR14_MACMU        0.92  0.99  436  595   19  178  160    0    0  194  F7AR14     Uncharacterized protein OS=Macaca mulatta GN=PDC PE=4 SV=1
   68 : G3GWV7_CRIGR        0.92  0.99  437  595    1  159  159    0    0  176  G3GWV7     Phosducin OS=Cricetulus griseus GN=I79_002242 PE=4 SV=1
   69 : L9JJ08_TUPCH        0.92  0.98  341  405    2   66   65    0    0   74  L9JJ08     Guanine nucleotide-binding protein subunit gamma OS=Tupaia chinensis GN=TREES_T100012334 PE=3 SV=1
   70 : R0JKQ1_ANAPL        0.92  0.98   32  339    1  308  308    0    0  308  R0JKQ1     Guanine nucleotide-binding protein subunit beta-4 (Fragment) OS=Anas platyrhynchos GN=Anapl_03219 PE=4 SV=1
   71 : D2GUD3_AILME        0.91  0.98   31  339    2  310  309    0    0  310  D2GUD3     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_000240 PE=4 SV=1
   72 : E1BW98_CHICK        0.91  0.99    1  339    2  340  339    0    0  340  E1BW98     Uncharacterized protein OS=Gallus gallus GN=GNB4 PE=4 SV=2
   73 : E2R2S8_CANFA        0.91  0.97    1  339    2  340  339    0    0  340  E2R2S8     Uncharacterized protein OS=Canis familiaris GN=GNB4 PE=4 SV=1
   74 : F2Z4Z8_PIG          0.91  0.96   31  339    1  309  309    0    0  309  F2Z4Z8     Uncharacterized protein (Fragment) OS=Sus scrofa GN=LOC100620305 PE=4 SV=2
   75 : F6S094_XENTR        0.91  0.98    1  339   47  385  339    0    0  385  F6S094     Uncharacterized protein OS=Xenopus tropicalis GN=gnb4 PE=4 SV=1
   76 : F6ZIZ9_MACMU        0.91  0.97    1  339    2  340  339    0    0  340  F6ZIZ9     Guanine nucleotide-binding protein subunit beta-4 OS=Macaca mulatta GN=GNB4 PE=2 SV=1
   77 : F7E427_ORNAN        0.91  0.98    1  339    2  340  339    0    0  340  F7E427     Uncharacterized protein OS=Ornithorhynchus anatinus GN=GNB4 PE=4 SV=1
   78 : G1LWF1_AILME        0.91  0.97    1  339    2  340  339    0    0  340  G1LWF1     Uncharacterized protein OS=Ailuropoda melanoleuca GN=GNB4 PE=4 SV=1
   79 : G1MU86_MELGA        0.91  0.98    1  339    2  341  340    1    1  341  G1MU86     Uncharacterized protein OS=Meleagris gallopavo GN=GNB4 PE=4 SV=2
   80 : GBB4_HUMAN          0.91  0.97    1  339    2  340  339    0    0  340  Q9HAV0     Guanine nucleotide-binding protein subunit beta-4 OS=Homo sapiens GN=GNB4 PE=1 SV=3
   81 : H2QNS5_PANTR        0.91  0.97    1  339    2  340  339    0    0  340  H2QNS5     Guanine nucleotide binding protein (G protein), beta polypeptide 4 OS=Pan troglodytes GN=GNB4 PE=2 SV=1
   82 : I3M5N1_SPETR        0.91  0.97   18  339    1  322  322    0    0  322  I3M5N1     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus GN=GNB4 PE=4 SV=1
   83 : I3MDZ6_SPETR        0.91  0.97  341  405    2   66   65    0    0   74  I3MDZ6     Guanine nucleotide-binding protein subunit gamma OS=Spermophilus tridecemlineatus GN=GNGT1 PE=3 SV=1
   84 : K7G2T1_PELSI        0.91  0.99    1  339    2  340  339    0    0  340  K7G2T1     Uncharacterized protein OS=Pelodiscus sinensis GN=GNB4 PE=4 SV=1
   85 : Q6GM38_XENLA        0.91  0.98    1  339    2  340  339    0    0  340  Q6GM38     MGC84000 protein OS=Xenopus laevis GN=MGC84000 PE=2 SV=1
   86 : U3FWV9_MICFL        0.91  0.98    1  339    2  340  339    0    0  340  U3FWV9     Guanine nucleotide-binding protein OS=Micrurus fulvius PE=2 SV=1
   87 : U3IXP6_ANAPL        0.91  0.98    1  339    2  341  340    1    1  341  U3IXP6     Uncharacterized protein OS=Anas platyrhynchos GN=GNB4 PE=4 SV=1
   88 : U3K127_FICAL        0.91  0.99    1  339    2  340  339    0    0  340  U3K127     Uncharacterized protein OS=Ficedula albicollis GN=GNB4 PE=4 SV=1
   89 : A5PKD6_BOVIN        0.90  0.97    1  339    2  340  339    0    0  340  A5PKD6     GNB4 protein OS=Bos taurus GN=GNB4 PE=2 SV=1
   90 : E2RD95_CANFA        0.90  0.97    1  339    2  340  339    0    0  340  E2RD95     Uncharacterized protein OS=Canis familiaris GN=GNB2 PE=4 SV=1
   91 : E9QKR0_MOUSE        0.90  0.97    1  339   44  382  339    0    0  382  E9QKR0     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 OS=Mus musculus GN=Gnb2 PE=4 SV=1
   92 : F6UCL7_HORSE        0.90  0.97    1  339    2  340  339    0    0  340  F6UCL7     Uncharacterized protein OS=Equus caballus GN=GNB4 PE=4 SV=1
   93 : F6WQ61_HORSE        0.90  0.97    1  339    2  340  339    0    0  340  F6WQ61     Uncharacterized protein OS=Equus caballus GN=GNB2 PE=4 SV=1
   94 : F6Y3N2_MONDO        0.90  0.97    1  339    2  340  339    0    0  340  F6Y3N2     Uncharacterized protein OS=Monodelphis domestica GN=GNB2 PE=4 SV=1
   95 : F7DRF8_CALJA        0.90  0.97    1  339    2  340  339    0    0  340  F7DRF8     Guanine nucleotide-binding protein subunit beta-4 OS=Callithrix jacchus GN=GNB4 PE=2 SV=1
   96 : F7G3J2_MONDO        0.90  0.98    1  339    2  340  339    0    0  340  F7G3J2     Uncharacterized protein OS=Monodelphis domestica GN=GNB4 PE=4 SV=1
   97 : F7GNL2_CALJA        0.90  0.97    1  339    2  340  339    0    0  340  F7GNL2     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 OS=Callithrix jacchus GN=GNB2 PE=2 SV=1
   98 : G1P7S2_MYOLU        0.90  0.97    1  339    2  340  339    0    0  340  G1P7S2     Uncharacterized protein OS=Myotis lucifugus GN=GNB2 PE=4 SV=1
   99 : G3W3Y2_SARHA        0.90  0.97    1  339    2  340  339    0    0  340  G3W3Y2     Uncharacterized protein OS=Sarcophilus harrisii GN=GNB2 PE=4 SV=1
  100 : GBB2_BOVIN          0.90  0.97    1  339    2  340  339    0    0  340  P11017     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 OS=Bos taurus GN=GNB2 PE=2 SV=3
  101 : GBB2_HUMAN          0.90  0.97    1  339    2  340  339    0    0  340  P62879     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 OS=Homo sapiens GN=GNB2 PE=1 SV=3
  102 : GBB4_RAT            0.90  0.97    1  339    2  340  339    0    0  340  O35353     Guanine nucleotide-binding protein subunit beta-4 OS=Rattus norvegicus GN=Gnb4 PE=2 SV=4
  103 : H0VZ49_CAVPO        0.90  0.97    1  339   33  371  339    0    0  371  H0VZ49     Uncharacterized protein (Fragment) OS=Cavia porcellus GN=LOC100718398 PE=4 SV=1
  104 : H2QV39_PANTR        0.90  0.97    1  339    2  340  339    0    0  340  H2QV39     Guanine nucleotide binding protein (G protein), beta polypeptide 2 OS=Pan troglodytes GN=GNB2 PE=2 SV=1
  105 : I3IZQ2_ORENI        0.90  0.98    1  339    2  340  339    0    0  340  I3IZQ2     Uncharacterized protein OS=Oreochromis niloticus GN=gnb4 PE=4 SV=1
  106 : I3MSE8_SPETR        0.90  0.97    7  339    2  334  333    0    0  334  I3MSE8     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus GN=GNB2 PE=4 SV=1
  107 : I7G5A5_MACFA        0.90  0.96    1  339    2  340  339    0    0  340  I7G5A5     Macaca fascicularis brain cDNA clone: QflA-17132, similar to human guanine nucleotide binding protein (G protein), betapolypeptide 2 (GNB2), mRNA, RefSeq: NM_005273.2 OS=Macaca fascicularis PE=2 SV=1
  108 : L8IQ29_9CETA        0.90  0.97    1  339    2  340  339    0    0  340  L8IQ29     Guanine nucleotide-binding protein subunit beta-4 OS=Bos mutus GN=M91_09229 PE=4 SV=1
  109 : L8IRX4_9CETA        0.90  0.97    9  339    1  331  331    0    0  331  L8IRX4     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 (Fragment) OS=Bos mutus GN=M91_01946 PE=4 SV=1
  110 : Q3U9V4_MOUSE        0.90  0.97    1  339    2  340  339    0    0  340  Q3U9V4     Guanine nucleotide binding protein, beta 2, isoform CRA_a OS=Mus musculus GN=Gnb2 PE=2 SV=1
  111 : Q45QL2_RAT          0.90  0.97   12  326    1  315  315    0    0  315  Q45QL2     Guanine nucleotide binding protein beta 4 (Fragment) OS=Rattus norvegicus GN=Gnb4 PE=2 SV=1
  112 : Q52LP8_HUMAN        0.90  0.96  431  595   22  185  164    0    0  201  Q52LP8     PDC protein (Fragment) OS=Homo sapiens GN=PDC PE=2 SV=1
  113 : Q6FHM2_HUMAN        0.90  0.97    1  339    2  340  339    0    0  340  Q6FHM2     GNB2 protein OS=Homo sapiens GN=GNB2 PE=2 SV=1
  114 : S7NEA9_MYOBR        0.90  0.97    1  339    2  340  339    0    0  340  S7NEA9     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 OS=Myotis brandtii GN=D623_10015176 PE=4 SV=1
  115 : S9WJ52_9CETA        0.90  0.97    1  339    2  340  339    0    0  340  S9WJ52     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 isoform 1 OS=Camelus ferus GN=CB1_001052004 PE=4 SV=1
  116 : S9XJL5_9CETA        0.90  0.97   19  339    1  321  321    0    0  321  S9XJL5     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 isoform 1 (Fragment) OS=Camelus ferus GN=CB1_001685001 PE=4 SV=1
  117 : V8P2E0_OPHHA        0.90  0.98    1  339    2  340  339    0    0  340  V8P2E0     Guanine nucleotide-binding protein subunit beta-4 OS=Ophiophagus hannah GN=GNB4 PE=4 SV=1
  118 : D2HX06_AILME        0.89  0.96    1  339    2  340  339    0    0  340  D2HX06     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=LOC100484553 PE=4 SV=1
  119 : E2RRE2_CANFA        0.89  0.96    1  306    2  307  306    0    0  344  E2RRE2     Uncharacterized protein OS=Canis familiaris GN=GNB2 PE=4 SV=1
  120 : G1P9Q0_MYOLU        0.89  0.97    1  339    2  340  339    0    0  340  G1P9Q0     Uncharacterized protein OS=Myotis lucifugus GN=GNB4 PE=4 SV=1
  121 : G3VNJ5_SARHA        0.89  0.95  341  405    2   66   65    0    0   74  G3VNJ5     Guanine nucleotide-binding protein subunit gamma OS=Sarcophilus harrisii GN=GNGT1 PE=3 SV=1
  122 : GBB4_MOUSE          0.89  0.97    1  339    2  340  339    0    0  340  P29387     Guanine nucleotide-binding protein subunit beta-4 OS=Mus musculus GN=Gnb4 PE=2 SV=4
  123 : H2LML7_ORYLA        0.89  0.97    1  339    2  340  339    0    0  340  H2LML7     Uncharacterized protein OS=Oryzias latipes GN=LOC101157764 PE=4 SV=1
  124 : H2PLP5_PONAB        0.89  0.96    1  339    2  340  339    0    0  340  H2PLP5     Uncharacterized protein OS=Pongo abelii GN=GNB2 PE=4 SV=1
  125 : H2UY24_TAKRU        0.89  0.97    1  339    2  340  339    0    0  340  H2UY24     Uncharacterized protein OS=Takifugu rubripes GN=LOC101066891 PE=4 SV=1
  126 : H2V772_TAKRU        0.89  0.98    1  339    2  340  339    0    0  340  H2V772     Uncharacterized protein OS=Takifugu rubripes GN=LOC101066063 PE=4 SV=1
  127 : L5LTY7_MYODS        0.89  0.97   17  339    1  323  323    0    0  323  L5LTY7     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 (Fragment) OS=Myotis davidii GN=MDA_GLEAN10005711 PE=4 SV=1
  128 : Q3THF3_MOUSE        0.89  0.97    1  339    2  340  339    0    0  340  Q3THF3     Putative uncharacterized protein OS=Mus musculus GN=Gnb4 PE=2 SV=1
  129 : Q3U2F9_MOUSE        0.89  0.97    1  339    2  340  339    0    0  340  Q3U2F9     Putative uncharacterized protein OS=Mus musculus GN=Gnb4 PE=2 SV=1
  130 : Q45QL6_RAT          0.89  0.97    3  321    1  319  319    0    0  319  Q45QL6     Guanine nucleotide binding protein beta 2 (Fragment) OS=Rattus norvegicus GN=Gnb2 PE=2 SV=1
  131 : C3ZSF0_BRAFL        0.88  0.96    1  339    3  341  339    0    0  341  C3ZSF0     Putative uncharacterized protein OS=Branchiostoma floridae GN=BRAFLDRAFT_220697 PE=4 SV=1
  132 : E9FUX0_DAPPU        0.88  0.95    1  339    2  340  339    0    0  340  E9FUX0     Guanine nucleotide binding protein, beta subunit OS=Daphnia pulex GN=Gnb1 PE=4 SV=1
  133 : H2LUY6_ORYLA        0.88  0.96    1  339    2  340  339    0    0  340  H2LUY6     Uncharacterized protein OS=Oryzias latipes GN=LOC101175500 PE=4 SV=1
  134 : H2WKU2_CAEJA        0.88  0.96   44  339    1  296  296    0    0  296  H2WKU2     Uncharacterized protein OS=Caenorhabditis japonica GN=WBGene00136241 PE=4 SV=2
  135 : M4AC83_XIPMA        0.88  0.97    1  339    2  340  339    0    0  340  M4AC83     Uncharacterized protein OS=Xiphophorus maculatus PE=4 SV=1
  136 : M7BKJ4_CHEMY        0.88  0.94    1  339    2  327  339    1   13  327  M7BKJ4     Guanine nucleotide-binding protein subunit beta-4 OS=Chelonia mydas GN=UY3_04385 PE=4 SV=1
  137 : R7TXX3_CAPTE        0.88  0.96    1  339    3  341  339    0    0  341  R7TXX3     Uncharacterized protein OS=Capitella teleta GN=CAPTEDRAFT_124853 PE=4 SV=1
  138 : A4IH33_XENTR        0.87  0.94    1  339    2  327  339    1   13  327  A4IH33     LOC549706 protein OS=Xenopus tropicalis GN=LOC549706 PE=2 SV=1
  139 : E2C0R0_HARSA        0.87  0.95   21  339   11  329  319    0    0  329  E2C0R0     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Harpegnathos saltator GN=EAI_13326 PE=4 SV=1
  140 : G3MLA0_9ACAR        0.87  0.95    1  339    2  340  339    0    0  340  G3MLA0     Putative uncharacterized protein OS=Amblyomma maculatum PE=2 SV=1
  141 : M3YW85_MUSPF        0.87  0.95    1  339    2  340  339    0    0  340  M3YW85     Uncharacterized protein OS=Mustela putorius furo GN=GNB2 PE=4 SV=1
  142 : T1IVE1_STRMM        0.87  0.95    1  339    2  340  339    0    0  340  T1IVE1     Uncharacterized protein OS=Strigamia maritima PE=4 SV=1
  143 : T1KY37_TETUR        0.87  0.95    1  339    2  341  340    1    1  341  T1KY37     Uncharacterized protein OS=Tetranychus urticae PE=4 SV=1
  144 : E0VYY5_PEDHC        0.86  0.94    1  339    2  344  343    1    4  344  E0VYY5     Guanine nucleotide-binding protein G, subunit beta, putative OS=Pediculus humanus subsp. corporis GN=Phum_PHUM521670 PE=4 SV=1
  145 : E3LFW0_CAERE        0.86  0.96    1  339    2  340  339    0    0  340  E3LFW0     CRE-GPB-1 protein OS=Caenorhabditis remanei GN=Cre-gpb-1 PE=4 SV=1
  146 : E5S1K6_TRISP        0.86  0.95    1  339    2  340  339    0    0  340  E5S1K6     Guanine nucleotide-binding protein subunit beta-1 OS=Trichinella spiralis GN=Tsp_02729 PE=4 SV=1
  147 : F1MSE1_BOVIN        0.86  0.86  407  595   13  230  218    1   30  245  F1MSE1     Phosducin OS=Bos taurus GN=PDC PE=4 SV=2
  148 : GBB1_CAEBR          0.86  0.96    1  339    2  340  339    0    0  340  Q61ZF6     Guanine nucleotide-binding protein subunit beta-1 OS=Caenorhabditis briggsae GN=gpb-1 PE=3 SV=1
  149 : GBB1_CAEEL          0.86  0.96    1  339    2  340  339    0    0  340  P17343     Guanine nucleotide-binding protein subunit beta-1 OS=Caenorhabditis elegans GN=gpb-1 PE=2 SV=2
  150 : GBB1_HOMAM          0.86  0.94    1  339    2  340  339    0    0  340  O45040     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Homarus americanus GN=GBETA1 PE=2 SV=1
  151 : GBB_PINFU           0.86  0.96    1  339    3  341  339    0    0  341  Q5GIS3     Guanine nucleotide-binding protein subunit beta OS=Pinctada fucata PE=1 SV=1
  152 : H3DDM6_TETNG        0.86  0.95    1  339    2  330  339    1   10  330  H3DDM6     Uncharacterized protein OS=Tetraodon nigroviridis PE=4 SV=1
  153 : H9C3G7_SCYPA        0.86  0.94    1  339    2  340  339    0    0  340  H9C3G7     G protein beta 1 OS=Scylla paramamosain PE=2 SV=1
  154 : J0DLW1_LOALO        0.86  0.96    1  339    2  340  339    0    0  340  J0DLW1     Guanine nucleotide-binding protein subunit beta-1 OS=Loa loa GN=LOAG_18194 PE=4 SV=1
  155 : PHOS_BOVIN  1A0R    0.86  0.86  407  595   13  230  218    1   30  245  P19632     Phosducin OS=Bos taurus GN=PDC PE=1 SV=2
  156 : Q86LH8_9HEMI        0.86  0.94    1  339    2  340  339    0    0  340  Q86LH8     Heterotrimeric guanine nucleotide-binding protein beta subunit OS=Sitobion avenae PE=2 SV=1
  157 : U6HDU0_ECHMU        0.86  0.94    1  339    2  340  339    0    0  340  U6HDU0     Guanine nucleotide binding protein subunit OS=Echinococcus multilocularis GN=EmuJ_000200300 PE=4 SV=1
  158 : U6J769_ECHGR        0.86  0.94    1  339    2  340  339    0    0  340  U6J769     Guanine nucleotide binding protein subunit OS=Echinococcus granulosus GN=EgrG_000200300 PE=4 SV=1
  159 : A1YWY1_9HYME        0.85  0.94    1  339    2  340  339    0    0  340  A1YWY1     Guanine nucleotide-binding protein subunit beta-like OS=Microplitis mediator PE=2 SV=1
  160 : A4IIB5_XENTR        0.85  0.94  341  405    2   66   65    0    0   73  A4IIB5     Guanine nucleotide-binding protein subunit gamma OS=Xenopus tropicalis GN=gngt1 PE=3 SV=1
  161 : B0XB74_CULQU        0.85  0.94    1  336    2  337  336    0    0  339  B0XB74     Putative uncharacterized protein OS=Culex quinquefasciatus GN=CpipJ_CPIJ016404 PE=4 SV=1
  162 : E3XAX7_ANODA        0.85  0.94    1  339    2  340  339    0    0  340  E3XAX7     Uncharacterized protein OS=Anopheles darlingi GN=AND_18300 PE=4 SV=1
  163 : F6RKF1_XENTR        0.85  0.94  341  405   22   86   65    0    0   93  F6RKF1     Guanine nucleotide-binding protein subunit gamma OS=Xenopus tropicalis GN=gngt1 PE=3 SV=1
  164 : H2ZX79_LATCH        0.85  0.94  341  405    2   66   65    0    0   73  H2ZX79     Guanine nucleotide-binding protein subunit gamma OS=Latimeria chalumnae GN=GNG11 PE=3 SV=1
  165 : H9J536_BOMMO        0.85  0.94    1  339    2  340  339    0    0  340  H9J536     Uncharacterized protein OS=Bombyx mori GN=LOC733012 PE=4 SV=1
  166 : L8INY5_9CETA        0.85  0.85  407  595   16  233  218    1   30  248  L8INY5     Phosducin (Fragment) OS=Bos mutus GN=M91_16525 PE=4 SV=1
  167 : Q16HK0_AEDAE        0.85  0.95    1  339    2  340  339    0    0  340  Q16HK0     AAEL013997-PA OS=Aedes aegypti GN=AAEL013997 PE=4 SV=1
  168 : Q5DB16_SCHJA        0.85  0.95    1  339    2  340  339    0    0  340  Q5DB16     SJCHGC05537 protein OS=Schistosoma japonicum PE=2 SV=1
  169 : T1G222_HELRO        0.85  0.96    1  339    2  340  339    0    0  340  T1G222     Uncharacterized protein OS=Helobdella robusta GN=HELRODRAFT_75178 PE=4 SV=1
  170 : B3RZG6_TRIAD        0.84  0.94    1  339    2  341  340    1    1  341  B3RZG6     G protein beta 1 subunit OS=Trichoplax adhaerens GN=TRIADDRAFT_64010 PE=4 SV=1
  171 : GBB_LYMST           0.84  0.94    1  339    3  341  339    0    0  341  Q08706     Guanine nucleotide-binding protein subunit beta OS=Lymnaea stagnalis PE=2 SV=1
  172 : K7G6E1_PELSI        0.84  0.96    1  339    2  340  339    0    0  340  K7G6E1     Uncharacterized protein OS=Pelodiscus sinensis GN=GNB3 PE=4 SV=1
  173 : M1MER8_BEMTA        0.84  0.93    1  339    2  340  339    0    0  340  M1MER8     Heterotrimeric guanine nucleotide-binding protein beta subunit OS=Bemisia tabaci PE=2 SV=1
  174 : Q1HPN1_BOMMO        0.84  0.94    1  339    2  340  339    0    0  340  Q1HPN1     Heterotrimeric guanine nucleotide-binding protein beta subunit OS=Bombyx mori PE=2 SV=1
  175 : Q45QL4_RAT          0.84  0.95   28  339    2  313  312    0    0  313  Q45QL4     Guanine nucleotide binding protein beta 3 (Fragment) OS=Rattus norvegicus GN=Gnb3 PE=2 SV=1
  176 : Q7SZU2_XENLA        0.84  0.94    1  339    2  340  339    0    0  340  Q7SZU2     Gnb3 protein OS=Xenopus laevis GN=gnb3 PE=2 SV=1
  177 : T2M4N6_HYDVU        0.84  0.93   19  336    1  319  319    1    1  329  T2M4N6     Guanine nucleotide-binding protein subunit beta-4 (Fragment) OS=Hydra vulgaris GN=GNB4 PE=2 SV=1
  178 : U3I6C4_ANAPL        0.84  0.96    1  339    2  340  339    0    0  340  U3I6C4     Uncharacterized protein OS=Anas platyrhynchos GN=GNB3 PE=4 SV=1
  179 : B3NXI4_DROER        0.83  0.94    1  339    2  340  339    0    0  340  B3NXI4     GG17923 OS=Drosophila erecta GN=Dere\GG17923 PE=4 SV=1
  180 : B4JLK7_DROGR        0.83  0.93    1  339    2  340  339    0    0  340  B4JLK7     GH12882 OS=Drosophila grimshawi GN=Dgri\GH12882 PE=4 SV=1
  181 : B4NPG5_DROWI        0.83  0.94    1  339    2  340  339    0    0  340  B4NPG5     GK15234 OS=Drosophila willistoni GN=Dwil\GK15234 PE=4 SV=1
  182 : B4R5I9_DROSI        0.83  0.94    1  339    2  340  339    0    0  340  B4R5I9     GD17247 OS=Drosophila simulans GN=Dsim\GD17247 PE=4 SV=1
  183 : B5DSF9_DROPS        0.83  0.93    1  339    2  340  339    0    0  340  B5DSF9     GA23154 OS=Drosophila pseudoobscura pseudoobscura GN=Dpse\GA23154 PE=4 SV=1
  184 : C1C3S0_LITCT        0.83  0.89  341  405    2   66   65    0    0   73  C1C3S0     Guanine nucleotide-binding protein subunit gamma OS=Lithobates catesbeiana GN=GBG1 PE=3 SV=1
  185 : D2HJ08_AILME        0.83  0.95   31  339    1  309  309    0    0  309  D2HJ08     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_011250 PE=4 SV=1
  186 : D4A752_RAT          0.83  0.92    1  339    2  337  339    1    3  337  D4A752     Guanine nucleotide-binding protein subunit beta-4 OS=Rattus norvegicus GN=Gnb4 PE=4 SV=2
  187 : E1BB14_BOVIN        0.83  0.95    1  339    2  340  339    0    0  340  E1BB14     Uncharacterized protein OS=Bos taurus GN=GNB3 PE=4 SV=1
  188 : E9PCP0_HUMAN        0.83  0.95    1  339    2  339  339    1    1  339  E9PCP0     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Homo sapiens GN=GNB3 PE=4 SV=2
  189 : F1S2Z8_PIG          0.83  0.85  407  595   14  231  218    1   30  246  F1S2Z8     Uncharacterized protein (Fragment) OS=Sus scrofa GN=PDC PE=4 SV=2
  190 : F1T0G4_HUMAN        0.83  0.95    1  339    2  340  339    0    0  340  F1T0G4     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Homo sapiens GN=GNB3 PE=2 SV=1
  191 : F6SJT1_HORSE        0.83  0.95    1  339    2  340  339    0    0  340  F6SJT1     Uncharacterized protein OS=Equus caballus GN=GNB3 PE=4 SV=1
  192 : F7CTP1_MACMU        0.83  0.95    1  339    2  340  339    0    0  340  F7CTP1     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Macaca mulatta GN=GNB3 PE=2 SV=1
  193 : G1P7P1_MYOLU        0.83  0.96    1  339    2  340  339    0    0  340  G1P7P1     Uncharacterized protein OS=Myotis lucifugus GN=GNB3 PE=4 SV=1
  194 : G7PJN5_MACFA        0.83  0.95    1  339    2  340  339    0    0  340  G7PJN5     Transducin beta chain 3 OS=Macaca fascicularis GN=EGM_02917 PE=4 SV=1
  195 : G9F6Y0_PIG          0.83  0.85  407  595    8  225  218    1   30  240  G9F6Y0     Phosducin (Fragment) OS=Sus scrofa PE=2 SV=1
  196 : GBB1_DROME          0.83  0.94    1  339    2  340  339    0    0  340  P26308     Guanine nucleotide-binding protein subunit beta-1 OS=Drosophila melanogaster GN=Gbeta13F PE=1 SV=1
  197 : GBB3_HUMAN          0.83  0.95    1  339    2  340  339    0    0  340  P16520     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Homo sapiens GN=GNB3 PE=1 SV=1
  198 : GBB3_RAT            0.83  0.95    1  339    2  340  339    0    0  340  P52287     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Rattus norvegicus GN=Gnb3 PE=1 SV=1
  199 : H0XUC3_OTOGA        0.83  0.95    1  339    2  340  339    0    0  340  H0XUC3     Uncharacterized protein OS=Otolemur garnettii GN=GNB3 PE=4 SV=1
  200 : H2NGA0_PONAB        0.83  0.95    1  339    2  340  339    0    0  340  H2NGA0     Uncharacterized protein OS=Pongo abelii GN=GNB3 PE=4 SV=1
  201 : Q17MH7_AEDAE        0.83  0.95    1  339    2  340  339    0    0  340  Q17MH7     AAEL001041-PA OS=Aedes aegypti GN=AAEL001041 PE=4 SV=1
  202 : Q54AE3_MOUSE        0.83  0.95    1  339    2  340  339    0    0  340  Q54AE3     GTP-binding protein beta3 subunit OS=Mus musculus GN=Gnb3 PE=4 SV=1
  203 : Q7Q6D2_ANOGA        0.83  0.94    1  339    2  340  339    0    0  340  Q7Q6D2     AGAP005913-PA OS=Anopheles gambiae GN=AGAP005913 PE=4 SV=3
  204 : S7PUS2_MYOBR        0.83  0.96    1  339    2  340  339    0    0  340  S7PUS2     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Myotis brandtii GN=D623_10009381 PE=4 SV=1
  205 : U3FSB2_CALJA        0.83  0.95    1  339    2  340  339    0    0  340  U3FSB2     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Callithrix jacchus GN=GNB3 PE=2 SV=1
  206 : A9UHL9_CANFA        0.82  0.96    1  339    2  340  339    0    0  340  A9UHL9     GTP-binding protein beta-3 subunit OS=Canis familiaris GN=GNB3 PE=2 SV=1
  207 : F1P8Q5_CANFA        0.82  0.95    1  339    2  340  339    0    0  340  F1P8Q5     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Canis familiaris GN=GNB3 PE=4 SV=1
  208 : L5M977_MYODS        0.82  0.96    1  339    2  340  339    0    0  340  L5M977     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Myotis davidii GN=MDA_GLEAN10016032 PE=4 SV=1
  209 : M3WGT4_FELCA        0.82  0.95    1  339    2  340  339    0    0  340  M3WGT4     Uncharacterized protein OS=Felis catus GN=GNB3 PE=4 SV=1
  210 : M3YZB8_MUSPF        0.82  0.95    1  339    6  344  339    0    0  344  M3YZB8     Uncharacterized protein (Fragment) OS=Mustela putorius furo GN=GNB3 PE=4 SV=1
  211 : Q6GLQ2_XENLA        0.82  0.92  341  405    2   66   65    0    0   73  Q6GLQ2     Guanine nucleotide-binding protein subunit gamma OS=Xenopus laevis GN=gngt1 PE=3 SV=1
  212 : F6W5B8_HORSE        0.81  0.85  407  595   18  235  218    1   30  250  F6W5B8     Phosducin (Fragment) OS=Equus caballus GN=PDC PE=4 SV=1
  213 : H0WIZ9_OTOGA        0.81  0.85  407  595   13  230  218    1   30  246  H0WIZ9     Uncharacterized protein OS=Otolemur garnettii GN=PDC PE=4 SV=1
  214 : H0ZSU7_TAEGU        0.81  0.95    1  339    2  340  339    0    0  340  H0ZSU7     Uncharacterized protein OS=Taeniopygia guttata GN=GNB3 PE=4 SV=1
  215 : H9GAL1_ANOCA        0.81  0.95    1  339    2  340  339    0    0  340  H9GAL1     Uncharacterized protein OS=Anolis carolinensis GN=GNB3 PE=4 SV=1
  216 : L5KYA3_PTEAL        0.81  0.85  407  595   13  230  218    1   30  245  L5KYA3     Phosducin OS=Pteropus alecto GN=PAL_GLEAN10017648 PE=4 SV=1
  217 : M7AMP4_CHEMY        0.81  0.92    1  339   12  350  339    0    0  350  M7AMP4     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Chelonia mydas GN=UY3_16430 PE=4 SV=1
  218 : PHOS_HORSE          0.81  0.85  407  595   13  230  218    1   30  245  Q9XS39     Phosducin OS=Equus caballus GN=PDC PE=2 SV=1
  219 : Q4SC83_TETNG        0.81  0.84    1  339    2  296  339    1   44  296  Q4SC83     Chromosome undetermined SCAF14659, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00020620001 PE=4 SV=1
  220 : U3JQ32_FICAL        0.81  0.96    1  339    2  340  339    0    0  340  U3JQ32     Uncharacterized protein OS=Ficedula albicollis GN=GNB3 PE=4 SV=1
  221 : D2HQU6_AILME        0.80  0.85  415  595    1  210  210    1   30  223  D2HQU6     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_014298 PE=4 SV=1
  222 : E4YGD2_OIKDI        0.80  0.94   12  339   51  378  328    0    0  378  E4YGD2     Whole genome shotgun assembly, allelic scaffold set, scaffold scaffoldA_246 OS=Oikopleura dioica GN=GSOID_T00024583001 PE=4 SV=1
  223 : E4YK89_OIKDI        0.80  0.94   12  339   47  374  328    0    0  374  E4YK89     Whole genome shotgun assembly, allelic scaffold set, scaffold scaffoldA_420 OS=Oikopleura dioica GN=GSOID_T00028373001 PE=4 SV=1
  224 : E4YNW6_OIKDI        0.80  0.94   12  339   60  387  328    0    0  387  E4YNW6     Whole genome shotgun assembly, allelic scaffold set, scaffold scaffoldA_638 OS=Oikopleura dioica GN=GSOID_T00030243001 PE=4 SV=1
  225 : F7AW67_CIOIN        0.80  0.94    2  339   10  347  338    0    0  347  F7AW67     Uncharacterized protein OS=Ciona intestinalis GN=LOC100182745 PE=4 SV=1
  226 : G1MAK0_AILME        0.80  0.85  407  595   15  232  218    1   30  247  G1MAK0     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PDC PE=4 SV=1
  227 : G1SRP6_RABIT        0.80  0.85  407  595   37  254  218    1   30  269  G1SRP6     Uncharacterized protein OS=Oryctolagus cuniculus GN=PDC PE=4 SV=2
  228 : G3TD87_LOXAF        0.80  0.85  407  595   13  230  218    1   30  246  G3TD87     Uncharacterized protein OS=Loxodonta africana GN=LOC100666643 PE=4 SV=1
  229 : H0YTE8_TAEGU        0.80  0.92  341  405    2   66   65    0    0   73  H0YTE8     Guanine nucleotide-binding protein subunit gamma OS=Taeniopygia guttata GN=GNGT1 PE=3 SV=1
  230 : H2ZC25_CIOSA        0.80  0.93    2  339   10  347  338    0    0  347  H2ZC25     Uncharacterized protein OS=Ciona savignyi GN=Csa.10536 PE=4 SV=1
  231 : M3YKX8_MUSPF        0.80  0.84  415  595    1  210  210    1   30  225  M3YKX8     Uncharacterized protein (Fragment) OS=Mustela putorius furo GN=PDC PE=4 SV=1
  232 : PHOS_CANFA          0.80  0.85  407  595   13  230  218    1   30  245  O77560     Phosducin OS=Canis familiaris GN=PDC PE=1 SV=2
  233 : PHOS_FELCA          0.80  0.84  407  595   13  230  218    1   30  245  P41686     Phosducin OS=Felis catus GN=PDC PE=2 SV=1
  234 : V8NFD7_OPHHA        0.80  0.92  341  405   16   80   65    0    0   87  V8NFD7     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11 (Fragment) OS=Ophiophagus hannah GN=GNG11 PE=4 SV=1
  235 : F7EQ61_MACMU        0.79  0.84  407  595   13  230  218    1   30  246  F7EQ61     Uncharacterized protein OS=Macaca mulatta GN=PDC PE=4 SV=1
  236 : F7I487_CALJA        0.79  0.84  407  595   21  238  218    1   30  255  F7I487     Uncharacterized protein (Fragment) OS=Callithrix jacchus GN=PDC PE=4 SV=1
  237 : G1PM46_MYOLU        0.79  0.84  407  595   21  238  218    1   30  253  G1PM46     Uncharacterized protein (Fragment) OS=Myotis lucifugus GN=PDC PE=4 SV=1
  238 : G1S8S6_NOMLE        0.79  0.84  407  595   13  230  218    1   30  246  G1S8S6     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100590520 PE=4 SV=1
  239 : G3I1D1_CRIGR        0.79  0.87    1  339    2  364  363    2   24  364  G3I1D1     Guanine nucleotide-binding protein subunit beta-4 OS=Cricetulus griseus GN=I79_017184 PE=4 SV=1
  240 : G3QIK9_GORGO        0.79  0.83  415  595    1  210  210    1   30  226  G3QIK9     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla GN=101144893 PE=4 SV=1
  241 : G3SAB6_GORGO        0.79  0.84  407  595   21  238  218    1   30  254  G3SAB6     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla GN=101146333 PE=4 SV=1
  242 : G7NXE9_MACFA        0.79  0.84  407  595   13  230  218    1   30  246  G7NXE9     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_01583 PE=4 SV=1
  243 : H2Q0S8_PANTR        0.79  0.84  407  595   13  230  218    1   30  246  H2Q0S8     Uncharacterized protein OS=Pan troglodytes GN=PDC PE=4 SV=1
  244 : I3N2Z0_SPETR        0.79  0.85  407  595   13  228  216    1   28  244  I3N2Z0     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=PDC PE=4 SV=1
  245 : L8Y0K2_TUPCH        0.79  0.92    1  316    2  317  316    0    0  342  L8Y0K2     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Tupaia chinensis GN=TREES_T100008262 PE=4 SV=1
  246 : S7PFB1_MYOBR        0.79  0.84  407  595   18  235  218    1   30  250  S7PFB1     Phosducin (Fragment) OS=Myotis brandtii GN=D623_10007709 PE=4 SV=1
  247 : G5C6C0_HETGA        0.78  0.85  407  595   20  236  217    1   29  251  G5C6C0     Phosducin (Fragment) OS=Heterocephalus glaber GN=GW7_07101 PE=4 SV=1
  248 : H0UT17_CAVPO        0.78  0.83  407  595   13  230  218    1   30  243  H0UT17     Uncharacterized protein OS=Cavia porcellus GN=LOC100718138 PE=4 SV=1
  249 : K7G6N0_PELSI        0.78  0.92  341  405    2   66   65    0    0   73  K7G6N0     Guanine nucleotide-binding protein subunit gamma OS=Pelodiscus sinensis GN=GNG11 PE=3 SV=1
  250 : L5LBP8_MYODS        0.78  0.84  407  595   13  230  218    1   30  245  L5LBP8     Phosducin OS=Myotis davidii GN=MDA_GLEAN10017474 PE=4 SV=1
  251 : PHOS_HUMAN          0.78  0.83  407  595   13  230  218    1   30  246  P20941     Phosducin OS=Homo sapiens GN=PDC PE=1 SV=1
  252 : PHOS_MOUSE          0.78  0.85  407  595   13  228  216    1   28  244  Q9QW08     Phosducin OS=Mus musculus GN=Pdc PE=2 SV=1
  253 : Q9UP23_HUMAN        0.78  0.83  407  595   50  267  218    1   30  283  Q9UP23     PhLP1 OS=Homo sapiens PE=2 SV=1
  254 : G1PXJ8_MYOLU        0.77  0.92  342  405    3   66   64    0    0   73  G1PXJ8     Guanine nucleotide-binding protein subunit gamma OS=Myotis lucifugus PE=3 SV=1
  255 : PHOS_RAT    2TRC    0.77  0.84  407  595   13  230  218    1   30  246  P20942     Phosducin OS=Rattus norvegicus GN=Pdc PE=1 SV=1
  256 : Q4RU65_TETNG        0.77  0.85    1  339    2  332  358    2   46  332  Q4RU65     Chromosome 1 SCAF14995, whole genome shotgun sequence OS=Tetraodon nigroviridis GN=GSTENG00028934001 PE=4 SV=1
  257 : F6YE86_MONDO        0.76  0.84  407  595   20  237  218    1   30  253  F6YE86     Uncharacterized protein OS=Monodelphis domestica GN=PDC PE=4 SV=2
  258 : G3WSQ3_SARHA        0.76  0.84  407  595   21  237  217    1   29  253  G3WSQ3     Uncharacterized protein (Fragment) OS=Sarcophilus harrisii GN=PDC PE=4 SV=1
  259 : B6V716_SHEEP        0.75  0.91  341  405    2   66   65    0    0   73  B6V716     Guanine nucleotide-binding protein subunit gamma OS=Ovis aries GN=GNG11 PE=3 SV=1
  260 : D2H8V0_AILME        0.75  0.91  341  405    2   66   65    0    0   73  D2H8V0     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=LOC100475394 PE=3 SV=1
  261 : E2RBE7_CANFA        0.75  0.91  341  405    2   66   65    0    0   73  E2RBE7     Guanine nucleotide-binding protein subunit gamma OS=Canis familiaris GN=GNG11 PE=3 SV=1
  262 : F1SFA9_PIG          0.75  0.91  341  405    3   67   65    0    0   74  F1SFA9     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Sus scrofa GN=GNG11 PE=3 SV=2
  263 : F6X563_HORSE        0.75  0.91  341  405    2   66   65    0    0   73  F6X563     Guanine nucleotide-binding protein subunit gamma OS=Equus caballus GN=GNG11 PE=3 SV=1
  264 : F6X977_CALJA        0.75  0.91  341  405    2   66   65    0    0   73  F6X977     Guanine nucleotide-binding protein subunit gamma OS=Callithrix jacchus GN=GNG11 PE=3 SV=1
  265 : G1KNH3_ANOCA        0.75  0.92  341  405    2   66   65    0    0   73  G1KNH3     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis GN=GNG11 PE=3 SV=1
  266 : G1QDU0_MYOLU        0.75  0.91  341  405    2   66   65    0    0   73  G1QDU0     Guanine nucleotide-binding protein subunit gamma OS=Myotis lucifugus PE=3 SV=1
  267 : G1RZQ5_NOMLE        0.75  0.91  341  405    2   66   65    0    0   73  G1RZQ5     Guanine nucleotide-binding protein subunit gamma OS=Nomascus leucogenys GN=LOC100593358 PE=3 SV=1
  268 : G1TCV2_RABIT        0.75  0.91  341  405    2   66   65    0    0   73  G1TCV2     Guanine nucleotide-binding protein subunit gamma OS=Oryctolagus cuniculus GN=GNG11 PE=3 SV=1
  269 : G3RG22_GORGO        0.75  0.91  341  405    2   66   65    0    0   73  G3RG22     Guanine nucleotide-binding protein subunit gamma OS=Gorilla gorilla gorilla GN=101139938 PE=3 SV=1
  270 : G5ANK6_HETGA        0.75  0.91  341  405    2   66   65    0    0   73  G5ANK6     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_02185 PE=3 SV=1
  271 : G7MLV7_MACMU        0.75  0.91  341  405    2   66   65    0    0   73  G7MLV7     Guanine nucleotide-binding protein subunit gamma OS=Macaca mulatta GN=GNG11 PE=3 SV=1
  272 : G7P1D1_MACFA        0.75  0.91  341  405    2   66   65    0    0   73  G7P1D1     Guanine nucleotide-binding protein subunit gamma OS=Macaca fascicularis GN=EGM_12769 PE=3 SV=1
  273 : GBG11_HUMAN         0.75  0.91  341  405    2   66   65    0    0   73  P61952     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11 OS=Homo sapiens GN=GNG11 PE=1 SV=1
  274 : GBG11_MOUSE         0.75  0.91  341  405    2   66   65    0    0   73  P61953     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11 OS=Mus musculus GN=Gng11 PE=1 SV=1
  275 : GBG11_RAT           0.75  0.91  341  405    2   66   65    0    0   73  P61954     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11 OS=Rattus norvegicus GN=Gng11 PE=3 SV=1
  276 : H0VCC2_CAVPO        0.75  0.91  341  405    2   66   65    0    0   73  H0VCC2     Guanine nucleotide-binding protein subunit gamma OS=Cavia porcellus GN=LOC100734182 PE=3 SV=1
  277 : H0WR89_OTOGA        0.75  0.91  341  405    2   66   65    0    0   73  H0WR89     Guanine nucleotide-binding protein subunit gamma OS=Otolemur garnettii GN=GNG11 PE=3 SV=1
  278 : H2PMW8_PONAB        0.75  0.91  341  405    2   66   65    0    0   73  H2PMW8     Guanine nucleotide-binding protein subunit gamma OS=Pongo abelii GN=GNG11 PE=3 SV=1
  279 : H2QUY0_PANTR        0.75  0.91  341  405    2   66   65    0    0   73  H2QUY0     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNG11 PE=3 SV=1
  280 : I3MDZ8_SPETR        0.75  0.91  341  405    2   66   65    0    0   73  I3MDZ8     Guanine nucleotide-binding protein subunit gamma OS=Spermophilus tridecemlineatus GN=GNG11 PE=3 SV=1
  281 : K9J4E7_DESRO        0.75  0.91  341  405   12   76   65    0    0   83  K9J4E7     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Desmodus rotundus PE=2 SV=1
  282 : L5KPE7_PTEAL        0.75  0.91  341  405    2   66   65    0    0   73  L5KPE7     Guanine nucleotide-binding protein subunit gamma OS=Pteropus alecto GN=PAL_GLEAN10021739 PE=3 SV=1
  283 : L9JFK2_TUPCH        0.75  0.91  341  405    2   66   65    0    0   73  L9JFK2     Guanine nucleotide-binding protein subunit gamma OS=Tupaia chinensis GN=TREES_T100012335 PE=3 SV=1
  284 : M1ESH5_MUSPF        0.75  0.91  341  405    1   65   65    0    0   72  M1ESH5     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Mustela putorius furo PE=2 SV=1
  285 : M3W6F0_FELCA        0.75  0.91  341  405    2   66   65    0    0   73  M3W6F0     Guanine nucleotide-binding protein subunit gamma OS=Felis catus GN=GNG11 PE=3 SV=1
  286 : M3XRC8_MUSPF        0.75  0.91  341  405    2   66   65    0    0   73  M3XRC8     Guanine nucleotide-binding protein subunit gamma OS=Mustela putorius furo GN=GNG11 PE=3 SV=1
  287 : Q53Y01_HUMAN        0.75  0.91  341  405    2   66   65    0    0   73  Q53Y01     Guanine nucleotide-binding protein subunit gamma OS=Homo sapiens GN=GNG11 PE=3 SV=1
  288 : S9XK08_9CETA        0.75  0.91  341  405    2   66   65    0    0   73  S9XK08     Guanine nucleotide-binding protein subunit gamma OS=Camelus ferus GN=CB1_001640009 PE=3 SV=1
  289 : U6CRB6_NEOVI        0.75  0.91  341  405    2   66   65    0    0   73  U6CRB6     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11 OS=Neovison vison GN=GBG11 PE=4 SV=1
  290 : G3TKW0_LOXAF        0.74  0.91  341  405    2   66   65    0    0   73  G3TKW0     Guanine nucleotide-binding protein subunit gamma OS=Loxodonta africana GN=LOC100676970 PE=3 SV=1
  291 : GBG11_BOVIN         0.74  0.89  341  405    2   66   65    0    0   73  Q5E9F0     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11 OS=Bos taurus GN=GNG11 PE=3 SV=1
  292 : H3CRG4_TETNG        0.74  0.89    1  339    4  342  339    0    0  342  H3CRG4     Uncharacterized protein (Fragment) OS=Tetraodon nigroviridis PE=4 SV=1
  293 : S7PSN4_MYOBR        0.74  0.91  341  405    2   66   65    0    0   73  S7PSN4     Guanine nucleotide-binding protein subunit gamma OS=Myotis brandtii GN=D623_10028360 PE=3 SV=1
  294 : E0VAY2_PEDHC        0.73  0.83    1  339    2  317  343    2   31  317  E0VAY2     Guanine nucleotide-binding protein subunit beta 1, putative OS=Pediculus humanus subsp. corporis GN=Phum_PHUM046980 PE=4 SV=1
  295 : H2MBG0_ORYLA        0.73  0.88    1  339    2  340  339    0    0  340  H2MBG0     Uncharacterized protein OS=Oryzias latipes GN=LOC101155714 PE=4 SV=1
  296 : I3K5F4_ORENI        0.73  0.88    1  339    2  340  339    0    0  340  I3K5F4     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100691200 PE=4 SV=1
  297 : Q6DH55_DANRE        0.73  0.88    1  339    2  340  339    0    0  340  Q6DH55     Guanine nucleotide binding protein (G protein), beta polypeptide 3, like OS=Danio rerio GN=gnb3a PE=2 SV=1
  298 : E3K0E6_PUCGT        0.72  0.87    1  338    7  344  338    0    0  345  E3K0E6     Guanine nucleotide-binding protein subunit beta OS=Puccinia graminis f. sp. tritici (strain CRL 75-36-700-3 / race SCCL) GN=PGTG_03727 PE=4 SV=1
  299 : F4PD00_BATDJ        0.72  0.90    1  338    6  343  338    0    0  344  F4PD00     Putative uncharacterized protein OS=Batrachochytrium dendrobatidis (strain JAM81 / FGSC 10211) GN=BATDEDRAFT_17943 PE=4 SV=1
  300 : G3GXI4_CRIGR        0.72  0.92  341  405    2   66   65    0    0   73  G3GXI4     Guanine nucleotide-binding protein subunit gamma OS=Cricetulus griseus GN=I79_002476 PE=3 SV=1
  301 : H2TLF6_TAKRU        0.72  0.87    1  339    2  345  344    2    5  345  H2TLF6     Uncharacterized protein OS=Takifugu rubripes GN=LOC101069051 PE=4 SV=1
  302 : K7AVV5_PANTR        0.72  0.89  341  405    2   66   65    0    0   73  K7AVV5     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNG11 PE=3 SV=1
  303 : Q4RKG1_TETNG        0.72  0.85  341  405    2   66   65    0    0   73  Q4RKG1     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00032971001 PE=3 SV=1
  304 : B8PE06_POSPM        0.71  0.88    7  339   17  350  334    1    1  350  B8PE06     Candidate G-protein beta subunit OS=Postia placenta (strain ATCC 44394 / Madison 698-R) GN=POSPLDRAFT_117050 PE=4 SV=1
  305 : D8PMM6_SCHCM        0.71  0.88    7  339   16  349  334    1    1  349  D8PMM6     Guanine nucleotide binding protein beta subunit 2 OS=Schizophyllum commune (strain H4-8 / FGSC 9210) GN=SCHCODRAFT_72736 PE=4 SV=1
  306 : E9BVY1_CAPO3        0.71  0.87    1  339    3  343  341    1    2  343  E9BVY1     Heterotrimeric G protein beta subunit 1 OS=Capsaspora owczarzaki (strain ATCC 30864) GN=CAOG_00482 PE=4 SV=1
  307 : F8SVV6_VERDA        0.71  0.86   38  339   18  322  305    3    3  323  F8SVV6     G protein beta subunit 1 OS=Verticillium dahliae GN=GPB1 PE=4 SV=1
  308 : R9AC26_WALI9        0.71  0.88    2  338   11  347  337    0    0  348  R9AC26     Guanine nucleotide-binding protein subunit beta OS=Wallemia ichthyophaga (strain EXF-994 / CBS 113033) GN=J056_001585 PE=4 SV=1
  309 : U5H3H5_USTV1        0.71  0.88    1  338    8  345  338    0    0  346  U5H3H5     Uncharacterized protein OS=Microbotryum violaceum (strain p1A1 Lamole) GN=MVLG_01890 PE=4 SV=1
  310 : A9QVE2_9HOMO        0.70  0.87    3  339   11  348  338    1    1  348  A9QVE2     G-protein beta subunit OS=Rhizoctonia solani PE=4 SV=1
  311 : F4R675_MELLP        0.70  0.87    1  338    7  344  338    0    0  345  F4R675     Heterotrimeric G-protein beta subunit (G-beta, Gpb) OS=Melampsora larici-populina (strain 98AG31 / pathotype 3-4-7) GN=MELLADRAFT_76428 PE=4 SV=1
  312 : M2PAK0_CERS8        0.70  0.86    1  339   11  350  340    1    1  350  M2PAK0     Heterotrimeric G-protein beta subunit OS=Ceriporiopsis subvermispora (strain B) GN=CERSUDRAFT_87872 PE=4 SV=1
  313 : M7WP58_RHOT1        0.70  0.87    1  339    9  349  341    1    2  349  M7WP58     Guanine nucleotide binding protein beta subunit 2 OS=Rhodosporidium toruloides (strain NP11) GN=RHTO_01066 PE=4 SV=1
  314 : Q6DLY8_LENED        0.70  0.88    3  339   12  349  338    1    1  349  Q6DLY8     Guanine nucleotide binding protein beta subunit 2 OS=Lentinula edodes GN=Gbeta2 PE=2 SV=1
  315 : S8EGS0_FOMPI        0.70  0.87    3  339   13  350  338    1    1  350  S8EGS0     Uncharacterized protein OS=Fomitopsis pinicola (strain FP-58527) GN=FOMPIDRAFT_1022435 PE=4 SV=1
  316 : A5LG07_CYPCA        0.69  0.85  341  405    2   66   65    0    0   73  A5LG07     Guanine nucleotide-binding protein subunit gamma OS=Cyprinus carpio GN=Ggamma1 PE=3 SV=1
  317 : A8N364_COPC7        0.69  0.86    3  339   12  348  337    0    0  348  A8N364     Guanine nucleotide binding protein beta subunit OS=Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003) GN=CC1G_00488 PE=4 SV=2
  318 : B3GAP7_9HOMO        0.69  0.87    3  339   11  348  338    1    1  348  B3GAP7     G-protein beta subunit OS=Rhizoctonia solani PE=4 SV=1
  319 : E1BZB1_CHICK        0.69  0.80  407  595   13  233  221    1   33  249  E1BZB1     Uncharacterized protein OS=Gallus gallus GN=PDC PE=4 SV=1
  320 : F8NEW0_SERL9        0.69  0.88    3  339   12  349  338    1    1  349  F8NEW0     Putative uncharacterized protein OS=Serpula lacrymans var. lacrymans (strain S7.9) GN=SERLADRAFT_455788 PE=4 SV=1
  321 : G3NSF5_GASAC        0.69  0.83  341  405    2   66   65    0    0   73  G3NSF5     Guanine nucleotide-binding protein subunit gamma OS=Gasterosteus aculeatus PE=3 SV=1
  322 : G3VP15_SARHA        0.69  0.85  341  405    2   66   65    0    0   73  G3VP15     Guanine nucleotide-binding protein subunit gamma OS=Sarcophilus harrisii PE=3 SV=1
  323 : H2LGY1_ORYLA        0.69  0.85  341  405    2   66   65    0    0   73  H2LGY1     Guanine nucleotide-binding protein subunit gamma OS=Oryzias latipes GN=LOC101175174 PE=3 SV=1
  324 : I2FWA1_USTH4        0.69  0.87    3  339   12  349  338    1    1  349  I2FWA1     Probable G-protein beta subunit Bpp1 OS=Ustilago hordei (strain Uh4875-4) GN=UHOR_01085 PE=4 SV=1
  325 : K5WAS4_AGABU        0.69  0.86    3  339   18  357  340    2    3  357  K5WAS4     Uncharacterized protein OS=Agaricus bisporus var. burnettii (strain JB137-S8 / ATCC MYA-4627 / FGSC 10392) GN=AGABI1DRAFT_81726 PE=4 SV=1
  326 : K5WPR8_PHACS        0.69  0.87    3  339   12  349  338    1    1  349  K5WPR8     Uncharacterized protein OS=Phanerochaete carnosa (strain HHB-10118-sp) GN=PHACADRAFT_248083 PE=4 SV=1
  327 : K9HV97_AGABB        0.69  0.86    3  339   18  357  340    2    3  357  K9HV97     Guanine nucleotide binding protein beta subunit 2 OS=Agaricus bisporus var. bisporus (strain H97 / ATCC MYA-4626 / FGSC 10389) GN=AGABI2DRAFT_132917 PE=4 SV=1
  328 : Q5BH99_EMENI        0.69  0.86    1  339   11  351  341    2    2  352  Q5BH99     G-protein beta subunit [Source:UniProtKB/TrEMBLAcc:O74214] OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) GN=sfaD PE=4 SV=1
  329 : R9PDL6_PSEHS        0.69  0.87    3  339   12  349  338    1    1  349  R9PDL6     Uncharacterized protein OS=Pseudozyma hubeiensis (strain SY62) GN=PHSY_007065 PE=4 SV=1
  330 : U3J567_ANAPL        0.69  0.81  407  595   17  237  221    1   33  253  U3J567     Uncharacterized protein (Fragment) OS=Anas platyrhynchos GN=PDC PE=4 SV=1
  331 : V2XAL1_MONRO        0.69  0.88    3  339   12  349  338    1    1  349  V2XAL1     Guanine nucleotide binding protein beta subunit 2 OS=Moniliophthora roreri (strain MCA 2997) GN=Moror_7203 PE=4 SV=1
  332 : B8M352_TALSN        0.68  0.85    1  338   12  353  342    3    4  361  B8M352     G protein complex beta subunit SfaD OS=Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006) GN=TSTA_092740 PE=4 SV=1
  333 : B8NKS0_ASPFN        0.68  0.85    1  339   12  352  341    2    2  353  B8NKS0     G-protein complex beta subunit SfaD OS=Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / NRRL 3357 / JCM 12722 / SRRC 167) GN=AFLA_093240 PE=4 SV=1
  334 : C0SBA6_PARBP        0.68  0.86    1  339    3  343  341    2    2  344  C0SBA6     Guanine nucleotide-binding protein subunit beta OS=Paracoccidioides brasiliensis (strain Pb03) GN=PABG_04961 PE=4 SV=1
  335 : C1GED5_PARBD        0.68  0.86    1  339   12  352  341    2    2  353  C1GED5     Guanine nucleotide-binding protein subunit beta OS=Paracoccidioides brasiliensis (strain Pb18) GN=PADG_05621 PE=4 SV=1
  336 : C4JRF6_UNCRE        0.68  0.86    1  337    8  346  339    2    2  362  C4JRF6     Guanine nucleotide-binding protein beta subunit OS=Uncinocarpus reesii (strain UAMH 1704) GN=UREG_05045 PE=4 SV=1
  337 : D4DCH1_TRIVH        0.68  0.86    1  339   10  350  341    2    2  351  D4DCH1     Putative uncharacterized protein OS=Trichophyton verrucosum (strain HKI 0517) GN=TRV_04826 PE=4 SV=1
  338 : E9D2J6_COCPS        0.68  0.85    1  339    8  348  341    2    2  349  E9D2J6     Guanine nucleotide-binding protein beta subunit OS=Coccidioides posadasii (strain RMSCC 757 / Silveira) GN=CPSG_03794 PE=4 SV=1
  339 : F2TKC5_AJEDA        0.68  0.86    1  335   12  348  337    2    2  352  F2TKC5     Guanine nucleotide-binding protein subunit beta OS=Ajellomyces dermatitidis (strain ATCC 18188 / CBS 674.68) GN=BDDG_06633 PE=4 SV=1
  340 : F6QEC0_ORNAN        0.68  0.82  407  595   16  232  217    1   29  248  F6QEC0     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus GN=PDC PE=4 SV=1
  341 : G1MR26_MELGA        0.68  0.79  415  595    1  213  213    1   33  229  G1MR26     Uncharacterized protein (Fragment) OS=Meleagris gallopavo GN=PDC PE=4 SV=2
  342 : G1WYS7_ARTOA        0.68  0.86    3  339    9  347  339    2    2  348  G1WYS7     Uncharacterized protein OS=Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491) GN=AOL_s00004g438 PE=4 SV=1
  343 : G3YDM4_ASPNA        0.68  0.86    1  339   11  351  341    2    2  352  G3YDM4     Guanine nucleotide-binding protein beta subunit OS=Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7) GN=gpb-1 PE=4 SV=1
  344 : I3JXJ7_ORENI        0.68  0.83  341  405    4   68   65    0    0   75  I3JXJ7     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Oreochromis niloticus GN=LOC100711075 PE=3 SV=1
  345 : K9J9M6_9EURO        0.68  0.85    1  339   12  352  341    2    2  353  K9J9M6     Heterotrimeric G-protein beta subunit OS=Monascus ruber GN=mgb1 PE=4 SV=1
  346 : M3XK01_LATCH        0.68  0.85  346  405    3   62   60    0    0   69  M3XK01     Guanine nucleotide-binding protein subunit gamma OS=Latimeria chalumnae GN=GNGT2 PE=3 SV=1
  347 : M3ZEP0_XIPMA        0.68  0.83  341  405    2   66   65    0    0   73  M3ZEP0     Guanine nucleotide-binding protein subunit gamma OS=Xiphophorus maculatus PE=3 SV=1
  348 : M7BLM1_CHEMY        0.68  0.80  407  595   13  233  221    1   33  249  M7BLM1     Phosducin OS=Chelonia mydas GN=UY3_04105 PE=4 SV=1
  349 : Q5DPY7_PARBR        0.68  0.86    1  339   12  352  341    2    2  353  Q5DPY7     Small G-beta protein GPB OS=Paracoccidioides brasiliensis GN=gpb PE=4 SV=1
  350 : R0L2Y6_ANAPL        0.68  0.80  414  595    1  214  214    1   33  230  R0L2Y6     Phosducin (Fragment) OS=Anas platyrhynchos GN=Anapl_16299 PE=4 SV=1
  351 : S8ANX5_DACHA        0.68  0.86    3  339    9  347  339    2    2  347  S8ANX5     Uncharacterized protein OS=Dactylellina haptotyla (strain CBS 200.50) GN=H072_1448 PE=4 SV=1
  352 : S9XF41_9CETA        0.68  0.69   92  339   41  402  362    1  114  402  S9XF41     Uncharacterized protein OS=Camelus ferus GN=CB1_000298004 PE=4 SV=1
  353 : T5BG07_AJEDE        0.68  0.86    1  339   12  352  341    2    2  353  T5BG07     Guanine nucleotide-binding protein subunit beta OS=Ajellomyces dermatitidis ATCC 26199 GN=BDFG_09361 PE=4 SV=1
  354 : U4LM13_PYROM        0.68  0.86    3  339    8  346  339    2    2  346  U4LM13     Similar to Guanine nucleotide-binding protein subunit beta acc. no. O14435 OS=Pyronema omphalodes (strain CBS 100304) GN=PCON_14045 PE=4 SV=1
  355 : A7IT75_MYCGR        0.67  0.86    3  339   12  350  339    2    2  350  A7IT75     G-protein beta subunit OS=Mycosphaerella graminicola GN=Gpb1 PE=4 SV=1
  356 : F6Z6E3_MONDO        0.67  0.86  348  405    9   66   58    0    0   73  F6Z6E3     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Monodelphis domestica GN=GNGT2 PE=3 SV=1
  357 : G4T932_PIRID        0.67  0.86    3  339   10  349  340    2    3  349  G4T932     Related to G-protein beta subunit Bpp1 OS=Piriformospora indica (strain DSM 11827) GN=PIIN_01639 PE=4 SV=1
  358 : J9VT59_CRYNH        0.67  0.86    1  339    6  352  347    1    8  352  J9VT59     Guanine nucleotide-binding protein subunit beta OS=Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487) GN=CNAG_01262 PE=4 SV=1
  359 : K1XI64_MARBU        0.67  0.84    1  339   12  354  343    4    4  355  K1XI64     Guanine nucleotide-binding protein beta subunit OS=Marssonina brunnea f. sp. multigermtubi (strain MB_m1) GN=MBM_01115 PE=4 SV=1
  360 : K7G053_PELSI        0.67  0.80  407  595   13  233  221    1   33  249  K7G053     Uncharacterized protein OS=Pelodiscus sinensis GN=PDC PE=4 SV=1
  361 : L5JRT2_PTEAL        0.67  0.83  346  405    3   62   60    0    0   69  L5JRT2     Guanine nucleotide-binding protein subunit gamma OS=Pteropus alecto GN=PAL_GLEAN10019697 PE=3 SV=1
  362 : M2LTE1_BAUCO        0.67  0.86    2  339   12  351  340    2    2  351  M2LTE1     Uncharacterized protein OS=Baudoinia compniacensis (strain UAMH 10762) GN=BAUCODRAFT_404084 PE=4 SV=1
  363 : M3ANL2_MYCFI        0.67  0.86    2  339   12  351  340    2    2  351  M3ANL2     G-protein beta subunit-like protein OS=Mycosphaerella fijiensis (strain CIRAD86) GN=MYCFIDRAFT_88295 PE=4 SV=1
  364 : Q589C5_BOTFU        0.67  0.85    1  339   15  357  343    4    4  358  Q589C5     G protein beta subunit OS=Botryotinia fuckeliana GN=bcgb1 PE=4 SV=1
  365 : R0JH78_ANAPL        0.67  0.85  346  405    3   62   60    0    0   69  R0JH78     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Anas platyrhynchos GN=GNGT2 PE=3 SV=1
  366 : U1GWM4_9EURO        0.67  0.87    1  339   12  352  341    2    2  353  U1GWM4     Guanine nucleotide-binding protein subunit beta OS=Endocarpon pusillum Z07020 GN=EPUS_06153 PE=4 SV=1
  367 : U3JL21_FICAL        0.67  0.81  407  595   17  237  221    1   33  252  U3JL21     Uncharacterized protein (Fragment) OS=Ficedula albicollis GN=PDC PE=4 SV=1
  368 : D3BQ34_POLPA        0.66  0.86    3  339    8  346  339    2    2  346  D3BQ34     G protein b-subunit OS=Polysphondylium pallidum GN=gpbA PE=4 SV=1
  369 : E3S4F0_PYRTT        0.66  0.85    2  339    9  348  340    2    2  348  E3S4F0     Putative uncharacterized protein OS=Pyrenophora teres f. teres (strain 0-1) GN=PTT_17426 PE=4 SV=1
  370 : E4ZZ68_LEPMJ        0.66  0.85    2  339   12  351  340    2    2  351  E4ZZ68     Similar to guanine nucleotide-binding protein subunit beta 1 OS=Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8) GN=LEMA_P109280.1 PE=4 SV=1
  371 : F1A421_DICPU        0.66  0.84    1  339    7  347  341    2    2  347  F1A421     Guanine nucleotide-binding protein subunit beta OS=Dictyostelium purpureum GN=DICPUDRAFT_93216 PE=4 SV=1
  372 : GBB_DICDI           0.66  0.84    1  339    7  347  341    2    2  347  P36408     Guanine nucleotide-binding protein subunit beta OS=Dictyostelium discoideum GN=gpbA PE=1 SV=1
  373 : H9G510_ANOCA        0.66  0.80  410  595   17  235  219    1   34  251  H9G510     Uncharacterized protein OS=Anolis carolinensis GN=PDC PE=4 SV=1
  374 : J4UDE4_TRIAS        0.66  0.85    1  339    9  353  345    3    6  353  J4UDE4     Mating factor receptor-coupled G protein OS=Trichosporon asahii var. asahii (strain ATCC 90039 / CBS 2479 / JCM 2466 / KCTC 7840 / NCYC 2677 / UAMH 7654) GN=A1Q1_01784 PE=4 SV=1
  375 : L8HRZ8_9CETA        0.66  0.82  341  405    2   62   65    1    4   69  L8HRZ8     Guanine nucleotide-binding protein subunit gamma OS=Bos mutus GN=M91_14200 PE=3 SV=1
  376 : M2SCA6_COCSN        0.66  0.85    2  339   12  351  340    2    2  351  M2SCA6     Uncharacterized protein OS=Cochliobolus sativus (strain ND90Pr / ATCC 201652) GN=COCSADRAFT_316295 PE=4 SV=1
  377 : M2SRU8_COCH5        0.66  0.85    2  339   12  351  340    2    2  351  M2SRU8     Uncharacterized protein OS=Cochliobolus heterostrophus (strain C5 / ATCC 48332 / race O) GN=COCHEDRAFT_1033387 PE=4 SV=1
  378 : N4XAZ2_COCH4        0.66  0.85    2  339   12  351  340    2    2  351  N4XAZ2     Uncharacterized protein OS=Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T) GN=COCC4DRAFT_26104 PE=4 SV=1
  379 : Q0TWX6_PHANO        0.66  0.85    2  339   12  351  340    2    2  351  Q0TWX6     Putative uncharacterized protein OS=Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) GN=SNOG_16044 PE=4 SV=2
  380 : Q18NX5_DUGJA        0.66  0.84   15  339    1  329  329    2    4  329  Q18NX5     Putative G-protein beta subunit (Fragment) OS=Dugesia japonica PE=2 SV=1
  381 : Q5KI86_CRYNJ        0.66  0.86    1  339    6  343  340    2    3  343  Q5KI86     Putative uncharacterized protein OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) GN=CND03830 PE=4 SV=1
  382 : Q6XSF5_COCHE        0.66  0.85    2  339   12  351  340    2    2  351  Q6XSF5     G-protein beta subunit Cgb1 OS=Cochliobolus heterostrophus PE=4 SV=1
  383 : R4GL61_CHICK        0.66  0.85  347  405    6   64   59    0    0   71  R4GL61     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Gallus gallus GN=LOC100859179 PE=3 SV=1
  384 : A2A614_MOUSE        0.65  0.83  346  405    3   62   60    0    0   69  A2A614     Guanine nucleotide-binding protein subunit gamma OS=Mus musculus GN=Gngt2 PE=3 SV=1
  385 : D3ZLD6_RAT          0.65  0.82  346  405    3   62   60    0    0   69  D3ZLD6     Guanine nucleotide-binding protein subunit gamma OS=Rattus norvegicus GN=Gngt2 PE=3 SV=1
  386 : F6UVS8_CALJA        0.65  0.85  346  405    3   62   60    0    0   69  F6UVS8     Guanine nucleotide-binding protein subunit gamma OS=Callithrix jacchus GN=GNGT2 PE=3 SV=1
  387 : F6W0I2_XENTR        0.65  0.85  346  405    3   62   60    0    0   69  F6W0I2     Guanine nucleotide-binding protein subunit gamma OS=Xenopus tropicalis GN=gngt2.1 PE=3 SV=1
  388 : G1KY89_ANOCA        0.65  0.83  346  405    3   62   60    0    0   69  G1KY89     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis GN=GNGT2 PE=3 SV=1
  389 : G4N528_MAGO7        0.65  0.83    1  339    3  345  343    4    4  346  G4N528     Guanine nucleotide-binding protein subunit beta OS=Magnaporthe oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) GN=MGG_05201 PE=4 SV=1
  390 : GBGT2_BOVIN         0.65  0.83  346  405    3   62   60    0    0   69  P50154     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2 OS=Bos taurus GN=GNGT2 PE=3 SV=1
  391 : GBGT2_CANFA         0.65  0.83  346  405    3   62   60    0    0   69  O97564     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2 OS=Canis familiaris GN=GNGT2 PE=3 SV=1
  392 : GBGT2_MOUSE         0.65  0.83  346  405    3   62   60    0    0   69  Q61017     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2 OS=Mus musculus GN=Gngt2 PE=3 SV=2
  393 : L8IWF0_9CETA        0.65  0.83  346  405    3   62   60    0    0   69  L8IWF0     Guanine nucleotide-binding protein subunit gamma OS=Bos mutus GN=M91_15619 PE=3 SV=1
  394 : Q1LXL0_DANRE        0.65  0.85  341  405    5   69   65    0    0   76  Q1LXL0     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=gngt1 PE=3 SV=1
  395 : Q6PBN9_DANRE        0.65  0.85  341  405    2   66   65    0    0   73  Q6PBN9     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=gngt1 PE=3 SV=1
  396 : S9WBK2_9CETA        0.65  0.83  346  405    3   62   60    0    0   69  S9WBK2     Guanine nucleotide-binding protein subunit gamma OS=Camelus ferus GN=CB1_002552003 PE=3 SV=1
  397 : T1G8D2_HELRO        0.65  0.85    2  339    5  328  339    2   16  328  T1G8D2     Uncharacterized protein OS=Helobdella robusta GN=HELRODRAFT_92225 PE=4 SV=1
  398 : B4HCF9_DROPE        0.64  0.73    1  339    2  278  339    2   62  278  B4HCF9     GL18448 OS=Drosophila persimilis GN=Dper\GL18448 PE=4 SV=1
  399 : H0YZ54_TAEGU        0.64  0.79  407  595   13  238  226    2   38  253  H0YZ54     Uncharacterized protein OS=Taeniopygia guttata GN=PDC PE=4 SV=1
  400 : D6RDH5_HUMAN        0.63  0.85  346  405    3   62   60    0    0   88  D6RDH5     Guanine nucleotide-binding protein subunit gamma OS=Homo sapiens GN=GNGT2 PE=3 SV=1
  401 : F6PKY3_MACMU        0.63  0.85  346  405    3   62   60    0    0   69  F6PKY3     Guanine nucleotide-binding protein subunit gamma OS=Macaca mulatta GN=GNGT2 PE=3 SV=1
  402 : F6SAR2_XENTR        0.63  0.77  413  595    1  214  215    2   34  229  F6SAR2     Uncharacterized protein (Fragment) OS=Xenopus tropicalis GN=pdc PE=4 SV=1
  403 : G1QRI6_NOMLE        0.63  0.85  346  405    3   62   60    0    0   69  G1QRI6     Guanine nucleotide-binding protein subunit gamma OS=Nomascus leucogenys GN=LOC100585001 PE=3 SV=1
  404 : G3QHT5_GORGO        0.63  0.85  346  405    3   62   60    0    0   69  G3QHT5     Guanine nucleotide-binding protein subunit gamma OS=Gorilla gorilla gorilla GN=101134560 PE=3 SV=1
  405 : G3U3B8_LOXAF        0.63  0.83  346  405    3   62   60    0    0   69  G3U3B8     Guanine nucleotide-binding protein subunit gamma OS=Loxodonta africana GN=LOC100674922 PE=3 SV=1
  406 : G8F5B1_MACFA        0.63  0.85  346  405    3   62   60    0    0   69  G8F5B1     Guanine nucleotide-binding protein subunit gamma OS=Macaca fascicularis GN=EGM_20808 PE=3 SV=1
  407 : GBGT2_HUMAN         0.63  0.85  346  405    3   62   60    0    0   69  O14610     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2 OS=Homo sapiens GN=GNGT2 PE=2 SV=1
  408 : H2NVK3_PONAB        0.63  0.85  346  405    3   62   60    0    0   69  H2NVK3     Guanine nucleotide-binding protein subunit gamma OS=Pongo abelii GN=GNGT2 PE=3 SV=1
  409 : H2QDC9_PANTR        0.63  0.85  346  405    3   62   60    0    0   69  H2QDC9     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNGT2 PE=3 SV=1
  410 : H2RGV2_PANTR        0.63  0.85  346  405    3   62   60    0    0   88  H2RGV2     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNGT2 PE=3 SV=1
  411 : H3B8F3_LATCH        0.63  0.76  407  595   22  241  221    2   34  258  H3B8F3     Uncharacterized protein (Fragment) OS=Latimeria chalumnae PE=4 SV=1
  412 : K7FAR0_PELSI        0.63  0.85  346  405    3   62   60    0    0   69  K7FAR0     Guanine nucleotide-binding protein subunit gamma OS=Pelodiscus sinensis GN=GNGT2 PE=3 SV=1
  413 : Q6P8Y9_MOUSE        0.63  0.83  346  405    3   62   60    0    0   69  Q6P8Y9     Guanine nucleotide-binding protein subunit gamma OS=Mus musculus GN=Gngt2 PE=3 SV=1
  414 : D2H579_AILME        0.62  0.82  346  405    3   62   60    0    0   69  D2H579     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=LOC100476550 PE=3 SV=1
  415 : F6UD42_HORSE        0.62  0.83  346  405    3   62   60    0    0   69  F6UD42     Guanine nucleotide-binding protein subunit gamma OS=Equus caballus GN=GNGT2 PE=3 SV=1
  416 : Q800J3_9SAUR        0.62  0.76  410  594   17  232  218    2   36  249  Q800J3     Phosducin OS=Phelsuma sundbergi longinsulae GN=PmlPD PE=2 SV=1
  417 : F1R9S7_DANRE        0.61  0.78  410  595   20  230  213    2   30  245  F1R9S7     Uncharacterized protein (Fragment) OS=Danio rerio GN=pdca PE=4 SV=1
  418 : F8W512_DANRE        0.61  0.78  411  595   12  221  212    2   30  236  F8W512     Uncharacterized protein OS=Danio rerio GN=pdca PE=4 SV=1
  419 : G1TBE3_RABIT        0.61  0.83  347  405    8   66   59    0    0   73  G1TBE3     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Oryctolagus cuniculus GN=GNGT2 PE=3 SV=1
  420 : G3HJN8_CRIGR        0.60  0.82  346  405    3   62   60    0    0   69  G3HJN8     Guanine nucleotide-binding protein subunit gamma OS=Cricetulus griseus GN=I79_010887 PE=3 SV=1
  421 : I3JY64_ORENI        0.60  0.77  408  595   16  225  212    2   27  241  I3JY64     Uncharacterized protein (Fragment) OS=Oreochromis niloticus GN=PDC (1 of 2) PE=4 SV=1
  422 : I3MA43_SPETR        0.60  0.85  346  405    3   62   60    0    0   69  I3MA43     Guanine nucleotide-binding protein subunit gamma OS=Spermophilus tridecemlineatus GN=GNGT2 PE=3 SV=1
  423 : L8YBJ9_TUPCH        0.60  0.83  346  405    3   62   60    0    0   69  L8YBJ9     Guanine nucleotide-binding protein subunit gamma OS=Tupaia chinensis GN=TREES_T100015363 PE=3 SV=1
  424 : M3VU45_FELCA        0.60  0.83  346  405    3   62   60    0    0   69  M3VU45     Guanine nucleotide-binding protein subunit gamma OS=Felis catus GN=GNGT2 PE=3 SV=1
  425 : Q3B734_DANRE        0.60  0.75  413  595   15  222  211    4   32  236  Q3B734     Pdc2 protein OS=Danio rerio GN=pdcb PE=2 SV=1
  426 : Q90WW8_DANRE        0.60  0.78  346  405    3   62   60    0    0   69  Q90WW8     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Danio rerio GN=gngt2a PE=2 SV=1
  427 : A5LG08_CYPCA        0.59  0.76  347  405    4   62   59    0    0   69  A5LG08     Guanine nucleotide-binding protein subunit gamma OS=Cyprinus carpio GN=Ggamma8 PE=3 SV=1
  428 : E7F1F5_DANRE        0.59  0.75  347  405    4   62   59    0    0   69  E7F1F5     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=gngt2b PE=3 SV=1
  429 : G1PLP0_MYOLU        0.59  0.80  350  405    1   56   56    0    0   63  G1PLP0     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Myotis lucifugus GN=GNGT2 PE=3 SV=1
  430 : H2M0A9_ORYLA        0.59  0.74  407  595   14  228  217    2   31  242  H2M0A9     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC100422798 PE=4 SV=1
  431 : Q6PBR4_DANRE        0.59  0.78  347  405    4   62   59    0    0   69  Q6PBR4     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=gngt2a PE=3 SV=1
  432 : Q9W613_ORYLA        0.59  0.74  407  595    8  222  217    2   31  236  Q9W613     Cone type phosducin OS=Oryzias latipes GN=OlPD-C PE=2 SV=1
  433 : A4IHM2_XENTR        0.58  0.78  346  405    3   62   60    0    0   69  A4IHM2     Guanine nucleotide-binding protein subunit gamma OS=Xenopus tropicalis GN=gngt2 PE=3 SV=1
  434 : H2MFP6_ORYLA        0.58  0.77  408  595   34  243  212    2   27  259  H2MFP6     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC100422797 PE=4 SV=1
  435 : I3JUQ9_ORENI        0.58  0.74  407  595    8  222  217    2   31  236  I3JUQ9     Uncharacterized protein OS=Oreochromis niloticus GN=PDC (2 of 2) PE=4 SV=1
  436 : I3JUR0_ORENI        0.58  0.74  407  595   32  246  217    2   31  260  I3JUR0     Uncharacterized protein (Fragment) OS=Oreochromis niloticus GN=PDC (2 of 2) PE=4 SV=1
  437 : M4AWG6_XIPMA        0.58  0.77  408  595    9  218  212    2   27  234  M4AWG6     Uncharacterized protein OS=Xiphophorus maculatus GN=PDC (1 of 2) PE=4 SV=1
  438 : Q9W612_ORYLA        0.58  0.77  408  595   10  219  212    2   27  235  Q9W612     Rod type phosducin OS=Oryzias latipes GN=OlPD-R PE=2 SV=1
  439 : G3NX02_GASAC        0.57  0.72  407  595    8  222  217    2   31  236  G3NX02     Uncharacterized protein OS=Gasterosteus aculeatus GN=PDC (1 of 2) PE=4 SV=1
  440 : G3NX13_GASAC        0.57  0.72  407  595   26  240  217    2   31  254  G3NX13     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus GN=PDC (1 of 2) PE=4 SV=1
  441 : H2SBF8_TAKRU        0.57  0.74  416  595   23  228  208    2   31  241  H2SBF8     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101064599 PE=4 SV=1
  442 : H3DL91_TETNG        0.57  0.74  407  595   12  226  217    2   31  239  H3DL91     Uncharacterized protein (Fragment) OS=Tetraodon nigroviridis GN=PDC PE=4 SV=1
  443 : Q4RJ15_TETNG        0.57  0.74  407  595    8  222  217    2   31  235  Q4RJ15     Chromosome 1 SCAF15039, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00033630001 PE=4 SV=1
  444 : V8P0Z4_OPHHA        0.57  0.83  346  405    3   62   60    0    0   69  V8P0Z4     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2 OS=Ophiophagus hannah GN=GNGT2 PE=4 SV=1
  445 : G3PP72_GASAC        0.56  0.75  408  595   14  223  212    2   27  238  G3PP72     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus GN=PDC (2 of 2) PE=4 SV=1
  446 : G3PP75_GASAC        0.56  0.75  408  595   16  225  212    2   27  240  G3PP75     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus GN=PDC (2 of 2) PE=4 SV=1
  447 : H2SBF7_TAKRU        0.56  0.74  407  595   31  245  217    2   31  258  H2SBF7     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101064599 PE=4 SV=1
  448 : Q6P968_DANRE        0.56  0.71  410  595   21  231  219    2   42  246  Q6P968     Pdc1 protein (Fragment) OS=Danio rerio GN=pdca PE=2 SV=1
  449 : Q568T1_DANRE        0.55  0.70  412  595   37  246  217    2   41  260  Q568T1     Pdc2 protein (Fragment) OS=Danio rerio GN=pdcb PE=2 SV=1
  450 : Q5RI07_DANRE        0.55  0.69  413  595   15  223  216    2   41  237  Q5RI07     Uncharacterized protein OS=Danio rerio GN=pdcb PE=4 SV=1
  451 : Q6DH10_DANRE        0.55  0.70  412  595   38  247  217    2   41  261  Q6DH10     Pdc2 protein (Fragment) OS=Danio rerio GN=pdcb PE=2 SV=1
  452 : S7N9H3_MYOBR        0.54  0.90  345  405    1   61   61    0    0   69  S7N9H3     Guanine nucleotide-binding protein subunit gamma OS=Myotis brandtii GN=D623_10033787 PE=3 SV=1
  453 : G5C4N7_HETGA        0.53  0.80  346  405    3   62   60    0    0   69  G5C4N7     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_21755 PE=3 SV=1
  454 : H0WB58_CAVPO        0.53  0.82  346  405    3   62   60    0    0   69  H0WB58     Guanine nucleotide-binding protein subunit gamma OS=Cavia porcellus GN=LOC100714012 PE=3 SV=1
  455 : H2SZY7_TAKRU        0.53  0.74  347  404    4   61   58    0    0   70  H2SZY7     Guanine nucleotide-binding protein subunit gamma OS=Takifugu rubripes GN=LOC101062666 PE=3 SV=1
  456 : Q4RYG1_TETNG        0.53  0.78  347  404    4   61   58    0    0   70  Q4RYG1     Guanine nucleotide-binding protein subunit gamma OS=Tetraodon nigroviridis GN=GNGT2 PE=3 SV=1
  457 : M3ZJP6_XIPMA        0.52  0.66  407  595    8  222  222    2   41  236  M3ZJP6     Uncharacterized protein OS=Xiphophorus maculatus GN=PDC (2 of 2) PE=4 SV=1
  458 : M4AT17_XIPMA        0.52  0.74  347  404    4   61   58    0    0   70  M4AT17     Guanine nucleotide-binding protein subunit gamma OS=Xiphophorus maculatus PE=3 SV=1
  459 : S4RVY4_PETMA        0.51  0.67  349  405    7   63   57    0    0   70  S4RVY4     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Petromyzon marinus PE=3 SV=1
  460 : G3NGK1_GASAC        0.48  0.72  347  404    4   61   58    0    0   70  G3NGK1     Guanine nucleotide-binding protein subunit gamma OS=Gasterosteus aculeatus PE=3 SV=1
  461 : H3CXB8_TETNG        0.48  0.68  356  405   17   66   50    0    0   74  H3CXB8     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Tetraodon nigroviridis GN=GNG8 PE=3 SV=1
  462 : J9NXA2_CANFA        0.48  0.70  408  595   51  277  227    3   40  301  J9NXA2     Uncharacterized protein OS=Canis familiaris GN=PDCL PE=4 SV=1
  463 : L5K9I4_PTEAL        0.48  0.70  408  595   51  277  227    3   40  301  L5K9I4     Phosducin-like protein OS=Pteropus alecto GN=PAL_GLEAN10012397 PE=4 SV=1
  464 : M3X7C8_FELCA        0.48  0.70  408  595   51  277  227    3   40  301  M3X7C8     Uncharacterized protein OS=Felis catus GN=PDCL PE=4 SV=1
  465 : S9YQD3_9CETA        0.48  0.70  408  595   51  277  227    3   40  301  S9YQD3     Phosducin-like protein OS=Camelus ferus GN=CB1_000091013 PE=4 SV=1
  466 : B5XA04_SALSA        0.47  0.72  347  404    4   61   58    0    0   70  B5XA04     Guanine nucleotide-binding protein subunit gamma OS=Salmo salar GN=GBGT2 PE=3 SV=1
  467 : F6TFS0_HORSE        0.47  0.70  408  595   12  238  227    3   40  262  F6TFS0     Uncharacterized protein (Fragment) OS=Equus caballus GN=PDCL PE=4 SV=1
  468 : F7BIF8_CALJA        0.47  0.70  408  595   51  277  227    3   40  301  F7BIF8     Phosducin-like protein OS=Callithrix jacchus GN=PDCL PE=2 SV=1
  469 : G3T8F8_LOXAF        0.47  0.70  408  595   51  277  227    3   40  301  G3T8F8     Uncharacterized protein OS=Loxodonta africana GN=LOC100669933 PE=4 SV=1
  470 : G5B6X7_HETGA        0.47  0.70  408  595   51  277  227    3   40  301  G5B6X7     Phosducin-like protein OS=Heterocephalus glaber GN=GW7_01156 PE=4 SV=1
  471 : H0X5R0_OTOGA        0.47  0.70  408  595   51  277  227    3   40  301  H0X5R0     Uncharacterized protein OS=Otolemur garnettii GN=PDCL PE=4 SV=1
  472 : H2V2V0_TAKRU        0.47  0.69  355  405   14   64   51    0    0   72  H2V2V0     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Takifugu rubripes GN=LOC101073162 PE=3 SV=1
  473 : H3AJE3_LATCH        0.47  0.65  355  405   16   66   51    0    0   74  H3AJE3     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Latimeria chalumnae PE=3 SV=1
  474 : K9IIZ7_DESRO        0.47  0.70  408  595   51  277  227    3   40  301  K9IIZ7     Putative conserved phosducin-like protein OS=Desmodus rotundus PE=2 SV=1
  475 : M3YRT2_MUSPF        0.47  0.70  408  595   51  277  227    3   40  301  M3YRT2     Uncharacterized protein OS=Mustela putorius furo GN=PDCL PE=4 SV=1
  476 : U6CUA9_NEOVI        0.47  0.70  408  595   51  277  227    3   40  301  U6CUA9     Phosducin-like protein OS=Neovison vison GN=PHLP PE=2 SV=1
  477 : D2I6X7_AILME        0.46  0.70  408  595   51  277  227    3   40  301  D2I6X7     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=LOC100468135 PE=4 SV=1
  478 : E1BQM7_CHICK        0.46  0.70  408  595   50  276  227    3   40  300  E1BQM7     Uncharacterized protein OS=Gallus gallus GN=PDCL PE=4 SV=1
  479 : F7F3M0_MACMU        0.46  0.70  408  595   51  277  227    3   40  301  F7F3M0     Phosducin-like protein OS=Macaca mulatta GN=PDCL PE=2 SV=1
  480 : G1N7F4_MELGA        0.46  0.70  408  595   50  276  227    3   40  300  G1N7F4     Uncharacterized protein OS=Meleagris gallopavo GN=PDCL PE=4 SV=1
  481 : G1S5V1_NOMLE        0.46  0.70  408  595   51  277  227    3   40  301  G1S5V1     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100588830 PE=4 SV=1
  482 : G3HLG7_CRIGR        0.46  0.70  408  595   51  277  227    3   40  301  G3HLG7     Phosducin-like protein OS=Cricetulus griseus GN=I79_011555 PE=4 SV=1
  483 : G3RC41_GORGO        0.46  0.70  408  595   51  277  227    3   40  301  G3RC41     Uncharacterized protein OS=Gorilla gorilla gorilla GN=101143641 PE=4 SV=1
  484 : G7PRH7_MACFA        0.46  0.70  408  595   51  277  227    3   40  301  G7PRH7     Phosducin-like protein OS=Macaca fascicularis GN=EGM_06661 PE=4 SV=1
  485 : H0VES7_CAVPO        0.46  0.70  408  595   51  277  227    3   40  301  H0VES7     Uncharacterized protein OS=Cavia porcellus GN=LOC100714122 PE=4 SV=1
  486 : H0Z927_TAEGU        0.46  0.70  408  595   50  276  227    3   40  300  H0Z927     Uncharacterized protein OS=Taeniopygia guttata GN=PDCL PE=4 SV=1
  487 : H2QXU6_PANTR        0.46  0.70  408  595   51  277  227    3   40  301  H2QXU6     Phosducin-like OS=Pan troglodytes GN=PDCL PE=2 SV=1
  488 : I3MFW8_SPETR        0.46  0.70  408  595   51  277  227    3   40  301  I3MFW8     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=PDCL PE=4 SV=1
  489 : PHLP_HUMAN          0.46  0.70  408  595   51  277  227    3   40  301  Q13371     Phosducin-like protein OS=Homo sapiens GN=PDCL PE=1 SV=3
  490 : PHLP_RAT            0.46  0.69  408  595   51  277  227    3   40  301  Q63737     Phosducin-like protein OS=Rattus norvegicus GN=Pdcl PE=1 SV=1
  491 : Q5R9T4_PONAB        0.46  0.70  408  595   51  277  227    3   40  301  Q5R9T4     Putative uncharacterized protein DKFZp468I225 OS=Pongo abelii GN=DKFZp468I225 PE=2 SV=1
  492 : R0JBI8_ANAPL        0.46  0.70  408  595   50  276  227    3   40  300  R0JBI8     Phosducin-like protein (Fragment) OS=Anas platyrhynchos GN=Anapl_11320 PE=4 SV=1
  493 : U3JH34_FICAL        0.46  0.70  408  595   50  276  227    3   40  300  U3JH34     Uncharacterized protein OS=Ficedula albicollis GN=PDCL PE=4 SV=1
  494 : F1SKW2_PIG          0.45  0.70  408  595   51  277  227    3   40  301  F1SKW2     Uncharacterized protein OS=Sus scrofa GN=LOC100153625 PE=4 SV=1
  495 : F6X4V6_MONDO        0.45  0.70  408  595 1173 1400  228    4   41 1424  F6X4V6     Uncharacterized protein OS=Monodelphis domestica GN=RC3H2 PE=4 SV=2
  496 : G1SVX0_RABIT        0.45  0.69  408  595   51  277  227    3   40  301  G1SVX0     Uncharacterized protein OS=Oryctolagus cuniculus GN=PDCL PE=4 SV=1
  497 : G3VYC4_SARHA        0.45  0.69  408  595   49  276  228    4   41  300  G3VYC4     Uncharacterized protein OS=Sarcophilus harrisii GN=PDCL PE=4 SV=1
  498 : K7FCM1_PELSI        0.45  0.70  408  595   49  275  227    3   40  299  K7FCM1     Uncharacterized protein OS=Pelodiscus sinensis GN=PDCL PE=4 SV=1
  499 : L8HKN3_9CETA        0.45  0.69  408  595   51  278  228    4   41  302  L8HKN3     Phosducin-like protein OS=Bos mutus GN=M91_20743 PE=4 SV=1
  500 : M7C2F6_CHEMY        0.45  0.70  408  595   49  275  227    3   40  276  M7C2F6     Phosducin-like protein (Fragment) OS=Chelonia mydas GN=UY3_08173 PE=4 SV=1
  501 : PHLP_BOVIN          0.45  0.70  408  595   51  277  227    3   40  301  Q2HJA9     Phosducin-like protein OS=Bos taurus GN=PDCL PE=2 SV=1
  502 : PHLP_MOUSE          0.45  0.69  408  595   51  277  227    3   40  301  Q9DBX2     Phosducin-like protein OS=Mus musculus GN=Pdcl PE=1 SV=1
  503 : Q3UZN6_MOUSE        0.45  0.69  408  595   51  277  227    3   40  301  Q3UZN6     Putative uncharacterized protein OS=Mus musculus GN=Pdcl PE=2 SV=1
  504 : Q923E8_MOUSE        0.45  0.69  408  595   51  277  227    3   40  301  Q923E8     Phosducin-like OS=Mus musculus GN=Pdcl PE=2 SV=1
  505 : E9G283_DAPPU        0.44  0.69  354  405    1   52   52    0    0   59  E9G283     Guanine nucleotide-binding protein subunit gamma OS=Daphnia pulex GN=Gng2 PE=3 SV=1
  506 : F6QJ91_ORNAN        0.44  0.70  408  595   49  275  227    3   40  299  F6QJ91     Uncharacterized protein OS=Ornithorhynchus anatinus GN=PDCL PE=4 SV=1
  507 : H3A709_LATCH        0.44  0.66  408  595   49  272  227    4   43  298  H3A709     Uncharacterized protein OS=Latimeria chalumnae PE=4 SV=1
  508 : M3ZSK3_XIPMA        0.44  0.67  408  595   52  278  227    3   40  306  M3ZSK3     Uncharacterized protein OS=Xiphophorus maculatus PE=4 SV=1
  509 : U3J3C8_ANAPL        0.44  0.68  408  565   50  246  197    3   40  246  U3J3C8     Uncharacterized protein OS=Anas platyrhynchos GN=PDCL PE=4 SV=1
  510 : G1PI75_MYOLU        0.43  0.69  408  595   48  274  227    3   40  298  G1PI75     Uncharacterized protein OS=Myotis lucifugus GN=PDCL PE=4 SV=1
  511 : H2ZSM5_LATCH        0.43  0.67  355  405   11   61   51    0    0   68  H2ZSM5     Guanine nucleotide-binding protein subunit gamma OS=Latimeria chalumnae PE=3 SV=1
  512 : I3KSW2_ORENI        0.43  0.67  355  405   15   65   51    0    0   72  I3KSW2     Guanine nucleotide-binding protein subunit gamma OS=Oreochromis niloticus GN=GNG12 (1 of 2) PE=3 SV=1
  513 : I3LIP5_PIG          0.43  0.65  408  595   51  262  227    6   55  286  I3LIP5     Uncharacterized protein OS=Sus scrofa PE=4 SV=1
  514 : L5LKR1_MYODS        0.43  0.69  408  595 1168 1394  227    3   40 1418  L5LKR1     RING finger and CCCH-type zinc finger domain-containing protein 2 OS=Myotis davidii GN=MDA_GLEAN10019370 PE=4 SV=1
  515 : O35359_RAT          0.43  0.65  355  403    7   55   49    0    0   55  O35359     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Rattus norvegicus PE=2 SV=1
  516 : S7Q7N3_MYOBR        0.43  0.69  408  595   71  297  227    3   40  321  S7Q7N3     Phosducin-like protein OS=Myotis brandtii GN=D623_10028434 PE=4 SV=1
  517 : C3KHI1_ANOFI        0.42  0.67  408  595   52  278  227    3   40  306  C3KHI1     Phosducin-like protein OS=Anoplopoma fimbria GN=PHLP PE=2 SV=1
  518 : G3PUE7_GASAC        0.42  0.68  408  595   52  278  227    3   40  306  G3PUE7     Uncharacterized protein OS=Gasterosteus aculeatus PE=4 SV=1
  519 : H2LK82_ORYLA        0.42  0.67  408  595   50  276  227    3   40  304  H2LK82     Uncharacterized protein OS=Oryzias latipes GN=LOC101170283 PE=4 SV=1
  520 : I3JBR2_ORENI        0.42  0.63  346  405    3   62   60    0    0   70  I3JBR2     Guanine nucleotide-binding protein subunit gamma OS=Oreochromis niloticus GN=LOC100707451 PE=3 SV=1
  521 : I3JKQ8_ORENI        0.42  0.68  408  595   52  278  227    3   40  306  I3JKQ8     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100704540 PE=4 SV=1
  522 : F6YZA3_MONDO        0.41  0.59  348  405   10   67   58    0    0   75  F6YZA3     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Monodelphis domestica GN=GNG8 PE=3 SV=1
  523 : G3VG64_SARHA        0.41  0.59  348  405    7   64   58    0    0   72  G3VG64     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Sarcophilus harrisii GN=GNG8 PE=3 SV=1
  524 : H2VAR1_TAKRU        0.41  0.67  408  595   52  278  227    3   40  306  H2VAR1     Uncharacterized protein OS=Takifugu rubripes GN=LOC101062086 PE=4 SV=1
  525 : I3ISJ0_DANRE        0.41  0.67  355  405   15   65   51    0    0   72  I3ISJ0     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=si:dkey-44g17.6 PE=3 SV=1
  526 : R0JLF0_ANAPL        0.41  0.63  355  405   16   66   51    0    0   74  R0JLF0     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Anas platyrhynchos GN=GNG4 PE=3 SV=1
  527 : U3KGE2_FICAL        0.41  0.63  355  405   16   66   51    0    0   74  U3KGE2     Guanine nucleotide-binding protein subunit gamma OS=Ficedula albicollis GN=GNG4 PE=3 SV=1
  528 : U3KGE4_FICAL        0.41  0.63  355  405   21   71   51    0    0   79  U3KGE4     Guanine nucleotide-binding protein subunit gamma OS=Ficedula albicollis GN=GNG4 PE=3 SV=1
  529 : J3S0H6_CROAD        0.40  0.67  408  595   50  270  227    4   46  294  J3S0H6     Phosducin-like protein-like OS=Crotalus adamanteus PE=2 SV=1
  530 : Q4SFP0_TETNG        0.40  0.65  346  405    3   62   60    0    0   70  Q4SFP0     Guanine nucleotide-binding protein subunit gamma OS=Tetraodon nigroviridis GN=GSTENG00019011001 PE=3 SV=1
  531 : Q503Q6_DANRE        0.40  0.63  346  405    3   62   60    0    0   70  Q503Q6     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=gng8 PE=3 SV=1
  532 : T1E4S6_CROHD        0.40  0.67  408  595   51  271  227    4   46  295  T1E4S6     Phosducin-like protein-like protein OS=Crotalus horridus PE=2 SV=1
  533 : T1JZU8_TETUR        0.40  0.62  348  405    3   60   58    0    0   67  T1JZU8     Guanine nucleotide-binding protein subunit gamma OS=Tetranychus urticae PE=3 SV=1
  534 : D3PHE7_LEPSM        0.39  0.73  356  405   13   63   51    1    1   71  D3PHE7     Guanine nucleotide-binding protein subunit gamma OS=Lepeophtheirus salmonis GN=GBG1 PE=3 SV=1
  535 : E3TD01_9TELE        0.39  0.63  355  405   15   65   51    0    0   72  E3TD01     Guanine nucleotide-binding protein subunit gamma OS=Ictalurus furcatus GN=GBG12 PE=3 SV=1
  536 : F6T6I4_HORSE        0.39  0.61  355  405   17   67   51    0    0   75  F6T6I4     Guanine nucleotide-binding protein subunit gamma OS=Equus caballus GN=GNG4 PE=3 SV=1
  537 : G3X9Q2_MOUSE        0.39  0.69  355  405   12   62   51    0    0   69  G3X9Q2     Guanine nucleotide-binding protein subunit gamma OS=Mus musculus GN=Gng7 PE=3 SV=1
  538 : G5AYI7_HETGA        0.39  0.63  355  405  239  289   51    0    0  297  G5AYI7     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_01781 PE=3 SV=1
  539 : G5BYX7_HETGA        0.39  0.65  355  405   15   65   51    0    0   72  G5BYX7     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_16097 PE=3 SV=1
  540 : GBG7_MOUSE          0.39  0.69  355  405   11   61   51    0    0   68  Q61016     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-7 OS=Mus musculus GN=Gng7 PE=2 SV=2
  541 : H0ZJ41_TAEGU        0.39  0.63  355  405   16   66   51    0    0   74  H0ZJ41     Guanine nucleotide-binding protein subunit gamma OS=Taeniopygia guttata GN=GNG4 PE=3 SV=1
  542 : M3X5V2_FELCA        0.39  0.65  355  405   15   65   51    0    0   72  M3X5V2     Guanine nucleotide-binding protein subunit gamma OS=Felis catus GN=LOC101084346 PE=3 SV=1
  543 : M3Y070_MUSPF        0.39  0.65  355  405   15   65   51    0    0   72  M3Y070     Guanine nucleotide-binding protein subunit gamma OS=Mustela putorius furo GN=GNG12 PE=3 SV=1
  544 : Q3UGN1_MOUSE        0.39  0.69  355  405   11   61   51    0    0   68  Q3UGN1     Guanine nucleotide-binding protein subunit gamma OS=Mus musculus GN=Gng7 PE=3 SV=1
  545 : S9WYB7_9CETA        0.39  0.63  355  405   25   75   51    0    0   83  S9WYB7     Guanine nucleotide-binding protein subunit gamma OS=Camelus ferus GN=CB1_000570011 PE=3 SV=1
  546 : B7ZSW5_XENTR        0.38  0.63  408  595   44  269  227    4   41  293  B7ZSW5     Uncharacterized protein OS=Xenopus tropicalis GN=pdcl PE=2 SV=1
  547 : C1BZE9_ESOLU        0.38  0.71  354  405   10   61   52    0    0   89  C1BZE9     Guanine nucleotide-binding protein subunit gamma OS=Esox lucius GN=GBG10 PE=3 SV=1
  548 : D3DQV2_HUMAN        0.38  0.69  354  405   10   61   52    0    0   68  D3DQV2     Guanine nucleotide-binding protein subunit gamma OS=Homo sapiens GN=hCG_1992840 PE=3 SV=1
  549 : E2R9G5_CANFA        0.38  0.67  354  405   10   61   52    0    0   68  E2R9G5     Guanine nucleotide-binding protein subunit gamma OS=Canis familiaris GN=GNG10 PE=3 SV=1
  550 : F1SNC2_PIG          0.38  0.63  354  405   10   61   52    0    0   68  F1SNC2     Guanine nucleotide-binding protein subunit gamma OS=Sus scrofa GN=GNG10 PE=3 SV=1
  551 : F7ESA3_CALJA        0.38  0.69  354  405   10   61   52    0    0   68  F7ESA3     Guanine nucleotide-binding protein subunit gamma OS=Callithrix jacchus GN=GNG10 PE=3 SV=1
  552 : F7FAQ9_MACMU        0.38  0.67  354  405   10   61   52    0    0   68  F7FAQ9     Guanine nucleotide-binding protein subunit gamma OS=Macaca mulatta GN=GNG10 PE=3 SV=1
  553 : G1MMQ9_AILME        0.38  0.67  354  405    6   57   52    0    0   63  G1MMQ9     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=GNG10 PE=3 SV=1
  554 : G3UN41_LOXAF        0.38  0.67  354  405   10   61   52    0    0   68  G3UN41     Guanine nucleotide-binding protein subunit gamma OS=Loxodonta africana GN=LOC100662559 PE=3 SV=1
  555 : GBG10_HUMAN         0.38  0.67  354  405   10   61   52    0    0   68  P50151     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-10 OS=Homo sapiens GN=GNG10 PE=1 SV=1
  556 : GBG10_MOUSE         0.38  0.67  354  405   10   61   52    0    0   68  Q9CXP8     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-10 OS=Mus musculus GN=Gng10 PE=3 SV=1
  557 : H2UJI4_TAKRU        0.38  0.71  354  405   10   61   52    0    0   68  H2UJI4     Guanine nucleotide-binding protein subunit gamma OS=Takifugu rubripes GN=LOC101078912 PE=3 SV=1
  558 : H9GE21_ANOCA        0.38  0.62  346  405    3   62   60    0    0   70  H9GE21     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis GN=GNG8 PE=3 SV=1
  559 : H9GIN9_ANOCA        0.38  0.61  408  595   90  323  234    6   47  344  H9GIN9     Uncharacterized protein OS=Anolis carolinensis GN=PDCL PE=4 SV=2
  560 : I1G1L1_AMPQE        0.38  0.61  348  403    1   54   56    1    2   63  I1G1L1     Guanine nucleotide-binding protein subunit gamma OS=Amphimedon queenslandica PE=3 SV=1
  561 : I3JL46_ORENI        0.38  0.71  354  405   10   61   52    0    0   68  I3JL46     Guanine nucleotide-binding protein subunit gamma OS=Oreochromis niloticus GN=LOC100709453 PE=3 SV=1
  562 : I3NFK1_SPETR        0.38  0.71  354  405   10   61   52    0    0   68  I3NFK1     Guanine nucleotide-binding protein subunit gamma OS=Spermophilus tridecemlineatus PE=3 SV=1
  563 : K7AE17_PANTR        0.38  0.67  354  405   10   61   52    0    0   68  K7AE17     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNG10 PE=3 SV=1
  564 : K9IG77_DESRO        0.38  0.69  354  405   10   61   52    0    0   68  K9IG77     Guanine nucleotide-binding protein subunit gamma OS=Desmodus rotundus PE=3 SV=1
  565 : L9KP22_TUPCH        0.38  0.67  354  405   10   61   52    0    0   75  L9KP22     Guanine nucleotide-binding protein subunit gamma OS=Tupaia chinensis GN=TREES_T100013205 PE=3 SV=1
  566 : M4AGS3_XIPMA        0.38  0.71  354  405   10   61   52    0    0   68  M4AGS3     Guanine nucleotide-binding protein subunit gamma OS=Xiphophorus maculatus GN=GNG10 PE=3 SV=1
  567 : M7B4L2_CHEMY        0.38  0.62  346  405    3   62   60    0    0   70  M7B4L2     Guanine nucleotide-binding protein subunit gamma OS=Chelonia mydas GN=UY3_15843 PE=3 SV=1
  568 : Q3KRE3_RAT          0.38  0.67  354  405   10   61   52    0    0   68  Q3KRE3     Guanine nucleotide-binding protein subunit gamma OS=Rattus norvegicus GN=Gng10 PE=3 SV=1
  569 : Q3SZ98_BOVIN        0.38  0.67  354  405   10   61   52    0    0   68  Q3SZ98     Guanine nucleotide-binding protein subunit gamma OS=Bos taurus GN=GNG10 PE=3 SV=1
  570 : Q4SSJ9_TETNG        0.38  0.68  356  405   16   65   50    0    0   72  Q4SSJ9     Guanine nucleotide-binding protein subunit gamma OS=Tetraodon nigroviridis GN=GNG12 PE=3 SV=1
  571 : V4B465_LOTGI        0.38  0.65  352  405    2   56   55    1    1   63  V4B465     Uncharacterized protein (Fragment) OS=Lottia gigantea GN=LOTGIDRAFT_80489 PE=4 SV=1
  572 : A4IFL6_BOVIN        0.37  0.61  355  405   17   67   51    0    0   75  A4IFL6     Guanine nucleotide-binding protein subunit gamma OS=Bos taurus GN=GNG4 PE=3 SV=1
  573 : B1APZ0_HUMAN        0.37  0.61  355  405   17   67   51    0    0   75  B1APZ0     Guanine nucleotide-binding protein subunit gamma OS=Homo sapiens GN=GNG4 PE=3 SV=1
  574 : B5X6R3_SALSA        0.37  0.63  346  405    3   62   60    0    0   70  B5X6R3     Guanine nucleotide-binding protein subunit gamma OS=Salmo salar GN=GBG8 PE=3 SV=1
  575 : C1C4N2_LITCT        0.37  0.69  354  405   10   61   52    0    0   68  C1C4N2     Guanine nucleotide-binding protein subunit gamma OS=Lithobates catesbeiana GN=GBG10 PE=3 SV=1
  576 : D2HG04_AILME        0.37  0.65  355  405   15   65   51    0    0   72  D2HG04     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=LOC100477221 PE=3 SV=1
  577 : D3ZVY9_RAT          0.37  0.63  355  405   15   65   51    0    0   72  D3ZVY9     Guanine nucleotide-binding protein subunit gamma OS=Rattus norvegicus GN=LOC685513 PE=3 SV=1
  578 : E1BE27_BOVIN        0.37  0.65  355  405   15   65   51    0    0   72  E1BE27     Guanine nucleotide-binding protein subunit gamma OS=Bos taurus GN=LOC529425 PE=3 SV=1
  579 : E2A4E0_CAMFO        0.37  0.67  355  405   95  146   52    1    1  153  E2A4E0     Guanine nucleotide-binding protein subunit gamma OS=Camponotus floridanus GN=EAG_14270 PE=3 SV=1
  580 : F1SEX7_PIG          0.37  0.65  355  405   15   65   51    0    0   72  F1SEX7     Guanine nucleotide-binding protein subunit gamma OS=Sus scrofa GN=LOC100520008 PE=3 SV=1
  581 : F6QSV4_CALJA        0.37  0.61  355  405   17   67   51    0    0   75  F6QSV4     Guanine nucleotide-binding protein subunit gamma OS=Callithrix jacchus GN=GNG4 PE=3 SV=1
  582 : F6S600_HORSE        0.37  0.65  355  405   15   65   51    0    0   72  F6S600     Guanine nucleotide-binding protein subunit gamma OS=Equus caballus GN=LOC100063518 PE=3 SV=1
  583 : F6TFY2_MACMU        0.37  0.61  355  405   17   67   51    0    0   75  F6TFY2     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Macaca mulatta GN=LOC718223 PE=3 SV=1
  584 : F7CFG8_MONDO        0.37  0.67  354  405   10   61   52    0    0   68  F7CFG8     Guanine nucleotide-binding protein subunit gamma OS=Monodelphis domestica GN=GNG10 PE=3 SV=1
  585 : G1QAT7_MYOLU        0.37  0.67  354  405   10   61   52    0    0   68  G1QAT7     Guanine nucleotide-binding protein subunit gamma OS=Myotis lucifugus GN=GNG10 PE=3 SV=1
  586 : G1QRN5_NOMLE        0.37  0.61  355  405   13   63   51    0    0   71  G1QRN5     Guanine nucleotide-binding protein subunit gamma OS=Nomascus leucogenys GN=LOC100591313 PE=3 SV=2
  587 : G1RSZ8_NOMLE        0.37  0.67  354  405   10   61   52    0    0   68  G1RSZ8     Guanine nucleotide-binding protein subunit gamma OS=Nomascus leucogenys GN=LOC100590570 PE=3 SV=1
  588 : G3I3U2_CRIGR        0.37  0.61  355  405   17   67   51    0    0   75  G3I3U2     Guanine nucleotide-binding protein subunit gamma OS=Cricetulus griseus GN=I79_018110 PE=3 SV=1
  589 : G3NJ54_GASAC        0.37  0.63  355  405   15   65   51    0    0   72  G3NJ54     Guanine nucleotide-binding protein subunit gamma OS=Gasterosteus aculeatus GN=GNG12 (1 of 2) PE=3 SV=1
  590 : G3PV62_GASAC        0.37  0.71  354  405   10   61   52    0    0   68  G3PV62     Guanine nucleotide-binding protein subunit gamma OS=Gasterosteus aculeatus GN=GNG10 PE=3 SV=1
  591 : G3UJY6_LOXAF        0.37  0.61  355  405   17   67   51    0    0   75  G3UJY6     Guanine nucleotide-binding protein subunit gamma OS=Loxodonta africana GN=LOC100664179 PE=3 SV=1
  592 : G5BTJ6_HETGA        0.37  0.61  355  405   17   67   51    0    0   75  G5BTJ6     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_02989 PE=3 SV=1
  593 : G8Y9E0_PICSO        0.37  0.58    5  339   17  403  390   10   58  404  G8Y9E0     Piso0_004656 protein OS=Pichia sorbitophila (strain ATCC MYA-4447 / BCRC 22081 / CBS 7064 / NBRC 10061 / NRRL Y-12695) GN=Piso0_004656 PE=4 SV=1
  594 : GBG4_HUMAN          0.37  0.61  355  405   17   67   51    0    0   75  P50150     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-4 OS=Homo sapiens GN=GNG4 PE=1 SV=1
  595 : GBG4_MOUSE          0.37  0.61  355  405   17   67   51    0    0   75  P50153     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-4 OS=Mus musculus GN=Gng4 PE=2 SV=1
  596 : GBG4_PONAB          0.37  0.61  355  405   17   67   51    0    0   75  Q5R639     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-4 OS=Pongo abelii GN=GNG4 PE=3 SV=1
  597 : H0VQH2_CAVPO        0.37  0.61  355  405   17   67   51    0    0   75  H0VQH2     Guanine nucleotide-binding protein subunit gamma OS=Cavia porcellus GN=LOC100728440 PE=3 SV=1
  598 : H0WWA0_OTOGA        0.37  0.61  355  405   17   67   51    0    0   75  H0WWA0     Guanine nucleotide-binding protein subunit gamma OS=Otolemur garnettii GN=GNG4 PE=3 SV=1
  599 : H2NND1_PONAB        0.37  0.65  354  405   10   61   52    0    0   61  H2NND1     Guanine nucleotide-binding protein subunit gamma OS=Pongo abelii GN=GNG10 PE=3 SV=1
  600 : H2Q1D9_PANTR        0.37  0.61  355  405   17   67   51    0    0   75  H2Q1D9     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNG4 PE=3 SV=1
  601 : H9GJ33_ANOCA        0.37  0.69  354  405   10   61   52    0    0   68  H9GJ33     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis GN=GNG10 PE=3 SV=1
  602 : I3N418_SPETR        0.37  0.69  354  405    6   57   52    0    0   64  I3N418     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Spermophilus tridecemlineatus PE=3 SV=1
  603 : K4FSL1_CALMI        0.37  0.67  354  405   10   61   52    0    0   68  K4FSL1     Guanine nucleotide-binding protein subunit gamma OS=Callorhynchus milii PE=3 SV=1
  604 : K7E376_MONDO        0.37  0.61  355  405   17   67   51    0    0   75  K7E376     Guanine nucleotide-binding protein subunit gamma OS=Monodelphis domestica GN=GNG4 PE=3 SV=1
  605 : K7G463_PELSI        0.37  0.62  346  405    7   66   60    0    0   74  K7G463     Guanine nucleotide-binding protein subunit gamma OS=Pelodiscus sinensis GN=GNG4 PE=3 SV=1
  606 : L8HY24_9CETA        0.37  0.61  355  405   17   67   51    0    0   75  L8HY24     Guanine nucleotide-binding protein subunit gamma OS=Bos mutus GN=M91_17221 PE=3 SV=1
  607 : L8I9N0_9CETA        0.37  0.65  355  405   15   65   51    0    0   72  L8I9N0     Guanine nucleotide-binding protein subunit gamma OS=Bos mutus GN=M91_12609 PE=3 SV=1
  608 : M0R809_RAT          0.37  0.61  355  405   17   67   51    0    0   75  M0R809     Guanine nucleotide-binding protein subunit gamma OS=Rattus norvegicus GN=Gng4 PE=3 SV=1
  609 : M3W570_FELCA        0.37  0.61  355  405   17   67   51    0    0   75  M3W570     Guanine nucleotide-binding protein subunit gamma OS=Felis catus GN=GNG4 PE=3 SV=1
  610 : M3ZWJ1_XIPMA        0.37  0.63  355  405   17   67   51    0    0   75  M3ZWJ1     Guanine nucleotide-binding protein subunit gamma OS=Xiphophorus maculatus GN=GNG4 PE=3 SV=1
  611 : N6T8G5_DENPD        0.37  0.62  354  405   14   65   52    0    0   72  N6T8G5     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Dendroctonus ponderosae GN=D910_12615 PE=3 SV=1
  612 : Q0VFL5_XENTR        0.37  0.61  355  405   17   67   51    0    0   75  Q0VFL5     Guanine nucleotide-binding protein subunit gamma OS=Xenopus tropicalis GN=gng4 PE=3 SV=1
  613 : Q6AZS8_XENLA        0.37  0.61  355  405   17   67   51    0    0   75  Q6AZS8     Guanine nucleotide-binding protein subunit gamma OS=Xenopus laevis GN=gng4 PE=3 SV=1
  614 : S7NID8_MYOBR        0.37  0.61  355  405   13   63   51    0    0   71  S7NID8     Guanine nucleotide-binding protein subunit gamma OS=Myotis brandtii GN=D623_10010302 PE=3 SV=1
  615 : V8NA62_OPHHA        0.37  0.62  346  405    3   62   60    0    0   70  V8NA62     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-8 (Fragment) OS=Ophiophagus hannah GN=GNG8 PE=4 SV=1
  616 : V8NSB0_OPHHA        0.37  0.65  428  595   45  244  206    3   45  268  V8NSB0     Phosducin-like protein (Fragment) OS=Ophiophagus hannah GN=PDCL PE=4 SV=1
  617 : C3ZWK3_BRAFL        0.36  0.61  411  588   47  245  212    4   48  245  C3ZWK3     Putative uncharacterized protein OS=Branchiostoma floridae GN=BRAFLDRAFT_102980 PE=4 SV=1
  618 : D2A574_TRICA        0.36  0.62  351  405   11   65   55    0    0   72  D2A574     Guanine nucleotide-binding protein subunit gamma OS=Tribolium castaneum GN=GLEAN_15232 PE=3 SV=1
  619 : E2AH25_CAMFO        0.36  0.62  351  405   11   65   55    0    0   72  E2AH25     Guanine nucleotide-binding protein subunit gamma OS=Camponotus floridanus GN=EAG_02185 PE=3 SV=1
  620 : E2B3W4_HARSA        0.36  0.62  351  405   11   65   55    0    0   72  E2B3W4     Guanine nucleotide-binding protein subunit gamma OS=Harpegnathos saltator GN=EAI_09343 PE=3 SV=1
  621 : E2BJE5_HARSA        0.36  0.58  408  595   55  265  222    4   46  283  E2BJE5     Phosducin-like protein OS=Harpegnathos saltator GN=EAI_10084 PE=4 SV=1
  622 : E3MVK7_CAERE        0.36  0.55  351  405    1   56   56    1    1   63  E3MVK7     Guanine nucleotide-binding protein subunit gamma OS=Caenorhabditis remanei GN=Cre-gpc-1 PE=3 SV=1
  623 : E9H697_DAPPU        0.36  0.61  350  405    2   57   56    0    0   64  E9H697     Guanine nucleotide-binding protein subunit gamma OS=Daphnia pulex GN=Gng3 PE=3 SV=1
  624 : F1QTL0_DANRE        0.36  0.61  408  566   52  249  198    3   40  272  F1QTL0     Uncharacterized protein OS=Danio rerio GN=pdcl PE=4 SV=1
  625 : F4W4B3_ACREC        0.36  0.59  408  595   56  265  222    4   47  283  F4W4B3     Phosducin-like protein OS=Acromyrmex echinatior GN=G5I_00229 PE=4 SV=1
  626 : G1K9Q7_ANOCA        0.36  0.59  342  405    4   67   64    0    0   75  G1K9Q7     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis GN=GNG4 PE=3 SV=1
  627 : H0VIQ6_CAVPO        0.36  0.61  347  405    8   66   59    0    0   74  H0VIQ6     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Cavia porcellus GN=LOC100725986 PE=3 SV=1
  628 : H0VXZ6_CAVPO        0.36  0.62  350  405   10   65   56    0    0   72  H0VXZ6     Guanine nucleotide-binding protein subunit gamma OS=Cavia porcellus GN=LOC100717644 PE=3 SV=1
  629 : H9JR79_BOMMO        0.36  0.62  408  595   56  268  222    3   44  268  H9JR79     Uncharacterized protein OS=Bombyx mori PE=4 SV=1
  630 : H9JYM1_APIME        0.36  0.60  351  405   11   65   55    0    0   72  H9JYM1     Guanine nucleotide-binding protein subunit gamma OS=Apis mellifera GN=LOC725453 PE=3 SV=1
  631 : K7IM20_NASVI        0.36  0.58  408  595   56  266  222    4   46  284  K7IM20     Uncharacterized protein OS=Nasonia vitripennis PE=4 SV=1
  632 : Q6PBT0_DANRE        0.36  0.61  408  566   52  249  198    3   40  282  Q6PBT0     Zgc:73264 OS=Danio rerio GN=pdcl PE=2 SV=1
  633 : T1IR80_STRMM        0.36  0.64  350  405    2   57   56    0    0   64  T1IR80     Guanine nucleotide-binding protein subunit gamma OS=Strigamia maritima PE=3 SV=1
  634 : T1IVX5_STRMM        0.36  0.62  348  405    1   58   58    0    0  134  T1IVX5     Guanine nucleotide-binding protein subunit gamma OS=Strigamia maritima PE=3 SV=1
  635 : V8P679_OPHHA        0.36  0.58  342  405   57  120   64    0    0  128  V8P679     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-4 (Fragment) OS=Ophiophagus hannah GN=GNG4 PE=4 SV=1
  636 : B7PIY5_IXOSC        0.35  0.60  408  595   56  268  222    3   44  292  B7PIY5     Putative uncharacterized protein OS=Ixodes scapularis GN=IscW_ISCW017884 PE=4 SV=1
  637 : E1BS32_CHICK        0.35  0.59  343  405    4   66   63    0    0   74  E1BS32     Guanine nucleotide-binding protein subunit gamma OS=Gallus gallus GN=GNG4 PE=3 SV=1
  638 : E9IXK4_SOLIN        0.35  0.59  408  595   60  270  222    4   46  288  E9IXK4     Putative uncharacterized protein (Fragment) OS=Solenopsis invicta GN=SINV_04410 PE=4 SV=1
  639 : F1PJE5_CANFA        0.35  0.62  346  405    3   62   60    0    0   70  F1PJE5     Guanine nucleotide-binding protein subunit gamma OS=Canis familiaris GN=GNG8 PE=3 SV=2
  640 : G1NH37_MELGA        0.35  0.59  343  405    4   66   63    0    0   74  G1NH37     Guanine nucleotide-binding protein subunit gamma OS=Meleagris gallopavo GN=GNG4 PE=3 SV=1
  641 : G3MLG6_9ACAR        0.35  0.61  408  595   47  258  222    3   45  278  G3MLG6     Putative uncharacterized protein OS=Amblyomma maculatum PE=2 SV=1
  642 : L7M7M0_9ACAR        0.35  0.59  408  595   52  261  222    3   47  282  L7M7M0     Putative phosducin-like protein OS=Rhipicephalus pulchellus PE=2 SV=1
  643 : R7VBP5_CAPTE        0.35  0.63  407  595   53  269  223    4   41  294  R7VBP5     Uncharacterized protein OS=Capitella teleta GN=CAPTEDRAFT_171124 PE=4 SV=1
  644 : T1PC11_MUSDO        0.35  0.58  413  595   67  274  221    4   52  281  T1PC11     Phosducin OS=Musca domestica PE=2 SV=1
  645 : U5EYG4_9DIPT        0.35  0.58  409  595   70  281  225    4   52  300  U5EYG4     Putative phosducin-like protein OS=Corethrella appendiculata PE=2 SV=1
  646 : V5HH29_IXORI        0.35  0.60  408  595   56  268  222    3   44  292  V5HH29     Putative phosducin-like protein OS=Ixodes ricinus PE=2 SV=1
  647 : B4MX70_DROWI        0.34  0.58  408  595   65  277  226    4   52  281  B4MX70     GK14696 OS=Drosophila willistoni GN=Dwil\GK14696 PE=4 SV=1
  648 : D1MLP0_MAYDE        0.34  0.58  408  595   66  281  224    5   45  305  D1MLP0     Phosducin-like protein OS=Mayetiola destructor PE=4 SV=1
  649 : D3TNR9_GLOMM        0.34  0.58  414  595   71  277  216    3   44  281  D3TNR9     Conserved phosducin-like protein OS=Glossina morsitans morsitans PE=2 SV=1
  650 : D6WGP8_TRICA        0.34  0.57  408  595   50  261  222    3   45  278  D6WGP8     Putative uncharacterized protein OS=Tribolium castaneum GN=TcasGA2_TC002130 PE=4 SV=1
  651 : E3X228_ANODA        0.34  0.56  409  595   78  289  226    6   54  302  E3X228     Uncharacterized protein OS=Anopheles darlingi GN=AND_11707 PE=4 SV=1
  652 : G6DPP4_DANPL        0.34  0.59  408  595   57  269  226    4   52  269  G6DPP4     Uncharacterized protein OS=Danaus plexippus GN=KGM_08388 PE=4 SV=1
  653 : H2Z465_CIOSA        0.34  0.62  413  593   47  243  197    6   17  247  H2Z465     Uncharacterized protein OS=Ciona savignyi PE=4 SV=1
  654 : K1RA44_CRAGI        0.34  0.62  407  588   50  255  216    4   45  409  K1RA44     Phosducin-like protein OS=Crassostrea gigas GN=CGI_10023679 PE=4 SV=1
  655 : B3MAC6_DROAN        0.33  0.59  412  595   63  271  218    3   44  275  B3MAC6     GF10390 OS=Drosophila ananassae GN=Dana\GF10390 PE=4 SV=1
  656 : B4JZZ8_DROGR        0.33  0.58  408  595   65  277  226    4   52  281  B4JZZ8     GH23318 OS=Drosophila grimshawi GN=Dgri\GH23318 PE=4 SV=1
  657 : B4L0I5_DROMO        0.33  0.57  412  595   70  278  222    4   52  282  B4L0I5     GI13629 OS=Drosophila mojavensis GN=Dmoj\GI13629 PE=4 SV=1
  658 : B4LII7_DROVI        0.33  0.58  408  595   64  276  226    4   52  280  B4LII7     GJ13966 OS=Drosophila virilis GN=Dvir\GJ13966 PE=4 SV=1
  659 : C4WUW2_ACYPI        0.33  0.63  408  595   40  236  203    4   22  253  C4WUW2     ACYPI007649 protein OS=Acyrthosiphon pisum GN=ACYPI007649 PE=2 SV=1
  660 : E2A8X8_CAMFO        0.33  0.56  422  595    1  197  208    5   46  214  E2A8X8     Phosducin-like protein (Fragment) OS=Camponotus floridanus GN=EAG_07472 PE=4 SV=1
  661 : E5S4G4_TRISP        0.33  0.57  408  588   57  256  200    5   20  256  E5S4G4     Putative phosducin OS=Trichinella spiralis GN=Tsp_05791 PE=4 SV=1
  662 : F1LFA7_ASCSU        0.33  0.62  416  591   49  226  187    6   21  236  F1LFA7     Phosducin-like protein (Fragment) OS=Ascaris suum PE=2 SV=1
  663 : H2LYA5_ORYLA        0.33  0.59  343  405    1   63   63    0    0   71  H2LYA5     Guanine nucleotide-binding protein subunit gamma OS=Oryzias latipes GN=LOC101157742 PE=3 SV=1
  664 : H3IFT5_STRPU        0.33  0.60  414  595   65  272  217    5   45  293  H3IFT5     Uncharacterized protein OS=Strongylocentrotus purpuratus PE=4 SV=1
  665 : H9GPV0_ANOCA        0.33  0.59  343  405    1   63   63    0    0   71  H9GPV0     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis GN=GNG2 PE=3 SV=1
  666 : M3HT93_CANMX        0.33  0.55    2  339   23  447  427   11   91  448  M3HT93     Guanine nucleotide-binding protein subunit beta, putative OS=Candida maltosa (strain Xu316) GN=G210_0547 PE=4 SV=1
  667 : N6TH14_DENPD        0.33  0.58  408  595   52  263  222    3   45  281  N6TH14     Uncharacterized protein (Fragment) OS=Dendroctonus ponderosae GN=D910_01130 PE=4 SV=1
  668 : Q7QA23_ANOGA        0.33  0.55  409  595   72  283  226    6   54  293  Q7QA23     AGAP004468-PA OS=Anopheles gambiae GN=AGAP004468 PE=4 SV=4
  669 : T1I1G1_RHOPR        0.33  0.57  408  595   55  260  222    4   51  284  T1I1G1     Uncharacterized protein OS=Rhodnius prolixus PE=4 SV=1
  670 : T1JYW6_TETUR        0.33  0.61  341  405    9   74   66    1    1   96  T1JYW6     Guanine nucleotide-binding protein subunit gamma OS=Tetranychus urticae PE=3 SV=1
  671 : B3NI49_DROER        0.32  0.57  408  595   60  272  226    4   52  276  B3NI49     GG13535 OS=Drosophila erecta GN=Dere\GG13535 PE=4 SV=1
  672 : B4HIH3_DROSE        0.32  0.57  408  595   60  272  226    4   52  276  B4HIH3     GM24478 OS=Drosophila sechellia GN=Dsec\GM24478 PE=4 SV=1
  673 : B4PCH8_DROYA        0.32  0.57  408  595   60  272  226    4   52  276  B4PCH8     GE19829 OS=Drosophila yakuba GN=Dyak\GE22253 PE=4 SV=1
  674 : B4QL45_DROSI        0.32  0.57  408  595   60  272  226    4   52  276  B4QL45     GD12551 OS=Drosophila simulans GN=Dsim\GD12551 PE=4 SV=1
  675 : F1L8F7_ASCSU        0.32  0.61  416  591   63  240  188    6   23  250  F1L8F7     Phosducin-like protein OS=Ascaris suum PE=2 SV=1
  676 : F1L9L2_ASCSU        0.32  0.61  416  591   50  227  188    6   23  237  F1L9L2     Phosducin-like protein OS=Ascaris suum PE=2 SV=1
  677 : F1LDU4_ASCSU        0.32  0.61  416  591   62  239  188    6   23  249  F1LDU4     Phosducin-like protein OS=Ascaris suum PE=2 SV=1
  678 : PHLP_DROME          0.32  0.57  408  595   60  272  226    4   52  276  Q9VUR7     Phosducin-like protein OS=Drosophila melanogaster GN=CG7650 PE=1 SV=2
  679 : T1G4J2_HELRO        0.32  0.54  414  588   56  251  212    7   54  318  T1G4J2     Uncharacterized protein OS=Helobdella robusta GN=HELRODRAFT_81825 PE=4 SV=1
  680 : T1J184_STRMM        0.32  0.60  408  595   48  257  222    3   47  268  T1J184     Uncharacterized protein OS=Strigamia maritima PE=4 SV=1
  681 : U1MBB8_ASCSU        0.32  0.61  416  591   68  245  189    7   25  255  U1MBB8     Phosducin-like protein OS=Ascaris suum GN=ASU_09845 PE=4 SV=1
  682 : V3Z3J5_LOTGI        0.32  0.61  407  595   46  258  223    4   45  275  V3Z3J5     Uncharacterized protein (Fragment) OS=Lottia gigantea GN=LOTGIDRAFT_221428 PE=4 SV=1
  683 : E0VIS2_PEDHC        0.31  0.56  408  595   52  258  222    3   50  275  E0VIS2     Phosducin, putative OS=Pediculus humanus subsp. corporis GN=Phum_PHUM232110 PE=4 SV=1
  684 : F6PYG2_CIOIN        0.31  0.52  413  594   52  249  218    5   57  257  F6PYG2     Uncharacterized protein OS=Ciona intestinalis GN=LOC100179946 PE=4 SV=2
  685 : G4VHU3_SCHMA        0.31  0.55  414  595   54  259  217    6   47  278  G4VHU3     Phosducin-like protein (Phlp) OS=Schistosoma mansoni GN=Smp_036130 PE=4 SV=1
  686 : H2KPJ9_CLOSI        0.31  0.59  415  595   59  261  205    7   27  279  H2KPJ9     Phosducin-like protein OS=Clonorchis sinensis GN=CLF_102126 PE=4 SV=1
  687 : Q16R22_AEDAE        0.31  0.57  408  595   59  271  226    4   52  286  Q16R22     AAEL011096-PA OS=Aedes aegypti GN=AAEL011096 PE=4 SV=1
  688 : Q2M1D7_DROPS        0.31  0.58  408  595   60  272  226    4   52  276  Q2M1D7     GA20503 OS=Drosophila pseudoobscura pseudoobscura GN=Dpse\GA20503 PE=4 SV=1
  689 : T1KKG2_TETUR        0.31  0.56  408  595   56  275  225    5   43  302  T1KKG2     Uncharacterized protein OS=Tetranychus urticae PE=4 SV=1
## ALIGNMENTS    1 -   70
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1    2 B S              0   0  117  195   58   SSSSSSSSSS SSS SSSS SSSSSS S            SS  SSSSS    SSSS     G      
     2    3 B E     >  -     0   0  107  209   43   EEEEEEEEEE EEE EEEE EEEEEE E            EE  EEEEE    EEEE     E      
     3    4 B L  H  > S+     0   0   52  229   31  LLLLLLLLLLL LLL LLLL LLLLLL L            LL  LLLLL    LLLL     M      
     4    5 B D  H  > S+     0   0  104  229   51  DDDDDDDDDDD DDD DDDD DDDDDD D            DD  DDDDD    DDDD     E      
     5    6 B Q  H  > S+     0   0  131  230   62  QQQQQQQQQQQ QQQ QQQQ QQQQQQ Q            QQ  QQQQQ    QQQQ     Q      
     6    7 B L  H  X S+     0   0   27  230   61  LLLLLLLLLLL LLL LLLL LLLLLL L            LL  LLLLL    LLLL     L      
     7    8 B R  H  X S+     0   0  110  233    4  RRRRRRRRRRR RRR RRRR RRRRRR R            RR  RRRRR    RRRR     R      
     8    9 B Q  H  X S+     0   0  117  233   49  QQQQQQQQQQQ QQQ QQQQ QQQQQQ Q            QQ  QQQQQ    QQQQ     Q      
     9   10 B E  H  X S+     0   0   78  234    8  EEEEEEEEEEE EEE EEEE EEEEEE E            EE  EEEEE    EEEE     E      
    10   11 B A  H  X S+     0   0    1  234    8  AAAAAAAAAAA AAA AAAA AAAAAA A            AA  AAAAA    AAAA     A      
    11   12 B E  H  X S+     0   0  121  234    8  EEEEEEEEEEE EEE EEEE EEEEEE E            EE  EEEEE    EEEE     E      
    12   13 B Q  H  X S+     0   0  111  238   70  QQQQQQQQQQQ QQQ QQQQ QQQQQQ Q            QQ  QQQQQ    QQQQ     Q      
    13   14 B L  H  X S+     0   0   14  238    4  LLLLLLLLLLL LLL LLLL LLLLLL L            LL  LLLLL    LLLL     L      
    14   15 B K  H  X S+     0   0   99  238   24  KKKKKKKKKKK KKK KKKK KKKKKK K            KK  KKKKK    KKKK     K      
    15   16 B N  H  X S+     0   0   33  239   51  NNNNNNNNNNN NNN NNNN NNNNNN N            NN  NNNNN    NNNN     K      
    16   17 B Q  H  X S+     0   0   82  239   58  QQQQQQQQQQQ QQQ QQQQ QQQQQQ Q            QQ  QQQQQ    QQQQ     Q      
    17   18 B I  H  X S+     0   0    7  240    4  IIIIIIIIIII III IIII IIIIII I            II  IIIII    IIII     I      
    18   19 B R  H  X S+     0   0  135  242   52  RRRRRRRRRRR RRR RRRRQRRRRRR R            RR  RRRRR    RRRR     A      
    19   20 B D  H  X S+     0   0   85  244   60  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D      
    20   21 B A  H  X S+     0   0   36  243   62  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A      
    21   22 B R  H >X S+     0   0   22  244   22  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R      
    22   23 B K  H 3< S+     0   0  136  244   50  KKKKKKKKKKK KKK KKKKKKKKKKK K            KK  KKKKK    KKKK     K      
    23   24 B A  H 3< S+     0   0   79  244   56  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A      
    24   25 B C  H << S+     0   0   19  244   85  CCCCCCCCCCC CCC CCCCCCCCCCC C            CC  CCCCC    CCCC     C      
    25   26 B A     <  +     0   0   46  244   56  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A      
    26   27 B D        +     0   0   88  243    0  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D      
    27   28 B A        -     0   0   17  243   50  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     V      
    28   29 B T    >>  -     0   0   59  244   35  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T      
    29   30 B L  H 3> S+     0   0    0  244    3  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L      
    30   31 B S  H 34 S+     0   0   38  244   90  SSSSSSSSSSS SSS SSSSSSSSSSS A            SA  SSASS    AAAA     A      
    31   32 B Q  H X4 S+     0   0  119  247   50  QQQQQQQQQQQ QQQ QQQQQQXQQQQ Q            QQ  QQQQQ    QQQQ     E      
    32   33 B I  H 3< S+     0   0   28  248   52  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     L     I
    33   34 B T  T >< S+     0   0    0  249   56  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     V     T
    34   35 B N  T <  S+     0   0  129  249   72  NNNNNNNNNNN NNN NNNANATNNAA A            AA  AAAAA    AAAA     S     T
    35   36 B N  T 3  S+     0   0  111  249   55  NNNNNNNNNNN NNN NNNNNNNNNNN N            NN  NNNNN    NNNN     G     S
    36   37 B I  S <  S-     0   0   21  249   49  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     L     L
    37   38 B D        -     0   0  138  249   32  DDDDDDDDDDD DDD DDDDDDDDDED D            DD  DDDDD    DDDD     E     D
    38   39 B P        -     0   0   89  250   59  PPPPPPPPPPP PPP PPPPPPPPPPP P            PP  PPPPP    PPPP     V     S
    39   40 B V        -     0   0   23  251   30  VVVVVVVVVVV VVV VVVVVVVVVVV V            VV  VVVIV    VVVV     V     V
    40   41 B G        -     0   0   54  251   45  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
    41   42 B R        -     0   0  115  251    6  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
    42   43 B I        +     0   0    8  251   27  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     V     I
    43   44 B Q        -     0   0   54  251   59  QQQQQQQQQQQ QQQ QQQQQQQQQQQ Q            QQ  QQQQQ    QQQQ     Q     Q
    44   45 B M        -     0   0   11  252    5  MMMMMMMMMMM MMM MMMMMMMMMMM M            MM  MMMMM    MMMM     M     M
    45   46 B R        -     0   0   49  252   18  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
    46   47 B T  E     +A  338   0A  12  252   43  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
    47   48 B R  E     +     0   0A  56  252   11  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
    48   49 B R  E     -A  337   0A  60  252    9  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
    49   50 B T  E     -A  336   0A  30  252   20  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
    50   51 B L  E     -A  335   0A   0  252    0  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
    51   52 B R        +     0   0  159  252   22  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
    52   53 B G        +     0   0   20  252    0  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
    53   54 B H        -     0   0    4  252    0  HHHHHHHHHHH HHH HHHHHHHHHHH H            HH  HHHHH    HHHH     H     H
    54   55 B L  S    S+     0   0  116  252    4  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
    55   56 B A  S    S-     0   0    0  252    4  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
    56   57 B K        -     0   0   15  252    0  KKKKKKKKKKK KKK KKKKKKKKKKK K            KK  KKKKK    KKKK     K     K
    57   58 B I  E     -D   73   0B   0  252    1  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     I     I
    58   59 B Y  E     -     0   0B   6  252    4  YYYYYYYYYYY YYY YYYYYYYYYYY Y            YY  YYYYY    YYYY     Y     Y
    59   60 B A  E     -D   72   0B  13  252    5  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
    60   61 B M  E     -D   71   0B  15  252    4  MMMMMMMMMMM MMM MMMMMMMMMMM M            MM  MMMMM    MMMM     M     M
    61   62 B H  E     -D   70   0B  44  252    4  HHHHHHHHHHH HHH HHHHHHHHHHH H            HH  HHHHH    HHHH     H     H
    62   63 B W  E     -D   69   0B  11  252    0  WWWWWWWWWWW WWW WWWWWWWWWWW W            WW  WWWWW    WWWW     W     W
    63   64 B G    >   -     0   0    3  252   43  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
    64   65 B T  T 3  S+     0   0   75  252   58  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     S
    65   66 B D  T 3  S-     0   0   80  252    1  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
    66   67 B S  S <  S+     0   0    3  252   50  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
    67   68 B R  S    S+     0   0   94  252   20  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
    68   69 B L  E     + E   0  82B  31  252   80  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
    69   70 B L  E     -DE  62  81B   0  252   12  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
    70   71 B L  E     -DE  61  80B   0  252    3  VVVVVVVVVVV VVV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
    71   72 B S  E     -DE  60  79B   0  252    1  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
    72   73 B A  E     -DE  59  78B   0  252    1  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
    73   74 B S  E >>  -DE  57  77B   0  252    1  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
    74   75 B Q  T 34 S+     0   0    1  252    1  QQQQQQQQQQQ QQQ QQQQQQQQQQQ Q            QQ  QQQQQ    QQQQ     Q     Q
    75   76 B D  T 34 S-     0   0    9  252    1  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
    76   77 B G  T <4 S+     0   0    7  252    1  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
    77   78 B K  E  <  -EF  73  93B  52  252    7  KKKKKKKKKKK KKK KKKKKKKKKKK K            KK  KKKKK    KKKK     K     K
    78   79 B L  E     -EF  72  92B   0  252    2  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
    79   80 B I  E     -EF  71  91B   0  252    3  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     I     I
    80   81 B I  E     -EF  70  90B   0  252   16  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     I     I
    81   82 B W  E     -EF  69  88B   0  252    0  WWWWWWWWWWW WWW WWWWWWWWWWW W            WW  WWWWW    WWWW     W     W
    82   83 B D  E >>> -EF  68  87B  21  252    2  DDDDDDDDDDD DDD DDDDDDDVDDD D            DD  DDDDD    DDDD     D     D
    83   84 B S  T 345S+     0   0    0  252   52  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
    84   85 B Y  T 345S+     0   0   57  251   17  YYYYYYYYYYY YYY YYYYYYYYYYY Y            YY  YYYYY    YYYY     Y     Y
    85   86 B T  T <45S-     0   0   56  252    5  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
    86   87 B T  T  <5 +     0   0   43  252    4  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
    87   88 B N  E   < -F   82   0B  99  252    4  NNNNNNNNNNN NNN NNNNNNNNNNN N            NN  NNNNN    NNNN     N     N
    88   89 B K  E     +F   81   0B  95  249    1  KKKKKKKKKKK KKK KKKKKKKKKKK K            KK  KKKKK    KKKK     K     K
    89   90 B V  E    S+     0   0B  66  249   17  VVVVVVVVVVV VVV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     M
    90   91 B H  E     -F   80   0B  57  249    2  HHHHHHHHHHH HHH HHHHHHHHHHH H            HH  HHHHH    HHHH     H     H
    91   92 B A  E     -F   79   0B  43  251    0  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
    92   93 B I  E     -F   78   0B   0  252    0  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     I     I
    93   94 B P  E     -F   77   0B  80  252    4  PPPPPPPPPPP PPP PPPPPPPPPPP P            PP  PPPPP    PPPP     P     P
    94   95 B L        -     0   0   26  252    0  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
    95   96 B R  S    S+     0   0  190  252    6  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
    96   97 B S        -     0   0   17  252    3  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
    97   98 B S  S    S+     0   0    6  252    3  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
    98   99 B W        +     0   0    2  252    0  WWWWWWWWWWW WWW WWWWWWWWWWW W            WW  WWWWW    WWWW     W     W
    99  100 B V  E     -G  115   0C   4  252    0  VVVVVVVVVVV VVV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
   100  101 B M  E     +     0   0C   5  252    0  MMMMMMMMMMM MMM MMMMMMMMMMM M            MM  MMMMM    MMMM     M     M
   101  102 B T  E     -G  114   0C   8  252    0  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   102  103 B C  E     -G  113   0C   0  252    1  CCCCCCCCCCC CCC CCCCCCCCCCC C            CC  CCCCC    CCCC     C     C
   103  104 B A  E     -G  112   0C   0  252    3  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   104  105 B Y  E     -G  111   0C   9  252    2  YYYYYYYYYYY YYY YYYYYYYYYYY Y            YY  YYYYY    YYYY     Y     Y
   105  106 B A    >   -     0   0    0  252   22  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   106  107 B P  T 3  S+     0   0   64  252    3  PPPPPPPPPPP PPP PPPPPPPPPPP P            PP  PPPPP    PPPP     P     P
   107  108 B S  T 3  S-     0   0   47  252    6  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   108  109 B G  S <  S+     0   0    8  252    6  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   109  110 B N  S    S+     0   0   50  252   22  NNNNNNNNNNN NNN NNNNNNNNNNN N            NN  NNNNN    NNNN     N     N
   110  111 B Y  E     - H   0 124C  50  252   13  YYYYYYYYYYY YYY YYYYYYYYYYY Y            YY  YYYYY    YYYY     Y     Y
   111  112 B V  E     -GH 104 123C   0  252    0  VVVVVVVVVVV VVV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
   112  113 B A  E     +GH 103 122C   0  252    2  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   113  114 B C  E     +GH 102 121C   5  252    2  CCCCCCCCCCC CCC CCCCCCCCCCC C            CC  CCCCC    CCCC     C     C
   114  115 B G  E     +GH 101 120C   1  252    0  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   115  116 B G  E >  S-G   99   0C   0  252    0  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   116  117 B L  T 3  S+     0   0    1  252    0  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   117  118 B D  T 3  S-     0   0   50  252    0  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   118  119 B N  S <  S+     0   0   30  252    0  NNNNNNNNNNN NNN NNNNNNNNNNN N            NN  NNNNN    NNNN     N     N
   119  120 B I  E     - I   0 139C  39  252   24  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     I     I
   120  121 B C  E     -HI 114 138C   0  252    3  CCCCCCCCCCC CCC CCCCCCCCCCC C            CC  CCCCC    CCCC     C     C
   121  122 B S  E     -HI 113 137C   9  252    6  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   122  123 B I  E     -HI 112 136C   0  252    2  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     I     I
   123  124 B Y  E     -H  111   0C   3  252    0  YYYYYYYYYYY YYY YYYYYYYYYYY Y            YY  YYYYY    YYYY     Y     Y
   124  125 B N  E     +H  110   0C  24  252   40  NNNNNNNNNNN NNN NNNNNNNNNNS N            NN  SNNNS    NNNN     N     N
   125  126 B L        +     0   0   11  252    1  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   126  127 B K  S    S+     0   0  109  252   43  KKKKKKKKKKK KKK KKKKKKKKKKK K            KK  KKKKK    KKKK     K     K
   127  128 B T  S    S-     0   0   64  252   55  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   128  129 B R  S    S+     0   0  267  250   17  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
   129  130 B E  S    S-     0   0  173  251    9  EEEEEEEEEEE EEE EEEEEEEEEEE E            EE  EEEEE    EEEE     E     E
   130  131 B G        -     0   0   50  252   11  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   131  132 B N        +     0   0   30  252   52  NNNNNNNNNNN NNN NNNNNNNNNNN N            NN  NNNNN    NNNN     N     N
   132  133 B V  S    S+     0   0   58  253   42  VVVVVVVVVVV VVV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
   133  134 B R  S    S-     0   0  213  253   22  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
   134  135 B V        -     0   0   29  253   15  VVVVVVVVVVV VVV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
   135  136 B S  S    S-     0   0   43  253   48  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   136  137 B R  E     -I  122   0C 105  253    7  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
   137  138 B E  E     -I  121   0C  75  253    3  EEEEEEEEEEE EEE EEEEEEEEEEE E            EE  EEEEE    EEEE     E     E
   138  139 B L  E     +I  120   0C   1  252    1  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   139  140 B A  E     +I  119   0C  61  252   57  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     P
   140  141 B G        +     0   0   50  252   25  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   141  142 B H        -     0   0    9  252    2  HHHHHHHHHHH HHH HHHHHHHHHHH H            HH  HHHHH    HHHH     H     H
   142  143 B T  S    S+     0   0   64  252   42  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   143  144 B G  S    S-     0   0    0  252    2  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   144  145 B Y        -     0   0    0  251    0  YYYYYYYYYYY YYY YYYYYYYYYYY Y            YY  YYYYY    YYYY     Y     Y
   145  146 B L  E     +J  160   0D   0  251    1  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   146  147 B S  E     -     0   0D   3  251    0  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   147  148 B C  E     -J  159   0D   9  251    5  CCCCCCCCCCC CCC CCCCCCCCCCC C            CC  CCCCC    CCCC     C     C
   148  149 B C  E     -J  158   0D   0  251    0  CCCCCCCCCCC CCC CCCCCCCCCCC C            CC  CCCCC    CCCC     C     C
   149  150 B R  E     -J  157   0D  53  251    4  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
   150  151 B F  E     -J  156   0D  10  251    0  FFFFFFFFFFF FFF FFFFFFFFFFF F            FF  FFFFF    FFFF     F     F
   151  152 B L  S    S-     0   0   26  251   24  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLVL    LLVV     L     L
   152  153 B D  S    S-     0   0   60  251   40  DDDDDDDDDDD DDD DDDDDDNDDDD D            DD  DDDDD    DDDD     D     D
   153  154 B D  S    S+     0   0   60  251    2  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   154  155 B N  S    S+     0   0   44  251   65  NNNNNNNNNNN NNN NNNNNNNNNNN N            NN  NNNSN    NNNN     N     N
   155  156 B Q  E     + K   0 169D  60  251   47  QQQQQQQQQQQ QQQ QQQQQQQQQQQ Q            QQ  QQQQQ    QQQQ     Q     Q
   156  157 B I  E     -JK 150 168D   0  251    1  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     I     I
   157  158 B V  E     -JK 149 167D   0  251   22  VVVVVVVVVVV VVV VVVVVVVVVVV V            VV  VVVVV    VIVV     V     V
   158  159 B T  E     -JK 148 166D   0  251    1  TTTTTTTTTTT TTT TTITTTTTTTT T            TT  TTTTT    TTTT     T     T
   159  160 B S  E     -JK 147 165D   0  251    2  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSR    SSSS     S     S
   160  161 B S  E >   -J  145   0D   0  251    0  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   161  162 B G  T 3  S+     0   0    0  251    0  GGGGGGGGGGG GGG GGGGGGEGGGG G            GG  GGGGG    GGGG     G     G
   162  163 B D  T 3  S-     0   0    5  251    0  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   163  164 B T  S <  S+     0   0    8  251   63  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   164  165 B T        -     0   0    2  251   16  TTTTTTTTTTT TTT TTATTTTTTST T            TT  TSTTT    TTTT     T     T
   165  166 B C  E     -KL 159 179D   0  251    0  CCCCCCCCCCC CCC CCCCCCCCCCC C            CC  CCCCC    CCCC     C     C
   166  167 B A  E     -KL 158 178D   0  252   62  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   167  168 B L  E     -KL 157 177D   6  252    6  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   168  169 B W  E     -KL 156 175D   2  252    0  WWWWWWWWWWW WWW WWWWWWWWWWW W            WW  WWWWW    WWWW     W     W
   169  170 B D  E >>> -KL 155 174D  37  252    0  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   170  171 B I  T 345S+     0   0    7  252    8  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     I     I
   171  172 B E  T 345S+     0   0  144  252    6  EEEEEEEEEEE EEE EEEEEEEEEEE E            EE  EEEEE    EEEE     E     E
   172  173 B T  T <45S-     0   0   78  252   36  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   173  174 B G  T  <5 +     0   0   16  253    8  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   174  175 B Q  E   < -L  169   0D 135  253   68  QQQQQQQQQQQ QQQ QQQQQQQQQQQ Q            QQ  QQQQQ    QQQQ     Q     Q
   175  176 B Q  E     -L  168   0D  30  253   45  QQQQQQQQQQQ QQQ QQQQQQQQQQQ Q            QQ  QQQQQ    QQQQ     Q     Q
   176  177 B T  E     +     0   0D  64  253   73  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   177  178 B T  E     -L  167   0D  20  253   47  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   178  179 B T  E     -L  166   0D   5  253   77  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   179  180 B F  E     +L  165   0D   1  253    0  FFFFFFFFFFF FFF FFFFFFFFFFF F            FF  FFFFF    FFFF     F     F
   180  181 B T        +     0   0   34  253   72  TTTTTTTTTTT TTT TTTTTTTTTAA T            AT  AATAA    TTTT     T     T
   181  182 B G        +     0   0   37  253   30  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   182  183 B H        -     0   0    7  253    0  HHHHHHHHHHH HHH HHHHHHHHHHH H            HH  HHHHH    HHHH     H     H
   183  184 B T  S    S+     0   0   99  253   63  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   184  185 B G  S    S-     0   0    0  253    1  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   185  186 B D        -     0   0    1  253    1  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   186  187 B V  E     -M  202   0E   0  253   22  VVVVVVVVVVV VVV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
   187  188 B M  E     +     0   0E   3  253    1  MMMMMMMMMMM MMM MMMMMMMMMMM M            MM  MMMMM    MMMM     M     M
   188  189 B S  E     -M  201   0E  16  253    8  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   189  190 B L  E     -M  200   0E   3  253   14  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   190  191 B S  E     -M  199   0E  21  253   24  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   191  192 B L  E     -M  198   0E  29  253   29  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   192  193 B A    >   -     0   0    4  253   57  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     S
   193  194 B P  T 3  S+     0   0   85  253   13  PPPPPPPPPPP PPP PPPPPPPPPPP P            PP  PPPPP    PPPP     P     P
   194  195 B D  T 3  S-     0   0   87  253   52  DDDDDDDDDDD DDD DDGDDDDDDDD D            DD  DDDDD    DDDD     D     D
   195  196 B T  S <  S+     0   0   62  253   97  TTTTTTTTTTT TTT TTTTTTTTTTT A            TA  TTATT    ASSS     T     M
   196  197 B R  S    S+     0   0  142  252   61  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRKK     R     R
   197  198 B L  E     - N   0 211E  37  252   71  LLLLLLLLLLL LLL LLLLLLLLLLL C            MC  LLCLL    CCCC     L     T
   198  199 B F  E     -MN 191 210E   0  252    0  FFFFFFFFFFF FFF FFFFFFFFFFF F            FF  FFFFF    FFFF     F     F
   199  200 B V  E     -MN 190 209E   0  252   11  VVVVVVVVVVV VVV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
   200  201 B S  E     -MN 189 208E   0  252    0  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   201  202 B G  E     +MN 188 207E   0  252    0  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   202  203 B A  E >   -M  186   0E   0  252    4  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   203  204 B C  T 3  S+     0   0    5  252    2  CCCCCCCCCCC CCC CCCCCCCCCCC C            CC  CCCCC    CCCC     C     C
   204  205 B D  T 3  S-     0   0   31  252    0  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   205  206 B A  S <  S+     0   0   20  252   16  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   206  207 B S  E     - O   0 222E   6  252   69  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   207  208 B A  E     -NO 201 221E   0  252   35  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     S
   208  209 B K  E     -NO 200 220E  18  252    0  KKKKKKKKKKK KKK KKKKKKKKKKK K            KK  KKKKK    KKKK     K     K
   209  210 B L  E     -NO 199 219E   2  252    8  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   210  211 B W  E     -NO 198 217E   1  252    0  WWWWWWWWWWW WWW WWWWWWWWWWW W            WW  WWWWW    WWWW     W     W
   211  212 B D  E >>> -NO 197 216E  11  252    1  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   212  213 B V  T 345S+     0   0   12  252   19  VVVVVVVVVVV VVV VVVVVVVVVVI V            IV  IIVVI    VIVV     V     I
   213  214 B R  T 345S+     0   0  194  252    1  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
   214  215 B E  T <45S-     0   0  111  252   59  EEEEEEEEEEE EEE EEEEEEEEEEE E            EE  EEEEE    EEEE     E     D
   215  216 B G  T  <5 +     0   0    8  252   25  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   216  217 B M  E      -     0   0    1  252    0  FFFFFFFFFFF FFF FFFFFFFFFFF F            FF  FFFFF    FFFF     F     F
   235  236 B P  T 3  S+     0   0   45  252    0  PPPPPPPPPPP PPP PPPPPPPPPPP P            PP  PPPPP    PPPP     P     P
   236  237 B N  T 3  S-     0   0   42  252   27  NNNNNNNNNNN NNN NNNNNNNNNNN N            NN  NNNNN    KNNN     N     N
   237  238 B G  S <  S+     0   0   12  252    8  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   238  239 B N  S    S+     0   0   56  252   76  NNNNNNNNNNN NNN NNNNNNNNNNN N            NN  NNNNN    NNNN     N     H
   239  240 B A  E     - Q   0 253F   0  252   11  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   240  241 B F  E     -PQ 233 252F   0  252   16  FFFFFFFFFFF FFF FFFFFFFFFFF F            FF  FFFFF    FFFF     F     F
   241  242 B A  E     -PQ 232 251F   0  252   51  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   242  243 B T  E     -PQ 231 250F   0  252    0  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   243  244 B G  E     +PQ 230 249F   0  252    0  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   244  245 B S  E >   -P  228   0F   0  252    0  SSSSSSSSSSS SSS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   245  246 B D  T 3  S+     0   0   13  252    0  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   246  247 B D  T 3  S-     0   0   28  252    0  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   247  248 B A  S <  S+     0   0    6  252   12  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   248  249 B T        -     0   0   16  252   42  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   249  250 B C  E     -QR 243 263F   0  252    3  CCCCCCCCCCC CCC CCCCCCCCCCC C            CC  CCCCC    CCCC     C     C
   250  251 B R  E     -QR 242 262F  23  252    3  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
   251  252 B L  E     -QR 241 261F   0  252    0  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   252  253 B F  E     -QR 240 259F   1  251    0  FFFFFFFFFFF FFF FFFFFFFFFFF F            FF  FFFFF    FFFF     F     F
   253  254 B D  E  >> -QR 239 258F   1  251    0  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   254  255 B L  T >45S+     0   0   15  251   26  LLLLLLLLLLL LLL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   255  256 B R  T 345S+     0   0   57  251    0  RRRRRRRRRRR RRR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
   256  257 B A  T 345S-     0   0    0  251    8  AAAAAAAAAAA AAA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   257  258 B D  T <<5 +     0   0    0  251    0  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   258  259 B Q  E      -     0   0  119  253   47  HHHHHHHHHHH HHH HHHHHHHHHHH H            HH  HHHHH    HHHH     H     H
   266  267 B D  T 3  S+     0   0  161  253   25  DDDDDDDDDDD DDD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   267  268 B N  T 3  S+     0   0   66  253   48  NNNNNNNNNNN NNN NNNNNNNNNNN N            NN  NNNNN    NNNN     N     N
   268  269 B I    <   +     0   0   23  253   21  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     I     I
   269  270 B I        +     0   0   97  253   31  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     I     I
   270  271 B C  S    S-     0   0   10  253    6  CCCCCCCCCCC CCC CCCCCCCCCCC C            CC  CCCCC    CCCC     C     C
   271  272 B G        -     0   0    1  253    0  GGGGGGGGGGG GGG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   272  273 B I  E     +S  288   0G   0  253    1  IIIIIIIIIII III IIIIIIIIIII I            II  IIIII    IIII     I     I
   273  274 B T  E     +     0   0G  13  253    4  TTTTTTTTTTT TTT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   274  275 B S  E     +S  287   0G  18  252    0  SSSSSSSSSSS  SS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   275  276 B V  E     +S  286   0G  10  252    5  VVVVVVVVVVV  VV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
   276  277 B S  E     -S  285   0G  15  252   21  SSSSSSSSSSS  SS SSSSSSSSSAA A            AA  AAAAA    AAAA     S     A
   277  278 B F  E     -S  284   0G  12  252   13  FFFFFFFFFFF  FF FFFFFFFFFFF F            FF  FFFFF    FFFF     F     F
   278  279 B S        -     0   0    3  252    1  SSSSSSSSSSS  SS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   279  280 B K  S    S+     0   0  104  252   80  KKKKKKKKKKK  KK KKKKKKKKKKK K            KK  KKKKK    KKKK     K     K
   280  281 B S  S    S-     0   0    2  252    0  SSSSSSSSSSS  SS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   281  282 B G  S    S+     0   0    0  252    0  GGGGGGGGGGG  GG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   282  283 B R        +     0   0    8  252    0  RRRRRRRRRRR  RR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
   283  284 B L  E     - T   0 297G   0  252   11  LLLLLLLLLLL  LL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   284  285 B L  E     -ST 277 296G   0  252    3  LLLLLLLLLLL  LL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   285  286 B L  E     -ST 276 295G   0  252   13  LLLLLLLLLLL  LL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   286  287 B A  E     -ST 275 294G   0  252   11  AAAAAAAAAAA  AA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   287  288 B G  E     -ST 274 293G   2  252    4  GGGGGGGGGGG  GG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   288  289 B Y  E >   -S  272   0G   4  252    0  YYYYYYYYYYY  YY YYYYYYYYYYY Y            YY  YYYYY    YYYY     Y     Y
   289  290 B D  T 3  S+     0   0    3  252    3  DDDDDDDDDDD  DD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   290  291 B D  T 3  S-     0   0   37  252    1  DDDDDDDDDDD  DD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   291  292 B F  S <  S+     0   0    3  252    3  FFFFFFFFFFF  FF FFFFFFFFFFF F            FF  FFFFF    FFFF     F     F
   292  293 B N        -     0   0   15  252   39  NNNNNNNNNNN  NN NNNNNNNNNNN N            NN  NNNNN    NNNN     N     N
   293  294 B C  E     -TU 287 307G   0  252    5  CCCCCCCCCCC  CC CCCCCCCCCCC C            CC  CCCCC    CCCC     C     C
   294  295 B N  E     -TU 286 306G   5  252   32  NNNNNNNNNNN  NN NNNNNNNNNNN N            NN  NNNNN    NNNN     N     N
   295  296 B V  E     -TU 285 305G   0  252    9  VVVVVVVVVVV  VV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
   296  297 B W  E     -TU 284 303G   6  252    0  WWWWWWWWWWW  WW WWWWWWWWWWW W            WW  WWWWW    WWWW     W     W
   297  298 B D  E  >  -T  283   0G   4  252    0  DDDDDDDDDDD  DD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   298  299 B A  T  4 S+     0   0    0  252   64  AAAAAAAAAAA  AA AAAAAAAAAAT T            TT  TTTST    TTTT     A     T
   299  300 B L  T  4 S+     0   0    0  252   11  LLLLLLLLLLL  LL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   300  301 B K  T  4 S-     0   0   29  252   17  KKKKKKKKKKK  KK KKKKKKKKKKK K            KK  KKKKK    KKKK     K     K
   301  302 B A  S  < S+     0   0   17  252   42  AAAAAAAAAAA  AA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     G
   302  303 B D  S    S-     0   0   95  252   20  DDDDDDDDDDD  DD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     E
   303  304 B R  E     -U  296   0G  69  252   15  RRRRRRRRRRR  RR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
   304  305 B A  E     -     0   0G  14  252   58  AAAAAAAAAAA  AA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   305  306 B G  E     -U  295   0G   4  252    5  GGGGGGGGGGG  GG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   306  307 B V  E >   -U  294   0G   7  252   45  VVVVVVVVVVV  VV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
   307  308 B L  E >  S+U  293   0G   2  251    1  LLLLLLLLLLL  LL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   308  309 B A  G >  S-     0   0    4  251   52  AAAAAAAAAAA  AA AAAAAAAAAAA A            AA  AAAAA    AAAA     A     A
   309  310 B G  G <   -     0   0    4  251    5  GGGGGGGGGGG  GG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   310  311 B H  G <  S+     0   0    8  251    0  HHHHHHHHHHH  HH HHHHHHHHHHH H            HH  HHHHH    HHHH     H     H
   311  312 B D    <   -     0   0   26  251   18  DDDDDDDDDDD  DD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   312  313 B N  S    S+     0   0   31  251    0  NNNNNNNNNNN  NN NNNNNNNNNNN N            NN  NNNNN    NNNN     N     N
   313  314 B R        +     0   0   40  251    1  RRRRRRRRRRR  RR RRRRRRRRRRR R            RR  RRRRR    RRRR     R     R
   314  315 B V        +     0   0    2  251    1  VVVVVVVVVVV  VV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
   315  316 B S  S    S-     0   0    2  251    2  SSSSSSSSSSS  SS SSSSSSSSSSS S            SS  SSSSS    SSSS     S     S
   316  317 B C  E     -B  329   0A  10  251    6  CCCCCCCCCCC  CC CCCCCCCCCCC C            CC  CCCCC    CCCC     C     C
   317  318 B L  E     -B  328   0A  15  250    4  LLLLLLLLLLL  LL LLLLLLLLLLL L            LL  LLLLL    LLLL     L     L
   318  319 B G  E     -B  327   0A  10  250    3  GGGGGGGGGGG  GG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   319  320 B V  E     -B  326   0A  25  250    0  VVVVVVVVVVV  VV VVVVVVVVVVV V            VV  VVVVV    VVVV     V     V
   320  321 B T    >   -     0   0    3  250   47  TTTTTTTTTTT  TT TTTTTTTTTTT T            TT  TTTTT    TTTT     T     T
   321  322 B D  T 3  S+     0   0   98  250   64  DDDDDDDDDDD  DD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   322  323 B D  T 3  S-     0   0   51  249    7  DDDDDDDDDDD  DD DDDDDDDDDDD D            DD  DDDDD    DDDD     D     D
   323  324 B G  S <  S+     0   0    0  249    5  GGGGGGGGGGG  GG GGGGGGGGGGG G            GG  GGGGG    GGGG     G     G
   324  325 B M  S    S+     0   0   36  249   20  MMMMMMMMMMM  MM MMMMMMMMMMM M            MM  MMMMM    IMMM     M     M
   325  326 B A        -     0   0    0  249   24  AAAAAAAAAAA  AA AAAAAAAAAAA A            AA  AAAAA    GAAA     A     A
   326  327 B V  E     -BC 319 338A   0  248   33  VVVVVVVVVVV  VV VVVVVVVVVVV V            VV  VVVVV     VVV     V     V
   327  328 B A  E     -BC 318 337A   0  247   47  AAAAAAAAAAA  AA AAAAAAAAAAA A            AA  AAAAA     AAA     A     A
   328  329 B T  E     -BC 317 336A   7  247    1  TTTTTTTTTTT  TT TTTTTTTTKTT T            TT  TTTTT     TTT     T     T
   329  330 B G  E     -BC 316 335A   1  247    2  GGGGGGGGGGG  GG GGGGGGGGGGG G            GG  GGGGG     GGG     G     G
   330  331 B S    >   -     0   0    6  247    0  SSSSSSSSSSS  SS SSSSSSSSSSS S            SS  SSSSS     SSS     S     S
   331  332 B W  T 3  S+     0   0    6  247    0  WWWWWWWWWWW  WW WWWWWWWWWWW W            WW  WWWWW     WWW     W     W
   332  333 B D  T 3  S-     0   0   17  247    0  DDDDDDDDDDD  DD DDDDDDDDDDD D            DD  DDDDD     DDD     D     D
   333  334 B S  S <  S+     0   0   12  247    2  SSSSSSSSSSS  SS SSSSSSSSSSS S            SS  SSSSS     SSS     S     S
   334  335 B F        -     0   0   78  247   39  FFFFFFFFFFF  FF FFFFFFFFFFF F            FF  FFFFF     FFF     F     F
   335  336 B L  E     -AC  50 329A   1  247    3  LLLLLLLLLLL  LL LLLLLLLLLLL L            LL  LLLLL     LLL     L     L
   336  337 B K  E     -AC  49 328A  60  246   25  KKKKKKKKKKK  KK KKKKKKKKKKK K            KK  KKKKK     KKK     K     R
   337  338 B I  E     -AC  48 327A   0  244   10  IIIIIIIIIII  II IIIIIIIIIII I            II  IIIII     III     I     I
   338  339 B W  E      AC  46 326A   2  243    0  WWWWWWWWWWW  WW WWWWWWWWWWW W            WW  WWWWW     WWW     W     W
   339  340 B N              0   0   10  236   46  NNNNNNNNNNN  NN  NNNNNNNNNN N            NN  NNNNN     NNN     N     N
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   85    5             P   P           P PPPPPPPPPPPP  PP     PPPP     PPPP  P  P 
   342    3 G V        +     0   0   96   88   62             V   V           V VVVVVVVVVVVV  VV     VVVV     VVVV  V  V 
   343    4 G I        -     0   0   38   92   33             I   I           I IIIIIIIIIIII  II     IIII     IIII  I  I 
   344    5 G N    >   -     0   0  109   92   65             N   N           N NNNNNNNNNNNN  NN     NNNN     NNNN  N  N 
   345    6 G I  G >  S+     0   0   25   93   47             I   I           I IIIIIIIIIIII  II     IIII     IIII  I  I 
   346    7 G E  G 3  S+     0   0  122  138   45             E   E           E EEEEEEEEEEEE  EE     EEEE     EEEE  E  E 
   347    8 G D  G <  S+     0   0  133  149   28             D   D           D DDDDDDDDDDDD  DD     DDDD     DDDD  D  D 
   348    9 G L    <   -     0   0   35  155   20             L   L           L LLLLLLLLLLLL  LL     LLLL     LLLL  L  L 
   349   10 G T     >  -     0   0   69  156   61             T   T           T TTTTTTTTTTTT  TT     TTTT     TTTT  T  T 
   350   11 G E  H  > S+     0   0  116  160   37             E   E           E EEEEEEEEEEEE  EE     EEEE     EEEE  E  E 
   351   12 G K  H >> S+     0   0   66  165   48             K   K           K KKKKKKKKKKKK  KK     KKKK     KKKK  K  K 
   352   13 G D  H 3> S+     0   0   39  166   39             D   D           D DDDDDDDDDDDD  DD     DDDD     DDDD  D  D 
   353   14 G K  H 3X S+     0   0   83  166   83             K   K           K KKKKKKKKKKKK  KK     KKKK     KKKK  K  K 
   354   15 G L  H < S+     0   0    7  249    4             E   E           E EEEEEEEEEEEE  EE     EEEE     EEEE  E  E 
   365   26 G V  H 3< S+     0   0   43  249   53             V   V           V VVVVVVVVVVVV  VV     VVVV     VVVV  V  L 
   366   27 G T  T 3< S+     0   0  116  249   83             T   T           T TTTTTTTTTTTT  TT     TTTT     TTTT  T  A 
   367   28 G L    <   -     0   0   49  249   60             L   L           L LLLLLLLLLLLL  LL     LLLL     LLLL  L  L 
   368   29 G E        -     0   0  191  249   51             E   E           E EEEEEEEEEEEE  EE     EEEE     EEEE  E  E 
   369   30 G R        -     0   0   32  249    0             R   R           R RRRRRRRRRRRR  RR     RRRR     RRRR  R  R 
   370   31 G M        -     0   0   53  249   83             M   M           M MMMMMMMMMMMM  MM     MMMM     MMMM  V  M 
   371   32 G L     >  -     0   0   75  248   80             L   L           L LLLLLLLLLLLL  LL     LLLL     LLML  M  L 
   372   33 G V  H  > S+     0   0    4  248   13             V   V           V VVVVVVVVVVVV  VV     VVVV     VVVV  V  V 
   373   34 G S  H  > S+     0   0   14  248    1             S   S           S SSSSSSSSSSSS  SS     SSSS     SSSS  S  S 
   374   35 G K  H  > S+     0   0   93  248   37             K   K           K KKKKKKKKKKKK  KK     KKKK     KKKK  K  K 
   375   36 G C  H  X S+     0   0    0  249   61             C   C           C CCCCCCCCCCCC  CC     CCCC     CCCA  C  C 
   376   37 G C  H  X S+     0   0    0  249   62             C   C           C CCCCCCCCCCCC  CC     CCCC     CCCC  C  C 
   377   38 G E  H  X S+     0   0   75  249   68             E   E           E EEEEEEEEEEEE  EE     EEEE     EEEE  E  E 
   378   39 G E  H  X S+     0   0   60  249   24             E   E           E EEEEEEEEEEEE  EE     EEEE     EEEE  E  E 
   379   40 G F  H  X S+     0   0    3  249   35             F   F           V VVVVVVVVVVVV  VV     VVVV     VVVV  V  V 
   380   41 G R  H  X S+     0   0   53  249   79             R   R           R RRRRRRRRRRRR  RR     KRRR     RRRR  R  R 
   381   42 G D  H  X S+     0   0   67  249   66             D   D           D DDDDDDDDDDDD  DD     DDDD     DDDD  D  D 
   382   43 G Y  H  X S+     0   0   43  249    2             Y   Y           Y YYYYYYYYYYYY  YY     YYYY     YYYY  Y  Y 
   383   44 G V  H >X S+     0   0    0  249   58             V   V           V VVVVVVVVVVVV  VV     VVVV     VVIV  I  V 
   384   45 G E  H 3X S+     0   0   71  249   48             E   E           E EEEEEEEEEEEE  EE     EEEE     EEEE  E  E 
   385   46 G E  H 3< S+     0   0  125  249   57             E   E           E EEEEEEEEEEEE  EE     EEEE     EEEE  E  E 
   386   47 G R  H XX S+     0   0   94  249   68             R   R           R RRRRRRRRRRRR  RR     RRRR     RRRR  R  R 
   387   48 G S  H >< S+     0   0   12  249   68             S   S           S SSSSSSSSSSSS  SS     SSSS     SSSS  S  S 
   388   49 G G  T 3< S+     0   0   38  249   78             G   G           G GGGGGGGGGGGG  GG     GGGG     GGGG  R  G 
   389   50 G E  T <4 S+     0   0  138  248   52             E   E           E EEEEEEEEEEEE  EE     EEEE     EDEE  E  E 
   390   51 G D    XX> -     0   0    1  248    0             D   D           D DDDDDDDDDDDD  DD     DDDD     DDDD  D  D 
   391   52 G P  H 3>5S+     0   0   17  249   27             P   P           P PPPPPPPPPPPP  PP     PPPP     PPPP  P  P 
   392   53 G L  H 345S+     0   0    6  249    3             L   L           L LLLLLLLLLLLL  LL     LLLL     LLLL  L  L 
   393   54 G V  H <45S+     0   0   24  249   30             V   V           V VVVVVVVVVVVV  VV     VVIV     VVVV  V  V 
   394   55 G K  H  <5S-     0   0  149  249   78             K   K           K KKKKKKKKKKKK  KK     KKKK     KKKK  K  K 
   395   56 G G     << -     0   0   38  249   34             G   G           G GGGGGGGGGGGG  GG     GGGG     GGGG  G  G 
   396   57 G I        -     0   0   21  249   27             I   I           I IIIIIIIIIIII  II     IVIV     VIIV  I  I 
   397   58 G P    >>  -     0   0   80  249   19             P   P           P PPPPPPPPPPPP  PP     PPPP     PPPP  P  P 
   398   59 G E  T 34 S+     0   0   75  249   62             E   E           E EEEEEEEEEEEE  EE     EEEE     EEEE  E  E 
   399   60 G D  T 34 S+     0   0  151  249   60             D   D           D DDDDDDDDDDDD  DD     DDDD     EDDD  D  E 
   400   61 G K  T <4 S+     0   0  163  249   65             K   K           K KKKKKKKKKKKK  KK     KKKK     KKKK  K  Q 
   401   62 G N     <  -     0   0    1  249    0             N   N           N NNNNNNNNNNNN  NN     NNNN     NNNN  N  N 
   402   63 G P  S    S+     0   0   36  249    0             P   P           P PPPPPPPPPPPP  PP     PPPP     PPPP  P  P 
   403   64 G F  S    S-     0   0    3  249    1             F   F           F FFFFFFFFFFFF  FF     FFFF     FFFF  F  F 
   404   65 G K              0   0  108  247   34             K   K           K KKKKKKKKKKKK  KK     KKKK     KKKK  K  K 
   405   66 G E              0   0  201  242    3             E   E           E EEEEEEEEEEEE  EE     EEEE     EEEE  E  E 
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   54   14                                                                        
   408   14 P E        +     0   0  153  148   31                                                                        
   409   15 P G  S    S+     0   0   38  151   33                                                                        
   410   16 P Q  S    S-     0   0   94  155   93                                                                        
   411   17 P A        +     0   0    1  157   48                                                                        
   412   18 P S        +     0   0   28  161   65                                                                        
   413   19 P H  S    S+     0   0   42  167   41                                                                        
   414   20 P T  S  > S-     0   0    2  172    0                                                                        
   415   21 P G  H  > S-     0   0   10  177    0                                                                        
   416   22 P P  H  > S+     0   0   14  183    0                                                                        
   417   23 P K  H  > S+     0   0    6  183    0                                                                        
   418   24 P G  H  X S+     0   0    0  183    0                                                                        
   419   25 P V  H  X S+     0   0    0  183    0                                                                        
   420   26 P I  H  X S+     0   0    4  183   16                                                                        
   421   27 P N  H  X S+     0   0   48  183   44                                                                        
   422   28 P D  H  X S+     0   0   14  184    0                                                                        
   423   29 P W  H  X S+     0   0    6  184    0                                                                        
   424   30 P R  H  < S+     0   0   67  184   27                                                                        
   425   31 P K  H >X S+     0   0   67  184   36                                                                        
   426   32 P F  H >X>S+     0   0    1  184    2                                                                        
   427   33 P K  H 3<5S+     0   0   30  184    8                                                                        
   428   34 P L  H <45S+     0   0  139  179    1                                                                        
   429   35 P E  H <<5S+     0   0   86  179   10                                                                        
   430   36 P S  T  <5       0   0   57  180   65                                                                        
   431   37 P E      <       0   0  118  186   66                                                                        
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  161   42                                                                        
   434   69 P S        +     0   0   52  162   66                                                                        
   435   70 P R        -     0   0  103  127   86                                                                        
   436   71 P K        +     0   0   22  130   11                                                                  K K   
   437   72 P M  S    S-     0   0   12  131   13                                                                  M MM  
   438   73 P S     >  -     0   0   52  139   66                                                                  S SS  
   439   74 P V  H  > S+     0   0  107  138   53                                                                  I II  
   440   75 P Q  H  > S+     0   0  133  139   51                                                                  Q QQ  
   441   76 P E  H  > S+     0   0   38  145   27                                                                  E EE  
   442   77 P Y  H  X S+     0   0   36  157   63                                                                  Y YY  
   443   78 P E  H  < S+     0   0  111  165   67                                                                  E EE  
   444   79 P L  H >X S+     0   0   45  167   54                                                            L     L LL  
   445   80 P I  H 3< S+     0   0   37  170   72                                                            V     I II  
   446   81 P H  T 3< S+     0   0  178  170   77                                                            H     H HH  
   447   82 P K  T <4 S+     0   0  140  169   68                                                            R     K KQ  
   448   83 P D     <  -     0   0   58  188   39                                                            D     E ED  
   449   84 P K        -     0   0  205  170   80                                                            K     K KK  
   450   85 P E        -     0   0   45  171   68                                                            E     E EE  
   451   86 P D    >>  -     0   0   87  189   32                                                            D     D DD  
   452   87 P E  H 3> S+     0   0  113  188   12                                                            E     E EE  
   453   88 P N  H 3> S+     0   0   73  189   59                                                            N     N NN  
   454   89 P C  H <> S+     0   0   32  190   71                                                            C     C CC  
   455   90 P L  H  X S+     0   0    4  190    2                                                            L     L LL  
   456   91 P R  H  X S+     0   0  131  190   62                                                            R     R RR  
   457   92 P K  H  X S+     0   0  112  190   60                                                            K     K KK  
   458   93 P Y  H  X S+     0   0    7  190    6                                                            Y     Y YY  
   459   94 P R  H  X S+     0   0   31  190   33                                                            R     R RR  
   460   95 P R  H  X S+     0   0  130  190   46                                                            R     R RR  
   461   96 P Q  H  X S+     0   0   96  190   33                                                            Q     Q QQ  
   462   97 P C  H  X S+     0   0   22  190   71                                                            C     C CC  
   463   98 P M  H  X S+     0   0   33  190   10                                                            M     M MM  
   464   99 P Q  H  X S+     0   0  115  190   54                                                            Q     Q QQ  
   465  100 P D  H  X S+     0   0   46  190   21                                                            D     D DD  
   466  101 P M  H  X S+     0   0   23  190    2                                                            M     M MM  
   467  102 P H  H  X S+     0   0   64  190   74                                                            H     H HH  
   468  103 P Q  H  < S+     0   0  143  190   60                                                            Q     Q QQ  
   469  104 P K  H  < S+     0   0  140  190   57                                                            K     K KK  
   470  105 P L  H  < S+     0   0   35  190   44                                                            L     L LL  
   471  106 P S     <  -     0   0   75  190   81                                                            S     S SS  
   472  107 P F        -     0   0   71  188   99                                                            F     F FF  
   473  108 P G        -     0   0   36  187   53                                                            G     G GG  
   474  109 P P        +     0   0   92  178   42                                                            P     P PP  
   475  110 P R        +     0   0  177  184   62                                                            R     R RR  
   476  111 P Y        +     0   0   51  185    4                                                            Y     Y YY  
   477  112 P G        +     0   0   12  189   60                                                            G     G GG  
   478  113 P F  S    S-     0   0  151  190  102                                                            F     F FF  
   479  114 P V  E     -v  532   0H  28  190   13                                                            V     V VV  
   480  115 P Y  E     -v  533   0H  71  183   67                                                            Y     Y YY  
   481  116 P E  E     -v  534   0H 108  190   44                                                            E     E EE  
   482  117 P L        -     0   0   12  190   33                                                            L     L LL  
   483  118 P E        +     0   0  134  190   75                                                            E     E EE  
   484  119 P S  S >> S-     0   0   57  190   54                                                            S     T TT  
   485  120 P G  H 3> S+     0   0   15  189   40                                                            G     G GG  
   486  121 P E  H 3> S+     0   0  127  190   23                                                            E     E EE  
   487  122 P Q  H <> S+     0   0   72  190   62                                                            Q     Q QQ  
   488  123 P F  H  X S+     0   0   26  190    1                                                            F     F FF  
   489  124 P L  H  X S+     0   0   90  190    6                                                            L     L LL  
   490  125 P E  H  X S+     0   0  103  190   40                                                            E     E EE  
   491  126 P T  H  < S+     0   0   10  190   74                                                            T     T TT  
   492  127 P I  H  < S+     0   0   17  190   12                                                            I     I II  
   493  128 P E  H  < S+     0   0  139  190   19                                                            E     E EE  
   494  129 P K  S  < S+     0   0  172  190   33                                                            K     K KK  
   495  130 P E  S    S-     0   0   38  185    5                                                            E     E EE  
   496  131 P Q    >   -     0   0  116  190   67                                                            Q     Q QQ  
   497  132 P K  T 3  S+     0   0  156  190   34                                                            K     K KK  
   498  133 P I  T 3  S+     0   0   68  190   87                                                            I     I IV  
   499  134 P T    <   -     0   0   10  190   37                                                            T     T TT  
   500  135 P T  E     -W  558   0H   7  189   62                                                            T     T TT  
   501  136 P I  E     -Wx 557 531H   3  190   15                                                            I     I II  
   502  137 P V  E     -Wx 556 532H   0  190   35                                                            I     V VV  
   503  138 P V  E     -Wx 555 533H   0  190   13                                                            V     V VV  
   504  139 P H  E     -Wx 554 534H   0  190    5                                                            H     H HN  
   505  140 P I  E     +Wx 553 535H   2  190    2                                                            I     I II  
   506  141 P Y  E     - x   0 536H   4  190    3                                                            Y     Y YY  
   507  142 P E    >   -     0   0   45  190   26                                                            E     E EE  
   508  143 P D  T 3  S+     0   0   95  190   50                                                            D     D DD  
   509  144 P G  T 3  S+     0   0   66  190   50                                                            G     G GG  
   510  145 P I  S X> S-     0   0   36  190   33                                                            I     I IV  
   511  146 P K  T 34 S+     0   0  191  190   72                                                            K     K KK  
   512  147 P G  T 3> S+     0   0   13  190   23                                                            G     G GG  
   513  148 P C  H <> S+     0   0    0  190   36                                                            C     C CC  
   514  149 P D  H  X S+     0   0   78  190   47                                                            D     D DD  
   515  150 P A  H  > S+     0   0   44  190   50                                                            A     A AA  
   516  151 P L  H  X S+     0   0    0  190   11                                                            L     L LL  
   517  152 P N  H  X S+     0   0   19  190   16                                                            N     N NN  
   518  153 P S  H  X S+     0   0   78  190   57                                                            S     D SS  
   519  154 P S  H  X S+     0   0    6  190   35                                                            S     S SS  
   520  155 P L  H  X S+     0   0    1  190   10                                                            L     L LL  
   521  156 P I  H  X S+     0   0  105  190   85                                                            T     T TA  
   522  157 P C  H  X S+     0   0   63  190   41                                                            C     C CC  
   523  158 P L  H  X S+     0   0    0  190    4                                                            L     L LL  
   524  159 P A  H  < S+     0   0    1  190   11                                                            A     A AA  
   525  160 P A  H  < S+     0   0   61  190   66                                                            A     A AV  
   526  161 P E  H  < S+     0   0   72  190   24                                                            E     E EE  
   527  162 P Y    ><  +     0   0    5  190    2                                                            Y     Y YY  
   528  163 P P  T 3  S+     0   0   28  190   28                                                            P     P PP  
   529  164 P M  T 3  S+     0   0   26  190   85                                                            M     I IM  
   530  165 P V  S <  S-     0   0    1  190    9                                                            V     V VV  
   531  166 P K  E     - x   0 501H  37  190    2                                                            K     K KK  
   532  167 P F  E     +vx 479 502H   0  190    1                                                            F     F FF  
   533  168 P C  E     -vx 480 503H   0  190   19                                                            C     C CC  
   534  169 P K  E     +vx 481 504H  51  190   38                                                            K     K KK  
   535  170 P I  E     - x   0 505H   1  190   21                                                            I     I II  
   536  171 P K  E >>  - x   0 506H  52  190   71                                                            K     K KK  
   537  172 P A  H >> S+     0   0   13  190   46                                                            A     A AA  
   538  173 P S  H 34 S+     0   0   88  190   29                                                            S     S SS  
   539  174 P N  H <4 S+     0   0   67  190   86                                                            N     N NN  
   540  175 P T  H << S-     0   0   25  190   72                                                            T     T TT  
   541  176 P G     <  +     0   0   66  189   23                                                            G     G GG  
   542  177 P A    >   -     0   0   39  190   57                                                            A     A AA  
   543  178 P G  T 3  S-     0   0   70  189   41                                                            G     G GG  
   544  179 P D  T 3  S+     0   0  151  189   78                                                            D     D DD  
   545  180 P R  S <  S+     0   0  167  189   57                                                            R     R RR  
   546  181 P F  S    S+     0   0   35  189    0                                                            F     F FF  
   547  182 P S    >>  -     0   0   34  189   69                                                            S     S SS  
   548  183 P S  T 34 S+     0   0   86  189   84                                                            S     L LS  
   549  184 P D  T 34 S+     0   0  126  189   66                                                            D     D DD  
   550  185 P V  T <4 S+     0   0   20  189   64                                                            V     V VV  
   551  186 P L     <  +     0   0    8  190   15                                                            L     L LL  
   552  187 P P  S    S+     0   0    1  190    0                                                            P     P PP  
   553  188 P T  E     -W  505   0H   1  190   42                                                            T     T TT  
   554  189 P L  E     -WY 504 566H   0  190    2                                                            L     L LL  
   555  190 P L  E     -WY 503 565H   4  190   10                                                            L     L LL  
   556  191 P V  E     +WY 502 564H   0  190   18                                                            V     V IV  
   557  192 P Y  E     +WY 501 562H  31  190    0                                                            Y     Y YY  
   558  193 P K  E >  S-WY 500 561H  25  190   13                                                            K     K KK  
   559  194 P G  T 3  S-     0   0   25  190   44                                                            G     G GG  
   560  195 P G  T 3  S+     0   0   48  190   21                                                            G     G GG  
   561  196 P E  E <   -Y  558   0H  38  190   37                                                            E     E EE  
   562  197 P L  E     +Y  557   0H  34  190   12                                                            L     L LL  
   563  198 P L  E     -     0   0H   2  190   21                                                            L     I II  
   564  199 P S  E     -Y  556   0H   4  190   29                                                            S     S SS  
   565  200 P N  E     -Y  555   0H  41  190    0                                                            N     N NN  
   566  201 P F  E >   -Y  554   0H   3  189    1                                                            F     F FF  
   567  202 P I  T 3  S-     0   0   87  187   24                                                            I     I II  
   568  203 P S  T >  S-     0   0   11  187   69                                                            S     S SS  
   569  204 P V  G X  S+     0   0    0  187   34                                                            V     V VV  
   570  205 P T  G >  S+     0   0   17  187   36                                                            T     A AA  
   571  206 P E  G <  S+     0   0  156  187   34                                                            E     E DE  
   572  207 P Q  G <  S+     0   0   84  187   43                                                            Q     Q QQ  
   573  208 P L  S <  S-     0   0   31  187   11                                                            F     F FF  
   574  209 P A    >   -     0   0   49  187   49                                                            A     A AA  
   575  210 P E  T 3  S+     0   0  201  187   27                                                            E     E EE  
   576  211 P E  T 3  S+     0   0  166  187   21                                                            E     E EE  
   577  212 P F    <   -     0   0   17  187    0                                                            F     F FF  
   578  213 P F    >>  -     0   0  146  187   24                                                            F     F FF  
   579  214 P T  H 3> S+     0   0   24  186   26                                                            T     A AA  
   580  215 P G  H 3> S+     0   0   32  186   71                                                            G     G GG  
   581  216 P D  H <> S+     0   0   57  186    4                                                            D     D DD  
   582  217 P V  H  X S+     0   0    0  186   23                                                            V     V VV  
   583  218 P E  H  X S+     0   0   32  186   10                                                            E     E EE  
   584  219 P S  H  X S+     0   0   58  186   51                                                            S     S SS  
   585  220 P F  H  < S+     0   0    2  187    1                                                            F     F FF  
   586  221 P L  H ><>S+     0   0    0  187    0                                                            L     L LL  
   587  222 P N  H ><5S+     0   0   61  187   83                                                            N     N NN  
   588  223 P E  T 3<5S+     0   0   70  187   16                                                            E     E EE  
   589  224 P Y  T < 5S-     0   0   20  183   49                                                            Y     Y YY  
   590  225 P G  T < 5S+     0   0    6  183    7                                                            G     G GG  
   591  226 P L      < +     0   0    2  183   19                                                            L     L LL  
   592  227 P L  S    S-     0   0   10  178    7                                                            L     L LL  
   593  228 P P        -     0   0   40  178   30                                                            P     P PP  
   594  229 P E              0   0   94  177   19                                                            E     E EE  
   595  230 P K              0   0  161  175   25                                                            R     R RK  
## ALIGNMENTS   71 -  140
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....8....:....9....:....0....:....1....:....2....:....3....:....4
     1    2 B S              0   0  117  195   58   SS SSSSSSS  SSSSSSSSSSSSSSSSSSSSSS SS S  SSS SSSS SSSSS SS ANS SSSS N
     2    3 B E     >  -     0   0  107  209   43   EE EEEEEEE  EEEEEEEEEEEEEEEEEEEEEE EE E  EEE EEEE EEEEE EE EEE EEEE E
     3    4 B L  H  > S+     0   0   52  229   31   LL LLLLLLL  LLLLLLLLLLLLLLLLLLLLLL LL L  LLL LLLL LLLLL LLLLLL LLLL V
     4    5 B D  H  > S+     0   0  104  229   51   EE EEEEEEE  EEEEEEEEEEEEEEEEEEEEEE EE E  EEE EEEE EEEEE EEEEDE EEEE E
     5    6 B Q  H  > S+     0   0  131  230   62   QQ QQQQQQQ  QQQQQQQQQQQQQQQQQQQQQQ QQ Q  QQQ QQQQ QQQQQ QQQQSQ QQQQ S
     6    7 B L  H  X S+     0   0   27  230   61   LL LLLLLLL  LLLLLLLLLLLLLLLLLLLLLL LL L  LLL LLLL LLLLL LLLLLL LLLL L
     7    8 B R  H  X S+     0   0  110  233    4   RR RRRRRRR  RRRRRRRRRRRRRRRRRRRRRRRRR R  RRR RRRR RRRRR RRRRRR RRRR R
     8    9 B Q  H  X S+     0   0  117  233   49   QQ QQQQQQQ  QQQQQQQQQQQQQQQQQQQQQQQQQ Q  QQQ QQQQ QLQQQ QQQQQQ QQVQ Q
     9   10 B E  H  X S+     0   0   78  234    8   EE EEEEEEE  EEEEEEEEEEEEEEEEEEEEEEEEEEE  EEE EEEE EEEEE EEEEEE EEEE E
    10   11 B A  H  X S+     0   0    1  234    8   AA AAAAAAA  AAAAAAAAAAAAAAAAAAAAAAAAAAA  AAA AAAA AAAAA AAACAA AATA A
    11   12 B E  H  X S+     0   0  121  234    8   EE EEEEEEE  EEEEEEEEEEEEEEEEEEEEEEEEEEE  EEE EEEE EEEEE EEEEEE EDEE E
    12   13 B Q  H  X S+     0   0  111  238   70   QQ QQQQQQQ  QQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQ QQQQ QQQQQ QQQAAQ QQQQ T
    13   14 B L  H  X S+     0   0   14  238    4   LL LLLLLLL  LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLL LLLL LLLLL LLLLLL LLLL L
    14   15 B K  H  X S+     0   0   99  238   24   RR RRRRRRR  RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRR RRRR RRRRR RRRKKR RRKR K
    15   16 B N  H  X S+     0   0   33  239   51   NN NNNNNNN  NNNNNNNNNNNNSNNNNNNNNNNNNNNN NNN NNNN NNNNN NNNNNN NNNN N
    16   17 B Q  H  X S+     0   0   82  239   58   QQ QQQQQQQ  QQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQ QQQQ QQQQQ QQQHAQ QQQQ T
    17   18 B I  H  X S+     0   0    7  240    4   II IIIIIII  IIIIIIIIIIIIIIIIIIIIIIIIIIII III IIII IIIIILIIIIII IIII I
    18   19 B R  H  X S+     0   0  135  242   52   RQ RQRQRQQQ RRRRRQRRQRRQKRRRRRQRRRRRQRRQ RRR RRRQ QRRRRQQQRRRR RRRR R
    19   20 B D  H  X S+     0   0   85  244   60   DD DDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDD DIEI D
    20   21 B A  H  X S+     0   0   36  243   62   AA AAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAA A.AT A
    21   22 B R  H >X S+     0   0   22  244   22   RR RRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRR R.RARR
    22   23 B K  H 3< S+     0   0  136  244   50   KK KKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKK KKKKKKKKKKKK K.KSKK
    23   24 B A  H 3< S+     0   0   79  244   56   AA AAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAASA A.ALAA
    24   25 B C  H << S+     0   0   19  244   85   CC CCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCC CCCCCCCCCCAC C.ADAA
    25   26 B A     <  +     0   0   46  244   56   SN SNSNSNNN SSGSSNGGNGGNGGGGGGNGGSGGNGGN GGGGSGGN NCGGSGNNGQCG G.ASCC
    26   27 B D        +     0   0   88  243    0   DD DDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDD D.D.DD
    27   28 B A        -     0   0   17  243   50   TA TATATAAA TTSTTASSASSATSSSSSASSSSSASSA SSSSTSST ASSSSSAASTTS S.T.TT
    28   29 B T    >>  -     0   0   59  244   35   TT TTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTT T.T.TT
    29   30 B L  H 3> S+     0   0    0  244    3   LL LLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLL L.L.LL
    30   31 B S  H 34 S+     0   0   38  244   90   AI VVAIAVVV AVTAAVTTITTVGTTTTTVTTSTTVTTV TTTTATTV VSTTSTVVTIVS T.T.VV
    31   32 B Q  H X4 S+     0   0  119  247   50  KQQQQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQQQQ QQQQQQQQQQQQ Q.Q.QQ
    32   33 B I  H 3< S+     0   0   28  248   52  IIIIIIIIIIII IIIIIIIIIIIIMIIIIIIIIIIIIIII IIIIIIII IIIIIIIIIVAM M.A.AA
    33   34 B T  T >< S+     0   0    0  249   56  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTPTTTTTTTTA ATA.TT
    34   35 B N  T <  S+     0   0  129  249   72  STSAASASTSSS TAATTSAASAASTAAAAASAAAAASAAS AAAATAAS SAAAAASSAAAA ATA.SA
    35   36 B N  T 3  S+     0   0  111  249   55  NSNGSNSNSNNN SSGSSNGGNGGNSGGGGGNGGGGGNGGN GGGGSGGN NGGGGGNNGNNG SSH.GN
    36   37 B I  S <  S-     0   0   21  249   49  MLMLLMLMLMMM LLLLLMLLMLLMLLLLLLMLLLLLMLLM LLLLLLLM MLLLLLMMLMML LLV.MM
    37   38 B D        -     0   0  138  249   32  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDEED DDE.EE
    38   39 B P        -     0   0   89  250   59  SSSPSSSSSSSS SSPSSSPPSPPSSPPPPPSPPSPPSPPS PPPPSPPS SSPPSPSSPAAP PSP.PP
    39   40 B V        -     0   0   23  251   30  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVV VVVVVVVVVVIV VVVVIV
    40   41 B G        -     0   0   54  251   45  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGG GGGGGG
    41   42 B R        -     0   0  115  251    6  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRR RRRRRR
    42   43 B I        +     0   0    8  251   27  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII IIIIIIIIIIII IIIIII
    43   44 B Q        -     0   0   54  251   59  QQQQQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQQQQ QQQQQQQQQQQQ QQQQQQ
    44   45 B M        -     0   0   11  252    5  MMMMMMMMMMMM MMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMMM MMMMMMIMMMMMMMMMMMM
    45   46 B R        -     0   0   49  252   18  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
    46   47 B T  E     +A  338   0A  12  252   43  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTTTTTTTTT
    47   48 B R  E     +     0   0A  56  252   11  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
    48   49 B R  E     -A  337   0A  60  252    9  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
    49   50 B T  E     -A  336   0A  30  252   20  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTTTTTTTTT
    50   51 B L  E     -A  335   0A   0  252    0  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
    51   52 B R        +     0   0  159  252   22  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRHRRRRRRRRRRRRRRRR
    52   53 B G        +     0   0   20  252    0  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
    53   54 B H        -     0   0    4  252    0  HHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHH HHHHHHHHHHHHHHHHHHH
    54   55 B L  S    S+     0   0  116  252    4  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
    55   56 B A  S    S-     0   0    0  252    4  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
    56   57 B K        -     0   0   15  252    0  KKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKK KKKKKKKKKKKKKKKKKKK
    57   58 B I  E     -D   73   0B   0  252    1  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII IIIIIIIIIIIIIIIIIII
    58   59 B Y  E     -     0   0B   6  252    4  YYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYY YYYYYYYYYYYYYYYYYYY
    59   60 B A  E     -D   72   0B  13  252    5  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
    60   61 B M  E     -D   71   0B  15  252    4  MMMMMMMMMMMM MMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMMM MMMMMMMMMMMMMMMMMMM
    61   62 B H  E     -D   70   0B  44  252    4  HHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHH HHHHHHHHHHHHHHHHHHH
    62   63 B W  E     -D   69   0B  11  252    0  WWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWWWWW WWWWWWWW WWWWWWWWWWWWWWWWWWW
    63   64 B G    >   -     0   0    3  252   43  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGAAGAGGG
    64   65 B T  T 3  S+     0   0   75  252   58  YSYTSYYYSYYY SSTSSYTTYTTYYTTTTTYTTSTTYTTY TTTTSTTY YSTTSTYYTSTSSTSSSSS
    65   66 B D  T 3  S-     0   0   80  252    1  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
    66   67 B S  S <  S+     0   0    3  252   50  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
    67   68 B R  S    S+     0   0   94  252   20  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRKRRRRRRRRRRKRRRRR
    68   69 B L  E     + E   0  82B  31  252   80  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLNNLNLLNLNY
    69   70 B L  E     -DE  62  81B   0  252   12  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
    70   71 B L  E     -DE  61  80B   0  252    3  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVV VVVVVVVVVVVVVVVVVVV
    71   72 B S  E     -DE  60  79B   0  252    1  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
    72   73 B A  E     -DE  59  78B   0  252    1  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
    73   74 B S  E >>  -DE  57  77B   0  252    1  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
    74   75 B Q  T 34 S+     0   0    1  252    1  QQQQQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQQQQ QQQQQQQQQQQQQQQQQQQ
    75   76 B D  T 34 S-     0   0    9  252    1  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
    76   77 B G  T <4 S+     0   0    7  252    1  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
    77   78 B K  E  <  -EF  73  93B  52  252    7  KKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKK KKKKKKKKKKKKKKKKKKK
    78   79 B L  E     -EF  72  92B   0  252    2  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
    79   80 B I  E     -EF  71  91B   0  252    3  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII IIIIIIIIIIIIIIIIIII
    80   81 B I  E     -EF  70  90B   0  252   16  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII IIIVIIIIIVVVVVIVIVV
    81   82 B W  E     -EF  69  88B   0  252    0  WWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWWWWW WWWWWWWW WWWWWWWWWWWWWWWWWWW
    82   83 B D  E >>> -EF  68  87B  21  252    2  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
    83   84 B S  T 345S+     0   0    0  252   52  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSA
    84   85 B Y  T 345S+     0   0   57  251   17  YYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYY YYYYYYYYYYYHYYYFYYY
    85   86 B T  T <45S-     0   0   56  252    5  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTTTTTTTTT
    86   87 B T  T  <5 +     0   0   43  252    4  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTTTTTTTTT
    87   88 B N  E   < -F   82   0B  99  252    4  NNNNNNNNnNNN NNNnNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNN NNNNNNNNNNNNNNNNNNN
    88   89 B K  E     +F   81   0B  95  249    1  KKKKKKKKkKKK KKKkKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKK KKKKKKKKKKKKKKKKKKK
    89   90 B V  E    S+     0   0B  66  249   17  MMMVMMMMMMMM MMVMMMVVMVVMMVVVVVMVVMVVMVVM VVVVMVVM MMVIMVMMVVVIVIMVMVV
    90   91 B H  E     -F   80   0B  57  249    2  HHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHH HHHHHHHHHHHHHHHHHHH
    91   92 B A  E     -F   79   0B  43  251    0  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
    92   93 B I  E     -F   78   0B   0  252    0  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII IIIIIIIIIIIIIIIIIII
    93   94 B P  E     -F   77   0B  80  252    4  PPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPP PPPPPPPPPPPPPPPPPPP
    94   95 B L        -     0   0   26  252    0  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
    95   96 B R  S    S+     0   0  190  252    6  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
    96   97 B S        -     0   0   17  252    3  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
    97   98 B S  S    S+     0   0    6  252    3  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
    98   99 B W        +     0   0    2  252    0  WWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWWWWW WWWWWWWW WWWWWWWWWWWWWWWWWWW
    99  100 B V  E     -G  115   0C   4  252    0  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVV VVVVVVVVVVVVVVVVVVV
   100  101 B M  E     +     0   0C   5  252    0  MMMMMMMMMMMM MMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMMM MMMMMMMMMMMMMMMMMMM
   101  102 B T  E     -G  114   0C   8  252    0  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTTTTTTTTT
   102  103 B C  E     -G  113   0C   0  252    1  CCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCC CCCCCCCCCCCCCCCCCCC
   103  104 B A  E     -G  112   0C   0  252    3  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
   104  105 B Y  E     -G  111   0C   9  252    2  YYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYY YYYYYYYYYYYYYYYYYYY
   105  106 B A    >   -     0   0    0  252   22  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
   106  107 B P  T 3  S+     0   0   64  252    3  PPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPP PPPPPPPPPPPPPPPPPPP
   107  108 B S  T 3  S-     0   0   47  252    6  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   108  109 B G  S <  S+     0   0    8  252    6  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   109  110 B N  S    S+     0   0   50  252   22  NNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNN NNNNNNNNNSNNSNNSNSS
   110  111 B Y  E     - H   0 124C  50  252   13  YYYFYYYYYYYY YYYYYYFFYFFFYFFFFFYFFYFFYFFY FFFFYFFY YYFYYFYYFYYYFYYYYYY
   111  112 B V  E     -GH 104 123C   0  252    0  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVV VVVVVVVVVVVVVVVVVVV
   112  113 B A  E     +GH 103 122C   0  252    2  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
   113  114 B C  E     +GH 102 121C   5  252    2  CCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCC CCCCCCCCCCCCCCCCCCC
   114  115 B G  E     +GH 101 120C   1  252    0  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   115  116 B G  E >  S-G   99   0C   0  252    0  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   116  117 B L  T 3  S+     0   0    1  252    0  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
   117  118 B D  T 3  S-     0   0   50  252    0  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   118  119 B N  S <  S+     0   0   30  252    0  NNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNN NNNNNNNNNNNNNNNNNNN
   119  120 B I  E     - I   0 139C  39  252   24  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII IIIIIIIIIIIIIIIIIII
   120  121 B C  E     -HI 114 138C   0  252    3  CCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCC CCCCCCCCCCCCCCCCCCC
   121  122 B S  E     -HI 113 137C   9  252    6  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   122  123 B I  E     -HI 112 136C   0  252    2  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII IIIIIIIIIIIIIIIIIII
   123  124 B Y  E     -H  111   0C   3  252    0  YYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYY YYYYYYYYYYYYYYYYYYY
   124  125 B N  E     +H  110   0C  24  252   40  NNNSNNNNNNNN NNSNNNSSNSSNNSSSSSNSSSSSNSSN SSSSNSSN NSSCSSNNSSSCSCNSNSS
   125  126 B L        +     0   0   11  252    1  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
   126  127 B K  S    S+     0   0  109  252   43  KKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKK KKKKKKKKKKKKKKKKKKK
   127  128 B T  S    S-     0   0   64  252   55  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTITTTTTTTTTTT
   128  129 B R  S    S+     0   0  267  250   17  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
   129  130 B E  S    S-     0   0  173  251    9  EEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEE EEEEEEEEEEEEEEEEEEE
   130  131 B G        -     0   0   50  252   11  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   131  132 B N        +     0   0   30  252   52  NNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNN NNNNNNNNNNNNNNNNNNN
   132  133 B V  S    S+     0   0   58  253   42  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVV VVVVVVVVVVVVVVVVVVV
   133  134 B R  S    S-     0   0  213  253   22  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
   134  135 B V        -     0   0   29  253   15  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVV VVVVVVVVVVVVVVVVVVV
   135  136 B S  S    S-     0   0   43  253   48  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSTSSSSSS SSSSSSSS STSSTSSSSSSSSSSSSSS
   136  137 B R  E     -I  122   0C 105  253    7  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
   137  138 B E  E     -I  121   0C  75  253    3  EEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEE EEEEEEEEEEEEEEEEEEE
   138  139 B L  E     +I  120   0C   1  252    1  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
   139  140 B A  E     +I  119   0C  61  252   57  PPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPP PPPPPPPPPPPPPPPPPPP
   140  141 B G        +     0   0   50  252   25  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   141  142 B H        -     0   0    9  252    2  HHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHH HHHHHHHHHHHHHHHHHHH
   142  143 B T  S    S+     0   0   64  252   42  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTI TTTTTTTTTTTTTTTTTTT
   143  144 B G  S    S-     0   0    0  252    2  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   144  145 B Y        -     0   0    0  251    0  YYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYY YYYYYYYYYYYYYYYYYYY
   145  146 B L  E     +J  160   0D   0  251    1  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
   146  147 B S  E     -     0   0D   3  251    0  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   147  148 B C  E     -J  159   0D   9  251    5  CCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCC CCCCCCCCCCCCCCCCCCC
   148  149 B C  E     -J  158   0D   0  251    0  CCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCC CCCCCCCCCCCCCCCCCCC
   149  150 B R  E     -J  157   0D  53  251    4  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
   150  151 B F  E     -J  156   0D  10  251    0  FFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFF FFFFFFFFFFFFFFFFFFF
   151  152 B L  S    S-     0   0   26  251   24  LLLLLLLLLLLL LILLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLILLLLLLLILILLLYV
   152  153 B D  S    S-     0   0   60  251   40  DDDDDDDDDDDD DDTDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   153  154 B D  S    S+     0   0   60  251    2  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   154  155 B N  S    S+     0   0   44  251   65  SNSNNSNSNSSS NNNNNSNNSNNSNNNNNNGNNNNNSNNG NNNNNNNS GSNNNNGGNNNNNNNNNSS
   155  156 B Q  E     + K   0 169D  60  251   47  QQQQEQQQQQQQ QEQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQQQQ QQQQQQQQQQQQQQQQEQQ
   156  157 B I  E     -JK 150 168D   0  251    1  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII IIIIIIIIIIIIIIIIIII
   157  158 B V  E     -JK 149 167D   0  251   22  VVVIVVVVVVVV VVIVVVIIVIIVVIIIIIIIILIIVIII IIIIVIIV ILIILIIIIVVIVIVVVVV
   158  159 B T  E     -JK 148 166D   0  251    1  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTTTTTTTTT
   159  160 B S  E     -JK 147 165D   0  251    2  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   160  161 B S  E >   -J  145   0D   0  251    0  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   161  162 B G  T 3  S+     0   0    0  251    0  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   162  163 B D  T 3  S-     0   0    5  251    0  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   163  164 B T  S <  S+     0   0    8  251   63  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTMMTMTTMTMM
   164  165 B T        -     0   0    2  251   16  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTN TTTTTTTTTTTTTTTTTST
   165  166 B C  E     -KL 159 179D   0  251    0  CCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCC CCCCCCCCCCCCCCCCCCC
   166  167 B A  E     -KL 158 178D   0  252   62  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
   167  168 B L  E     -KL 157 177D   6  252    6  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLMLLLLLLL
   168  169 B W  E     -KL 156 175D   2  252    0  WWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWWWWW WWWWWWWW WWWWWWWWWWWWWWWWWWW
   169  170 B D  E >>> -KL 155 174D  37  252    0  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   170  171 B I  T 345S+     0   0    7  252    8  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII IIIIIIIIIIIIIIIIIII
   171  172 B E  T 345S+     0   0  144  252    6  EEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEE EEEEEEEEEEEEEEEEEEE
   172  173 B T  T <45S-     0   0   78  252   36  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTTTTTTTTT
   173  174 B G  T  <5 +     0   0   16  253    8  AGAGGAGAGAAA GGGGGAGGAGGAGGGGGGGGGGGGAGGG GGGGGGGA GGGSGGGGGGGSGSGGGGG
   174  175 B Q  E   < -L  169   0D 135  253   68  QQQQQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQQQQ QQQQQQQQQQQQQQQQQQQ
   175  176 B Q  E     -L  168   0D  30  253   45  QQQQQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQQQQ QQQQQQQQQQQQQQQQQQQ
   176  177 B T  E     +     0   0D  64  253   73  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TSTTATTTTMTTCTTTTCC
   177  178 B T  E     -L  167   0D  20  253   47  TTTVTTTTTTTT TTATTTVVTVVTTVVVVVTVVTVVTVVT VVVVTVVT TTVTTVTTVTTTTTTTTTT
   178  179 B T  E     -L  166   0D   5  253   77  TTTGTTTTTTTT TTTTTAGGMGGTTGAGGGTGGTGGAGGT GAGGAGGT TSGVTATTGSSVAVTSTSS
   179  180 B F  E     +L  165   0D   1  253    0  FFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFF FFFFFFFFFFFFFFFFFFF
   180  181 B T        +     0   0   34  253   72  TTTATTTTTTTT TTTTTTAATAATTAAAAATAASAATAAT AAAATAAT TTASSATTATTSTSTATIT
   181  182 B G        +     0   0   37  253   30  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   182  183 B H        -     0   0    7  253    0  HHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHH HHHHHHHHHHHHHHHHHHH
   183  184 B T  S    S+     0   0   99  253   63  STSSTSTSTSSS TTSTTSSSSSSSTSSSSSSSSTSSSSSS SSSSTSSS STSSTSSSSTTTTTTTTTT
   184  185 B G  S    S-     0   0    0  253    1  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   185  186 B D        -     0   0    1  253    1  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   186  187 B V  E     -M  202   0E   0  253   22  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVV VVVVVVVVVVVVVVVVVVV
   187  188 B M  E     +     0   0E   3  253    1  MMMMMMMMMMMM MMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMMM MMMMMMMMMMMMMMMMMMM
   188  189 B S  E     -M  201   0E  16  253    8  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   189  190 B L  E     -M  200   0E   3  253   14  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
   190  191 B S  E     -M  199   0E  21  253   24  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   191  192 B L  E     -M  198   0E  29  253   29  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
   192  193 B A    >   -     0   0    4  253   57  SSSASSSSSSSS SSSSSSAASAASSAAAAASAASAASAAS AAAASAAS SSASSASSASSSSSSASAS
   193  194 B P  T 3  S+     0   0   85  253   13  PPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPP PPPPPPPPPEPPPPPPPPP
   194  195 B D  T 3  S-     0   0   87  253   52  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   195  196 B T  S <  S+     0   0   62  253   97  MMMGMMMMMMMM MMMMMMGGMGGMMGGGGGLGGYGGMGGL GGGGMGGM LFGQYGLLGHMLFLMMMTM
   196  197 B R  S    S+     0   0  142  252   61  RRRRRRRRRRRR RRRRRRRRRRRRKRRRRRKRRKRRRRRK RRRRSRRR KRRRKRKKRRRRRRRRRRR
   197  198 B L  E     - N   0 211E  37  252   71  TTTTTTTTTTTT TTCTTTTTTTSTTTTSTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTTTTTSTTT
   198  199 B F  E     -MN 191 210E   0  252    0  FFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFF FFFFFFFFFFFFFFFFFFF
   199  200 B V  E     -MN 190 209E   0  252   11  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVV VVVVVVVVVVVVIVVVVVV
   200  201 B S  E     -MN 189 208E   0  252    0  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   201  202 B G  E     +MN 188 207E   0  252    0  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   202  203 B A  E >   -M  186   0E   0  252    4  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
   203  204 B C  T 3  S+     0   0    5  252    2  CCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCC CCCCCCCCCCCCCCCCCCC
   204  205 B D  T 3  S-     0   0   31  252    0  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   205  206 B A  S <  S+     0   0   20  252   16  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
   206  207 B S  E     - O   0 222E   6  252   69  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSTSSSSSS SSSSSSSS STSSTSSSSSSSSSSSSSS
   207  208 B A  E     -NO 201 221E   0  252   35  SSSISSSSSSSS SSVSSSIISIISSIIIIISIISIISIIS IIIISIIS SSIVSISSIAAVAASASAA
   208  209 B K  E     -NO 200 220E  18  252    0  KKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKK KKKKKKKKKKKKKKKKKKK
   209  210 B L  E     -NO 199 219E   2  252    8  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
   210  211 B W  E     -NO 198 217E   1  252    0  WWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWWWWW WWWWWWWW WWWWWWWWWWWWWWWWWWW
   211  212 B D  E >>> -NO 197 216E  11  252    1  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   212  213 B V  T 345S+     0   0   12  252   19  IIIVIIIIIIII IIVIIIVVIVVIIVVVVVIVVIVVIVVI VVVVIVVI IVVIIVIIVIVIIIIIIIV
   213  214 B R  T 345S+     0   0  194  252    1  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
   214  215 B E  T <45S-     0   0  111  252   59  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDED
   215  216 B G  T  <5 +     0   0    8  252   25  GGGSGGGGGGGG GGSGGGSSGSSGGSSSSSGSSGSSGSSG SSSSGSSG GGSSGSGGSGGSGSGGGGG
   216  217 B M  E      -     0   0    1  252    0  FFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFF FFFFFFFFFFFFFFFFFFF
   235  236 B P  T 3  S+     0   0   45  252    0  PPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPP PPPPPPPPPPPPPPPPPPP
   236  237 B N  T 3  S-     0   0   42  252   27  NNNNNNNNNNNN NNNNNNNNNNNNNNNNNNSNNNNNNNNS NNNNSNNN SNNNNNSSNNNNSNNNNNN
   237  238 B G  S <  S+     0   0   12  252    8  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   238  239 B N  S    S+     0   0   56  252   76  YHYYHYHYHYYY HHNHHYYYYYYYHYYYYYYYYNYYYYYY YYYYHYYY YNYSNYYYYNYSNSHFHYY
   239  240 B A  E     - Q   0 253F   0  252   11  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
   240  241 B F  E     -PQ 233 252F   0  252   16  FFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFF FFFFFFFFFFFFFFFFFFF
   241  242 B A  E     -PQ 232 251F   0  252   51  AAATAAAAAAAA AATAAATTATTAATTTTTATTGTTATTA TTTTATTA AGTAGTAATAAAAAAAAAA
   242  243 B T  E     -PQ 231 250F   0  252    0  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTTTTTTTTT
   243  244 B G  E     +PQ 230 249F   0  252    0  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   244  245 B S  E >   -P  228   0F   0  252    0  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   245  246 B D  T 3  S+     0   0   13  252    0  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   246  247 B D  T 3  S-     0   0   28  252    0  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   247  248 B A  S <  S+     0   0    6  252   12  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
   248  249 B T        -     0   0   16  252   42  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTTTTTTTTT
   249  250 B C  E     -QR 243 263F   0  252    3  CCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCC CCCCCCCCCCCCCCCCCCC
   250  251 B R  E     -QR 242 262F  23  252    3  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
   251  252 B L  E     -QR 241 261F   0  252    0  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
   252  253 B F  E     -QR 240 259F   1  251    0  FFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFF FFFFFFFFFFFFFFFFFFF
   253  254 B D  E  >> -QR 239 258F   1  251    0  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   254  255 B L  T >45S+     0   0   15  251   26  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLIILILLLLII
   255  256 B R  T 345S+     0   0   57  251    0  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
   256  257 B A  T 345S-     0   0    0  251    8  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
   257  258 B D  T <<5 +     0   0    0  251    0  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   258  259 B Q  E      -     0   0  119  253   47  HHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHH HHHHHHHHHHHHHHHHHHH
   266  267 B D  T 3  S+     0   0  161  253   25  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   267  268 B N  T 3  S+     0   0   66  253   48  NNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNN NNNNNNNNNNNNNNNNNNN
   268  269 B I    <   +     0   0   23  253   21  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII IIIIIIIIIIIIIIIIIII
   269  270 B I        +     0   0   97  253   31  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIITIIII IIIIIIII IIIIIIIIIIIIIIIIIII
   270  271 B C  S    S-     0   0   10  253    6  CCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCC CCCCCCCCCCCCCCCCCCC
   271  272 B G        -     0   0    1  253    0  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   272  273 B I  E     +S  288   0G   0  253    1  IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII IIIIIIIIIIIIIIIIIII
   273  274 B T  E     +     0   0G  13  253    4  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTT TTTTTTTTTTTTTTTTTTT
   274  275 B S  E     +S  287   0G  18  252    0  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   275  276 B V  E     +S  286   0G  10  252    5  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVV VVVVVVVVVVVVVVVVVVV
   276  277 B S  E     -S  285   0G  15  252   21  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAAAAA
   277  278 B F  E     -S  284   0G  12  252   13  FFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFF FFFFFFFFFFFFFFFFFFF
   278  279 B S        -     0   0    3  252    1  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   279  280 B K  S    S+     0   0  104  252   80  KKKRKKKKKKKK KKRKKKRRKRRKKRRRRRKRRKRRKRRK RRRRKRRK KKRRKRKKRKKRKRKKKKK
   280  281 B S  S    S-     0   0    2  252    0  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSS SSSSSSSSSSSSSSSSSSS
   281  282 B G  S    S+     0   0    0  252    0  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   282  283 B R        +     0   0    8  252    0  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
   283  284 B L  E     - T   0 297G   0  252   11  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLLLLLLLL
   284  285 B L  E     -ST 277 296G   0  252    3  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLFLLL LLLLLLLLLLLLLLLLLLL
   285  286 B L  E     -ST 276 295G   0  252   13  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL LLLLLLLLLLLLFLLLLLL
   286  287 B A  E     -ST 275 294G   0  252   11  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA AAAAAAAAAAAAAAAGAAA
   287  288 B G  E     -ST 274 293G   2  252    4  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   288  289 B Y  E >   -S  272   0G   4  252    0  YYYYYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYYYYY YYYYYYYY YYYYYYYYYYYYYYYYYYY
   289  290 B D  T 3  S+     0   0    3  252    3  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   290  291 B D  T 3  S-     0   0   37  252    1  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   291  292 B F  S <  S+     0   0    3  252    3  FFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFF FFFFFFFFFFFFFFFFFFF
   292  293 B N        -     0   0   15  252   39  NNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNN NNNNNNNNNNNNNNNNNNN
   293  294 B C  E     -TU 287 307G   0  252    5  CCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCC CCCCCCCCCCCCCCCCCCC
   294  295 B N  E     -TU 286 306G   5  252   32  NNNNNNNNNNNN NNNNNNNNNNNNNNNNNNSNNNNNNNNS NNNNNNNN SNNNNNSSNNNNNNNNNNN
   295  296 B V  E     -TU 285 305G   0  252    9  VVVIVVVVVVVV VVIVVVIIVIIVVIIIIIVIIVIIVIIV IIIIVIIV VVIIVIVVIVVIVIVVVVV
   296  297 B W  E     -TU 284 303G   6  252    0  WWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWWWWW WWWWWWWW WWWWWWWWWWWWWWWWWWW
   297  298 B D  E  >  -T  283   0G   4  252    0  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDD DDDDDDDDDDDDDDDDDDD
   298  299 B A  T  4 S+     0   0    0  252   64  TTTATTTTTTTT TTSTTTAATAATTAAAAAAAATAATAAA AAAATAAT ATAATAAAASSASATTTSS
   299  300 B L  T  4 S+     0   0    0  252   11  LLLMLLLLLLLL LLMLLLMMLMMLLMMMMMLMMLMMLMML MMMMLMML LLMMLMLLMMMMMMLLLMM
   300  301 B K  T  4 S-     0   0   29  252   17  KKKKKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKKKKK KKKKKKKK KKKKKKKKKKRKRKKKKKK
   301  302 B A  S  < S+     0   0   17  252   42  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGTGQGGQGTA
   302  303 B D  S    S-     0   0   95  252   20  DEDDEDEDEDDD EEDEEDDDDDDDEDDDDDGDDEDDDDDG DDDDEDDD GDDDEDGGDEEDEDEDEEE
   303  304 B R  E     -U  296   0G  69  252   15  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRR RRRRRRRRRRRRRRRRRRR
   304  305 B A  E     -     0   0G  14  252   58  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA SAAAAASSAAAAAAAAAAA
   305  306 B G  E     -U  295   0G   4  252    5  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGG GGGGGGGGGGGGGGGGGGG
   306  307 B V  E >   -U  294   0G   7  252   45  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVV VVVVVVVVVVVVVVVVVIV
   307  308 B L  E >  S+U  293   0G   2  251    1  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLL L LLLLLLLLLLLLLLLLLLL
   308  309 B A  G >  S-     0   0    4  251   52  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAA A AAAAAAAAAAAAAAAAAAA
   309  310 B G  G <   -     0   0    4  251    5  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGG G GGGGGGGGGGGGGGGGGGG
   310  311 B H  G <  S+     0   0    8  251    0  HHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHH H HHHHHHHHHHHHHHHHHHH
   311  312 B D    <   -     0   0   26  251   18  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDD D DDDDDDDDDDDDDDDDDDD
   312  313 B N  S    S+     0   0   31  251    0  NNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNN N NNNNNNNNNNNNNNNNNNN
   313  314 B R        +     0   0   40  251    1  RRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRR R RRRRRRRRRRRRRRRRRRR
   314  315 B V        +     0   0    2  251    1  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVV V VVVVVVVVVVVVVVVVVVV
   315  316 B S  S    S-     0   0    2  251    2  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSS S SSSSSSSSSSSSSSSSSSS
   316  317 B C  E     -B  329   0A  10  251    6  CCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCC C CCCCCCCCCCCCCCCCCCC
   317  318 B L  E     -B  328   0A  15  250    4  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLL LLLLLL L LLLLLLLLLLLLLLLLLLL
   318  319 B G  E     -B  327   0A  10  250    3  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGG G GGGGGGGGGGGGGGGGGGG
   319  320 B V  E     -B  326   0A  25  250    0  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVV V VVVVVVVVVVVVVVVVVVV
   320  321 B T    >   -     0   0    3  250   47  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTT T TTTTTTTTTTTTTTTTTTT
   321  322 B D  T 3  S+     0   0   98  250   64  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDGDDDDDD DDDDDD D DSDDKDDDDDEDEDDEDEE
   322  323 B D  T 3  S-     0   0   51  249    7  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDD D DDDDDDDD DDDDDDDDDD
   323  324 B G  S <  S+     0   0    0  249    5  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGG G GGGGGGGG GGGGGGGGGG
   324  325 B M  S    S+     0   0   36  249   20  MMMMMMMMMMMM MMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMM M MMMMMMMM MMMMMMMMMM
   325  326 B A        -     0   0    0  249   24  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAA A AAAAAAAA AAAAAAAAAA
   326  327 B V  E     -BC 319 338A   0  248   33  VVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVG V VVVVVVVV VVAVAVVVVV
   327  328 B A  E     -BC 318 337A   0  247   47  AAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA  AAAAAG A AAACAAAA AACCCAAAAA
   328  329 B T  E     -BC 317 336A   7  247    1  TTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTT  TTTTTP T TTTTTTTT TTTTTTTTTT
   329  330 B G  E     -BC 316 335A   1  247    2  GGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGG  GGGGGG G GGGGGGGG GGGGGGGGGG
   330  331 B S    >   -     0   0    6  247    0  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSS  SSSSSS S SSSSSSSS SSSSSSSSSS
   331  332 B W  T 3  S+     0   0    6  247    0  WWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWWWW  WWWWWW W WWWWWWWW WWWWWWWWWW
   332  333 B D  T 3  S-     0   0   17  247    0  DDDDDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDDDD  DDDDDD D DDDDDDDD DDDDDDDDDD
   333  334 B S  S <  S+     0   0   12  247    2  SSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSS  SSSSSS S SSSSSSSS SSSSSSSSSS
   334  335 B F        -     0   0   78  247   39  FFFFFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFFFF  FFFFFF F FFFFFFFF FFFFFFFFFF
   335  336 B L  E     -AC  50 329A   1  247    3  LLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLL  LLLLLL L LLLLLLLL LLLLLLLLLL
   336  337 B K  E     -AC  49 328A  60  246   25  RRRKRRRRRRRR RRKRRRKKRKKRRKKKKKRKKRKKRKK  KKKKRK R RRKKRKRR KKKKKRKRRK
   337  338 B I  E     -AC  48 327A   0  244   10  IIIIIIIIIIII IIVIIIIIIIIIIIIIIIIIIIIIIII  IIIIII I IIIIIIII IIIIIIIIII
   338  339 B W  E      AC  46 326A   2  243    0  WWWWWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWWWW  WWWWWW W WWWWWWWW WWWWWWWWWW
   339  340 B N              0   0   10  236   46  NNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNN  NNNNNN N NNNNNNNN NNNNNNNNNN
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   85    5              P                                     P                   
   342    3 G V        +     0   0   96   88   62              V                                     V                   
   343    4 G I        -     0   0   38   92   33              I                                     I                   
   344    5 G N    >   -     0   0  109   92   65              N                                     N                   
   345    6 G I  G >  S+     0   0   25   93   47              I                                     I                   
   346    7 G E  G 3  S+     0   0  122  138   45              E                                     E                   
   347    8 G D  G <  S+     0   0  133  149   28              D                                     D                   
   348    9 G L    <   -     0   0   35  155   20              L                                     L                   
   349   10 G T     >  -     0   0   69  156   61              S                                     T                   
   350   11 G E  H  > S+     0   0  116  160   37              E                                     E                   
   351   12 G K  H >> S+     0   0   66  165   48              K                                     K                   
   352   13 G D  H 3> S+     0   0   39  166   39              D                                     D                   
   353   14 G K  H 3X S+     0   0   83  166   83              K                                     K                   
   354   15 G L  H < S+     0   0    7  249    4              E                                     E                   
   365   26 G V  H 3< S+     0   0   43  249   53              L                                     L                   
   366   27 G T  T 3< S+     0   0  116  249   83              T                                     T                   
   367   28 G L    <   -     0   0   49  249   60              L                                     L                   
   368   29 G E        -     0   0  191  249   51              E                                     E                   
   369   30 G R        -     0   0   32  249    0              R                                     R                   
   370   31 G M        -     0   0   53  249   83              V                                     Q                   
   371   32 G L     >  -     0   0   75  248   80              L                                     V                   
   372   33 G V  H  > S+     0   0    4  248   13              V                                     V                   
   373   34 G S  H  > S+     0   0   14  248    1              S                                     S                   
   374   35 G K  H  > S+     0   0   93  248   37              K                                     K                   
   375   36 G C  H  X S+     0   0    0  249   61              C                                     S                   
   376   37 G C  H  X S+     0   0    0  249   62              C                                     C                   
   377   38 G E  H  X S+     0   0   75  249   68              E                                     E                   
   378   39 G E  H  X S+     0   0   60  249   24              A                                     E                   
   379   40 G F  H  X S+     0   0    3  249   35              V                                     V                   
   380   41 G R  H  X S+     0   0   53  249   79              R                                     R                   
   381   42 G D  H  X S+     0   0   67  249   66              D                                     D                   
   382   43 G Y  H  X S+     0   0   43  249    2              Y                                     Y                   
   383   44 G V  H >X S+     0   0    0  249   58              V                                     I                   
   384   45 G E  H 3X S+     0   0   71  249   48              E                                     E                   
   385   46 G E  H 3< S+     0   0  125  249   57              D                                     E                   
   386   47 G R  H XX S+     0   0   94  249   68              R                                     R                   
   387   48 G S  H >< S+     0   0   12  249   68              S                                     S                   
   388   49 G G  T 3< S+     0   0   38  249   78              G                                     G                   
   389   50 G E  T <4 S+     0   0  138  248   52              E                                     E                   
   390   51 G D    XX> -     0   0    1  248    0              D                                     D                   
   391   52 G P  H 3>5S+     0   0   17  249   27              P                                     P                   
   392   53 G L  H 345S+     0   0    6  249    3              L                                     L                   
   393   54 G V  H <45S+     0   0   24  249   30              V                                     V                   
   394   55 G K  H  <5S-     0   0  149  249   78              K                                     K                   
   395   56 G G     << -     0   0   38  249   34              G                                     G                   
   396   57 G I        -     0   0   21  249   27              I                                     I                   
   397   58 G P    >>  -     0   0   80  249   19              P                                     P                   
   398   59 G E  T 34 S+     0   0   75  249   62              E                                     E                   
   399   60 G D  T 34 S+     0   0  151  249   60              D                                     D                   
   400   61 G K  T <4 S+     0   0  163  249   65              K                                     K                   
   401   62 G N     <  -     0   0    1  249    0              N                                     N                   
   402   63 G P  S    S+     0   0   36  249    0              P                                     P                   
   403   64 G F  S    S-     0   0    3  249    1              F                                     F                   
   404   65 G K              0   0  108  247   34              K                                     K                   
   405   66 G E              0   0  201  242    3              E                                     E                   
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   54   14                                                                        
   408   14 P E        +     0   0  153  148   31                                                                        
   409   15 P G  S    S+     0   0   38  151   33                                                                        
   410   16 P Q  S    S-     0   0   94  155   93                                                                        
   411   17 P A        +     0   0    1  157   48                                                                        
   412   18 P S        +     0   0   28  161   65                                                                        
   413   19 P H  S    S+     0   0   42  167   41                                                                        
   414   20 P T  S  > S-     0   0    2  172    0                                                                        
   415   21 P G  H  > S-     0   0   10  177    0                                                                        
   416   22 P P  H  > S+     0   0   14  183    0                                                                        
   417   23 P K  H  > S+     0   0    6  183    0                                                                        
   418   24 P G  H  X S+     0   0    0  183    0                                                                        
   419   25 P V  H  X S+     0   0    0  183    0                                                                        
   420   26 P I  H  X S+     0   0    4  183   16                                                                        
   421   27 P N  H  X S+     0   0   48  183   44                                                                        
   422   28 P D  H  X S+     0   0   14  184    0                                                                        
   423   29 P W  H  X S+     0   0    6  184    0                                                                        
   424   30 P R  H  < S+     0   0   67  184   27                                                                        
   425   31 P K  H >X S+     0   0   67  184   36                                                                        
   426   32 P F  H >X>S+     0   0    1  184    2                                                                        
   427   33 P K  H 3<5S+     0   0   30  184    8                                                                        
   428   34 P L  H <45S+     0   0  139  179    1                                                                        
   429   35 P E  H <<5S+     0   0   86  179   10                                                                        
   430   36 P S  T  <5       0   0   57  180   65                                                                        
   431   37 P E      <       0   0  118  186   66                                           R                            
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  161   42                                           V                            
   434   69 P S        +     0   0   52  162   66                                           S                            
   435   70 P R        -     0   0  103  127   86                                           R                            
   436   71 P K        +     0   0   22  130   11                                           K                            
   437   72 P M  S    S-     0   0   12  131   13                                           M                            
   438   73 P S     >  -     0   0   52  139   66                                           S                            
   439   74 P V  H  > S+     0   0  107  138   53                                           I                            
   440   75 P Q  H  > S+     0   0  133  139   51                                           Q                            
   441   76 P E  H  > S+     0   0   38  145   27                                           E                            
   442   77 P Y  H  X S+     0   0   36  157   63                                           Y                            
   443   78 P E  H  < S+     0   0  111  165   67                                           E                            
   444   79 P L  H >X S+     0   0   45  167   54                                           L                            
   445   80 P I  H 3< S+     0   0   37  170   72                                           I                            
   446   81 P H  T 3< S+     0   0  178  170   77                                           H                            
   447   82 P K  T <4 S+     0   0  140  169   68                                           K                            
   448   83 P D     <  -     0   0   58  188   39                                           E                            
   449   84 P K        -     0   0  205  170   80                                           K                            
   450   85 P E        -     0   0   45  171   68                                           E                            
   451   86 P D    >>  -     0   0   87  189   32                                           D                            
   452   87 P E  H 3> S+     0   0  113  188   12                                           E                            
   453   88 P N  H 3> S+     0   0   73  189   59                                           N                            
   454   89 P C  H <> S+     0   0   32  190   71                                           C                            
   455   90 P L  H  X S+     0   0    4  190    2                                           L                            
   456   91 P R  H  X S+     0   0  131  190   62                                           R                            
   457   92 P K  H  X S+     0   0  112  190   60                                           K                            
   458   93 P Y  H  X S+     0   0    7  190    6                                           Y                            
   459   94 P R  H  X S+     0   0   31  190   33                                           R                            
   460   95 P R  H  X S+     0   0  130  190   46                                           R                            
   461   96 P Q  H  X S+     0   0   96  190   33                                           Q                            
   462   97 P C  H  X S+     0   0   22  190   71                                           C                            
   463   98 P M  H  X S+     0   0   33  190   10                                           M                            
   464   99 P Q  H  X S+     0   0  115  190   54                                           Q                            
   465  100 P D  H  X S+     0   0   46  190   21                                           D                            
   466  101 P M  H  X S+     0   0   23  190    2                                           M                            
   467  102 P H  H  X S+     0   0   64  190   74                                           H                            
   468  103 P Q  H  < S+     0   0  143  190   60                                           Q                            
   469  104 P K  H  < S+     0   0  140  190   57                                           K                            
   470  105 P L  H  < S+     0   0   35  190   44                                           L                            
   471  106 P S     <  -     0   0   75  190   81                                           S                            
   472  107 P F        -     0   0   71  188   99                                           F                            
   473  108 P G        -     0   0   36  187   53                                           G                            
   474  109 P P        +     0   0   92  178   42                                           P                            
   475  110 P R        +     0   0  177  184   62                                           R                            
   476  111 P Y        +     0   0   51  185    4                                           Y                            
   477  112 P G        +     0   0   12  189   60                                           G                            
   478  113 P F  S    S-     0   0  151  190  102                                           F                            
   479  114 P V  E     -v  532   0H  28  190   13                                           V                            
   480  115 P Y  E     -v  533   0H  71  183   67                                           Y                            
   481  116 P E  E     -v  534   0H 108  190   44                                           E                            
   482  117 P L        -     0   0   12  190   33                                           L                            
   483  118 P E        +     0   0  134  190   75                                           E                            
   484  119 P S  S >> S-     0   0   57  190   54                                           T                            
   485  120 P G  H 3> S+     0   0   15  189   40                                           G                            
   486  121 P E  H 3> S+     0   0  127  190   23                                           K                            
   487  122 P Q  H <> S+     0   0   72  190   62                                           Q                            
   488  123 P F  H  X S+     0   0   26  190    1                                           F                            
   489  124 P L  H  X S+     0   0   90  190    6                                           L                            
   490  125 P E  H  X S+     0   0  103  190   40                                           E                            
   491  126 P T  H  < S+     0   0   10  190   74                                           T                            
   492  127 P I  H  < S+     0   0   17  190   12                                           I                            
   493  128 P E  H  < S+     0   0  139  190   19                                           E                            
   494  129 P K  S  < S+     0   0  172  190   33                                           K                            
   495  130 P E  S    S-     0   0   38  185    5                                           E                            
   496  131 P Q    >   -     0   0  116  190   67                                           L                            
   497  132 P K  T 3  S+     0   0  156  190   34                                           K                            
   498  133 P I  T 3  S+     0   0   68  190   87                                           I                            
   499  134 P T    <   -     0   0   10  190   37                                           T                            
   500  135 P T  E     -W  558   0H   7  189   62                                           T                            
   501  136 P I  E     -Wx 557 531H   3  190   15                                           I                            
   502  137 P V  E     -Wx 556 532H   0  190   35                                           V                            
   503  138 P V  E     -Wx 555 533H   0  190   13                                           V                            
   504  139 P H  E     -Wx 554 534H   0  190    5                                           H                            
   505  140 P I  E     +Wx 553 535H   2  190    2                                           I                            
   506  141 P Y  E     - x   0 536H   4  190    3                                           Y                            
   507  142 P E    >   -     0   0   45  190   26                                           E                            
   508  143 P D  T 3  S+     0   0   95  190   50                                           D                            
   509  144 P G  T 3  S+     0   0   66  190   50                                           G                            
   510  145 P I  S X> S-     0   0   36  190   33                                           I                            
   511  146 P K  T 34 S+     0   0  191  190   72                                           K                            
   512  147 P G  T 3> S+     0   0   13  190   23                                           G                            
   513  148 P C  H <> S+     0   0    0  190   36                                           C                            
   514  149 P D  H  X S+     0   0   78  190   47                                           D                            
   515  150 P A  H  > S+     0   0   44  190   50                                           A                            
   516  151 P L  H  X S+     0   0    0  190   11                                           L                            
   517  152 P N  H  X S+     0   0   19  190   16                                           N                            
   518  153 P S  H  X S+     0   0   78  190   57                                           S                            
   519  154 P S  H  X S+     0   0    6  190   35                                           S                            
   520  155 P L  H  X S+     0   0    1  190   10                                           L                            
   521  156 P I  H  X S+     0   0  105  190   85                                           T                            
   522  157 P C  H  X S+     0   0   63  190   41                                           C                            
   523  158 P L  H  X S+     0   0    0  190    4                                           L                            
   524  159 P A  H  < S+     0   0    1  190   11                                           A                            
   525  160 P A  H  < S+     0   0   61  190   66                                           A                            
   526  161 P E  H  < S+     0   0   72  190   24                                           E                            
   527  162 P Y    ><  +     0   0    5  190    2                                           Y                            
   528  163 P P  T 3  S+     0   0   28  190   28                                           P                            
   529  164 P M  T 3  S+     0   0   26  190   85                                           I                            
   530  165 P V  S <  S-     0   0    1  190    9                                           V                            
   531  166 P K  E     - x   0 501H  37  190    2                                           K                            
   532  167 P F  E     +vx 479 502H   0  190    1                                           F                            
   533  168 P C  E     -vx 480 503H   0  190   19                                           C                            
   534  169 P K  E     +vx 481 504H  51  190   38                                           K                            
   535  170 P I  E     - x   0 505H   1  190   21                                           I                            
   536  171 P K  E >>  - x   0 506H  52  190   71                                           K                            
   537  172 P A  H >> S+     0   0   13  190   46                                           A                            
   538  173 P S  H 34 S+     0   0   88  190   29                                           S                            
   539  174 P N  H <4 S+     0   0   67  190   86                                           N                            
   540  175 P T  H << S-     0   0   25  190   72                                           T                            
   541  176 P G     <  +     0   0   66  189   23                                           G                            
   542  177 P A    >   -     0   0   39  190   57                                           A                            
   543  178 P G  T 3  S-     0   0   70  189   41                                           G                            
   544  179 P D  T 3  S+     0   0  151  189   78                                           D                            
   545  180 P R  S <  S+     0   0  167  189   57                                           R                            
   546  181 P F  S    S+     0   0   35  189    0                                           F                            
   547  182 P S    >>  -     0   0   34  189   69                                           S                            
   548  183 P S  T 34 S+     0   0   86  189   84                                           L                            
   549  184 P D  T 34 S+     0   0  126  189   66                                           D                            
   550  185 P V  T <4 S+     0   0   20  189   64                                           V                            
   551  186 P L     <  +     0   0    8  190   15                                           L                            
   552  187 P P  S    S+     0   0    1  190    0                                           P                            
   553  188 P T  E     -W  505   0H   1  190   42                                           T                            
   554  189 P L  E     -WY 504 566H   0  190    2                                           L                            
   555  190 P L  E     -WY 503 565H   4  190   10                                           L                            
   556  191 P V  E     +WY 502 564H   0  190   18                                           I                            
   557  192 P Y  E     +WY 501 562H  31  190    0                                           Y                            
   558  193 P K  E >  S-WY 500 561H  25  190   13                                           K                            
   559  194 P G  T 3  S-     0   0   25  190   44                                           G                            
   560  195 P G  T 3  S+     0   0   48  190   21                                           G                            
   561  196 P E  E <   -Y  558   0H  38  190   37                                           E                            
   562  197 P L  E     +Y  557   0H  34  190   12                                           L                            
   563  198 P L  E     -     0   0H   2  190   21                                           I                            
   564  199 P S  E     -Y  556   0H   4  190   29                                           S                            
   565  200 P N  E     -Y  555   0H  41  190    0                                           N                            
   566  201 P F  E >   -Y  554   0H   3  189    1                                           F                            
   567  202 P I  T 3  S-     0   0   87  187   24                                           I                            
   568  203 P S  T >  S-     0   0   11  187   69                                           S                            
   569  204 P V  G X  S+     0   0    0  187   34                                           V                            
   570  205 P T  G >  S+     0   0   17  187   36                                           A                            
   571  206 P E  G <  S+     0   0  156  187   34                                           E                            
   572  207 P Q  G <  S+     0   0   84  187   43                                           Q                            
   573  208 P L  S <  S-     0   0   31  187   11                                           F                            
   574  209 P A    >   -     0   0   49  187   49                                           A                            
   575  210 P E  T 3  S+     0   0  201  187   27                                           E                            
   576  211 P E  T 3  S+     0   0  166  187   21                                           E                            
   577  212 P F    <   -     0   0   17  187    0                                           F                            
   578  213 P F    >>  -     0   0  146  187   24                                           F                            
   579  214 P T  H 3> S+     0   0   24  186   26                                           A                            
   580  215 P G  H 3> S+     0   0   32  186   71                                           G                            
   581  216 P D  H <> S+     0   0   57  186    4                                           D                            
   582  217 P V  H  X S+     0   0    0  186   23                                           V                            
   583  218 P E  H  X S+     0   0   32  186   10                                           E                            
   584  219 P S  H  X S+     0   0   58  186   51                                           S                            
   585  220 P F  H  < S+     0   0    2  187    1                                           F                            
   586  221 P L  H ><>S+     0   0    0  187    0                                           L                            
   587  222 P N  H ><5S+     0   0   61  187   83                                           N                            
   588  223 P E  T 3<5S+     0   0   70  187   16                                           E                            
   589  224 P Y  T < 5S-     0   0   20  183   49                                           Y                            
   590  225 P G  T < 5S+     0   0    6  183    7                                           G                            
   591  226 P L      < +     0   0    2  183   19                                           L                            
   592  227 P L  S    S-     0   0   10  178    7                                           L                            
   593  228 P P        -     0   0   40  178   30                                           P                            
   594  229 P E              0   0   94  177   19                                           E                            
   595  230 P K              0   0  161  175   25                                           R                            
## ALIGNMENTS  141 -  210
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....5....:....6....:....7....:....8....:....9....:....0....:....1
     1    2 B S              0   0  117  195   58  SNNNSS SSNSSNS NSSN NN  N NSSSNGNN G GNNNNN  SGG GGGGG NGGGGNGNGGGGGGG
     2    3 B E     >  -     0   0  107  209   43  EEEEEE EEDEEDE EEEE EE  E EEEDDEEE E EEEEEE  EEE EEEEE EEEEEEEEEEEEEEE
     3    4 B L  H  > S+     0   0   52  229   31  LLLLLL LLLLLLL LLLL LL  L LLLLLMLL L MLLLLL  LMM MMMMM LMMMMIMIMMMMMMM
     4    5 B D  H  > S+     0   0  104  229   51  EDDDDE DDDEEDD DDDE EE  D EDEDEEDD E EDDDDD  EEE EEEEE DEEEEDEEEEEEEEE
     5    6 B Q  H  > S+     0   0  131  230   62  QSNSQA QQSAQSQ SQQS AA  S AQSQAQSS Q QSSSSS  QQQ QQQQQ SQQQQAQAQQQQQQQ
     6    7 B L  H  X S+     0   0   27  230   61  LLLLLL LLLLLLL LLLL LL  L LLLLLMLL L MLLLLL  LLL LLLLL LLLLLLLLLLLLLLL
     7    8 B R  H  X S+     0   0  110  233    4  RRRRRR RRRRRRR RRRR RR  R RRRRRRRR R KRRRRR  RRR RRRRR RRKRRRRRRRRRRRR
     8    9 B Q  H  X S+     0   0  117  233   49  QQQQQQ QQQQQQQ QQQQ QQ  Q QQQQQQTQ Q QQQQQQ  QQQ QQQQQ QQQQQAQQQQQQQQQ
     9   10 B E  H  X S+     0   0   78  234    8  EEEEEE EEEEEEE EEEE EE  E EEEEEEEE E EEEEEE  EEE EEEEE EEEEEEEEEEEEEEE
    10   11 B A  H  X S+     0   0    1  234    8  AAAAAA AAATAAA ASSA AA  A ASAATAAA A AAAAAA  AAA AAAAA AAAAAAAAAAAAAAA
    11   12 B E  H  X S+     0   0  121  234    8  EEEEEE EEEEEEE EEEE EE  E EEEEEEEE E EEEEEE  EEE EEEEE EEEEEEEEEEEEEEE
    12   13 B Q  H  X S+     0   0  111  238   70  QTTTQQ QQRQQRQ TQQT AT  T TQQAQQTT A QSSSSS  QQQ QQQQQ SQQQQQQTQQQQQQQ
    13   14 B L  H  X S+     0   0   14  238    4  LLLLLL LLLLLLL LLLL LL  L LLLLLLLL L LLLLLL  LLL LLLLL LLLLLLLLLLLLLLL
    14   15 B K  H  X S+     0   0   99  238   24  RKKKKK KKKKRKK KKKK KK  K KKKKKKKK K KKKKKK  RKK KKKKK KKKKKKKKKKKKKKK
    15   16 B N  H  X S+     0   0   33  239   51  NNNNSS SSNNNNS NNNN NN  N NNSNNKNN K KNNNNN  NKK KKKKK NKKKKNKNKKKKKKK
    16   17 B Q  H  X S+     0   0   82  239   58  QTTCQQ QQTQQTQ AQQA AA  A AMQQQQAA Q QAAAAA  QQQ QQQQQ AQQQQAQAQQQQQQQ
    17   18 B I  H  X S+     0   0    7  240    4  IIIIII IIIIIII IIII II  I IIIIIIII I IIIIII  III IIIII IIIIIIIIIIIIIII
    18   19 B R  H  X S+     0   0  135  242   52  RRRRRR RRRRRRR RRRR RR  R RRRRRARR A ARRRRR  QAA AAAAA RAAAARARAAAAAAA
    19   20 B D  H  X S+     0   0   85  244   60  SDDDEE EEDEDDE DEED DD  D DEDDEDDD EDDDDDDD  DDD DDDDD DDDDDDDDDDDDDDD
    20   21 B A  H  X S+     0   0   36  243   62  PAAAAA AAAAAAA AAAA AA  A AAAAAAAA AAAAAAAA  AAA AAAAA AAAAAAAAAAAAAAA
    21   22 B R  H >X S+     0   0   22  244   22  ARRRRR RRRRRRR RRRR RR  R RRRRRRRR RRRRRRRR  RRR RRRRR RRRRRRRRRRRRRRR
    22   23 B K  H 3< S+     0   0  136  244   50  SKKKKK KKKKKKK KKKK KK  K KKKKKKKK KKKKKKKK  KKK KKKKK KKKKKKKKKKKKKKK
    23   24 B A  H 3< S+     0   0   79  244   56  SQAASA SSNAANA AVVV AV  A AAAKAAAA QVAAAAAA  AAA AAAAA AAAAAAAAAAAAAAA
    24   25 B C  H << S+     0   0   19  244   85  SAAAAA AAAACAA AAAA AA  A AAMAACAA CACAAAAA  CCC CCCCC ACCCCACVCCCCCCC
    25   26 B A     <  +     0   0   46  244   56  PCCCNN NNLASLS CAAC CC  C CAAAGACC AQACCCCC  NAA AAAAA CAAAACACAAAAAAA
    26   27 B D        +     0   0   88  243    0  SDDDDD DDDDDDD DDDD DD  D DDDDDDDD DDDDDDDD  DDD DDDDD DDDDDDDDDDDDDDD
    27   28 B A        -     0   0   17  243   50  STTTTT TTTTSTT TTTT TT  T TTTTTTTT TTTTTTTT  ATV VIVTV TVIMVTITTVTITII
    28   29 B T    >>  -     0   0   59  244   35  PTTTTT TTTTTTT STTS SS  S STSTTTSSTTNTSSSSS  TTT TTTTT STTTTSTSTTTTTTT
    29   30 B L  H 3> S+     0   0    0  244    3  ALLLLL LLLLLLL LLLL LL  L LLLLLLLLLIFLLLLLL  LLL LLLLL LLLLLILILLLLLLL
    30   31 B S  H 34 S+     0   0   38  244   90  SVVVAA AAVNSAA SAAV IV  A VLAVAAVAAELALLLLL  VAA AAAAA LAAAALALAAAAAAA
    31   32 B Q  H X4 S+     0   0  119  247   50  EQQQTA TTQQQQS QQQQ QQ  Q QQQAQQTQEQSQQQQQQ QQEE EEEEE QEEEEQEQEEEEEEE
    32   33 B I  H 3< S+     0   0   28  248   52  IAAAVV VVAAIAV AAAA AA  A AAIVAIAALTVIAAAAA LILL LLLLL ALLLLALALLLLLLL
    33   34 B T  T >< S+     0   0    0  249   56  TTTTAA AATATTA TAAT TT  T TSATCVTTVTAVAAAAA VTVV VVVAV AVVVVTVTAVVVAVV
    34   35 B N  T <  S+     0   0  129  249   72  AGSASA SSAVASA TAAA NN  S NAAASSGSSGQATTATA SSSS SSSSS TSSSSSSASSSSSSS
    35   36 B N  T 3  S+     0   0  111  249   55  GNNNNS NNGNGGN SNNG NN  N NNNNGGNNGGNGSLSSS GNGG GGGGG SGGGGQGQGGGGGGG
    36   37 B I  S <  S-     0   0   21  249   49  LMMMLM LLMVLML MVVM LL  L LVIVVVMLLMVVLLLLL LMLL LLLLL LLLLLLLLLLLLLLL
    37   38 B D        -     0   0  138  249   32  DEEEEE EEDEDEE EDDE EE  E EEEEEEEEEEDEEEEEE EDEE EEEEE EEEEEEEEEEEEEEE
    38   39 B P        -     0   0   89  250   59  PPPPPP PPPQSPP PPPP PP  P PPPPALPPVVQVPPPPP VSVV VVVVV PVVVVAVAVVVVVVV
    39   40 B V        -     0   0   23  251   30  VIIIII IIIVVII VVVI II  I IVVVVVIIVVIVIIIII VVVV VVVVV IVVVVVVVVVVVVVV
    40   41 B G        -     0   0   54  251   45  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGSGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
    41   42 B R        -     0   0  115  251    6  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
    42   43 B I        +     0   0    8  251   27  IIIIII IIIIIII IIII II  I IIIIIIIIVIIIIIIII VIVV VVVVV IVVVIIVIVVVVVVV
    43   44 B Q        -     0   0   54  251   59  QQQQQQ QQQQQQQ QQQQ QQ  Q QQQQQQQQQQQQQQQQQ QQQQ QQQQQ QQQQQQQQQQQQQQQ
    44   45 B M        -     0   0   11  252    5  MMMMMM MMMMMMM MMMM MM  M MLMMMMMMMLMMMMMMM MMMM MMMMM MMMMMLMLMMMMMMM
    45   46 B R        -     0   0   49  252   18  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
    46   47 B T  E     +A  338   0A  12  252   43  TTTTTT TTTTTTT TTTT TT  T TTTTTTTTTTTTTTTTT TTTT TTTTT TTTTTTTTTTTTTTT
    47   48 B R  E     +     0   0A  56  252   11  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
    48   49 B R  E     -A  337   0A  60  252    9  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
    49   50 B T  E     -A  336   0A  30  252   20  TTTTTT TTTTTTT TTTT TT  T TTTTTTTTTTTTTTTTT TTTT TTTTT TTTTTTTTTTTTTTT
    50   51 B L  E     -A  335   0A   0  252    0  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
    51   52 B R        +     0   0  159  252   22  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
    52   53 B G        +     0   0   20  252    0  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
    53   54 B H        -     0   0    4  252    0  HHHHHH HHHHHHH HHHH HH  H HHHHHHHHHHHHHHHHH HHHH HHHHH HHHHHHHHHHHHHHH
    54   55 B L  S    S+     0   0  116  252    4  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
    55   56 B A  S    S-     0   0    0  252    4  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
    56   57 B K        -     0   0   15  252    0  KKKKKK KKKKKKK KKKK KK  K KKKKKKKKKKKKKKKKK KKKK KKKKK KKKKKKKKKKKKKKK
    57   58 B I  E     -D   73   0B   0  252    1  IIIIII IIIIIII IIII II  I IIIIIIIIIIIIIIIII IIII IIIII IIIIIIIIIIIIIII
    58   59 B Y  E     -     0   0B   6  252    4  YYYYYY YYYYYYY YYYY YY  Y YYYYYYYYYYYYYYYYY YYYY YYYYY YYYYYYYYYYYYYYY
    59   60 B A  E     -D   72   0B  13  252    5  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
    60   61 B M  E     -D   71   0B  15  252    4  MMMMMM MMMMMMM MMMM MM  M MMMMMMMMMMMMMMMMM MMMM MMMMM MMMMMMMMMMMMMMM
    61   62 B H  E     -D   70   0B  44  252    4  HHHHHH HHHHHHH HHHH HH  H HHHHHHHHHHHHHHHHH HHHH HHHHH HHHHHHHHHHHHHHH
    62   63 B W  E     -D   69   0B  11  252    0  WWWWWW WWWWWWW WWWW WW  W WWWWWWWWWWWWWWWWW WWWW WWWWW WWWWWWWWWWWWWWW
    63   64 B G    >   -     0   0    3  252   43  GGGGAA AAGAGGA GAAG GG  G GSAAASGGASASGGGGG AGAA AAAAA GAAAAGAGAGAAAAA
    64   65 B T  T 3  S+     0   0   75  252   58  TSSSST SSSSSSS STTS CS  S STSSSTSSTTCTNNNNN TYTT TTTTT NTTTTSTNTTTTTTT
    65   66 B D  T 3  S-     0   0   80  252    1  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
    66   67 B S  S <  S+     0   0    3  252   50  SSssSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
    67   68 B R  S    S+     0   0   94  252   20  RRrrRR RRRRRRR RRRR RR  R RRRRRKRRKRRKRRRRR KRKK KKKKK RKKKKRKRKKKKKKK
    68   69 B L  E     + E   0  82B  31  252   80  LNYNNN NNNNLNN NNNN NN  N NNNNNLNNLLSLNNNNN LSLL LLLLL NLLLLYLYLLLLLLL
    69   70 B L  E     -DE  62  81B   0  252   12  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LVLL LLLLL LLLLLLLLLLLLLLL
    70   71 B L  E     -DE  61  80B   0  252    3  VVVVVV VVVVVVV VVVV VV  V VVVVVVVVVVVVVVVVV VAVV VVVVV VVVVVVVVVVVVVVV
    71   72 B S  E     -DE  60  79B   0  252    1  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SVSS SSSSS SSSSSSSSSSSSSSS
    72   73 B A  E     -DE  59  78B   0  252    1  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAAAAAAAAAA ATAA AAAAA AAAAAAAAAAAAAAA
    73   74 B S  E >>  -DE  57  77B   0  252    1  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SASS SSSSS SSSSSSSSSSSSSSS
    74   75 B Q  T 34 S+     0   0    1  252    1  QQQQQQ QQQQQQQ QQQQ QQ  Q QQQQQQQQQQQQQQQQQ QEQQ QQQQQ QQQQQQQQQQQQQQQ
    75   76 B D  T 34 S-     0   0    9  252    1  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DLDD DDDDD DDDDDDDDDDDDDDD
    76   77 B G  T <4 S+     0   0    7  252    1  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GPGG GGGGG GGGGGGGGGGGGGGG
    77   78 B K  E  <  -EF  73  93B  52  252    7  KKKKKK KKKKKKK KKKK KK  K KKKKKKKKKKKKKKKKK KRKK KKKKK KKKKKKKKKKKKKKK
    78   79 B L  E     -EF  72  92B   0  252    2  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LELL LLLLL LLLLLLLLLLLLLLL
    79   80 B I  E     -EF  71  91B   0  252    3  IIIIII IIIIIII IIII II  I IIIIIIIIIIIIIIIII IVII IIIII IIIIIIIIIIIIIII
    80   81 B I  E     -EF  70  90B   0  252   16  IVVVVV VVVVIVV VVVV VV  V VVVVVVVVVVVVVVVVV VSVV VVVVV VVVVVVVVVVVVVVV
    81   82 B W  E     -EF  69  88B   0  252    0  WWWWWW WWWWWWW WWWW WW  W WWWWWWWWWWWWWWWWW WSWW WWWWW WWWWWWWWWWWWWWW
    82   83 B D  E >>> -EF  68  87B  21  252    2  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DLDD DDDDD DDDDDDDDDDDDDDD
    83   84 B S  T 345S+     0   0    0  252   52  SSASSS SSSGSSS SGGS SS  S SGGSGTSSTTSTSSSSS TRTS STSTS SSTTSSTSTSTTTTT
    84   85 B Y  T 345S+     0   0   57  251   17  YYYYYY YYYYYYY YYYY HH  H HYFYYYYHYYYYHHHHH YTYY YYYYY HYYYYHYHYYYYYYY
    85   86 B T  T <45S-     0   0   56  252    5  TTTTTT TTTTTTT TTTT TT  T TTTTTTTTTTTTTTTTT TITT TTTTT TTTTTTTTTTTTTTT
    86   87 B T  T  <5 +     0   0   43  252    4  TTTTTT TTTTTTT TTTT TT  T TTTTTTTTTTTTTTTTT TMTT TTTTT TTTTTTTTTTTTTTT
    87   88 B N  E   < -F   82   0B  99  252    4  NNNNNN NNNNNNN NNNN NN  N NNNNNNNNNNNNNNNNN NHNN NNNNN NNNNNNNNNNNNNNN
    88   89 B K  E     +F   81   0B  95  249    1  KKKKKK KKKKKKK KKKK KK  K KKKKKKKKKKKKKKKKK K.KK KKKKK KKKKKKKKKKKKKKK
    89   90 B V  E    S+     0   0B  66  249   17  VVVVVV VVVVMVV VVVV VV  V VVMIVVVVVVVVVVVVV V.VV VVVVV VVVVVVVVVVVVVVV
    90   91 B H  E     -F   80   0B  57  249    2  HHHHHH HHHHHHH HHHH HH  H HHHHHHHHHHHHHHHHH H.HH HHHHH HHHHHHHHHHHHHHH
    91   92 B A  E     -F   79   0B  43  251    0  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
    92   93 B I  E     -F   78   0B   0  252    0  IIIIII IIIIIII IIII II  I IIIIIIIIIIIIIIIII IIII IIIII IIIIIIIIIIIIIII
    93   94 B P  E     -F   77   0B  80  252    4  PPPPPP PPPPPPP PPPP PP  P PPPPPPPPPPPPPPPPP PPPP PPPPP PPPPPPPPPPPPPPP
    94   95 B L        -     0   0   26  252    0  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
    95   96 B R  S    S+     0   0  190  252    6  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
    96   97 B S        -     0   0   17  252    3  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
    97   98 B S  S    S+     0   0    6  252    3  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
    98   99 B W        +     0   0    2  252    0  WWWWWW WWWWWWW WWWW WW  W WWWWWWWWWWWWWWWWW WWWW WWWWW WWWWWWWWWWWWWWW
    99  100 B V  E     -G  115   0C   4  252    0  VVVVVV VVVVVVV VVVV VV  V VVVVVVVVVVVVVVVVV VVVV VVVVV VVVVVVVVVVVVVVV
   100  101 B M  E     +     0   0C   5  252    0  MMMMMM MMMMMMM MMMM MM  M MMMMMMMMMMMMMMMMM MMMM MMMMM MMMMMMMMMMMMMMM
   101  102 B T  E     -G  114   0C   8  252    0  TTTTTT TTTTTTT TTTT TT  T TTTTTTTTTTTTTTTTT TTTT TTTTT TTTTTTTTTTTTTTT
   102  103 B C  E     -G  113   0C   0  252    1  CCCCCC CCCCCCC CCCC CC  C CCCCCCCCCCCCCCCCC CCCC CCCCC CCCCCCCCCCCCCCC
   103  104 B A  E     -G  112   0C   0  252    3  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAASAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   104  105 B Y  E     -G  111   0C   9  252    2  YYYYYY YYYYYYY YYYY YY  Y YYYYYYYYYYYYYYYYY YYYY YYYYY YYYYYYYYYYYYYYY
   105  106 B A    >   -     0   0    0  252   22  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   106  107 B P  T 3  S+     0   0   64  252    3  PPPPPP PPPPPPP PPPP PP  P PPPPPPPPPPQPPPPPP PPPP PPPPP PPPPPPPPPPPPPPP
   107  108 B S  T 3  S-     0   0   47  252    6  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   108  109 B G  S <  S+     0   0    8  252    6  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   109  110 B N  S    S+     0   0   50  252   22  NSSSSN SSSSNSS SSSS NN  S NNNNNNSSNNNNSSSSS NNNN NNNNN SNNNNNNNNNNNNNN
   110  111 B Y  E     - H   0 124C  50  252   13  FYYFFY FFYYYYY FYYY FF  Y FYYYFFYYFFYFYYYYY FYFF FFFFF YFFFFYFYFFFFFFF
   111  112 B V  E     -GH 104 123C   0  252    0  VVVVVV VVVVVVV VVVV VV  V VVVVVVVVVVVVVVVVV VVVV VVVVV VVVVVVVVVVVVVVV
   112  113 B A  E     +GH 103 122C   0  252    2  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   113  114 B C  E     +GH 102 121C   5  252    2  CCCCCC CCCCCCC CCCC CC  C CCCCCCCCCCCCCCCCC CCCC CCCCC CCCCCCCCCCCCCCC
   114  115 B G  E     +GH 101 120C   1  252    0  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   115  116 B G  E >  S-G   99   0C   0  252    0  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   116  117 B L  T 3  S+     0   0    1  252    0  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   117  118 B D  T 3  S-     0   0   50  252    0  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   118  119 B N  S <  S+     0   0   30  252    0  NNNNNN NNNNNNN NNNN NN  N NNNNNNNNNNNNNNNNN NNNN NNNNN NNNNNNNNNNNNNNN
   119  120 B I  E     - I   0 139C  39  252   24  IIIIII IIIIIII IIII II  I IIIIIMIIMMIMMMMMM MIMM MMMMM MMMMMIMIMMMMMMM
   120  121 B C  E     -HI 114 138C   0  252    3  CCCCCC CCCCCCC CCCC CC  C CCCCCCCCCCCCCCCCC CCCC CCCCC CCCCCCCCCCCCCCC
   121  122 B S  E     -HI 113 137C   9  252    6  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   122  123 B I  E     -HI 112 136C   0  252    2  IIIIII IIIIIII IIII II  I IIIIIIIIIIIIIIIII IIII IIIII IIIIIIIIIIIIIII
   123  124 B Y  E     -H  111   0C   3  252    0  YYYYYY YYYYYYY YYYY YY  Y YYYYYYYYYYYYYYYYY YYYY YYYYY YYYYYYYYYYYYYYY
   124  125 B N  E     +H  110   0C  24  252   40  SSSSSS SSSSSSS SCCS NN  S NNSSSNSSSNSNNNNNN SNSN NSNSN NNSSNNNNSSSSSSS
   125  126 B L        +     0   0   11  252    1  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   126  127 B K  S    S+     0   0  109  252   43  KKKKKK KKKKKKK KKKK KK  K KKKKKKKKKKKKKKKKK KKKK KKKKK KKKKKKKKKKKKKKK
   127  128 B T  S    S-     0   0   64  252   55  TTTTTT TTTTTTT TTTT TT  T TTTTTTTTSTTTTTTTT STSS SSSSS TSSSSTSTSSSSSSS
   128  129 B R  S    S+     0   0  267  250   17  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
   129  130 B E  S    S-     0   0  173  251    9  EEEEEE EEEEEEE EEEE EE  E EEEEEEEEEEEEEEEEE EEEE EEEEE EEEEEEEEEEEEEEE
   130  131 B G        -     0   0   50  252   11  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   131  132 B N        +     0   0   30  252   52  NNNNNN NNNNNNN NNNN NN  N NNNNNNTNNNNNNNNNN NNNN NNNNN NNNNNNNNNNNNNNN
   132  133 B V  S    S+     0   0   58  253   42  VVVVVV VVVVVVV VVVV VV  V VVVVVVVVVVVVVVVVV VVVV VVVVV VVVVVVVVVVVVVVV
   133  134 B R  S    S-     0   0  213  253   22  RRRRRR RRRRRRR RRRR RR  R RRRRRKRRKRRKRRRRR KRKK KKKKK RKKKKRKRKKKKKKK
   134  135 B V        -     0   0   29  253   15  VVVVVV VVVVVVV VVVV VV  V VVVVVVVVVVVVVVVVV VVVV VVVVV VVVVVIVIVVVVVVV
   135  136 B S  S    S-     0   0   43  253   48  SSSSSS SSSSTSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSASASSSSSSS
   136  137 B R  E     -I  122   0C 105  253    7  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
   137  138 B E  E     -I  121   0C  75  253    3  EEEEEE EEEEEEE EEEE EE  E EEEEEEEEEEEEEEEEE EEEE EEEEE EEEEEEEEEEEEEEE
   138  139 B L  E     +I  120   0C   1  252    1  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   139  140 B A  E     +I  119   0C  61  252   57  PPPPPP PPPPPPP PPPP PP  P PPSPPSPPSAPSPPPPP SPSS SSSSS PSSSSGSGSSSSSSS
   140  141 B G        +     0   0   50  252   25  GGGGGG GGGGGGG GGGG GG  G GGGGGAGGAAGAGGGGG AGAA AAAGA GAAAAGAGGAAAGAA
   141  142 B H        -     0   0    9  252    2  HHHHHH HHHHHHH HHHH HH  H HHHHHHHHHHHHHHHHH HHHH HHHHH HHHHHHHHHHHHHHH
   142  143 B T  S    S+     0   0   64  252   42  TTTTTT TTTTTTT TTTT TT  S TTNTTTTSTTTTGGGGG TTTT TTTTT GTTTTTTTTTTTTTT
   143  144 B G  S    S-     0   0    0  252    2  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   144  145 B Y        -     0   0    0  251    0  YYYYYY YYYYYYY YYYY YY  Y YYYYYYYYYYYYYYYYY YYYY YYYYY YYYYYYYYYYYYYYY
   145  146 B L  E     +J  160   0D   0  251    1  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   146  147 B S  E     -     0   0D   3  251    0  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   147  148 B C  E     -J  159   0D   9  251    5  CCCCCC CCCCCCC CCCC CC  C CCCCCCCCCCCCCCCCC CCCC CCCCC CCCCCCCCCCCCCCC
   148  149 B C  E     -J  158   0D   0  251    0  CCCCCC CCCCCCC CCCC CC  C CCCCCCCCCCCCCCCCC CCCC CCCCC CCCCCCCCCCCCCCC
   149  150 B R  E     -J  157   0D  53  251    4  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
   150  151 B F  E     -J  156   0D  10  251    0  FFFFFF FFFFFFF FFFF FF  F FFFFFFFFFFFFFFFFF FFFF FFFFF FFFFFFFFFFFFFFF
   151  152 B L  S    S-     0   0   26  251   24  LLLLLL LLVLLVL LLLI LL  L LILIILLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   152  153 B D  S    S-     0   0   60  251   40  DDDDDD DDDDDDD DDDD DD  D DDDDDDNDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   153  154 B D  S    S+     0   0   60  251    2  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   154  155 B N  S    S+     0   0   44  251   65  NNNNNN NNNNNNN NNNN NN  N NSNTNNDNNNTNNNNNN NGNN NNNNN NNNNNNNNNNNNNNN
   155  156 B Q  E     + K   0 169D  60  251   47  QQQQQQ QQQQQQQ QQQQ QQ  Q QQQNSSQQNQQNQQQQQ NQNN NNNNN QNNNNQNQNNNNNNN
   156  157 B I  E     -JK 150 168D   0  251    1  IIIIII IIIIIII IIII II  I IIIIIIIIIIIIIIIII IIII IIIII IIIIIIIIIIIIIII
   157  158 B V  E     -JK 149 167D   0  251   22  IVVVVV VVVVLVV VVVV VV  L VVVVVVVLVVLVVVVVV VIVV VVVVV VVVVVVVVVVVVVVV
   158  159 B T  E     -JK 148 166D   0  251    1  TTTTTT TTTTTTT TTTT TT  T TTTTTTTTTTTTTTTTT TTTT TTTTT TTTTTTTTTTTTTTT
   159  160 B S  E     -JK 147 165D   0  251    2  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   160  161 B S  E >   -J  145   0D   0  251    0  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   161  162 B G  T 3  S+     0   0    0  251    0  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   162  163 B D  T 3  S-     0   0    5  251    0  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   163  164 B T  S <  S+     0   0    8  251   63  TMMMMM MMMMTMM MVVM MM  M MVMMMTMMTTTTMMMMM TTTT TTTTT MTTTTMTMTTTTTTT
   164  165 B T        -     0   0    2  251   16  TTTTTT TTTSTTT STTS SS  T STTTSTSTTTTTSSSSS TTTT TTTTT STTTTSTSTTTTTTT
   165  166 B C  E     -KL 159 179D   0  251    0  CCCCCC CCCCCCC CCCC CC  C CCCCCCCCCCCCCCCCC CCC. CCCCC CCCCCCCCCCCCCCC
   166  167 B A  E     -KL 158 178D   0  252   62  AAAAAA AAAAAAA AAAA GG  A GGAGAAAAAACAGGGGG AAAA AAATA GAAAAAAATAAATAA
   167  168 B L  E     -KL 157 177D   6  252    6  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLP LLLL LLLLL LLLLLLLLLLLLLLL
   168  169 B W  E     -KL 156 175D   2  252    0  WWWWWW WWWWWWW WWWW WW  W WWWWWWWWWWWWWWWWW WWWW WWWWW WWWWWWWWWWWWWWW
   169  170 B D  E >>> -KL 155 174D  37  252    0  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   170  171 B I  T 345S+     0   0    7  252    8  IIIIII IIIIIII IIII II  I IIIIIIIIIIIIIIIII IIII IIIII IIIIIIIIIIIIIII
   171  172 B E  T 345S+     0   0  144  252    6  EEEEEE EEEEEEE EEEE EE  E EEEEEEEEEEEEEEEEE EEEE EEEEE EEEEEEEEEEEEEEE
   172  173 B T  T <45S-     0   0   78  252   36  TTTTTT TTTTTTT TTTT TT  T TTTTTTTTTTTTTTTTT TTTT TTTTT TTTTTTTTTTTTTTT
   173  174 B G  T  <5 +     0   0   16  253    8  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   174  175 B Q  E   < -L  169   0D 135  253   68  QQQQQQ QQQQQQQ QQQQ QQ  Q QQQHQQQQQQQQLLLLL QQQQ QQQQQ LQQQQQQQQQQQQQQ
   175  176 B Q  E     -L  168   0D  30  253   45  QQQQQQ QQQQQQQ QQQQ QQ  Q QQQQQQQQQQQQQQQQQ QQQQ QQQQQ QQQQQQQQQQQQQQQ
   176  177 B T  E     +     0   0D  64  253   73  TCCCCC CCCTACV CVVC CC  C CVTTTKCCKKLKVVVVV KTKK KKKKK VKKKKSKTKKKKKKK
   177  178 B T  E     -L  167   0D  20  253   47  VTTTTT TTTTTTT SCCT TT  G TATTTTTGTTTTTTTTT TTTT TTTTT TTTTTTTTTTTTTTT
   178  179 B T  E     -L  166   0D   5  253   77  GSSSAA AAQAAQA SGGS SS  Q STSSSVSQVVSVSSSSS VTVV VVVVV SVVVVSVSVVVVVVV
   179  180 B F  E     +L  165   0D   1  253    0  FFFFFF FFFFFFF FFFF FF  F FFFFFFFFFFFFFFFFF FFFF FFFFF FFFFFFFFFFFFFFF
   180  181 B T        +     0   0   34  253   72  ATTTTT TTTTTTT ITTI LL  T LTNTTLITVTILLLLLL VTVV VVVVV LVVVVQVQVVVVVVV
   181  182 B G        +     0   0   37  253   30  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   182  183 B H        -     0   0    7  253    0  HHHHHH HHHHHHH HHHH HH  H HHHHHHHHHHHHHHHHH HHHH HHHHH HHHHHHHHHHHHHHH
   183  184 B T  S    S+     0   0   99  253   63  STTTTT TTTTTTT TTTT TT  T TTTTTTTTTTTTTTTTT TSTT TTTTT TTTTTTTTTTTTTTT
   184  185 B G  S    S-     0   0    0  253    1  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   185  186 B D        -     0   0    1  253    1  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   186  187 B V  E     -M  202   0E   0  253   22  VVVVVV VVVVVVV VVVV VV  V VVVVVCVVCCVCVVVVV CVCC CCCCC VCCCCVCVCCCCCCC
   187  188 B M  E     +     0   0E   3  253    1  MMMMMM MMMMMMM MMMM MM  M MMMMMMMMMMMMMMMMM MMMM MMMMM MMMMMMMMMMMMMMM
   188  189 B S  E     -M  201   0E  16  253    8  SSSSSS SSSSSSS SSSS AA  S ASSSSSSSSSSSAAAAA SSSS SSSSS ASSSSASASSSSSSS
   189  190 B L  E     -M  200   0E   3  253   14  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   190  191 B S  E     -M  199   0E  21  253   24  SSSSSS SSSSSSS SSSS SS  S SSSSSASSAASASSSSS ASAA AAAAA SAAAASASAAAAAAA
   191  192 B L  E     -M  198   0E  29  253   29  LLLLLL LLLLLLL MLLL VL  L LLVLTVLLVVLVLLLLL VLVV VVVVV LVVVVLVLVVVVVVV
   192  193 B A    >   -     0   0    4  253   57  AASSSS SSSSSSS SSSA SS  A SASSSSAASSCSAAAAA SSSS SSSSS ASSSSASASSSSSSS
   193  194 B P  T 3  S+     0   0   85  253   13  PHPPPP PPPPPPP PPPP PP  P PPPTPPPPPPNPPPPPP PPPP PPPPP PPPPPPPPPPPPPPP
   194  195 B D  T 3  S-     0   0   87  253   52  DDDDDD DDNDDSD DDDD QQ  D QDEDDDDDDDDDQQQQQ DDDD DDDDD QDDDDQDQDDDDDDD
   195  196 B T  S <  S+     0   0   62  253   97  GTNMFM FFMMYMM MMMM FC  Q CLMnFFMQYFgFCCCCC FLFF FFFFF CFYFFSYGFFFFFFF
   196  197 B R  S    S+     0   0  142  252   61  RHRRRR RRRRKRR RRRR RR  R RRRkRKHRKNrKKKKKK KKRN NKNKN KNKKNKKKKNKKKKK
   197  198 B L  E     - N   0 211E  37  252   71  TTTTTT TTTTTTT TTTT VV  T VTAVTLTTLLTLTTTTT LTLL LLLLL TLLLLTLTLLLLLLL
   198  199 B F  E     -MN 191 210E   0  252    0  FFFFFF FFFFFFF FFFF FF  F FFFFFFFFFFFFFFFFF FFFF FFFFF FFFFFFFFFFFFFFF
   199  200 B V  E     -MN 190 209E   0  252   11  VVVVIV IITVVTI VVVV VV  V VVVVVIVVIIVIVVVVV IVII IIIII VIIIIVIVIIIIIII
   200  201 B S  E     -MN 189 208E   0  252    0  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   201  202 B G  E     +MN 188 207E   0  252    0  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   202  203 B A  E >   -M  186   0E   0  252    4  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   203  204 B C  T 3  S+     0   0    5  252    2  CCCCCC CCCCCCC CCCC CC  C CCCCCCCCCCCCCCCCC CCCC CCCCC CCCCCCCCCCCCCCC
   204  205 B D  T 3  S-     0   0   31  252    0  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   205  206 B A  S <  S+     0   0   20  252   16  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   206  207 B S  E     - O   0 222E   6  252   69  SSSSSS SSSSTSS SSSS SS  S SSSSSTSSSSSTSSSSS SSSS SSSSS SSSSSTSKSSSSSSS
   207  208 B A  E     -NO 201 221E   0  252   35  IAAAAA AAAASAA AAAA AA  A AAAAAAAAAAAAAAAAA ASAA AAAAA AAAAAAAAAAAAAAA
   208  209 B K  E     -NO 200 220E  18  252    0  KKKKKK KKKKKKK KKKK KK  K KKKKKKKKKKKKKKKKK KKKK KKKKK KKKKKKKKKKKKKKK
   209  210 B L  E     -NO 199 219E   2  252    8  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLVLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   210  211 B W  E     -NO 198 217E   1  252    0  WWWWWW WWWWWWW WWWW WW  W WWWWWWWWWWWWWWWWW WWWW WWWWW WWWWWWWWWWWWWWW
   211  212 B D  E >>> -NO 197 216E  11  252    1  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   212  213 B V  T 345S+     0   0   12  252   19  VIIIII IIIIIII VIII II  V IIIIVVIVVVIVIIIII VIVV VVVVV IVVVVIVIVVVVVVV
   213  214 B R  T 345S+     0   0  194  252    1  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
   214  215 B E  T <45S-     0   0  111  252   59  DDDEDD DDDDDDD DDDE EE  D EDDTDEEDEQDEEEEEE EDEE EEEEE EEEEEEEEEEEEEEE
   215  216 B G  T  <5 +     0   0    8  252   25  SGGGGG GGGGGGG GGGG GG  C GGGGGGGCGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   216  217 B M  E      -     0   0    1  252    0  FFFFFF FFFFFFF FFFF FF  F FFFFFFFFFFFFFFFFF FFFF FFFFF FFFFFFFFFFFFFFF
   235  236 B P  T 3  S+     0   0   45  252    0  PPPPPP PPPPPPP PPPP PP  P PPPPPPPPPPPPPPPPP PPPP PPPPP PPPPPPPPPPPPPPP
   236  237 B N  T 3  S-     0   0   42  252   27  NNNNSN SSNNNNS NSSN NN  S NSSNNNNSNSSNNNNNN NSNN NNNSN NNNNSSNNSNNNSNN
   237  238 B G  S <  S+     0   0   12  252    8  GGGGGG GGGGGGG GGGG GG  G GGGSGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   238  239 B N  S    S+     0   0   56  252   76  YFYQNF NNHYNHH YFFY HH  F HLQNHEWFEQFEQQQQQ EYEE EEEEE QEEEEQEFEEEEEEE
   239  240 B A  E     - Q   0 253F   0  252   11  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   240  241 B F  E     -PQ 233 252F   0  252   16  FFFFFF FFFFFFF FFFF FF  F FFFFFIFFIIFIFFFFF IFII IIIII FIIIIFIFIIIIIII
   241  242 B A  E     -PQ 232 251F   0  252   51  TAAAAA AAAAGAA AGGA AA  A AATAACAACCGCAAAAA CACC CCCCC ACCCCACACCCCCCC
   242  243 B T  E     -PQ 231 250F   0  252    0  TTTTTT TTTTTTT TTTT TT  T TTTTTTTTTTTTTTTTT TTTT TTTTT TTTTTTTTTTTTTTT
   243  244 B G  E     +PQ 230 249F   0  252    0  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   244  245 B S  E >   -P  228   0F   0  252    0  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   245  246 B D  T 3  S+     0   0   13  252    0  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   246  247 B D  T 3  S-     0   0   28  252    0  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   247  248 B A  S <  S+     0   0    6  252   12  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   248  249 B T        -     0   0   16  252   42  TTTTTT TTTTTTT TTTT TT  T TTTCTTTTSTTTTTTTT STSS SSSSS TSSSSTSTSSSSSSS
   249  250 B C  E     -QR 243 263F   0  252    3  CCCCCC CCCCCCC CCCC CC  C CCCCCCCCCCCCCCCCC CCCC CCCCC CCCCCCCCCCCCCCC
   250  251 B R  E     -QR 242 262F  23  252    3  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
   251  252 B L  E     -QR 241 261F   0  252    0  LLLLLL LLLLLLL LLLL LL  M LFLLLLLMLMLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   252  253 B F  E     -QR 240 259F   1  251    0  FFFFFF FFFF.FF FFFF FF  F FFFFFFFFFFFFFFFFF FFFF FFFFF FFFFFFFFFFFFFFF
   253  254 B D  E  >> -QR 239 258F   1  251    0  DDDDDD DDDD.DD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   254  255 B L  T >45S+     0   0   15  251   26  LIIIII IIII.II IIII II  I IIVIILIILLILIIIII LLLL LLLLL ILLLLILILLLLLLL
   255  256 B R  T 345S+     0   0   57  251    0  RRRRRR RRRR.RR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
   256  257 B A  T 345S-     0   0    0  251    8  AAAAAA AAAA.AA SAAA AA  A AAAAAASAAASAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   257  258 B D  T <<5 +     0   0    0  251    0  DDDDDD DDDD.DD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   258  259 B Q  E      -     0   0  119  253   47  HHHHHH HHHHHHH HHHH HH  H HHNHHHHHHQHHHHHHH HHHH HHHHH HHHHHHQHHHDDHHH
   266  267 B D  T 3  S+     0   0  161  253   25  DDDDDD DDDDDDD DDDD DD  D DDDDDEDDEDDEDDDDD EDEE EEEEE DEEEEDEDEEEEEEE
   267  268 B N  T 3  S+     0   0   66  253   48  NNNNNN NNNNNNN NNNN NN  N NNNSNSNNSSNSNNNNN GNSS SSSSS NSSSSNSNSSSSSSS
   268  269 B I    <   +     0   0   23  253   21  IIIIII IIIIIII IIII II  I IIIIIIIIIIIIIIIII IIII IIIII IIIIIIIIIIIIIII
   269  270 B I        +     0   0   97  253   31  IIIIII IIIIIII IIII II  I IIIIIIIIIIIIIIIII IIII IIIII IIIIIIIIIIIIIIV
   270  271 B C  S    S-     0   0   10  253    6  CCCCCC CCCCCCC CCCC CC  C CCCCCCCCCCCCCCCCC CCCC CCCCC CCCCCCCCCCCCCCC
   271  272 B G        -     0   0    1  253    0  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG SGGGG GGGGGGGGGGGGGGG
   272  273 B I  E     +S  288   0G   0  253    1  IIIIII IIIIIII IIII II  I IIIIIIIIIIIIIIIII IIII IIIII IIIIIIIIIIIIIII
   273  274 B T  E     +     0   0G  13  253    4  TTTTTT TTTTTTT TTTT TT  T TTTTTTTTTTTTTTTTT TTTT TTTTT TTTTTTTTTTTTTTT
   274  275 B S  E     +S  287   0G  18  252    0  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   275  276 B V  E     +S  286   0G  10  252    5  VVVVVV VVVVVVV VVVV VV  V VVVVVVVVVVVVVVVVV VVVV VVVVV VVVVVVVVVVVVVVV
   276  277 B S  E     -S  285   0G  15  252   21  AAAAAA AAAAAAA SAAA AA  A AAAAAAAAASAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   277  278 B F  E     -S  284   0G  12  252   13  FFFFFF FFFFFFF FFFF FF  F FFFFFFFFFFFFFFFFF FFFF FFFFF FFFFFFFFFFFFFFF
   278  279 B S        -     0   0    3  252    1  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   279  280 B K  S    S+     0   0  104  252   80  RKKKKK KKKKKKK KKKK KK  K KKKKKRKKLLKRKKKKK LKLL LLLLL KLLLLKLKLLLLLLL
   280  281 B S  S    S-     0   0    2  252    0  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   281  282 B G  S    S+     0   0    0  252    0  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   282  283 B R        +     0   0    8  252    0  RRRRRR RRKRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
   283  284 B L  E     - T   0 297G   0  252   11  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   284  285 B L  E     -ST 277 296G   0  252    3  LLLLLL LLLLLLL LLLL LL  L LLLLLMLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   285  286 B L  E     -ST 276 295G   0  252   13  LLLLFF FFLLLLF LLLL LL  L LLFMLLLLFFLLLLLLL FLFF FFFFF LFFFFLFLFFFFFFF
   286  287 B A  E     -ST 275 294G   0  252   11  AAAAAA AAAGAAA AGGA AA  A AGAAGAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   287  288 B G  E     -ST 274 293G   2  252    4  GGGGGG GGGGGGG GGGG GG  G GGGGRGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   288  289 B Y  E >   -S  272   0G   4  252    0  YYYYYY YYYYYYY YYYY YY  Y YYYYYYYYYYYYYYYYY YYYY YYYYY YYYYYYYYYYYYYYY
   289  290 B D  T 3  S+     0   0    3  252    3  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   290  291 B D  T 3  S-     0   0   37  252    1  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   291  292 B F  S <  S+     0   0    3  252    3  FFFFFF FFFFFFF FFFF FF  F FFFYFFFFFFFFFFFFF FFFF FFFFF FFFFFFFFFFFFFFF
   292  293 B N        -     0   0   15  252   39  NNNNNN NNNNNNN NNNN NN  N NNNNNNNNNNNNNNNNN NNNN NNNNN NNNNNNNNNNNNNNN
   293  294 B C  E     -TU 287 307G   0  252    5  CCCCCC CCCCCCC CCCC CC  C CCCCCCCCCCCCCCCCC CCCC CCCCC CCCCCCCCCCCCCCC
   294  295 B N  E     -TU 286 306G   5  252   32  NNNNNN NNNNNNN NNNN NN  N NNNNNNNNNNNNNNNNN NSNN NNNNN NNNNNNNNNNNNNNN
   295  296 B V  E     -TU 285 305G   0  252    9  IVVVVV VVVVVVV VVVV VV  V VIVIVIVVVIVIVVVVV VVVV VVVVV VVVVVVVVVVIIVIV
   296  297 B W  E     -TU 284 303G   6  252    0  WWWWWW WWWWWWW WWWW WW  W WWWWWWWWWWWWWWWWW WWWW WWWWW WWWWWWWWWWWWWWW
   297  298 B D  E  >  -T  283   0G   4  252    0  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   298  299 B A  T  4 S+     0   0    0  252   64  ASSSSS SSSVTSS STTS TT  S TTSTVSSSSTTSTTTTT SASS SSSSS TSSSSTSTSSSSSSS
   299  300 B L  T  4 S+     0   0    0  252   11  MMMIMM MMMLLMM MLLM LL  M MLLLLLMMLLLLMMMMM MLMM MIMMM MMLMMMLMMMMMMMM
   300  301 B K  T  4 S-     0   0   29  252   17  KRKKRQ RRRRKRR KKKK KK  K KKKKKKKKKKKKKKKKK KKKK KKKKK KKKKKKKKKKKKKKK
   301  302 B A  S  < S+     0   0   17  252   42  GTASQQ QQTQGTQ AQQS AA  S AQQGQATSCRGAAAAAA CGCS SCSGS ASCCSACAGSGGGGC
   302  303 B D  S    S-     0   0   95  252   20  DEEEEE EEEEEEE EDDE EE  E EEEEEEEEEEEEEEEEE EGEE EEEEE EEEEEEEEEEEEEEE
   303  304 B R  E     -U  296   0G  69  252   15  RRRRRR RRRRRRR RRRR RR  R RRRRTRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
   304  305 B A  E     -     0   0G  14  252   58  AAAAAS AAAAAAA AAAA AA  A AAAVHVAAVVAVSSSSS VAVV VVVVV SVVVVAVAVVVVVVV
   305  306 B G  E     -U  295   0G   4  252    5  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   306  307 B V  E >   -U  294   0G   7  252   45  VVVIVV VVVVVVV IVVI II  I IIVVVIIIVVVIIIIII IVII ITIVI IIVIIIIIVIIIVVM
   307  308 B L  E >  S+U  293   0G   2  251    1  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   308  309 B A  G >  S-     0   0    4  251   52  AAAAAA AAAAAAA AAAA AA  A AAAAASAASSASAAAAA SASS SSSSS ASSSSASASSSSSSS
   309  310 B G  G <   -     0   0    4  251    5  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   310  311 B H  G <  S+     0   0    8  251    0  HHHHHH HHHHHHH HHHH HH  H HHHHHHHHHHHHHHHHH HHHH HHHHH HHHHHHHHHHHHHHH
   311  312 B D    <   -     0   0   26  251   18  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   312  313 B N  S    S+     0   0   31  251    0  NNNNNN NNNNNNN NNNN NN  N NNNNNNNNNNNNNNNNN NNNN NNNNN NNNNNNNNNNNNNNN
   313  314 B R        +     0   0   40  251    1  RRRRRR RRRRRRR RRRR RR  R RRRRRRRRRRRRRRRRR RRRR RRRRR RRRRRRRRRRRRRRR
   314  315 B V        +     0   0    2  251    1  VVVVVV VVVVVVV VVVV VV  V VVVVVVVVVVVVVVVVV VVVV VVVVV VVVVVVVVVVVVVVV
   315  316 B S  S    S-     0   0    2  251    2  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   316  317 B C  E     -B  329   0A  10  251    6  CCCCCC CCCCCCC CCCC CC  C CCCCCCCRCCCCCCCCC CCCC CCCCC CCCCCCCCCCCCCCC
   317  318 B L  E     -B  328   0A  15  250    4  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   318  319 B G  E     -B  327   0A  10  250    3  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   319  320 B V  E     -B  326   0A  25  250    0  VVVVVV VVVVVVV VVVV VV  V VVVVVVVVVVVVVVVVV VVVV VVVVV VVVVVVVVVVVVVVV
   320  321 B T    >   -     0   0    3  250   47  TTTTTT TTTTTTT TSST TT  T TSTTTTTTTTTTTTTTT TTTT TTTTT TTTTTTTTTTTTTTT
   321  322 B D  T 3  S+     0   0   98  250   64  DEEDEE EEEEKEE EEEE EE  E EEECEAEEAADAEEEEE ADAA AAAAA EAAAAEAEAAAAAAA
   322  323 B D  T 3  S-     0   0   51  249    7  DDDDDD DDDDDDD DDDD NN  N NDDDDDDNDDDDNNNNN DDDD DDDDD NDDDDNDNDDDDDDD
   323  324 B G  S <  S+     0   0    0  249    5  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   324  325 B M  S    S+     0   0   36  249   20  MMMMMM MMMMMMM MMMM MM  M MMMMSMMMMMMMMMMMM MMMM MMMMM MMMMMMMMMMMMMMM
   325  326 B A        -     0   0    0  249   24  AAAAAA AAAAAAA AAAA AA  A AAAAAAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   326  327 B V  E     -BC 319 338A   0  248   33  VVVVVV VVVVVVV VVVV VV  V VVIIVVVVVVVVVVVVV VVVV VVVVV VVVVVVVVVVVVVVV
   327  328 B A  E     -BC 318 337A   0  247   47  AAAACC CCAAAAC ACCA AA  A ACAAAAAAAAAAAAAAA AAAA AAAAA AAAAAAAAAAAAAAA
   328  329 B T  E     -BC 317 336A   7  247    1  TTTTTT TTTTTTT TTTT TT  T TTTTTTTTTTTTTTTTT TTTT TTTTT TTTTTTTTTTTTTTT
   329  330 B G  E     -BC 316 335A   1  247    2  GGGGGG GGGGGGG GGGG GG  G GGGGGGGGGGGGGGGGG GGGG GGGGG GGGGGGGGGGGGGGG
   330  331 B S    >   -     0   0    6  247    0  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   331  332 B W  T 3  S+     0   0    6  247    0  WWWWWW WWWWWWW WWWW WW  W WWWWWWWWWWWWWWWWW WWWW WWWWW WWWWWWWWWWWWWWW
   332  333 B D  T 3  S-     0   0   17  247    0  DDDDDD DDDDDDD DDDD DD  D DDDDDDDDDDDDDDDDD DDDD DDDDD DDDDDDDDDDDDDDD
   333  334 B S  S <  S+     0   0   12  247    2  SSSSSS SSSSSSS SSSS SS  S SSSSSSSSSSSSSSSSS SSSS SSSSS SSSSSSSSSSSSSSS
   334  335 B F        -     0   0   78  247   39  FFFFFF FFFFFFF FFFF FF  F FFFLFFFFFFFFFFFFF FFFF FFFFF FFFFFFFFFFFFFFF
   335  336 B L  E     -AC  50 329A   1  247    3  LLLLLL LLLLLLL LLLL LL  L LLLLLLLLLLLLLLLLL LLLL LLLLL LLLLLLLLLLLLLLL
   336  337 B K  E     -AC  49 328A  60  246   25  KKKRKK KKKRRKK RRRR RR  R RRKKKKRRKKQKRRRRR KRKK KKKKK RKKKKRKRKKKKKKK
   337  338 B I  E     -AC  48 327A   0  244   10  IIIIII IIIIIII IIII  V  I VIIIIIIIII IVVVVV VIII IIIII VIIIIVIVIVVVIVV
   338  339 B W  E      AC  46 326A   2  243    0  WWWWWW WWWWWWW WWWW  W  W WWWWWWWWWW WWWWWW WWWW WWWWW WWWWWWWWWWWWWWW
   339  340 B N              0   0   10  236   46  NNNNNN NNNNNNN NNNN  N  N NNNNNNNNNN NNNNNN NNNN NNNNN NNNNNNNNNNNNNNN
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   85    5                     P  PP                   P                          
   342    3 G V        +     0   0   96   88   62                     V  VV                   V                          
   343    4 G I        -     0   0   38   92   33                     I  II                   I                          
   344    5 G N    >   -     0   0  109   92   65                     N  NN                   N                          
   345    6 G I  G >  S+     0   0   25   93   47                     I  II                   I                          
   346    7 G E  G 3  S+     0   0  122  138   45                     E  EE                   E                          
   347    8 G D  G <  S+     0   0  133  149   28                     D  DD                   D                          
   348    9 G L    <   -     0   0   35  155   20                     L  LL                   L                          
   349   10 G T     >  -     0   0   69  156   61                     T  TT                   T                          
   350   11 G E  H  > S+     0   0  116  160   37                     E  EE                   E                          
   351   12 G K  H >> S+     0   0   66  165   48                     K  KK                   K                          
   352   13 G D  H 3> S+     0   0   39  166   39                     D  DD                   D                          
   353   14 G K  H 3X S+     0   0   83  166   83                     K  KK                   K                          
   354   15 G L  H < S+     0   0    7  249    4                     E  EE                   E                          
   365   26 G V  H 3< S+     0   0   43  249   53                     V  VT                   V                          
   366   27 G T  T 3< S+     0   0  116  249   83                     K  KK                   K                          
   367   28 G L    <   -     0   0   49  249   60                     L  LL                   L                          
   368   29 G E        -     0   0  191  249   51                     E  EE                   E                          
   369   30 G R        -     0   0   32  249    0                     R  RR                   R                          
   370   31 G M        -     0   0   53  249   83                     Q  QQ                   Q                          
   371   32 G L     >  -     0   0   75  248   80                     L  LM                   L                          
   372   33 G V  H  > S+     0   0    4  248   13                     V  VL                   V                          
   373   34 G S  H  > S+     0   0   14  248    1                     S  SS                   S                          
   374   35 G K  H  > S+     0   0   93  248   37                     K  KK                   K                          
   375   36 G C  H  X S+     0   0    0  249   61                     M  MC                   A                          
   376   37 G C  H  X S+     0   0    0  249   62                     C  CA                   C                          
   377   38 G E  H  X S+     0   0   75  249   68                     E  EE                   E                          
   378   39 G E  H  X S+     0   0   60  249   24                     E  EE                   E                          
   379   40 G F  H  X S+     0   0    3  249   35                     I  II                   I                          
   380   41 G R  H  X S+     0   0   53  249   79                     K  KK                   K                          
   381   42 G D  H  X S+     0   0   67  249   66                     T  TD                   T                          
   382   43 G Y  H  X S+     0   0   43  249    2                     Y  YY                   Y                          
   383   44 G V  H >X S+     0   0    0  249   58                     I  II                   I                          
   384   45 G E  H 3X S+     0   0   71  249   48                     E  EE                   E                          
   385   46 G E  H 3< S+     0   0  125  249   57                     D  DE                   G                          
   386   47 G R  H XX S+     0   0   94  249   68                     K  KR                   N                          
   387   48 G S  H >< S+     0   0   12  249   68                     S  SS                   S                          
   388   49 G G  T 3< S+     0   0   38  249   78                     G  GG                   G                          
   389   50 G E  T <4 S+     0   0  138  248   52                     E  EE                   E                          
   390   51 G D    XX> -     0   0    1  248    0                     D  DD                   D                          
   391   52 G P  H 3>5S+     0   0   17  249   27                     P  PP                   P                          
   392   53 G L  H 345S+     0   0    6  249    3                     L  LL                   L                          
   393   54 G V  H <45S+     0   0   24  249   30                     V  VV                   V                          
   394   55 G K  H  <5S-     0   0  149  249   78                     K  KK                   K                          
   395   56 G G     << -     0   0   38  249   34                     G  GG                   G                          
   396   57 G I        -     0   0   21  249   27                     I  II                   I                          
   397   58 G P    >>  -     0   0   80  249   19                     P  PP                   P                          
   398   59 G E  T 34 S+     0   0   75  249   62                     E  EE                   E                          
   399   60 G D  T 34 S+     0   0  151  249   60                     D  DD                   D                          
   400   61 G K  T <4 S+     0   0  163  249   65                     K  KK                   K                          
   401   62 G N     <  -     0   0    1  249    0                     N  NN                   N                          
   402   63 G P  S    S+     0   0   36  249    0                     P  PP                   P                          
   403   64 G F  S    S-     0   0    3  249    1                     F  FF                   F                          
   404   65 G K              0   0  108  247   34                     K  KK                   K                          
   405   66 G E              0   0  201  242    3                     E  EE                   E                          
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   54   14        F       F          F                      F     F               
   408   14 P E        +     0   0  153  148   31        E       E          E                      E     E               
   409   15 P G  S    S+     0   0   38  151   33        G       G          G                      G     G               
   410   16 P Q  S    S-     0   0   94  155   93        Q       Q          Q                      Q     Q               
   411   17 P A        +     0   0    1  157   48        A       A          A                      A     A               
   412   18 P S        +     0   0   28  161   65        S       S          S                      T     T               
   413   19 P H  S    S+     0   0   42  167   41        H       H          H                      H     H               
   414   20 P T  S  > S-     0   0    2  172    0        T       T          T                      T     T               
   415   21 P G  H  > S-     0   0   10  177    0        G       G          G                      G     G               
   416   22 P P  H  > S+     0   0   14  183    0        P       P          P                      P     P               
   417   23 P K  H  > S+     0   0    6  183    0        K       K          K                      K     K               
   418   24 P G  H  X S+     0   0    0  183    0        G       G          G                      G     G               
   419   25 P V  H  X S+     0   0    0  183    0        V       V          V                      V     V               
   420   26 P I  H  X S+     0   0    4  183   16        I       I          I                      I     I               
   421   27 P N  H  X S+     0   0   48  183   44        N       N          N                      N     N               
   422   28 P D  H  X S+     0   0   14  184    0        D       D          D                      D     D               
   423   29 P W  H  X S+     0   0    6  184    0        W       W          W                      W     W               
   424   30 P R  H  < S+     0   0   67  184   27        R       R          R                      R     R               
   425   31 P K  H >X S+     0   0   67  184   36        K       K          K                      K     K               
   426   32 P F  H >X>S+     0   0    1  184    2        F       F          F                      F     F               
   427   33 P K  H 3<5S+     0   0   30  184    8        K       K          K                      K     K               
   428   34 P L  H <45S+     0   0  139  179    1        L       L          L                      L     L               
   429   35 P E  H <<5S+     0   0   86  179   10        E       E          E                      E     E               
   430   36 P S  T  <5       0   0   57  180   65        s       s          s                      s     s               
   431   37 P E      <       0   0  118  186   66        r       r          r                      r     r               
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  161   42        F       F          F                      L     L               
   434   69 P S        +     0   0   52  162   66        S       S          S                      S     S               
   435   70 P R        -     0   0  103  127   86        R       R          R                      R     R               
   436   71 P K        +     0   0   22  130   11        K       K          K                      K     K               
   437   72 P M  S    S-     0   0   12  131   13        M       M          M                      M     M               
   438   73 P S     >  -     0   0   52  139   66        S       S          S                      S     S               
   439   74 P V  H  > S+     0   0  107  138   53        V       V          V                      V     V               
   440   75 P Q  H  > S+     0   0  133  139   51        Q       Q          Q                      Q     Q               
   441   76 P E  H  > S+     0   0   38  145   27        E       E          E                      E     E               
   442   77 P Y  H  X S+     0   0   36  157   63        Y       Y          Y                      Y     Y               
   443   78 P E  H  < S+     0   0  111  165   67        E       E          E                      E     E               
   444   79 P L  H >X S+     0   0   45  167   54        L       L          L                      L     L               
   445   80 P I  H 3< S+     0   0   37  170   72        I       I          I                      I     I               
   446   81 P H  T 3< S+     0   0  178  170   77        H       H          H                      H     H               
   447   82 P K  T <4 S+     0   0  140  169   68        K       K          K                      Q     Q               
   448   83 P D     <  -     0   0   58  188   39        D       D          D                      D     D               
   449   84 P K        -     0   0  205  170   80        K       K          K                      K     K               
   450   85 P E        -     0   0   45  171   68        E       E          E                      E     E               
   451   86 P D    >>  -     0   0   87  189   32        D       D          D                      D     D               
   452   87 P E  H 3> S+     0   0  113  188   12        E       E          E                      E     E               
   453   88 P N  H 3> S+     0   0   73  189   59        N       N          N                      N     N               
   454   89 P C  H <> S+     0   0   32  190   71        C       C          C                      C     C               
   455   90 P L  H  X S+     0   0    4  190    2        L       L          L                      L     L               
   456   91 P R  H  X S+     0   0  131  190   62        R       R          R                      R     R               
   457   92 P K  H  X S+     0   0  112  190   60        K       K          K                      K     K               
   458   93 P Y  H  X S+     0   0    7  190    6        Y       Y          Y                      Y     Y               
   459   94 P R  H  X S+     0   0   31  190   33        R       R          R                      R     R               
   460   95 P R  H  X S+     0   0  130  190   46        R       R          R                      R     R               
   461   96 P Q  H  X S+     0   0   96  190   33        Q       Q          Q                      Q     Q               
   462   97 P C  H  X S+     0   0   22  190   71        C       C          C                      C     C               
   463   98 P M  H  X S+     0   0   33  190   10        M       M          M                      M     M               
   464   99 P Q  H  X S+     0   0  115  190   54        Q       Q          Q                      Q     Q               
   465  100 P D  H  X S+     0   0   46  190   21        D       D          D                      D     D               
   466  101 P M  H  X S+     0   0   23  190    2        M       M          M                      M     M               
   467  102 P H  H  X S+     0   0   64  190   74        H       H          H                      H     H               
   468  103 P Q  H  < S+     0   0  143  190   60        Q       Q          Q                      Q     Q               
   469  104 P K  H  < S+     0   0  140  190   57        K       K          K                      K     K               
   470  105 P L  H  < S+     0   0   35  190   44        L       L          L                      L     L               
   471  106 P S     <  -     0   0   75  190   81        S       S          S                      S     S               
   472  107 P F        -     0   0   71  188   99        F       F          F                      F     F               
   473  108 P G        -     0   0   36  187   53        G       G          G                      G     G               
   474  109 P P        +     0   0   92  178   42        P       P          P                      P     P               
   475  110 P R        +     0   0  177  184   62        R       R          R                      R     R               
   476  111 P Y        +     0   0   51  185    4        Y       Y          Y                      Y     Y               
   477  112 P G        +     0   0   12  189   60        G       G          G                      G     G               
   478  113 P F  S    S-     0   0  151  190  102        F       F          F                      F     F               
   479  114 P V  E     -v  532   0H  28  190   13        V       V          V                      V     V               
   480  115 P Y  E     -v  533   0H  71  183   67        Y       Y          Y                      Y     Y               
   481  116 P E  E     -v  534   0H 108  190   44        E       E          E                      E     E               
   482  117 P L        -     0   0   12  190   33        L       L          L                      L     L               
   483  118 P E        +     0   0  134  190   75        E       E          E                      E     E               
   484  119 P S  S >> S-     0   0   57  190   54        S       S          S                      S     S               
   485  120 P G  H 3> S+     0   0   15  189   40        G       G          G                      G     G               
   486  121 P E  H 3> S+     0   0  127  190   23        E       E          E                      E     E               
   487  122 P Q  H <> S+     0   0   72  190   62        Q       Q          Q                      Q     Q               
   488  123 P F  H  X S+     0   0   26  190    1        F       F          F                      F     F               
   489  124 P L  H  X S+     0   0   90  190    6        L       L          L                      L     L               
   490  125 P E  H  X S+     0   0  103  190   40        E       E          E                      E     E               
   491  126 P T  H  < S+     0   0   10  190   74        T       T          T                      T     T               
   492  127 P I  H  < S+     0   0   17  190   12        I       I          I                      I     I               
   493  128 P E  H  < S+     0   0  139  190   19        E       E          E                      E     E               
   494  129 P K  S  < S+     0   0  172  190   33        K       K          K                      K     K               
   495  130 P E  S    S-     0   0   38  185    5        E       E          E                      E     E               
   496  131 P Q    >   -     0   0  116  190   67        Q       Q          Q                      Q     Q               
   497  132 P K  T 3  S+     0   0  156  190   34        K       K          K                      K     K               
   498  133 P I  T 3  S+     0   0   68  190   87        I       I          I                      I     I               
   499  134 P T    <   -     0   0   10  190   37        T       T          T                      T     T               
   500  135 P T  E     -W  558   0H   7  189   62        T       T          T                      T     T               
   501  136 P I  E     -Wx 557 531H   3  190   15        I       I          I                      I     I               
   502  137 P V  E     -Wx 556 532H   0  190   35        V       V          V                      V     V               
   503  138 P V  E     -Wx 555 533H   0  190   13        V       V          V                      V     V               
   504  139 P H  E     -Wx 554 534H   0  190    5        H       H          H                      H     H               
   505  140 P I  E     +Wx 553 535H   2  190    2        I       I          I                      I     I               
   506  141 P Y  E     - x   0 536H   4  190    3        Y       Y          Y                      Y     Y               
   507  142 P E    >   -     0   0   45  190   26        E       E          E                      E     E               
   508  143 P D  T 3  S+     0   0   95  190   50        D       D          D                      D     D               
   509  144 P G  T 3  S+     0   0   66  190   50        G       G          G                      G     G               
   510  145 P I  S X> S-     0   0   36  190   33        I       I          I                      I     I               
   511  146 P K  T 34 S+     0   0  191  190   72        K       K          K                      K     K               
   512  147 P G  T 3> S+     0   0   13  190   23        G       G          G                      G     G               
   513  148 P C  H <> S+     0   0    0  190   36        C       C          C                      C     C               
   514  149 P D  H  X S+     0   0   78  190   47        D       D          D                      D     D               
   515  150 P A  H  > S+     0   0   44  190   50        A       A          A                      A     A               
   516  151 P L  H  X S+     0   0    0  190   11        L       L          L                      L     L               
   517  152 P N  H  X S+     0   0   19  190   16        N       N          N                      N     N               
   518  153 P S  H  X S+     0   0   78  190   57        S       S          S                      S     S               
   519  154 P S  H  X S+     0   0    6  190   35        S       S          S                      S     S               
   520  155 P L  H  X S+     0   0    1  190   10        L       L          L                      L     L               
   521  156 P I  H  X S+     0   0  105  190   85        I       I          T                      T     T               
   522  157 P C  H  X S+     0   0   63  190   41        C       C          C                      C     C               
   523  158 P L  H  X S+     0   0    0  190    4        L       L          L                      L     L               
   524  159 P A  H  < S+     0   0    1  190   11        A       A          A                      A     A               
   525  160 P A  H  < S+     0   0   61  190   66        A       A          A                      A     A               
   526  161 P E  H  < S+     0   0   72  190   24        E       E          E                      E     E               
   527  162 P Y    ><  +     0   0    5  190    2        Y       Y          Y                      Y     Y               
   528  163 P P  T 3  S+     0   0   28  190   28        P       P          P                      P     P               
   529  164 P M  T 3  S+     0   0   26  190   85        M       M          M                      M     M               
   530  165 P V  S <  S-     0   0    1  190    9        V       V          V                      V     V               
   531  166 P K  E     - x   0 501H  37  190    2        K       K          K                      K     K               
   532  167 P F  E     +vx 479 502H   0  190    1        F       F          F                      F     F               
   533  168 P C  E     -vx 480 503H   0  190   19        C       C          C                      C     C               
   534  169 P K  E     +vx 481 504H  51  190   38        K       K          K                      K     K               
   535  170 P I  E     - x   0 505H   1  190   21        I       I          I                      I     I               
   536  171 P K  E >>  - x   0 506H  52  190   71        K       K          K                      K     K               
   537  172 P A  H >> S+     0   0   13  190   46        A       A          A                      A     A               
   538  173 P S  H 34 S+     0   0   88  190   29        S       S          S                      S     S               
   539  174 P N  H <4 S+     0   0   67  190   86        N       N          N                      N     N               
   540  175 P T  H << S-     0   0   25  190   72        T       T          T                      T     T               
   541  176 P G     <  +     0   0   66  189   23        G       G          G                      G     G               
   542  177 P A    >   -     0   0   39  190   57        A       A          A                      A     A               
   543  178 P G  T 3  S-     0   0   70  189   41        G       G          G                      G     G               
   544  179 P D  T 3  S+     0   0  151  189   78        D       D          D                      D     D               
   545  180 P R  S <  S+     0   0  167  189   57        R       R          R                      R     R               
   546  181 P F  S    S+     0   0   35  189    0        F       F          F                      F     F               
   547  182 P S    >>  -     0   0   34  189   69        S       S          S                      S     S               
   548  183 P S  T 34 S+     0   0   86  189   84        S       S          S                      S     S               
   549  184 P D  T 34 S+     0   0  126  189   66        D       D          D                      D     D               
   550  185 P V  T <4 S+     0   0   20  189   64        V       V          V                      V     V               
   551  186 P L     <  +     0   0    8  190   15        L       L          L                      L     L               
   552  187 P P  S    S+     0   0    1  190    0        P       P          P                      P     P               
   553  188 P T  E     -W  505   0H   1  190   42        T       T          T                      T     T               
   554  189 P L  E     -WY 504 566H   0  190    2        L       L          L                      L     L               
   555  190 P L  E     -WY 503 565H   4  190   10        L       L          L                      L     L               
   556  191 P V  E     +WY 502 564H   0  190   18        V       V          V                      V     V               
   557  192 P Y  E     +WY 501 562H  31  190    0        Y       Y          Y                      Y     Y               
   558  193 P K  E >  S-WY 500 561H  25  190   13        K       K          K                      K     K               
   559  194 P G  T 3  S-     0   0   25  190   44        G       G          G                      G     G               
   560  195 P G  T 3  S+     0   0   48  190   21        G       G          G                      G     G               
   561  196 P E  E <   -Y  558   0H  38  190   37        E       E          E                      E     E               
   562  197 P L  E     +Y  557   0H  34  190   12        L       L          L                      L     L               
   563  198 P L  E     -     0   0H   2  190   21        L       L          L                      I     I               
   564  199 P S  E     -Y  556   0H   4  190   29        S       S          S                      S     S               
   565  200 P N  E     -Y  555   0H  41  190    0        N       N          N                      N     N               
   566  201 P F  E >   -Y  554   0H   3  189    1        F       F          F                      F     F               
   567  202 P I  T 3  S-     0   0   87  187   24        I       I          I                      I     I               
   568  203 P S  T >  S-     0   0   11  187   69        S       S          S                      S     S               
   569  204 P V  G X  S+     0   0    0  187   34        V       V          V                      V     V               
   570  205 P T  G >  S+     0   0   17  187   36        T       T          T                      A     A               
   571  206 P E  G <  S+     0   0  156  187   34        E       E          E                      E     E               
   572  207 P Q  G <  S+     0   0   84  187   43        Q       Q          Q                      Q     Q               
   573  208 P L  S <  S-     0   0   31  187   11        L       L          L                      F     F               
   574  209 P A    >   -     0   0   49  187   49        A       A          A                      A     A               
   575  210 P E  T 3  S+     0   0  201  187   27        E       E          E                      E     E               
   576  211 P E  T 3  S+     0   0  166  187   21        E       E          E                      E     E               
   577  212 P F    <   -     0   0   17  187    0        F       F          F                      F     F               
   578  213 P F    >>  -     0   0  146  187   24        F       F          F                      F     F               
   579  214 P T  H 3> S+     0   0   24  186   26        T       T          T                      T     T               
   580  215 P G  H 3> S+     0   0   32  186   71        G       G          G                      G     G               
   581  216 P D  H <> S+     0   0   57  186    4        D       D          D                      D     D               
   582  217 P V  H  X S+     0   0    0  186   23        V       V          V                      V     V               
   583  218 P E  H  X S+     0   0   32  186   10        E       E          E                      E     E               
   584  219 P S  H  X S+     0   0   58  186   51        S       S          S                      S     S               
   585  220 P F  H  < S+     0   0    2  187    1        F       F          F                      F     F               
   586  221 P L  H ><>S+     0   0    0  187    0        L       L          L                      L     L               
   587  222 P N  H ><5S+     0   0   61  187   83        N       N          N                      N     N               
   588  223 P E  T 3<5S+     0   0   70  187   16        E       E          E                      E     E               
   589  224 P Y  T < 5S-     0   0   20  183   49        Y       Y          Y                      Y     Y               
   590  225 P G  T < 5S+     0   0    6  183    7        G       G          G                      G     G               
   591  226 P L      < +     0   0    2  183   19        L       L          L                      L     L               
   592  227 P L  S    S-     0   0   10  178    7        L       L          L                      L     L               
   593  228 P P        -     0   0   40  178   30        P       P          P                      P     P               
   594  229 P E              0   0   94  177   19        E       E          E                      E     E               
   595  230 P K              0   0  161  175   25        K       K          K                      K     K               
## ALIGNMENTS  211 -  280
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....2....:....3....:....4....:....5....:....6....:....7....:....8
     1    2 B S              0   0  117  195   58     GG P SG                  S     G          S                        
     2    3 B E     >  -     0   0  107  209   43     EE G EE    H    H        E     E          E                        
     3    4 B L  H  > S+     0   0   52  229   31     MI F LM    V    V        L     M          L                        
     4    5 B D  H  > S+     0   0  104  229   51     EE Q DE    E    E        E     E          E                        
     5    6 B Q  H  > S+     0   0  131  230   62     QQ E QQ    E    E        Q     Q          Q                        
     6    7 B L  H  X S+     0   0   27  230   61     MM Q LM    L    L        L     L          L                        
     7    8 B R  H  X S+     0   0  110  233    4     KK R RK    R    R        R     K          R                        
     8    9 B Q  H  X S+     0   0  117  233   49     QQ L QQ    N    N        Q     Q          Q                        
     9   10 B E  H  X S+     0   0   78  234    8     EE E EE    E    E        E     E          E                        
    10   11 B A  H  X S+     0   0    1  234    8     AS E AA    A    A        A     A          A                        
    11   12 B E  H  X S+     0   0  121  234    8     EE M EE    E    E        E     E          E                        
    12   13 B Q  H  X S+     0   0  111  238   70     QQ S QQ EEEN    N        Q     Q          Q                        
    13   14 B L  H  X S+     0   0   14  238    4     LL Q LL IIII    I        L     L          L                        
    14   15 B K  H  X S+     0   0   99  238   24     KK T KK KKKK    K        R     K          R                        
    15   16 B N  H  X S+     0   0   33  239   51     KK P NK DDDK    K        N     K          N                        
    16   17 B Q  H  X S+     0   0   82  239   58     QQ C QQ EEEE    E        Q     Q          Q                        
    17   18 B I  H  X S+     0   0    7  240    4     II K II IIII    I        I     I          I                        
    18   19 B R  H  X S+     0   0  135  242   52     AE M RA KKKR    R        Q     A          R                        
    19   20 B D  H  X S+     0   0   85  244   60     DE D DD QQQD    D        D     D          D                        
    20   21 B A  H  X S+     0   0   36  243   62     AA A AA KKKK    K        A     A          A                        
    21   22 B R  H >X S+     0   0   22  244   22     RR R RR RRRR    R        R     R          R                        
    22   23 B K  H 3< S+     0   0  136  244   50     KK K KK RRRQ    L        K     K          K                        
    23   24 B A  H 3< S+     0   0   79  244   56     AA A AA EEEA    A        A     A          A                        
    24   25 B C  H << S+     0   0   19  244   85     CC C CC CCCL    L        C     C          C                        
    25   26 B A     <  +     0   0   46  244   56     AA A AA RRRK    K        N     A          S                        
    26   27 B D        +     0   0   88  243    0     DD D DD DDDD    D        D     D          D                        
    27   28 B A        -     0   0   17  243   50     TT T AT TTTS    S        A     T          S                        
    28   29 B T    >>  -     0   0   59  244   35     TT T TT TTTS    S        T     T          T                        
    29   30 B L  H 3> S+     0   0    0  244    3     LL L LL MMML    L        L     L          L                        
    30   31 B S  H 34 S+     0   0   38  244   90     AA A SA QQQS    S        V     A          S                        
    31   32 B Q  H X4 S+     0   0  119  247   50     QQ Q QQ QQQE    E        Q     E          Q                        
    32   33 B I  H 3< S+     0   0   28  248   52     IL I II VVVV    V        I     L          I                        
    33   34 B T  T >< S+     0   0    0  249   56     VV V TV CCCA    A        T     V          T                        
    34   35 B N  T <  S+     0   0  129  249   72     SS S AS IIIS    A        S     S          A                        
    35   36 B N  T 3  S+     0   0  111  249   55     GG G NG NNNN    G        N     G          G                        
    36   37 B I  S <  S-     0   0   21  249   49     MI V IV VVVV    V        M     L          L                        
    37   38 B D        -     0   0  138  249   32     EE E DE DDDD    D        D     E          D                        
    38   39 B P        -     0   0   89  250   59     VV V PV PPPA    A        S     V          S                        
    39   40 B V        -     0   0   23  251   30     VV V VV LLLI    I        V     A          V                        
    40   41 B G        -     0   0   54  251   45     GG G GG GGGG    G        G     G          G                        
    41   42 B R        -     0   0  115  251    6     RR R RR RRRR    R        R     R          R                        
    42   43 B I        +     0   0    8  251   27     II I II VVVV    V        I     V          I                        
    43   44 B Q        -     0   0   54  251   59     QQ Q QQ QQQQ    Q        Q     Q          Q                        
    44   45 B M        -     0   0   11  252    5     MM M MM MMMM    M        M     M          M                        
    45   46 B R        -     0   0   49  252   18     RR R RR RRRR    R        R     R          R                        
    46   47 B T  E     +A  338   0A  12  252   43     TT T TT TTTT    T        T     T          T                        
    47   48 B R  E     +     0   0A  56  252   11     RR R RR RRRR    R        R     R          R                        
    48   49 B R  E     -A  337   0A  60  252    9     RR R RR RRRR    R        R     R          R                        
    49   50 B T  E     -A  336   0A  30  252   20     TT T TT TTTT    T        T     T          T                        
    50   51 B L  E     -A  335   0A   0  252    0     LL L LL LLLL    L        L     L          L                        
    51   52 B R        +     0   0  159  252   22     RR R RR RRRR    R        R     R          R                        
    52   53 B G        +     0   0   20  252    0     GG G GG GGGG    G        G     G          G                        
    53   54 B H        -     0   0    4  252    0     HH H HH HHHH    H        H     H          H                        
    54   55 B L  S    S+     0   0  116  252    4     LL L LL LLLL    L        L     L          L                        
    55   56 B A  S    S-     0   0    0  252    4     AA A AA AAAA    A        A     A          A                        
    56   57 B K        -     0   0   15  252    0     KK K KK KKKK    K        K     K          K                        
    57   58 B I  E     -D   73   0B   0  252    1     II I II IIII    I        I     I          I                        
    58   59 B Y  E     -     0   0B   6  252    4     YY Y YY YYYY    Y        Y     Y          Y                        
    59   60 B A  E     -D   72   0B  13  252    5     AA A AA AAAA    A        A     A          A                        
    60   61 B M  E     -D   71   0B  15  252    4     LC M ML MMMM    M        M     M          M                        
    61   62 B H  E     -D   70   0B  44  252    4     HH H HH HHHH    H        H     H          H                        
    62   63 B W  E     -D   69   0B  11  252    0     WW W WW WWWW    W        W     W          W                        
    63   64 B G    >   -     0   0    3  252   43     SS C GS SSSG    G        G     A          G                        
    64   65 B T  T 3  S+     0   0   75  252   58     TT T TT TTTT    T        Y     T          S                        
    65   66 B D  T 3  S-     0   0   80  252    1     DD D DD DDDD    D        D     D          D                        
    66   67 B S  S <  S+     0   0    3  252   50     SS S SS SSSS    S        s     S          S                        
    67   68 B R  S    S+     0   0   94  252   20     KK K RK RRRR    R        d     K          R                        
    68   69 B L  E     + E   0  82B  31  252   80     LL L LL NNNH    H        L     L          L                        
    69   70 B L  E     -DE  62  81B   0  252   12     MM L LM LLLV    V        L     L          L                        
    70   71 B L  E     -DE  61  80B   0  252    3     VV V VV VVVV    V        T     V          V                        
    71   72 B S  E     -DE  60  79B   0  252    1     SS S SS SSSS    S        Q     S          S                        
    72   73 B A  E     -DE  59  78B   0  252    1     AA A AA AAAA    A        K     A          A                        
    73   74 B S  E >>  -DE  57  77B   0  252    1     SS S SS SSSS    S        E     S          S                        
    74   75 B Q  T 34 S+     0   0    1  252    1     QQ Q QQ QQQQ    Q        A     Q          Q                        
    75   76 B D  T 34 S-     0   0    9  252    1     DD D DD DDDD    D        S     D          D                        
    76   77 B G  T <4 S+     0   0    7  252    1     GG G GG GGGG    G        C     G          G                        
    77   78 B K  E  <  -EF  73  93B  52  252    7     KK K KK KKKK    K        V     K          K                        
    78   79 B L  E     -EF  72  92B   0  252    2     LL L LL LLLL    L        P     L          L                        
    79   80 B I  E     -EF  71  91B   0  252    3     II I II IIII    I        V     I          I                        
    80   81 B I  E     -EF  70  90B   0  252   16     VV V IV VVVL    L        V     V          I                        
    81   82 B W  E     -EF  69  88B   0  252    0     WW W WW WWWW    W        F     W          W                        
    82   83 B D  E >>> -EF  68  87B  21  252    2     DD D DD DDDD    D        P     D          D                        
    83   84 B S  T 345S+     0   0    0  252   52     TT T ST SSSS    S        g     T          S                        
    84   85 B Y  T 345S+     0   0   57  251   17     YY Y YY YYYY    Y        l     Y          Y                        
    85   86 B T  T <45S-     0   0   56  252    5     TT T TT TTTT    T        I     T          T                        
    86   87 B T  T  <5 +     0   0   43  252    4     TT T TT TTTT    T        L     T          T                        
    87   88 B N  E   < -F   82   0B  99  252    4     NN N NN NNNN    N        S     N          N                        
    88   89 B K  E     +F   81   0B  95  249    1     KK K .K KKKK    K        K     K          K                        
    89   90 B V  E    S+     0   0B  66  249   17     VV V .V VVVV    V        M     V          M                        
    90   91 B H  E     -F   80   0B  57  249    2     HH H .H HHHH    H        H     H          H                        
    91   92 B A  E     -F   79   0B  43  251    0     AA A .A AAAA    A        A     A          A                        
    92   93 B I  E     -F   78   0B   0  252    0     II I .I IIII    I        I     I          I                        
    93   94 B P  E     -F   77   0B  80  252    4     PP P .P PPPP    P        P     P          P                        
    94   95 B L        -     0   0   26  252    0     LL L .L LLLL    L        L     L          L                        
    95   96 B R  S    S+     0   0  190  252    6     RR R .R RRRR    R        R     R          R                        
    96   97 B S        -     0   0   17  252    3     SS S .S SSSS    S        S     S          S                        
    97   98 B S  S    S+     0   0    6  252    3     SS S .S SSSS    S        S     S          S                        
    98   99 B W        +     0   0    2  252    0     WW W .W WWWW    W        W     W          W                        
    99  100 B V  E     -G  115   0C   4  252    0     VV V .V VVVV    V        V     V          V                        
   100  101 B M  E     +     0   0C   5  252    0     MM M .M MMMM    M        M     M          M                        
   101  102 B T  E     -G  114   0C   8  252    0     TT T .T TTTT    T        T     T          T                        
   102  103 B C  E     -G  113   0C   0  252    1     CC C .C CCCC    C        C     C          C                        
   103  104 B A  E     -G  112   0C   0  252    3     AA A .A AAAA    A        A     A          A                        
   104  105 B Y  E     -G  111   0C   9  252    2     YY Y .Y YYYY    Y        Y     Y          Y                        
   105  106 B A    >   -     0   0    0  252   22     AA A .A AAAA    A        A     A          A                        
   106  107 B P  T 3  S+     0   0   64  252    3     PP P .P PPPP    P        P     P          P                        
   107  108 B S  T 3  S-     0   0   47  252    6     SS S .S SSSS    S        S     S          S                        
   108  109 B G  S <  S+     0   0    8  252    6     GG G .G AAAG    G        G     G          G                        
   109  110 B N  S    S+     0   0   50  252   22     NN N .N NNNS    S        N     N          N                        
   110  111 B Y  E     - H   0 124C  50  252   13     FY F .F FFFF    F        Y     F          Y                        
   111  112 B V  E     -GH 104 123C   0  252    0     VV V .V VVVV    V        V     V          V                        
   112  113 B A  E     +GH 103 122C   0  252    2     AA A .A AAAA    A        A     A          A                        
   113  114 B C  E     +GH 102 121C   5  252    2     CC C .C CCCC    C        C     C          C                        
   114  115 B G  E     +GH 101 120C   1  252    0     GG G .G GGGG    G        G     G          G                        
   115  116 B G  E >  S-G   99   0C   0  252    0     GG G .G GGGG    G        G     G          G                        
   116  117 B L  T 3  S+     0   0    1  252    0     LL L .L LLLL    L        L     L          L                        
   117  118 B D  T 3  S-     0   0   50  252    0     DD D .D DDDD    D        D     D          D                        
   118  119 B N  S <  S+     0   0   30  252    0     NN N .N NNNN    N        N     N          N                        
   119  120 B I  E     - I   0 139C  39  252   24     MM M .M IIII    I        I     M          I                        
   120  121 B C  E     -HI 114 138C   0  252    3     CC C .C CCCC    C        C     C          C                        
   121  122 B S  E     -HI 113 137C   9  252    6     SS S .S SSSS    S        S     S          S                        
   122  123 B I  E     -HI 112 136C   0  252    2     II I .I IIIV    V        I     I          I                        
   123  124 B Y  E     -H  111   0C   3  252    0     YY Y .Y YYYY    Y        Y     Y          Y                        
   124  125 B N  E     +H  110   0C  24  252   40     SN N .S NNNN    N        N     S          S                        
   125  126 B L        +     0   0   11  252    1     LL L .L LLLL    L        L     L          L                        
   126  127 B K  S    S+     0   0  109  252   43     KK K .K KKKK    K        K     K          K                        
   127  128 B T  S    S-     0   0   64  252   55     SS T .S TTTT    T        T     S          T                        
   128  129 B R  S    S+     0   0  267  250   17     RR R .R KKKR    R        R     R          R                        
   129  130 B E  S    S-     0   0  173  251    9     EE E .E EEEE    E        E     E          E                        
   130  131 B G        -     0   0   50  252   11     GG G .G GGGG    G        G     G          G                        
   131  132 B N        +     0   0   30  252   52     NN N .S TTTN    N        N     N          N                        
   132  133 B V  S    S+     0   0   58  253   42     VV V KV VVVV    V        V     V          V                        
   133  134 B R  S    S-     0   0  213  253   22     KK K MK RRRR    R        R     K          R                        
   134  135 B V        -     0   0   29  253   15     VV V TV VVVV    V        V     V          V                        
   135  136 B S  S    S-     0   0   43  253   48     SS S AS SSSS    S        S     S          T                        
   136  137 B R  E     -I  122   0C 105  253    7     RR R TR RRRR    R        R     R          R                        
   137  138 B E  E     -I  121   0C  75  253    3     EE E HE EEEE    E        E     E          E                        
   138  139 B L  E     +I  120   0C   1  252    1     LL L WL LLLL    L        L     L          L                        
   139  140 B A  E     +I  119   0C  61  252   57     SS S QS PPPN    N        P     S          P                        
   140  141 B G        +     0   0   50  252   25     AA A DA GGGG    G        G     A          G                        
   141  142 B H        -     0   0    9  252    2     HH H LH HHHH    H        H     H          H                        
   142  143 B T  S    S+     0   0   64  252   42     TT T FT TTTT    T        T     T          T                        
   143  144 B G  S    S-     0   0    0  252    2     GG G GG GGGG    G        G     G          g                        
   144  145 B Y        -     0   0    0  251    0     YY Y YY YYYY    Y        Y     Y          y                        
   145  146 B L  E     +J  160   0D   0  251    1     LL L LL LLLL    L        L     L          L                        
   146  147 B S  E     -     0   0D   3  251    0     SS S SS SSSS    S        S     S          S                        
   147  148 B C  E     -J  159   0D   9  251    5     CC C CC CCCC    C        C     C          C                        
   148  149 B C  E     -J  158   0D   0  251    0     CC C CC CCCC    C        C     C          C                        
   149  150 B R  E     -J  157   0D  53  251    4     RR R RR RRRR    R        R     R          R                        
   150  151 B F  E     -J  156   0D  10  251    0     FF F FF FFFF    F        F     F          F                        
   151  152 B L  S    S-     0   0   26  251   24     LL L LL IIIL    L        L     L          L                        
   152  153 B D  S    S-     0   0   60  251   40     DD D DD DDDD    D        D     D          D                        
   153  154 B D  S    S+     0   0   60  251    2     DD D DD DDDD    D        D     D          D                        
   154  155 B N  S    S+     0   0   44  251   65     NN N NN SSST    A        G     N          N                        
   155  156 B Q  E     + K   0 169D  60  251   47     NN N QN QQQR    R        Q     S          Q                        
   156  157 B I  E     -JK 150 168D   0  251    1     II I II IIII    I        I     I          I                        
   157  158 B V  E     -JK 149 167D   0  251   22     VV V VV IIIV    V        I     V          L                        
   158  159 B T  E     -JK 148 166D   0  251    1     TT T TT TTTT    T        T     T          T                        
   159  160 B S  E     -JK 147 165D   0  251    2     SS S SS SSSS    S        S     S          S                        
   160  161 B S  E >   -J  145   0D   0  251    0     SS S SS SSSS    S        S     S          S                        
   161  162 B G  T 3  S+     0   0    0  251    0     GG G GG GGGG    G        G     G          G                        
   162  163 B D  T 3  S-     0   0    5  251    0     DD D DD DDDD    D        D     D          D                        
   163  164 B T  S <  S+     0   0    8  251   63     TT T TT MMMM    M        T     T          T                        
   164  165 B T        -     0   0    2  251   16     TT T TT TTTT    T        T     T          T                        
   165  166 B C  E     -KL 159 179D   0  251    0     CC C CC CCCC    C        C     C          C                        
   166  167 B A  E     -KL 158 178D   0  252   62     AC A AA GGGA    A        A     A          A                        
   167  168 B L  E     -KL 157 177D   6  252    6     LL L LL LLLL    L        L     L          L                        
   168  169 B W  E     -KL 156 175D   2  252    0     WW W WW WWWW    W        W     W          W                        
   169  170 B D  E >>> -KL 155 174D  37  252    0     DD D DD DDDD    D        D     D          D                        
   170  171 B I  T 345S+     0   0    7  252    8     II I II IIII    I        I     I          I                        
   171  172 B E  T 345S+     0   0  144  252    6     EE E EE EEEE    E        E     E          E                        
   172  173 B T  T <45S-     0   0   78  252   36     TT T TT TTTT    T        T     T          T                        
   173  174 B G  T  <5 +     0   0   16  253    8     GG G GG GGGG    G        G     G          G                        
   174  175 B Q  E   < -L  169   0D 135  253   68     QQ Q QQ QQQM    M        Q     Q          Q                        
   175  176 B Q  E     -L  168   0D  30  253   45     QP Q QQ QQQQ    Q        Q     Q          Q                        
   176  177 B T  E     +     0   0D  64  253   73     KK K TK TTTT    T        T     K          A                        
   177  178 B T  E     -L  167   0D  20  253   47     TT T TT TTTT    T        T     T          T                        
   178  179 B T  E     -L  166   0D   5  253   77     VT V TV AAAA    A        T     V          A                        
   179  180 B F  E     +L  165   0D   1  253    0     FF F FF FFFF    F        F     F          F                        
   180  181 B T        +     0   0   34  253   72     IV M AI VVVT    T        A     V          T                        
   181  182 B G        +     0   0   37  253   30     GG G GG GGGG    G        G     G          G                        
   182  183 B H        -     0   0    7  253    0     HH H HH HHHH    H        H     H          H                        
   183  184 B T  S    S+     0   0   99  253   63     TT T TT TTTT    T        S     T          T                        
   184  185 B G  S    S-     0   0    0  253    1     GG G GG GGGG    G        G     G          G                        
   185  186 B D        -     0   0    1  253    1     DD D DD DDDD    D        D     D          D                        
   186  187 B V  E     -M  202   0E   0  253   22     CC C VC VVVV    V        V     C          V                        
   187  188 B M  E     +     0   0E   3  253    1     MM M MM MMMM    M        M     M          M                        
   188  189 B S  E     -M  201   0E  16  253    8     SS S SS SSSS    S        S     S          S                        
   189  190 B L  E     -M  200   0E   3  253   14     LL L LL VVVL    L        L     L          L                        
   190  191 B S  E     -M  199   0E  21  253   24     AA A SA AAAS    S        S     A          S                        
   191  192 B L  E     -M  198   0E  29  253   29     VV V LV LLLV    V        L     V          L                        
   192  193 B A    >   -     0   0    4  253   57     SS S AS SSST    T        S     S          S                        
   193  194 B P  T 3  S+     0   0   85  253   13     PP P PP NNND    E        P     P          P                        
   194  195 B D  T 3  S-     0   0   87  253   52     DD D DD DDDD    D        D     D          D                        
   195  196 B T  S <  S+     0   0   62  253   97     FF F TF RRRK    K        L     F          Y                        
   196  197 B R  S    S+     0   0  142  252   61     KK K RK FFFN    N        K     K          K                        
   197  198 B L  E     - N   0 211E  37  252   71     LL L ML TTTT    T        T     L          T                        
   198  199 B F  E     -MN 191 210E   0  252    0     FF F FF FFFF    F        F     F          F                        
   199  200 B V  E     -MN 190 209E   0  252   11     II I VI VVVI    I        V     I          V                        
   200  201 B S  E     -MN 189 208E   0  252    0     SS S SS SSSS    S        S     S          S                        
   201  202 B G  E     +MN 188 207E   0  252    0     GG G GG GGGG    G        G     G          G                        
   202  203 B A  E >   -M  186   0E   0  252    4     AA A AA GGGA    A        A     A          A                        
   203  204 B C  T 3  S+     0   0    5  252    2     CC C CC CCCC    C        C     C          C                        
   204  205 B D  T 3  S-     0   0   31  252    0     DD D DD DDDD    D        D     D          D                        
   205  206 B A  S <  S+     0   0   20  252   16     AA A AA AAAA    A        A     A          A                        
   206  207 B S  E     - O   0 222E   6  252   69     TT T ST AAAT    T        S     S          T                        
   207  208 B A  E     -NO 201 221E   0  252   35     AA A AA AAAA    A        S     A          S                        
   208  209 B K  E     -NO 200 220E  18  252    0     KK K KK KKKK    K        K     K          K                        
   209  210 B L  E     -NO 199 219E   2  252    8     LL L LL LLLL    L        L     L          L                        
   210  211 B W  E     -NO 198 217E   1  252    0     WW W WW WWWW    W        W     W          W                        
   211  212 B D  E >>> -NO 197 216E  11  252    1     DD D DD DDDD    D        D     D          D                        
   212  213 B V  T 345S+     0   0   12  252   19     VI V IV VVVL    L        V     V          I                        
   213  214 B R  T 345S+     0   0  194  252    1     RR R RR RRRR    R        R     R          R                        
   214  215 B E  T <45S-     0   0  111  252   59     EE E EE TTTD    D        D     E          D                        
   215  216 B G  T  <5 +     0   0    8  252   25     GG G GG GGGG    G        G     G          G                        
   216  217 B M  E      -     0   0    1  252    0     FF F FF FFFF    F        F     F          .                        
   235  236 B P  T 3  S+     0   0   45  252    0     PP P PP PPPP    P        P     P          .                        
   236  237 B N  T 3  S-     0   0   42  252   27     NN N NN NNNN    N        S     N          .                        
   237  238 B G  S <  S+     0   0   12  252    8     GG G GG YYYN    N        G     G          .                        
   238  239 B N  S    S+     0   0   56  252   76     EE E NE QQQM    M        Y     E          .                        
   239  240 B A  E     - Q   0 253F   0  252   11     AA A AA SSSA    A        A     A          .                        
   240  241 B F  E     -PQ 233 252F   0  252   16     II I FI FFFF    F        F     I          .                        
   241  242 B A  E     -PQ 232 251F   0  252   51     CC C AC GGGG    G        A     C          .                        
   242  243 B T  E     -PQ 231 250F   0  252    0     TT T TT TTTT    T        T     T          .                        
   243  244 B G  E     +PQ 230 249F   0  252    0     GG G GG GGGG    G        G     G          .                        
   244  245 B S  E >   -P  228   0F   0  252    0     SS S SS SSSS    S        S     S          .                        
   245  246 B D  T 3  S+     0   0   13  252    0     DD D DD DDDD    D        D     D          .                        
   246  247 B D  T 3  S-     0   0   28  252    0     DD D DD DDDD    D        D     D          .                        
   247  248 B A  S <  S+     0   0    6  252   12     AA A AA AAAA    A        A     A          .                        
   248  249 B T        -     0   0   16  252   42     TT T TT TTTT    T        T     S          .                        
   249  250 B C  E     -QR 243 263F   0  252    3     CC C CC CCCC    C        C     C          .                        
   250  251 B R  E     -QR 242 262F  23  252    3     RR R RR RRRR    R        R     R          .                        
   251  252 B L  E     -QR 241 261F   0  252    0     LL L LL LLLL    L        L     L          .                        
   252  253 B F  E     -QR 240 259F   1  251    0     FF F FF FFFF    F        F     F          .                        
   253  254 B D  E  >> -QR 239 258F   1  251    0     DD D DD DDDD    D        D     D          .                        
   254  255 B L  T >45S+     0   0   15  251   26     LL L LL IIII    I        L     L          .                        
   255  256 B R  T 345S+     0   0   57  251    0     RR R RR RRRR    R        R     R          .                        
   256  257 B A  T 345S-     0   0    0  251    8     AA A AA AAAS    S        A     A          .                        
   257  258 B D  T <<5 +     0   0    0  251    0     DD D DD DDDD    D        D     D          .                        
   258  259 B Q  E      -     0   0  119  253   47     HH H HH HHHN    N        H     H          H                        
   266  267 B D  T 3  S+     0   0  161  253   25     EE E DE EEED    D        D     E          D                        
   267  268 B N  T 3  S+     0   0   66  253   48     TS S NT SSSN    N        N     S          N                        
   268  269 B I    <   +     0   0   23  253   21     II I II IIII    I        I     I          I                        
   269  270 B I        +     0   0   97  253   31     II I II VVVA    A        I     I          I                        
   270  271 B C  S    S-     0   0   10  253    6     CC C CC CCCC    C        C     C          C                        
   271  272 B G        -     0   0    1  253    0     GG G GG GGGG    G        G     G          G                        
   272  273 B I  E     +S  288   0G   0  253    1     II I II IIII    I        I     I          I                        
   273  274 B T  E     +     0   0G  13  253    4     TT T TT TTTT    T        T     T          T                        
   274  275 B S  E     +S  287   0G  18  252    0     SS S SS SSSS    S        S     S          S                        
   275  276 B V  E     +S  286   0G  10  252    5     II V VI VVVV    V        V     V          V                        
   276  277 B S  E     -S  285   0G  15  252   21     AA A AA AAAA    A        A     A          A                        
   277  278 B F  E     -S  284   0G  12  252   13     LF F FL FFFF    F        F     F          F                        
   278  279 B S        -     0   0    3  252    1     SS S SS SSSS    S        S     S          S                        
   279  280 B K  S    S+     0   0  104  252   80     RR R KR KKKR    K        K     L          K                        
   280  281 B S  S    S-     0   0    2  252    0     SS S SS SSSS    S        S     S          S                        
   281  282 B G  S    S+     0   0    0  252    0     GG G GG GGGG    G        G     G          G                        
   282  283 B R        +     0   0    8  252    0     RR R RR RRRR    R        R     R          R                        
   283  284 B L  E     - T   0 297G   0  252   11     LL L LL LLLL    L        L     L          L                        
   284  285 B L  E     -ST 277 296G   0  252    3     LL M LV LLLF    F        L     L          L                        
   285  286 B L  E     -ST 276 295G   0  252   13     FL L LF LLLF    F        L     F          L                        
   286  287 B A  E     -ST 275 294G   0  252   11     AA A AA AAAA    A        A     A          A                        
   287  288 B G  E     -ST 274 293G   2  252    4     GG G GG GGGG    G        G     G          G                        
   288  289 B Y  E >   -S  272   0G   4  252    0     YY Y YY YYYY    Y        Y     Y          Y                        
   289  290 B D  T 3  S+     0   0    3  252    3     DD D DD DDDD    D        D     D          D                        
   290  291 B D  T 3  S-     0   0   37  252    1     DD D DD DDDD    D        D     D          D                        
   291  292 B F  S <  S+     0   0    3  252    3     FF F FF FFFF    F        F     F          F                        
   292  293 B N        -     0   0   15  252   39     NN N NN NNNN    N        N     N          N                        
   293  294 B C  E     -TU 287 307G   0  252    5     CC C CC CCCC    C        C     C          C                        
   294  295 B N  E     -TU 286 306G   5  252   32     NN N NN NNNN    N        S     N          N                        
   295  296 B V  E     -TU 285 305G   0  252    9     II I VI VVVI    I        V     V          V                        
   296  297 B W  E     -TU 284 303G   6  252    0     WW W WW WWWW    W        W     W          W                        
   297  298 B D  E  >  -T  283   0G   4  252    0     DD D DD DDDD    D        D     D          D                        
   298  299 B A  T  4 S+     0   0    0  252   64     SA S TS TTTA    A        A     S          T                        
   299  300 B L  T  4 S+     0   0    0  252   11     LL L LL LLLM    M        L     M          L                        
   300  301 B K  T  4 S-     0   0   29  252   17     KK K KK KKKK    K        K     K          K                        
   301  302 B A  S  < S+     0   0   17  252   42     AS G AA GGGG    G        G     V          G                        
   302  303 B D  S    S-     0   0   95  252   20     EE E DE DDDD    D        G     E          E                        
   303  304 B R  E     -U  296   0G  69  252   15     RR R RR RRRR    R        R     R          R                        
   304  305 B A  E     -     0   0G  14  252   58     VV V AV AAAA    A        A     V          A                        
   305  306 B G  E     -U  295   0G   4  252    5     GG G GG GGGG    G        G     A          G                        
   306  307 B V  E >   -U  294   0G   7  252   45     II I VI VVVV    V        V     P          V                        
   307  308 B L  E >  S+U  293   0G   2  251    1     LL L LL LLLL    L        L     A          L                        
   308  309 B A  G >  S-     0   0    4  251   52     SS S AS AAAA    A        A     I          A                        
   309  310 B G  G <   -     0   0    4  251    5     GG G GG GGGG    G        G     K          G                        
   310  311 B H  G <  S+     0   0    8  251    0     HH H HH HHHH    H        H     H          H                        
   311  312 B D    <   -     0   0   26  251   18     DD D DD DDDD    D        D     S          D                        
   312  313 B N  S    S+     0   0   31  251    0     NN N NN NNNN    N        N     T          N                        
   313  314 B R        +     0   0   40  251    1     RR R RR RRRR    R        R     W          R                        
   314  315 B V        +     0   0    2  251    1     VV V VV VVVV    V        V     Y          V                        
   315  316 B S  S    S-     0   0    2  251    2     SS S SS SSSS    S        S     V          S                        
   316  317 B C  E     -B  329   0A  10  251    6     CC C CC CCCC    C        C     C          C                        
   317  318 B L  E     -B  328   0A  15  250    4     LL L LL LLLL    L        L                L                        
   318  319 B G  E     -B  327   0A  10  250    3     GG G GG GGGG    G        G                G                        
   319  320 B V  E     -B  326   0A  25  250    0     VV V VV VVVI    I        V                V                        
   320  321 B T    >   -     0   0    3  250   47     TT T TT SSST    T        T                T                        
   321  322 B D  T 3  S+     0   0   98  250   64     AA A DA EEEV    V        D                K                        
   322  323 B D  T 3  S-     0   0   51  249    7     DD D DD DDDD    D        D                D                        
   323  324 B G  S <  S+     0   0    0  249    5     GG G GG GGGG    G        G                G                        
   324  325 B M  S    S+     0   0   36  249   20     MM M MM MMMM    M        M                M                        
   325  326 B A        -     0   0    0  249   24     AA A AA AAAA    A        A                A                        
   326  327 B V  E     -BC 319 338A   0  248   33     VV V VV VVVV    V        V                V                        
   327  328 B A  E     -BC 318 337A   0  247   47     AS A AA GGGA    A        A                A                        
   328  329 B T  E     -BC 317 336A   7  247    1     TT T TT TTTT    T        T                T                        
   329  330 B G  E     -BC 316 335A   1  247    2     GG G GG GGGG    G        G                G                        
   330  331 B S    >   -     0   0    6  247    0     SS S SS SSSS    S        S                S                        
   331  332 B W  T 3  S+     0   0    6  247    0     WW W WW WWWW    W        W                W                        
   332  333 B D  T 3  S-     0   0   17  247    0     DD D DD DDDD    D        D                D                        
   333  334 B S  S <  S+     0   0   12  247    2     SS S SS SSSS    S        S                S                        
   334  335 B F        -     0   0   78  247   39     FF F FF FFFF    F        F                F                        
   335  336 B L  E     -AC  50 329A   1  247    3     LL L LL LLLL    L        L                L                        
   336  337 B K  E     -AC  49 328A  60  246   25     KK K KK RRRK    K        R                R                        
   337  338 B I  E     -AC  48 327A   0  244   10     II I II IIIV    V        I                I                        
   338  339 B W  E      AC  46 326A   2  243    0     WW W WW WWWW    W        W                W                        
   339  340 B N              0   0   10  236   46     NN N NN NNNN    N        N                N                        
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   85    5  P                 P    P              P         PPPPPPPPPPPPPPPPPPPPPP
   342    3 G V        +     0   0   96   88   62  V                 A    A              A    A    AAAAAAAAAAAAAAAAAAAAAA
   343    4 G I        -     0   0   38   92   33  I                 I    I              I    L    LLLLLLILLLLLLLLLLLLLLL
   344    5 G N    >   -     0   0  109   92   65  N                 N    N              N    H    HHHHHHNHHHHHHHHHHHHHHH
   345    6 G I  G >  S+     0   0   25   93   47  I                 I    I              I    I    IIIIIIIIIIIIIIIIIIIIII
   346    7 G E  G 3  S+     0   0  122  138   45  D                 E    E              E    E    EEEEEEEEEEEEEEEEEEEEEE
   347    8 G D  G <  S+     0   0  133  149   28  D                 D    D              D    D    DDDDDDDDDDDDDDDDDDDDDD
   348    9 G L    <   -     0   0   35  155   20  L                 L    L              L    L    LLLLLLLLLLLLLLLLLLLLLL
   349   10 G T     >  -     0   0   69  156   61  T                 S    S              S    P    PPPPPPSPPPPPPPPPPPPPPP
   350   11 G E  H  > S+     0   0  116  160   37  E                 E    E              E    E    EEEEEEEEEEEEEEEEEEEEEE
   351   12 G K  H >> S+     0   0   66  165   48  K                 K    K              K    K    KKKKKKKKKKKKKKKKKKKKKK
   352   13 G D  H 3> S+     0   0   39  166   39  D                 D    D              D    E    EEEEEEEEEEEEEEEEEEEEEE
   353   14 G K  H 3X S+     0   0   83  166   83  K                 K    K              K    K    KKKKKKKKKKKKKKKKKKKKKK
   354   15 G L  H < S+     0   0    7  249    4  E                 E    E              E    E    EEEEEEEEEEEEEEEEEEEEEE
   365   26 G V  H 3< S+     0   0   43  249   53  V                 V    V              V    V    VVVVVVVVVVVVVVVVVVVVVV
   366   27 G T  T 3< S+     0   0  116  249   83  K                 K    K              K    T    KKKKKKKKKKKKKKKKKKKKKK
   367   28 G L    <   -     0   0   49  249   60  L                 L    L              L    L    LLLLLLLLLLLLLLLLLLLLLL
   368   29 G E        -     0   0  191  249   51  E                 E    E              E    Q    QQQQQQDQQQQQQQQQQQQQQQ
   369   30 G R        -     0   0   32  249    0  R                 R    R              R    R    RRRRRRRRRRRRRRRRRRRRRR
   370   31 G M        -     0   0   53  249   83  Q                 Q    Q              Q    Q    QQQQQQQQQQQQQQQQQQQQQQ
   371   32 G L     >  -     0   0   75  248   80  L                 P    P              P    Q    QQQQQQPQQQQQQQQQQQQQQQ
   372   33 G V  H  > S+     0   0    4  248   13  V                 V    V              V    V    VVVVVVVVVVVVVVVVVVVVVV
   373   34 G S  H  > S+     0   0   14  248    1  S                 S    S              S    S    SSSSSSSSSSSSSSSSSSSSSS
   374   35 G K  H  > S+     0   0   93  248   37  K                 K    K              K    K    KKKKKKKKKKKKKKKKKKKKKK
   375   36 G C  H  X S+     0   0    0  249   61  M                 C    C              C    C    CCCCCCCCCCCCCCCCCCCCCC
   376   37 G C  H  X S+     0   0    0  249   62  C                 S    S              S    S    SSSSSSSSSSSSSSSSSSSSSS
   377   38 G E  H  X S+     0   0   75  249   68  E                 E    E              E    E    EEEEEEEEEEEEEEEEEEEEEE
   378   39 G E  H  X S+     0   0   60  249   24  E                 E    E              D    E    EEEEEEEEEEEEEEEEEEEEEE
   379   40 G F  H  X S+     0   0    3  249   35  I                 I    I              I    I    IIIIIIIIIIIIIIIIIIIIII
   380   41 G R  H  X S+     0   0   53  249   79  K                 K    K              K    K    KKKKKKKKKKKKKKKKKKKKKK
   381   42 G D  H  X S+     0   0   67  249   66  T                 N    N              N    N    NNNNNNNNNNNNNNNNNNNNNN
   382   43 G Y  H  X S+     0   0   43  249    2  Y                 Y    Y              Y    Y    YYYYYYYYYYYYYYYYYYYYYY
   383   44 G V  H >X S+     0   0    0  249   58  I                 I    I              I    I    IIIIIIIIIIIIIIIIIIIIII
   384   45 G E  H 3X S+     0   0   71  249   48  E                 E    E              E    E    EEEEEEEEEEEEEEEEEEEEEE
   385   46 G E  H 3< S+     0   0  125  249   57  D                 E    E              E    E    EEEEEEEEEEEEEEEEEEEEEE
   386   47 G R  H XX S+     0   0   94  249   68  K                 R    R              R    R    RRRRRRRRRRRRRRRRRRRRRR
   387   48 G S  H >< S+     0   0   12  249   68  S                 S    S              S    S    SSSSSSSSSSSSSSSSSSSSSS
   388   49 G G  T 3< S+     0   0   38  249   78  G                 G    G              G    G    GGGGGGGGGGGGGGGGGGGGGG
   389   50 G E  T <4 S+     0   0  138  248   52  E                 E    E              E    E    EEEEEEDEEEEEEEEEEEEEEE
   390   51 G D    XX> -     0   0    1  248    0  D                 D    D              D    D    DDDDDDDDDDDDDDDDDDDDDD
   391   52 G P  H 3>5S+     0   0   17  249   27  P                 P    P              P    P    PPPPPPPPPPPPPPPPPPPPPP
   392   53 G L  H 345S+     0   0    6  249    3  L                 L    L              L    L    LLLLLLLLLLLLLLLLLLLLLL
   393   54 G V  H <45S+     0   0   24  249   30  V                 V    V              V    V    VVVVVVVVVVVVVVVVVVVVVV
   394   55 G K  H  <5S-     0   0  149  249   78  K                 K    K              K    K    KKKKKKKKKKKKKKKKKKKKKK
   395   56 G G     << -     0   0   38  249   34  G                 G    G              G    G    GGGGGGGGGGGGGGGGGGGGGG
   396   57 G I        -     0   0   21  249   27  I                 V    I              I    I    IIIIIIIIIIIIIIIIIIIIII
   397   58 G P    >>  -     0   0   80  249   19  P                 P    P              P    P    PPPPPPPPPPPPPPPPPPPPPP
   398   59 G E  T 34 S+     0   0   75  249   62  E                 E    E              E    E    EEEEEEEEEEEEEEEEEEEEEE
   399   60 G D  T 34 S+     0   0  151  249   60  D                 D    D              D    D    DDDDDDDDDDDDDDDDDDDDDD
   400   61 G K  T <4 S+     0   0  163  249   65  K                 K    R              R    K    KKKKKKRKKKKKKKKKKKKKKK
   401   62 G N     <  -     0   0    1  249    0  N                 N    N              N    N    NNNNNNNNNNNNNNNNNNNNNN
   402   63 G P  S    S+     0   0   36  249    0  P                 P    P              P    P    PPPPPPPPPPPPPPPPPPPPPP
   403   64 G F  S    S-     0   0    3  249    1  F                 F    F              F    F    FFFFFFFFFFFFFFFFFFFFFF
   404   65 G K              0   0  108  247   34  K                 K    K              K    K    KKKKKKKKKKKKKKKKKKKKKK
   405   66 G E              0   0  201  242    3  E                 E    E              E    E    EEEEEEEEEEEEEEEEEEEEEE
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   54   14   FF  F F       FFF   FF FFFF  FFFF FFF FFFF F FF                      
   408   14 P E        +     0   0  153  148   31   EE  E E       EEE   EE EEEE  EEEE EEE EEEE E EE                      
   409   15 P G  S    S+     0   0   38  151   33   GG  G G       GGG   GG GGGG  GGGG GGG GGGG G GG                      
   410   16 P Q  S    S-     0   0   94  155   93   QQ  Q Q       QQQ   QQ QQQQ  QQQQ QQQ QQQQ Q QQ                      
   411   17 P A        +     0   0    1  157   48   AA  A A       AAA   AA AAAA  AAAA AAA VAAA A AA                      
   412   18 P S        +     0   0   28  161   65   TT  T T       TTT   TT TTTT  TTTT TTT TTTT T TT                      
   413   19 P H  S    S+     0   0   42  167   41   HH  H H       HHH   HH HHHH  HHHH HHH HHHH H HH                      
   414   20 P T  S  > S-     0   0    2  172    0   TT  T T       TTT   TT TTTT  TTTT TTT TTTT T TT                      
   415   21 P G  H  > S-     0   0   10  177    0   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGGG G GG                      
   416   22 P P  H  > S+     0   0   14  183    0   PP  P P  P    PPP  PPP PPPP PPPPP PPP PPPP P PP                      
   417   23 P K  H  > S+     0   0    6  183    0   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK K KK                      
   418   24 P G  H  X S+     0   0    0  183    0   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGGG G GG                      
   419   25 P V  H  X S+     0   0    0  183    0   VV  V V  V    VVV  VVV VVVV VVVVV VVV VVVV V VV                      
   420   26 P I  H  X S+     0   0    4  183   16   II  I I  I    III  III IIII IIIII III IIII I II                      
   421   27 P N  H  X S+     0   0   48  183   44   NN  N N  N    NNN  NNN NNHN NNNNN HNN HNNN N NN                      
   422   28 P D  H  X S+     0   0   14  184    0   DD  D D  D    DDD  DDD DDDD DDDDD DDD DDDD D DD                      
   423   29 P W  H  X S+     0   0    6  184    0   WW  W W  W    WWW  WWW WWWW WWWWW WWW WWWW W WW                      
   424   30 P R  H  < S+     0   0   67  184   27   RR  R R  R    RRR  RRR RRRR RRRRR RRR RRRR R RR                      
   425   31 P K  H >X S+     0   0   67  184   36   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK K KK                      
   426   32 P F  H >X>S+     0   0    1  184    2   FF  F F  F    FFF  FFF FFFF FFFFF FFF FFFF F FF                      
   427   33 P K  H 3<5S+     0   0   30  184    8   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK K KK                      
   428   34 P L  H <45S+     0   0  139  179    1   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   429   35 P E  H <<5S+     0   0   86  179   10   EE  E E  E    EEE  EEE EEEE EEEER EEE EEEE E EE                      
   430   36 P S  T  <5       0   0   57  180   65   ss  s s  s    sss  sss ssss sssss sss ssss s ss                      
   431   37 P E      <       0   0  118  186   66   rr  k r  r    rrr  rrr rrrr rrrrr rrr rrrr r rk                      
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  161   42   FI  I F  F    FLF  FFF VVFV VVVVF FVV FVMV M FF                      
   434   69 P S        +     0   0   52  162   66   SS  S S  S    SGS  SSS SSSS SSSSS SSH SSSS S GS                      
   435   70 P R        -     0   0  103  127   86   RR  R R  R    RRR  RRR RRRR RRRRR RRR RRRR R RR                      
   436   71 P K        +     0   0   22  130   11   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK K KK                      
   437   72 P M  S    S-     0   0   12  131   13   MM  M M  M    MMM  MMM MMMM MMMMM MMV MMMM M MM                      
   438   73 P S     >  -     0   0   52  139   66   SS  S S  S    SSS  SSS SSSS SSSSS SSS SSSS S SS                      
   439   74 P V  H  > S+     0   0  107  138   53   II  I I  I    III  III IIII IIIII III IIII I VV                      
   440   75 P Q  H  > S+     0   0  133  139   51   QQ  Q Q  Q    QQQ  QQQ QQQQ QQQQQ QQQ QQQQ Q QQ                      
   441   76 P E  H  > S+     0   0   38  145   27   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   442   77 P Y  H  X S+     0   0   36  157   63   YY  Y Y  Y    YYY  YYY YYYY YYYYY YYY YYYY Y YY                      
   443   78 P E  H  < S+     0   0  111  165   67   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   444   79 P L  H >X S+     0   0   45  167   54   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   445   80 P I  H 3< S+     0   0   37  170   72   II  I I  I    III  III IIII IIIII III IIII I II                      
   446   81 P H  T 3< S+     0   0  178  170   77   HH  H H  H    HHH  HHH HHHH HHHHH HNN HHHH H HH                      
   447   82 P K  T <4 S+     0   0  140  169   68   QQ  K Q  R    RQQ  RRR KKQK KKKKQ QQQ QKQK Q QQ                      
   448   83 P D     <  -     0   0   58  188   39   DD  D D  D    DDD  DDD EEDE EEEED DDD DEDE D ED                      
   449   84 P K        -     0   0  205  170   80   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK K KK                      
   450   85 P E        -     0   0   45  171   68   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   451   86 P D    >>  -     0   0   87  189   32   DD  D D  D    DDD  DDD DDDD DDDDD DDD DDDD D DD                      
   452   87 P E  H 3> S+     0   0  113  188   12   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   453   88 P N  H 3> S+     0   0   73  189   59   NN  N N  N    NNN  NNN NNTN NNNNN TND TNSN G NK                      
   454   89 P C  H <> S+     0   0   32  190   71   CC  C C  C    CCC  CCC CCCC CCCCC CCC CCCC C CC                      
   455   90 P L  H  X S+     0   0    4  190    2   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   456   91 P R  H  X S+     0   0  131  190   62   RR  R R  R    RRR  RRR RRRR RRRRR RRR RRRR R RR                      
   457   92 P K  H  X S+     0   0  112  190   60   KK  K K  K    KRK  KKK KKKK KKKKK KKK KKKK K RK                      
   458   93 P Y  H  X S+     0   0    7  190    6   YY  Y Y  Y    YYY  YYY YYYY YYYYY YYY YYYY Y YY                      
   459   94 P R  H  X S+     0   0   31  190   33   RR  R R  R    RRR  RRR RRRR RRRRR RRR RRRR R RR                      
   460   95 P R  H  X S+     0   0  130  190   46   RR  R R  R    RRR  RRR RRRR RRRRR RRR RRRR R KK                      
   461   96 P Q  H  X S+     0   0   96  190   33   QQ  Q Q  Q    QQQ  QQQ QQQQ QQQQQ QQQ QQQQ Q QQ                      
   462   97 P C  H  X S+     0   0   22  190   71   CC  C C  C    CCC  CCC CCCC CCCCC CCC CCCC C CC                      
   463   98 P M  H  X S+     0   0   33  190   10   MM  M M  M    MMM  MMM MMMM MMMMM MMM MMMM M MM                      
   464   99 P Q  H  X S+     0   0  115  190   54   QQ  Q Q  Q    QQQ  QQQ QQQQ QQQQQ QQQ QQQQ Q QQ                      
   465  100 P D  H  X S+     0   0   46  190   21   DD  D D  D    DDD  DDD DDDD DDDDD DDD DDDD D DD                      
   466  101 P M  H  X S+     0   0   23  190    2   MM  M M  M    MMM  MMM MMMM MMMMM MMM MMMM M MM                      
   467  102 P H  H  X S+     0   0   64  190   74   HH  H H  H    HHH  HHH HHHH HHHHH HHH HHHH H HH                      
   468  103 P Q  H  < S+     0   0  143  190   60   QQ  Q Q  Q    QQQ  QQQ QQQQ QQQQQ QQQ QQQQ Q QQ                      
   469  104 P K  H  < S+     0   0  140  190   57   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK K KK                      
   470  105 P L  H  < S+     0   0   35  190   44   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   471  106 P S     <  -     0   0   75  190   81   SS  S S  S    SSS  SSS SSSS SSSSS SSS SSSS S SS                      
   472  107 P F        -     0   0   71  188   99   FF  F F  F    FFF  FFF FFFF FFFFF FFF FFFF F FF                      
   473  108 P G        -     0   0   36  187   53   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGGG G GG                      
   474  109 P P        +     0   0   92  178   42   PP  P P  P    PPP  PPP PPPP PPPPP PPP PPPP P PP                      
   475  110 P R        +     0   0  177  184   62   RR  R R  R    RRR  RRR RRRR RRRRR RRR RRRR R RR                      
   476  111 P Y        +     0   0   51  185    4   YY  Y Y  Y    YYY  YYY YYYY YYYYY YYY YYYY Y YY                      
   477  112 P G        +     0   0   12  189   60   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGGG G GG                      
   478  113 P F  S    S-     0   0  151  190  102   FF  F F  F    FFF  FFF FFFF FFFFF FFF FFFF F FF                      
   479  114 P V  E     -v  532   0H  28  190   13   VV  V V  V    VVV  VVV VVVV VVVVV VVV VVVV V VV                      
   480  115 P Y  E     -v  533   0H  71  183   67   YY  Y Y  Y    YYY  YYY YYYY YYYYY YYY YYYY Y RI                      
   481  116 P E  E     -v  534   0H 108  190   44   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   482  117 P L        -     0   0   12  190   33   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   483  118 P E        +     0   0  134  190   75   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   484  119 P S  S >> S-     0   0   57  190   54   TT  T T  T    TTT  TTT TTTT TTTTT TTT TTTT T NS                      
   485  120 P G  H 3> S+     0   0   15  189   40   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGGG G GG                      
   486  121 P E  H 3> S+     0   0  127  190   23   EE  E E  E    EEE  EEE EEEE EEEEE EEE EKEK E EE                      
   487  122 P Q  H <> S+     0   0   72  190   62   QQ  Q Q  Q    QQQ  QQQ QQQQ QQQQQ QQQ QQQQ Q QQ                      
   488  123 P F  H  X S+     0   0   26  190    1   FF  F F  F    FFF  FFF FFFF FFFFF FFF FFFF F FF                      
   489  124 P L  H  X S+     0   0   90  190    6   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   490  125 P E  H  X S+     0   0  103  190   40   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   491  126 P T  H  < S+     0   0   10  190   74   TT  T T  T    TTT  TTT TTTT TTTTT TTT TTTT T AA                      
   492  127 P I  H  < S+     0   0   17  190   12   II  I I  I    III  III IIII IIIII III IIII I II                      
   493  128 P E  H  < S+     0   0  139  190   19   EE  E E  E    EEE  GEE EEEE EEEEE EEE EEEE E EE                      
   494  129 P K  S  < S+     0   0  172  190   33   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK K KK                      
   495  130 P E  S    S-     0   0   38  185    5   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   496  131 P Q    >   -     0   0  116  190   67   QQ  Q Q  Q    QQQ  QQQ QQKL LLQLQ KQQ KLQL Q QQ                      
   497  132 P K  T 3  S+     0   0  156  190   34   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK K KK                      
   498  133 P I  T 3  S+     0   0   68  190   87   II  I I  I    III  III IIII IIIII III IIVI V II                      
   499  134 P T    <   -     0   0   10  190   37   TT  T T  T    TTT  TTT TTTT TTTTT TTT TTTT T TT                      
   500  135 P T  E     -W  558   0H   7  189   62   TT  T T  T    TTT  TTT TTTT TTTTT TTT TTTT T TT                      
   501  136 P I  E     -Wx 557 531H   3  190   15   II  I I  I    III  III IIII IIIII III IIII I IV                      
   502  137 P V  E     -Wx 556 532H   0  190   35   VV  V V  V    VVV  VVV VVVV VVVVV VVV VVVV V II                      
   503  138 P V  E     -Wx 555 533H   0  190   13   VV  V V  V    VVV  VVV VVVV VVVVV VVV VVVV V VV                      
   504  139 P H  E     -Wx 554 534H   0  190    5   HH  H H  H    HHH  HHH HHHH HHHHH HHH HHNH N HH                      
   505  140 P I  E     +Wx 553 535H   2  190    2   II  I I  I    III  III IIII IIIII III IIII I II                      
   506  141 P Y  E     - x   0 536H   4  190    3   YY  Y Y  Y    YYY  YYY YYYY YYYYY YYY YYYY Y YY                      
   507  142 P E    >   -     0   0   45  190   26   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   508  143 P D  T 3  S+     0   0   95  190   50   DD  D D  D    DDD  DDD DDED DDDDD EDD EDDD D DD                      
   509  144 P G  T 3  S+     0   0   66  190   50   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGGG G GD                      
   510  145 P I  S X> S-     0   0   36  190   33   IV  I I  I    III  IVI IIII IIIII III IIVI V II                      
   511  146 P K  T 34 S+     0   0  191  190   72   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKRK R KK                      
   512  147 P G  T 3> S+     0   0   13  190   23   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGGG G GG                      
   513  148 P C  H <> S+     0   0    0  190   36   CC  C C  C    CCC  CCC CCCC CCCCC CCC CCCC C CC                      
   514  149 P D  H  X S+     0   0   78  190   47   DD  D D  D    DDD  DDD DDDD DDDDD DDD DDDD D EE                      
   515  150 P A  H  > S+     0   0   44  190   50   AA  V A  A    AAA  AAA AAAA AAAAA AAT AAAA A AA                      
   516  151 P L  H  X S+     0   0    0  190   11   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   517  152 P N  H  X S+     0   0   19  190   16   NN  N N  N    NNN  NNN NNNN NNNNN NNN NNNN N NN                      
   518  153 P S  H  X S+     0   0   78  190   57   SS  S S  S    SSS  SSS SDSS SSSSN SSS SSSS S NN                      
   519  154 P S  H  X S+     0   0    6  190   35   SS  S S  S    SSS  SSS SSSS SSSSS SSS SSSS S SS                      
   520  155 P L  H  X S+     0   0    1  190   10   LL  L L  F    FLL  FFF LLLL LLLLF LLL LLLL L LL                      
   521  156 P I  H  X S+     0   0  105  190   85   AT  T A  T    TTT  TTT TTTT TTTTT TTT TTAT E NN                      
   522  157 P C  H  X S+     0   0   63  190   41   CC  C C  C    CCC  CCC CCCC CCCCY CCC CCCC C CC                      
   523  158 P L  H  X S+     0   0    0  190    4   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   524  159 P A  H  < S+     0   0    1  190   11   AA  A A  A    AAA  AAA AAAA AAAAA AAA AAAA A AA                      
   525  160 P A  H  < S+     0   0   61  190   66   AA  A A  A    AAI  AAV AAAA AAAAA AAA AAVA A AV                      
   526  161 P E  H  < S+     0   0   72  190   24   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   527  162 P Y    ><  +     0   0    5  190    2   YY  Y Y  Y    YYY  YYY YYYY YYYYY YYY YYYY Y YY                      
   528  163 P P  T 3  S+     0   0   28  190   28   PP  P P  P    PPP  PPP PPPP PPPPP PPP PPPP P SS                      
   529  164 P M  T 3  S+     0   0   26  190   85   ML  M M  M    MMM  MMM IIMI IIIIM MMM MIMI M MM                      
   530  165 P V  S <  S-     0   0    1  190    9   VV  V V  V    VVV  VVV VVVV VVVVV VVV VVVV V VV                      
   531  166 P K  E     - x   0 501H  37  190    2   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK K KK                      
   532  167 P F  E     +vx 479 502H   0  190    1   FF  F F  F    FFF  FFF FFFF FFFFF FFF FFFF F FF                      
   533  168 P C  E     -vx 480 503H   0  190   19   CC  C C  C    CCC  CCC CCCC CCCCC CCC CCCC C CC                      
   534  169 P K  E     +vx 481 504H  51  190   38   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK K KK                      
   535  170 P I  E     - x   0 505H   1  190   21   II  I I  I    III  III IIII IIIII III IIII I II                      
   536  171 P K  E >>  - x   0 506H  52  190   71   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK R KK                      
   537  172 P A  H >> S+     0   0   13  190   46   AA  A A  A    AAA  AAA AAAA AAAAA AAA AAAA A AA                      
   538  173 P S  H 34 S+     0   0   88  190   29   SS  S S  S    SSS  SSS SSSS SSSSS SSS SSSS S SS                      
   539  174 P N  H <4 S+     0   0   67  190   86   NN  N N  N    NNN  NNN NNNN NNNNN NKN HNNN N NN                      
   540  175 P T  H << S-     0   0   25  190   72   TT  T T  T    TTT  TTT TTTT TTTTT TTT TTTT T TT                      
   541  176 P G     <  +     0   0   66  189   23   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGGG G GG                      
   542  177 P A    >   -     0   0   39  190   57   AA  A A  A    AAA  AAA AAAA AAAAA AAA AAAA A AA                      
   543  178 P G  T 3  S-     0   0   70  189   41   GG  G G  G    GGG  GGR GGEG GGGGR EGG EGGG G GG                      
   544  179 P D  T 3  S+     0   0  151  189   78   DD  D D  D    DDD  DDD DDDD DDDDD DDD DDDD D ED                      
   545  180 P R  S <  S+     0   0  167  189   57   RR  R R  R    RRR  RRR RRRR RRRRR RRR RRRR R RR                      
   546  181 P F  S    S+     0   0   35  189    0   FF  F F  F    FFF  FFF FFFF FFFFF FFF FFFF F FF                      
   547  182 P S    >>  -     0   0   34  189   69   SS  S S  S    SSS  SSS SSSS SSSSS SSS SSSS S SS                      
   548  183 P S  T 34 S+     0   0   86  189   84   SS  S S  S    SST  SSS LLSL LLLLS SSL SLTL S SS                      
   549  184 P D  T 34 S+     0   0  126  189   66   DD  D D  D    DDD  EDD DDDD DDDDE DEK DDDD D DD                      
   550  185 P V  T <4 S+     0   0   20  189   64   VV  V V  V    VVV  VVV VVVV VVVVV VVV VVVV V VV                      
   551  186 P L     <  +     0   0    8  190   15   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   552  187 P P  S    S+     0   0    1  190    0   PP  P P  P    PPP  PPP PPPP PPPPP PPP PPPP P PP                      
   553  188 P T  E     -W  505   0H   1  190   42   TT  T T  T    TTT  TTT TTTT TTTTT TTT TTTT T TT                      
   554  189 P L  E     -WY 504 566H   0  190    2   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   555  190 P L  E     -WY 503 565H   4  190   10   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   556  191 P V  E     +WY 502 564H   0  190   18   VV  V V  V    VVV  VIV IVVI IIIIV VVV VIVI V VV                      
   557  192 P Y  E     +WY 501 562H  31  190    0   YY  Y Y  Y    YYY  YYY YYYY YYYYY YYY YYYY Y YY                      
   558  193 P K  E >  S-WY 500 561H  25  190   13   KK  K K  K    KKK  KKK KKKK KKKKK KKK KKKK K KK                      
   559  194 P G  T 3  S-     0   0   25  190   44   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGGG G GG                      
   560  195 P G  T 3  S+     0   0   48  190   21   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGGG G GG                      
   561  196 P E  E <   -Y  558   0H  38  190   37   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   562  197 P L  E     +Y  557   0H  34  190   12   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   563  198 P L  E     -     0   0H   2  190   21   II  I I  I    III  III IIII IIIII III IIII I II                      
   564  199 P S  E     -Y  556   0H   4  190   29   SS  S S  S    SSS  SSS SSSS SSSSS SSS SSSS S SS                      
   565  200 P N  E     -Y  555   0H  41  190    0   NN  N N  N    NNN  NNN NNNN NNNNN NNN NNNN N NN                      
   566  201 P F  E >   -Y  554   0H   3  189    1   FF  F F  F    FFF  FFF FFFF FFFFF FFF FFFF F FF                      
   567  202 P I  T 3  S-     0   0   87  187   24   LI  I L  I    III  III IIII IIIII III IIII I II                      
   568  203 P S  T >  S-     0   0   11  187   69   SS  S S  S    SSS  SSS SSSS SSSSS SNS SSSS S SS                      
   569  204 P V  G X  S+     0   0    0  187   34   VV  V V  V    VVV  VVV VVVV VVVVI VVV VVVV V VV                      
   570  205 P T  G >  S+     0   0   17  187   36   AT  A A  T    TAA  TTS AAAA AAAAA AAT AAAA A ST                      
   571  206 P E  G <  S+     0   0  156  187   34   EE  E E  E    EEE  EEE DEEE EEDEE EQE EEEE E EE                      
   572  207 P Q  G <  S+     0   0   84  187   43   QQ  Q Q  Q    QQQ  QQQ QQQQ QQQQQ QQQ QQQQ Q QQ                      
   573  208 P L  S <  S-     0   0   31  187   11   FL  F F  F    FFF  FFF FFFF FFFFF FFF FFFF F FF                      
   574  209 P A    >   -     0   0   49  187   49   AA  A A  T    TAA  AAA AAAA AAAAA ATA AAAA A AA                      
   575  210 P E  T 3  S+     0   0  201  187   27   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   576  211 P E  T 3  S+     0   0  166  187   21   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE D DD                      
   577  212 P F    <   -     0   0   17  187    0   FF  F F  F    FFF  FFF FFFF FFFFF FFF FFFF F FF                      
   578  213 P F    >>  -     0   0  146  187   24   FF  F F  F    FFF  FFF FFFF FFFFF FFF FFFF F FF                      
   579  214 P T  H 3> S+     0   0   24  186   26   AA  A A  A    AAA  SAA AAAA AAAAA AAA AAAA A AA                      
   580  215 P G  H 3> S+     0   0   32  186   71   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGVG A VV                      
   581  216 P D  H <> S+     0   0   57  186    4   DD  D D  D    DDD  DDD DDDD DDDDD DDD DDDD D DD                      
   582  217 P V  H  X S+     0   0    0  186   23   VV  V V  V    VVV  VVV VVVV VVVVV VVV VVVV V VI                      
   583  218 P E  H  X S+     0   0   32  186   10   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   584  219 P S  H  X S+     0   0   58  186   51   SS  S S  S    SSS  SSS SSSS SSSSS SSS SSSS S SC                      
   585  220 P F  H  < S+     0   0    2  187    1   FF  F F  F    FFF  FFF FFFF FFFFF FFF FFFF F FF                      
   586  221 P L  H ><>S+     0   0    0  187    0   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   587  222 P N  H ><5S+     0   0   61  187   83   NN  N N  N    NNN  NNN NNNN NNNNN NNN NNNN N NN                      
   588  223 P E  T 3<5S+     0   0   70  187   16   EE  E E  Q    QEE  EEE EEEE EEEEE EEE EEEE E EE                      
   589  224 P Y  T < 5S-     0   0   20  183   49   YY  Y Y  Y    YYY  YYY YYYY YYYYY YYY YYYY Y YY                      
   590  225 P G  T < 5S+     0   0    6  183    7   GG  G G  G    GGG  GGG GGGG GGGGG GGG GGGG G GG                      
   591  226 P L      < +     0   0    2  183   19   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   592  227 P L  S    S-     0   0   10  178    7   LL  L L  L    LLL  LLL LLLL LLLLL LLL LLLL L LL                      
   593  228 P P        -     0   0   40  178   30   PP  P P  P    PPP  PPP PPPP PPPPP PPP PPPP P PP                      
   594  229 P E              0   0   94  177   19   EE  E E  E    EEE  EEE EEEE EEEEE EEE EEEE E EE                      
   595  230 P K              0   0  161  175   25   RR  R R  R    RRR  RRR RRRR RRRRR RRR RRRR R RR                      
## ALIGNMENTS  281 -  350
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....9....:....0....:....1....:....2....:....3....:....4....:....5
     1    2 B S              0   0  117  195   58             G NGGGEE G    D  E EEE              A   AAAAAAAA   A A   A 
     2    3 B E     >  -     0   0  107  209   43             E GEEEKK E    E KK KKK              K   KKKKKKKK   K K   K 
     3    4 B L  H  > S+     0   0   52  229   31             M LMMMII M    Y IIMIIIII IM I   IIIIII IIIIIIIII  II I   I 
     4    5 B D  H  > S+     0   0  104  229   51             E DEEEAA E    N AAAAAAAA AA A   AAAATA ATTTTTVTT  TT T   T 
     5    6 B Q  H  > S+     0   0  131  230   62             E NQQQAN E    Q AAAAAAAA AA A   AAAAAA AAAAAAAAS  AA A   A 
     6    7 B L  H  X S+     0   0   27  230   61             L LLLLAV L    L AAAAAAAA AA A   AAAAAA AAAAAAAAA  AA A   A 
     7    8 B R  H  X S+     0   0  110  233    4             R RRRRRR R  RRK RRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
     8    9 B Q  H  X S+     0   0  117  233   49             K QKKKRR K  RRA HRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
     9   10 B E  H  X S+     0   0   78  234    8             E EEEEEE E  EET LEEEEEEE EE E   EEEEEE EEEEEEEEE  EE E   E 
    10   11 B A  H  X S+     0   0    1  234    8             A AAAAAA A  AAA SAAAAAAA AV A   AAAAAA AAAAAAAAA  AA A   A 
    11   12 B E  H  X S+     0   0  121  234    8             D EDDEEE D  EEE EEEEEEEE EE E   DEEEED EEEEEEEEE  EE E   E 
    12   13 B Q  H  X S+     0   0  111  238   70             N FSSKTS N  SSE GNQTSMSS SQ V   GSSSGG SGGGGGVGG  GG G   G 
    13   14 B L  H  X S+     0   0   14  238    4             L LLLLLL L  LLL LLLLLLLL LP L   LLLLLL LLLLLLLLL  LL L   L 
    14   15 B K  H  X S+     0   0   99  238   24             K KKKKKK K  RKK KKKKKKKR KK K   KKKKKK KKKKKKKKK  KK K   K 
    15   16 B N  H  X S+     0   0   33  239   51             E NDDDEE D  EEA DEEEEEEE EE E   EEEEDE EDDDDDDDD  ED D   D 
    16   17 B Q  H  X S+     0   0   82  239   58             Q AQQDKK Q  KKK KKKKKKKK KK K   KKKKKK KKRRRRRRR  KK K   R 
    17   18 B I  H  X S+     0   0    7  240    4             I IIIIII I  III IIIIIIII II I   IIIIII IIIIIIIII  II I   I 
    18   19 B R  H  X S+     0   0  135  242   52             T RTTTRK T  RRK RRRRRRRR RR R   RRRRRR RKKKKKRKK  KK R   K 
    19   20 B D  H  X S+     0   0   85  244   60             A DAAAAQ A  AAA AAAAAAAA AA A   AAAARA ARRRRRHRR  RR R   R 
    20   21 B A  H  X S+     0   0   36  243   62             A AAAAKK A  RKD KKRKKKKR KR S   KKKKRK KRRRRRRRR  KR R   R 
    21   22 B R  H >X S+     0   0   22  244   22             R RRRRRR R  RKR KRRRRRKR KR R   KKRKKK KKKKKKRKK  KK K   K 
    22   23 B K  H 3< S+     0   0  136  244   50             K KKKKDD K  EED EEDDEEEE ED E   DEEEDD EDDDDDDDD  DD E   D 
    23   24 B A  H 3< S+     0   0   79  244   56             A AAATQA G  SSS QQAQSQSS SA A   QTSTDQ SEEEEEDEE  EE E   E 
    24   25 B C  H << S+     0   0   19  244   85             V AVVVLL V  SSK TLALSLSS SA S   MSTSLM SLLLLLLLL  LL L   L 
    25   26 B A     <  +     0   0   46  244   56             Q CQQQAA Q  AAK AAAAAAAA AA A   AAAAAA AAAAAAAAA  AA A   A 
    26   27 B D        +     0   0   88  243    0             D DDDDDD D  DDD DDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
    27   28 B A        -     0   0   17  243   50             T TTTLTT T  TTT STTTTTTT TT T   TTTTTT TTTTTTTTT  AT T   T 
    28   29 B T    >>  -     0   0   59  244   35             T TTTTTT T  SST TSSTSSSS SS S   SSSSTS STTSSTTTS  DT T   S 
    29   30 B L  H 3> S+     0   0    0  244    3             L LLLLLL L  LLL LLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
    30   31 B S  H 34 S+     0   0   38  244   90             Q AQQQRK Q  RRL RRRRRRRR RR R   RRRRRR RQRRRRRRR  RR R   R 
    31   32 B Q  H X4 S+     0   0  119  247   50             E QEEDAA E  AAE ASAAAAAA AA A   AAAADA AQQQQQQQE  QQ Q   Q 
    32   33 B I  H 3< S+     0   0   28  248   52             A AAAHMV A  MMA MMMMMMMM MM M   MMMMVM MVVVVVVVV  LV V   V 
    33   34 B T  T >< S+     0   0    0  249   56             A TAAVAS V  AAA AATAAAAA AT A   AAAAAA AAAAAAAAA  AA A   A 
    34   35 B N  T <  S+     0   0  129  249   72             A TGAAAA A  AAS AHEAAAAA AE A   NAAAQN AMQQQQQQQ  KQ Q   Q 
    35   36 B N  T 3  S+     0   0  111  249   55             G NGGGED G  EED DEDEEEEE ED E   DEEEnD Ennnnnnnn  en s   n 
    36   37 B I  S <  S-     0   0   21  249   49             L MIITII L  VVV IILMVIVV VL V   IVVVtI Vtttttttt  vt t   t 
    37   38 B D        -     0   0  138  249   32             A ESTADE A  ADA EDEDADDP DE D   EDDDDE DDDDDDDDD  EE D   D 
    38   39 B P        -     0   0   89  250   59             V PVVVPP V  AAEPPPSPAPAA AS T   PPSPAP APTPPPPPP  AT P   P 
    39   40 B V        -     0   0   23  251   30             V VVVVLL I  LLLILLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
    40   41 B G        -     0   0   54  251   45             G GGGGPP G  PPPPPPPPPPPP PP P   PPPPPP PPPPPTPPP  PP P   P 
    41   42 B R        -     0   0  115  251    6             R RRRRRR R  RRRRRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
    42   43 B I        +     0   0    8  251   27             I LVVVII I  IILGVIVVIIII IV I   IIIIII IIIIIIIII  TI I   I 
    43   44 B Q        -     0   0   54  251   59             Q QQQQPM Q  VVSqVAVLVAVV VV V   VVVVGV VGGGGGGGG  LG M   G 
    44   45 B M        -     0   0   11  252    5             M MMMLIM M  MMMmMMMMMMMM MM M   MMMMMM MMMMMMMMM  MM M   M 
    45   46 B R        -     0   0   49  252   18             K RKKKKK K  RRRKKRRKRRRR RR R   KRRRKK RRKRRRRRR  KK K   R 
    46   47 B T  E     +A  338   0A  12  252   43             T TTTTPV T  PPVAPPPPPPPP PP P   PPPPPP PPPPPPPPP  NP P   P 
    47   48 B R  E     +     0   0A  56  252   11             R RRRRRR R  RRRKRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
    48   49 B R  E     -A  337   0A  60  252    9             K RKKKRR K  RRRRRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
    49   50 B T  E     -A  336   0A  30  252   20             T TTTTTT T  AASTTTTTATAA AT A   TAAATT ATTNNNNNN  TT T   N 
    50   51 B L  E     -A  335   0A   0  252    0             L LLLLLL L  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
    51   52 B R        +     0   0  159  252   22             R RRRRKK R  RRRKKKKKRKRR RK K   KRRRKK RKKKKKKKK  KK K   K 
    52   53 B G        +     0   0   20  252    0             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
    53   54 B H        -     0   0    4  252    0             H HHHHHH H  HHHHHHHHHHHH HH H   HHHHHH HHHHHHHHH  HH H   H 
    54   55 B L  S    S+     0   0  116  252    4             L LLLLLL L  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
    55   56 B A  S    S-     0   0    0  252    4             A AAAAAA A  AAAAAAAAAAAA AA A   AAAAAA AAAAAAAAA  AA A   A 
    56   57 B K        -     0   0   15  252    0             K KKKKKK K  KKKKKKKKKKKK KK K   KKKKKK KKKKKKKKK  KK K   K 
    57   58 B I  E     -D   73   0B   0  252    1             I IIIIII I  IIIIIIIIIIII II I   IIIIII IIIIIIIII  II I   I 
    58   59 B Y  E     -     0   0B   6  252    4             Y YYYYYY Y  YYYYYYYYYYYY YY Y   YYYYYY YYYYYYYYY  YY Y   Y 
    59   60 B A  E     -D   72   0B  13  252    5             A AAAAAA A  AAAAAAAAAAAA AA A   AAAAAA AAAAAAAAA  SA A   A 
    60   61 B M  E     -D   71   0B  15  252    4             M MMMMMM M  MMMMMMMMMMMM MM M   MMMMMM MMMMMMMMM  MM M   M 
    61   62 B H  E     -D   70   0B  44  252    4             H HHHHHH H  HHHHHHHHHHHH HH H   HHHHHH HHHHHHHHH  HH H   H 
    62   63 B W  E     -D   69   0B  11  252    0             W WWWWWW W  WWWWWWWWWWWW WW W   WWWWWW WWWWWWWWW  WW W   W 
    63   64 B G    >   -     0   0    3  252   43             G GSSGAG G  AASSSSAAAAAA AA A   AAAASA ASSSSSSSS  SS S   S 
    64   65 B T  T 3  S+     0   0   75  252   58             A CTTTQS A  TATTAQAQTQAT AA A   NATATN ATTTTTTTT  TT T   T 
    65   66 B D  T 3  S-     0   0   80  252    1             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
    66   67 B S  S <  S+     0   0    3  252   50             S sASSQK s  RRNRKKKKRKRR RK R   KRRRRK RRRRRRRRR  RR R   R 
    67   68 B R  S    S+     0   0   94  252   20             K rKKKRR r  RRRRRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
    68   69 B L  E     + E   0  82B  31  252   80             L NLLLHH L  HHHHHHHHHHHH HH H   HHHHHH HHHHHHHHH  HH H   H 
    69   70 B L  E     -DE  62  81B   0  252   12             C LCCCLL C  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
    70   71 B L  E     -DE  61  80B   0  252    3             V VVVVVV V  VVVVVVVVVVVV VV V   VVVVVV VVVVVVVVV  VV V   V 
    71   72 B S  E     -DE  60  79B   0  252    1             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
    72   73 B A  E     -DE  59  78B   0  252    1             A AAAAAA A  AAAAAAAAAAAA AA A   AAAAAA AAAAAAAAA  AA A   A 
    73   74 B S  E >>  -DE  57  77B   0  252    1             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
    74   75 B Q  T 34 S+     0   0    1  252    1             Q QQQQQQ Q  QQQQQQQQQQQQ QQ Q   QQQQQQ QQQQQQQQQ  QQ Q   Q 
    75   76 B D  T 34 S-     0   0    9  252    1             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
    76   77 B G  T <4 S+     0   0    7  252    1             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
    77   78 B K  E  <  -EF  73  93B  52  252    7             K KKKKKK K  KKKKKKKKKKKK KK K   KKKKKK KKKKKKKKK  KK K   K 
    78   79 B L  E     -EF  72  92B   0  252    2             L LLLLLL L  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
    79   80 B I  E     -EF  71  91B   0  252    3             I IIIIII I  IILIIIIIIIII II I   IIIIII IIIIIIIII  II I   I 
    80   81 B I  E     -EF  70  90B   0  252   16             V VVVVVV V  VVVIIVVVVVVV VV V   VVVVIV VIIIIIIII  II I   I 
    81   82 B W  E     -EF  69  88B   0  252    0             W WWWWWW W  WWWWWWWWWWWW WW W   WWWWWW WWWWWWWWW  WW W   W 
    82   83 B D  E >>> -EF  68  87B  21  252    2             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
    83   84 B S  T 345S+     0   0    0  252   52             S STTSAA S  AAAAAAAAAAAA AA A   AAAAAA AAAAAAAAA  AA A   A 
    84   85 B Y  T 345S+     0   0   57  251   17             I YIIYYF V  YYYYYYYYYYYY YY Y   YYYYYY YYYYYYYYY  YY Y   Y 
    85   86 B T  T <45S-     0   0   56  252    5             T TTTTTT T  TTTTTTTTTTTT TT T   TTTTTT TTTTTTTTT  TT T   T 
    86   87 B T  T  <5 +     0   0   43  252    4             T TTTTTT T  TTTTTTTTTTTT TT T   TTTTTT TTTTTTTTT  TT T   T 
    87   88 B N  E   < -F   82   0B  99  252    4             N NNNNNN N  NNNNNNNNNNNN NN N   NNNNNN NNNNNNNNN  NN N   N 
    88   89 B K  E     +F   81   0B  95  249    1             K KKKKKK K  KKKKKKKKKKKK KK K   KKKKKK KKKKKKKKK  KK K   K 
    89   90 B V  E    S+     0   0B  66  249   17             V IVVVVV V  VVIVVVVVVVVV VV V   VVVVVV VVVVVVVVV  VV V   V 
    90   91 B H  E     -F   80   0B  57  249    2             N HNNHHH N  HHHHHHHHHHHH HH H   HHHHHH HHHHHHHHH  HH H   H 
    91   92 B A  E     -F   79   0B  43  251    0             A AAAAAA A  AAAAAAAAAAAA AA A   AAAAAA AAAAAAAAA  AA A   A 
    92   93 B I  E     -F   78   0B   0  252    0             I IIIIII I  IIIIIIIIIIII II I   IIIIII IIIIIIIII  II I   I 
    93   94 B P  E     -F   77   0B  80  252    4             P PPPPPP P  PPPPPPPPPPPP PP P   PPPPPP PPPPPPPPP  PP P   P 
    94   95 B L        -     0   0   26  252    0             L LLLLLL L  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
    95   96 B R  S    S+     0   0  190  252    6             K RKKKRR K  RRRRRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
    96   97 B S        -     0   0   17  252    3             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
    97   98 B S  S    S+     0   0    6  252    3             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
    98   99 B W        +     0   0    2  252    0             W WWWWWW W  WWWWWWWWWWWW WW W   WWWWWW WWWWWWWWW  WW W   W 
    99  100 B V  E     -G  115   0C   4  252    0             V VVVVVV V  VVVVVVVVVVVV VV V   VVVVVV VVVVVVVVV  VV V   V 
   100  101 B M  E     +     0   0C   5  252    0             M MMMMMM M  MMMMMMMMMMMM MM M   MMMMMM MMMMMMMMM  MM M   M 
   101  102 B T  E     -G  114   0C   8  252    0             T TTTTTT T  TTTTTTTTTTTT TT T   TTTTTT TTTTTTTTT  TT T   T 
   102  103 B C  E     -G  113   0C   0  252    1             C CCCCCC C  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   103  104 B A  E     -G  112   0C   0  252    3             A AAASAA A  AAAAAAAAAAAA AA A   AAAAAA AAAAAAAAA  AA A   A 
   104  105 B Y  E     -G  111   0C   9  252    2             Y YYYYYY Y  YYYYYYYYYYYY YY Y   YYYYYY YYYYYYYYY  YY Y   Y 
   105  106 B A    >   -     0   0    0  252   22             A AAAAAA A  SSAAASSAASSS SS S   ASSSAA SAAAAAAAA  AA A   A 
   106  107 B P  T 3  S+     0   0   64  252    3             P PPPPPP P  PPPPPPPPPPAP PP P   PPPPPP PPPPPPPPP  PP P   P 
   107  108 B S  T 3  S-     0   0   47  252    6             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   108  109 B G  S <  S+     0   0    8  252    6             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   109  110 B N  S    S+     0   0   50  252   22             N SNNNNN N  NNNNNNNNNNNN NN N   NNNNNN NNNNNNNNN  NN N   N 
   110  111 B Y  E     - H   0 124C  50  252   13             L FLLMFY L  YFFYLFFFLFFY FF F   WYFYYS FYYYYYYYY  YY Y   Y 
   111  112 B V  E     -GH 104 123C   0  252    0             V VVVVVV V  VVVVVVVVVVVV VV V   VVVVVV VVVVVVVVV  VV V   V 
   112  113 B A  E     +GH 103 122C   0  252    2             A AAAAAA A  AAAAAAAAAAAA AA A   AAAAAA AAAAAAAAA  AA A   A 
   113  114 B C  E     +GH 102 121C   5  252    2             C CCCCCC C  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   114  115 B G  E     +GH 101 120C   1  252    0             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   115  116 B G  E >  S-G   99   0C   0  252    0             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   116  117 B L  T 3  S+     0   0    1  252    0             L LLLLLL L  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
   117  118 B D  T 3  S-     0   0   50  252    0             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   118  119 B N  S <  S+     0   0   30  252    0             N NNNNNN N  NNNNNNNNNNNN NN N   NNNNNN NNNNNNNNN  NN N   N 
   119  120 B I  E     - I   0 139C  39  252   24             M IMMMII M  IIIIIVIIIIII II I   IIIIII IIIIIIIII  II I   I 
   120  121 B C  E     -HI 114 138C   0  252    3             C CCCCCC C  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   121  122 B S  E     -HI 113 137C   9  252    6             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   122  123 B I  E     -HI 112 136C   0  252    2             I IIIIII I  IIIIIIIIIIII II I   IIIIII IIIIIIIII  VI I   I 
   123  124 B Y  E     -H  111   0C   3  252    0             Y YYYYYY Y  YYYYYYYYYYYY YY Y   YYYYYY YYYYYYYYY  YY Y   Y 
   124  125 B N  E     +H  110   0C  24  252   40             N SNNNNN N  NNNNNNNSNNNN SN N   SSNSNS NNNNNNNNN  NN N   N 
   125  126 B L        +     0   0   11  252    1             L LLLLLL L  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
   126  127 B K  S    S+     0   0  109  252   43             K KKKKRK K  HQKNRRRRHRNH KR N   RNNNSR NSSSSSSSS  SS S   S 
   127  128 B T  S    S-     0   0   64  252   55             S TGGAST S  SNSqGSNSSASS QN S   GNANSG TASSSSSSS  AS S   S 
   128  129 B R  S    S+     0   0  267  250   17             K RKKKKK K  KKRrRKKKKKKK DK K   RKKKRR KRRRRRRRR  RR R   R 
   129  130 B E  S    S-     0   0  173  251    9             D EDDDEE D  EEEDDEEEEEEE GE E   DDEDED EEEEEEDEE  DE E   E 
   130  131 B G        -     0   0   50  252   11             G VGGGGG G  ggGGGGgGgggg Tg a   pgagGp nGGGGGGGG  GG G   G 
   131  132 B N        +     0   0   30  252   52             N TNNNSS N  nsVPSTgTnsnn Ng g   nngnPn sPPPPPPPP  PP P   P 
   132  133 B V  S    S+     0   0   58  253   42             V SVVVVV V  VVVTVANVVVLV AN V   IANATI MTTTTTTTT  TT T   T 
   133  134 B R  S    S-     0   0  213  253   22             K SKKKRK K  KRRRKKKKKKRK RK K   KRKRRK RRRRRRRRR  RR R   R 
   134  135 B V        -     0   0   29  253   15             V GVVVVV V  GGVVVVSVGVGG GS G   VGGGVV GVVVVVVVV  VV V   V 
   135  136 B S  S    S-     0   0   43  253   48             M DMMMAA M  AATASAAAAAAA AA G   GAAAAG AAAAAAAAA  AA A   A 
   136  137 B R  E     -I  122   0C 105  253    7             R MRRRRR R  RRRRRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
   137  138 B E  E     -I  121   0C  75  253    3             E TEEEEE E  EEEEEEEEEEEE EE E   EEEEEE EEEEEEEEE  EE E   E 
   138  139 B L  E     +I  120   0C   1  252    1             L .LLLLL L  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
   139  140 B A  E     +I  119   0C  61  252   57             A .AAASS A  SSASQSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   140  141 B G        +     0   0   50  252   25             A .AAAAA A  AASGAAAAAAAA AA A   AAAAGA AGGGGGGGG  GG G   G 
   141  142 B H        -     0   0    9  252    2             H .HHHHH H  HHHHHHHHHHHH HH H   HHHHHH HHHHHHHHH  HH H   H 
   142  143 B T  S    S+     0   0   64  252   42             T .TTTTT T  SSTATTSTSTSS SS S   TSSSST SSSTTASST  SS S   T 
   143  144 B G  S    S-     0   0    0  252    2             G .GGGGG g  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   144  145 B Y        -     0   0    0  251    0             Y .YYYYY y  YYYYYYYYYYYY YY Y   YYYYYY YYYYYYYYY  YY Y   Y 
   145  146 B L  E     +J  160   0D   0  251    1             L .LLLLL L  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
   146  147 B S  E     -     0   0D   3  251    0             S .SSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   147  148 B C  E     -J  159   0D   9  251    5             C .CCCCC C  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   148  149 B C  E     -J  158   0D   0  251    0             C .CCCCC C  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   149  150 B R  E     -J  157   0D  53  251    4             R .RRRRR R  RRRRRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
   150  151 B F  E     -J  156   0D  10  251    0             F .FFFFF F  FFFFFFFFFFFF FF F   FFFFFF FFFFFFFFF  FF F   F 
   151  152 B L  S    S-     0   0   26  251   24             L .ILLLI L  LLLILLILLLLL II I   LIIIIL LIIVVIIIV  LI I   V 
   152  153 B D  S    S-     0   0   60  251   40             S .SSSNS S  NNSNNNNNSNNN NN N   NNNNNN NNNNNNNNN  NN N   N 
   153  154 B D  S    S+     0   0   60  251    2             D .DDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   154  155 B N  S    S+     0   0   44  251   65             S .STSRR T  RRRRRRRRRRRR RR R   QRRRRQ RRRRRRRRR  RR R   R 
   155  156 B Q  E     + K   0 169D  60  251   47             E .EEEQQ E  QQESQQQQQQQQ QQ Q   QQQQRQ QRRRRRRRR  RR R   R 
   156  157 B I  E     -JK 150 168D   0  251    1             I .IIIII I  IIIIIVIIIIII II I   IIIIII IIIIIIIII  II I   I 
   157  158 B V  E     -JK 149 167D   0  251   22             L .IIILL L  VVVLLLVLVLVV VV V   LVVVIL VIIIIILII  LI I   I 
   158  159 B T  E     -JK 148 166D   0  251    1             T .TTTTS T  TTTTTTTTTTTT TT T   TTTTTT TTTTTTTTT  TT T   T 
   159  160 B S  E     -JK 147 165D   0  251    2             S .SSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   160  161 B S  E >   -J  145   0D   0  251    0             S .SSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   161  162 B G  T 3  S+     0   0    0  251    0             G .GGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   162  163 B D  T 3  S-     0   0    5  251    0             D .DDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   163  164 B T  S <  S+     0   0    8  251   63             C .CCCMM C  MMMMMMMMMMMM MM M   MMMMMM MMMMMMMMM  MM M   M 
   164  165 B T        -     0   0    2  251   16             T .TTTSS T  TTTTSTTTTSTT TT T   STTTTS TTTTTTTTT  TT T   T 
   165  166 B C  E     -KL 159 179D   0  251    0             C CCCCCC C  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   166  167 B A  E     -KL 158 178D   0  252   62             V AVVVMM V  MMAMMMMMMMMM MM M   IMMMMI MMMMMMIMM  MM M   M 
   167  168 B L  E     -KL 157 177D   6  252    6             L LLLLLL L  LLLKLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
   168  169 B W  E     -KL 156 175D   2  252    0             W WWWWWW W  WWWWWWWWWWWW WW W   WWWWWW WWWWWWWWW  WW W   W 
   169  170 B D  E >>> -KL 155 174D  37  252    0             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   170  171 B I  T 345S+     0   0    7  252    8             I IIIIII I  IICIIVIVIVII II I   IIIIII IIIIIIIII  II I   I 
   171  172 B E  T 345S+     0   0  144  252    6             E EEEEED E  EEEEEDEDEDEE EE E   GEEEED EEEEEEEEE  DE E   E 
   172  173 B T  T <45S-     0   0   78  252   36             T TTTTAA T  AATTSAAAAAAA AA A   SAAASS ASSSSSSSS  TS S   S 
   173  174 B G  T  <5 +     0   0   16  253    8             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   174  175 B Q  E   < -L  169   0D 135  253   68             T QTTSVM T  VVQQVVAVVVVV VA V   TVVVST VSSSSTATT  AS S   S 
   175  176 B Q  E     -L  168   0D  30  253   45             Q QQQQRK Q  RRLKRRRRRRRR RR R   RRRRKR RKKKKKKKK  RK K   K 
   176  177 B T  E     +     0   0D  64  253   73             K CKKKVT K  VVRVIVVVVIVV VV V   IVVVVI VVVVVVIVV  IV V   V 
   177  178 B T  E     -L  167   0D  20  253   47             T ATTTVL T  VVTTQIMIVIVV VM V   TIVITT VTTTTTTTT  TT T   T 
   178  179 B T  E     -L  166   0D   5  253   77             V SVVVEE V  EESEEEEEEEEE EE E   EEEEEE EEEEEEEEE  DE E   E 
   179  180 B F  E     +L  165   0D   1  253    0             F FFFFFF F  FFFFFFFFFFFF FF F   FFFFFF FFFFFFFFF  FF F   F 
   180  181 B T        +     0   0   34  253   72             A VAAANN A  SSQAHNNNSNSS SN S   NSSSAN SAAAAAAAA  AA A   A 
   181  182 B G        +     0   0   37  253   30             G GGGGDD G  DDGDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   182  183 B H        -     0   0    7  253    0             H HHHHHH H  HHHHHHHHHHHH HH H   HHHHHH HHHHHHHHH  HH H   H 
   183  184 B T  S    S+     0   0   99  253   63             Q SQQLST Q  TTALTTTSTTTT TT T   TTTTLT TLLLLLLLL  LL L   L 
   184  185 B G  S    S-     0   0    0  253    1             G GGGGGG G  GGGGGGGGGAGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   185  186 B D        -     0   0    1  253    1             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   186  187 B V  E     -M  202   0E   0  253   22             C VCCCVV C  VVVVVVVVVVVV VV V   VVVVVV VVVVVVVVV  VV V   V 
   187  188 B M  E     +     0   0E   3  253    1             M MMMMMM M  MMMMMMMMMMMM MM M   MMMMMM MMMMMMMMM  MM M   M 
   188  189 B S  E     -M  201   0E  16  253    8             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   189  190 B L  E     -M  200   0E   3  253   14             L LLLLLL L  LLLIILLLLLLL LL L   ILLLII LIIIIIIII  LI I   I 
   190  191 B S  E     -M  199   0E  21  253   24             A SAGASS A  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   191  192 B L  E     -M  198   0E  29  253   29             V LVVVLL V  LLLLLLLLLLLL LL L   LLLLIL LIIIIIIII  VI I   I 
   192  193 B A    >   -     0   0    4  253   57             S SSSSGS S  GGSNGGGGGGGG AG G   SAGANS GNNNNNNNN  NN N   N 
   193  194 B P  T 3  S+     0   0   85  253   13             P PPPPPP P  PPPPPPPPPPPP PP P   PPPPPS PPPPPPPPP  PP P   P 
   194  195 B D  T 3  S-     0   0   87  253   52             D DDDDND D  SNDTNNNNNNNN NN N   NSNSTN NTTTTTTTT  TT T   T 
   195  196 B T  S <  S+     0   0   62  253   97             F MFFFLK F  QQanQQQQQQQQ MQ Q   PnQnnP Qnnnnnsnn  nn n   n 
   196  197 B R  S    S+     0   0  142  252   61             K RKKNNN K  NNnnNNNNNNNN NN N   NnNnnN Nnnnnndnn  nn n   n 
   197  198 B L  E     - N   0 211E  37  252   71             F MFFTTV F  VITTTLVVVVVV TV V   VVVVIV VVIVVIVIV  IV V   V 
   198  199 B F  E     -MN 191 210E   0  252    0             F FFFFFF F  FFFFFFFFFFFF FF F   FFFFFF FFFFFFFFF  FF F   F 
   199  200 B V  E     -MN 190 209E   0  252   11             I IIIIVV I  VVVIVVVVVVVV VV V   VIVIVV VVVVVVVVV  VV V   V 
   200  201 B S  E     -MN 189 208E   0  252    0             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   201  202 B G  E     +MN 188 207E   0  252    0             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   202  203 B A  E >   -M  186   0E   0  252    4             A AAAAAA A  AAAAAAAAAAAA AA A   AAAAAA AAAAAAAAA  AA A   A 
   203  204 B C  T 3  S+     0   0    5  252    2             C CCCCCC C  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   204  205 B D  T 3  S-     0   0   31  252    0             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   205  206 B A  S <  S+     0   0   20  252   16             F AFFFAS Y  AAAAAAAAATAA AA A   AAAAAA AAAAAAMAS  AA T   A 
   206  207 B S  E     - O   0 222E   6  252   69             T STTTTT T  STQFTTTTTTTT TT T   MTTTFV TFFFFFFFF  FF F   F 
   207  208 B A  E     -NO 201 221E   0  252   35             A SAAAAA A  AAAAAAAAAAAA AA A   AAAAAA AAAAAAAAA  AA A   A 
   208  209 B K  E     -NO 200 220E  18  252    0             K KKKKKK K  KKKKKKKKKKKK KK K   KKKKKK KKKKKKKKK  KK K   K 
   209  210 B L  E     -NO 199 219E   2  252    8             L LLLLVV L  LIVLIVLVLVLL LL L   VLLLLV LLLLLLLLL  LL L   L 
   210  211 B W  E     -NO 198 217E   1  252    0             W WWWWWW W  WWWWWWWWWWWW WW W   WWWWWW WWWWWWWWW  WW W   W 
   211  212 B D  E >>> -NO 197 216E  11  252    1             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   212  213 B V  T 345S+     0   0   12  252   19             I IIIIVI I  IIIIMIIIIIII II I   IITIII IIIIIIITI  II I   I 
   213  214 B R  T 345S+     0   0  194  252    1             R RRRRRR R  RRRRRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
   214  215 B E  T <45S-     0   0  111  252   59             E EEEETT E  SSEASTTTSTSS TT S   STSTTS STTAALVVA  TT T   A 
   215  216 B G  T  <5 +     0   0    8  252   25             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGDG  GG G   G 
   216  217 B M  E      -     0   0    1  252    0             F FFFFFF F  FFFFFFFFFFFF FF F   FFFFFF FFFFFFFFF  FF F   F 
   235  236 B P  T 3  S+     0   0   45  252    0             P PPPPPP P  PPPPPPPPPPPP PP P   PPPPPP PPPPPPPPP  PP P   P 
   236  237 B N  T 3  S-     0   0   42  252   27             N NNNNNN N  NNSDNNNNNNNN NN N   NNNNDN NDDDDDDDD  DD D   D 
   237  238 B G  S <  S+     0   0   12  252    8             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   238  239 B N  S    S+     0   0   56  252   76             N QNNNDE N  DDQHDDDDDDDD DD D   DDEDND DNNNNNNNN  NN N   N 
   239  240 B A  E     - Q   0 253F   0  252   11             A AAAAAA A  AAASAAAAAAAA AA A   AASAAA AAAAAAAAA  AA A   A 
   240  241 B F  E     -PQ 233 252F   0  252   16             V FVVVFF V  FFFFFFFFFFFF FF F   FFFFFF FFFFFFFFF  FF F   F 
   241  242 B A  E     -PQ 232 251F   0  252   51             I ALIIAG I  AAGVAAAAAAAA AA A   AAAAGA AGGGGGGGG  GG G   G 
   242  243 B T  E     -PQ 231 250F   0  252    0             T TTTTTS T  TTTTTTTTTTTT TT T   TTTTTT TTTTTTTTT  TT T   T 
   243  244 B G  E     +PQ 230 249F   0  252    0             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   244  245 B S  E >   -P  228   0F   0  252    0             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   245  246 B D  T 3  S+     0   0   13  252    0             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   246  247 B D  T 3  S-     0   0   28  252    0             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   247  248 B A  S <  S+     0   0    6  252   12             A AAAAAA A  AAAAAAAAAAAA AA A   AAAATA ATTTTTTTT  AT A   T 
   248  249 B T        -     0   0   16  252   42             T STTSSS T  SSTTTSSSSSSS SS S   SSSSTS SSSTTSTST  TS T   T 
   249  250 B C  E     -QR 243 263F   0  252    3             C CCCCCC C  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   250  251 B R  E     -QR 242 262F  23  252    3             K RKKKRR K  RRRRRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
   251  252 B L  E     -QR 241 261F   0  252    0             L LLMLLL L  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
   252  253 B F  E     -QR 240 259F   1  251    0             Y FYYYFF Y  FFFFFFFFFFFF FF F   FFFFFF FFFFFFFFF  FF F   F 
   253  254 B D  E  >> -QR 239 258F   1  251    0             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   254  255 B L  T >45S+     0   0   15  251   26             L ILLLLL L  ILLILLILILII II I   LIIIIL IIIIIIIII  II I   I 
   255  256 B R  T 345S+     0   0   57  251    0             R RRRRRR R  RRRRRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
   256  257 B A  T 345S-     0   0    0  251    8             A AAASAA A  AAAAAAAAAAAA AA A   AAAAAA AAAAAAAAA  AA A   A 
   257  258 B D  T <<5 +     0   0    0  251    0             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   258  259 B Q  E      -     0   0  119  253   47             D RDDDHH D  HHHSHHHHHHHH HH H   HHHHSH HSSSSSSSS  SS S   S 
   266  267 B D  T 3  S+     0   0  161  253   25             S DSSSDD S  DDEEDDDDDDDD DD D   DDDDDD DDDDDDDDD  ED D   D 
   267  268 B N  T 3  S+     0   0   66  253   48             S NSSSNN S  NNNSNNNNNNNN NN N   NNNNQN NQQQQQQQQ  QQ Q   Q 
   268  269 B I    <   +     0   0   23  253   21             I IIIIVI I  IIIIIVIVIVII II I   IIIIII IVIVVIVVV  II V   V 
   269  270 B I        +     0   0   97  253   31             M IMMMLL M  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL V   L 
   270  271 B C  S    S-     0   0   10  253    6             C CCCCCC C  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   271  272 B G        -     0   0    1  253    0             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   272  273 B I  E     +S  288   0G   0  253    1             V IVVVII V  IIIIVIIIIIII II I   IIIIII IIIIIIIII  II I   I 
   273  274 B T  E     +     0   0G  13  253    4             T TTTTTT T  TTTTTTTTTTTT TT T   TTTTTT TTTTTTTTT  TT T   T 
   274  275 B S  E     +S  287   0G  18  252    0             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   275  276 B V  E     +S  286   0G  10  252    5             L VLLIVV L  VVIVVVVVVVVV VV V   VVVVVV VVVVVVVVV  VV V   V 
   276  277 B S  E     -S  285   0G  15  252   21             A AAAAAA A  AAGAGGAAAGAA AA A   GAAAGG AAAAAAAAA  AA A   A 
   277  278 B F  E     -S  284   0G  12  252   13             P FPPPFF P  FFFTFFFFFFFF FF F   FFFFFF FFFFFFFFF  FF F   F 
   278  279 B S        -     0   0    3  252    1             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   279  280 B K  S    S+     0   0  104  252   80             L KLLLAI F  IILVNVIAIVII II I   VIIIVV IVVVVVVVV  VV V   V 
   280  281 B S  S    S-     0   0    2  252    0             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   281  282 B G  S    S+     0   0    0  252    0             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   282  283 B R        +     0   0    8  252    0             R RRRRRR R  RRRRRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
   283  284 B L  E     - T   0 297G   0  252   11             L LLLLIL L  IILLIIVIILII IV I   IIVILI ILLLLLLLL  LL L   L 
   284  285 B L  E     -ST 277 296G   0  252    3             L LIIILL L  LLLLLILLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
   285  286 B L  E     -ST 276 295G   0  252   13             L LLLLFF L  FFFFFFFFFFFF FF F   FFFFFF FFFFFFFFF  FF F   F 
   286  287 B A  E     -ST 275 294G   0  252   11             A AAAAAA A  GGAAAAGAGAGG GG G   AGGGAA GAAAAAAAA  AA A   A 
   287  288 B G  E     -ST 274 293G   2  252    4             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   288  289 B Y  E >   -S  272   0G   4  252    0             Y YYYYYY Y  YYYYYYYYYYYY YY Y   YYYYYY YYYYYYYYY  YY Y   Y 
   289  290 B D  T 3  S+     0   0    3  252    3             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   290  291 B D  T 3  S-     0   0   37  252    1             D DDDDDD D  DDNDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   291  292 B F  S <  S+     0   0    3  252    3             F FFFFFF F  WWFFYFWFWFWW WW W   YWWWFY WFFYYFYFY  FF F   Y 
   292  293 B N        -     0   0   15  252   39             N NNNNNN N  TTDENNTNTNTT TT T   TTTTET TEEEEEEEE  EE E   E 
   293  294 B C  E     -TU 287 307G   0  252    5             V CVVCCC V  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   294  295 B N  E     -TU 286 306G   5  252   32             N NNNNNN N  NNNKNNNNNNNN NN N   NNNNKN NKKKKKKKK  KK K   K 
   295  296 B V  E     -TU 285 305G   0  252    9             I IIIIVV I  VVVVVVVVVVVV VV V   VVVVVV VVVVVVVVV  VV V   V 
   296  297 B W  E     -TU 284 303G   6  252    0             W WWWWWW W  WWWWWWWWWWWW WW W   WWWWWW WWWWWWWWW  WW W   W 
   297  298 B D  E  >  -T  283   0G   4  252    0             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   298  299 B A  T  4 S+     0   0    0  252   64             A SSSSTT A  TTTITTTTTTTT TT T   TTTTVT TVVVVVVVV  VV V   V 
   299  300 B L  T  4 S+     0   0    0  252   11             L ILLLLL L  LLLTLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
   300  301 B K  T  4 S-     0   0   29  252   17             K KKKKKK K  KKKRKKKKKKKK KK R   KKKKRK KRRRRRRRR  RR R   R 
   301  302 B A  S  < S+     0   0   17  252   42             A AAASGG A  GGRGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   302  303 B D  S    S-     0   0   95  252   20             E EEEEEE E  EETEEEEEEEEE EE E   EEEEDE EDDEEDEDE  ED D   E 
   303  304 B R  E     -U  296   0G  69  252   15             R RRRRRR R  RRRKRRRRRRRR RR R   RRRRKR RKKKKKKKK  KK K   K 
   304  305 B A  E     -     0   0G  14  252   58             V IVVVVV V  VVVVVVVVVVVV VV V   VVVVVV VVVVVVVVV  VV V   V 
   305  306 B G  E     -U  295   0G   4  252    5             G GGGGGG G  GGAGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   306  307 B V  E >   -U  294   0G   7  252   45             V IVVVVV V  VVISVVVVVVVV VV V   VVVVSV VSSSSSSSS  AS S   S 
   307  308 B L  E >  S+U  293   0G   2  251    1             L LLLLLL L  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
   308  309 B A  G >  S-     0   0    4  251   52             A AAASAA A  TTPVSATATATT TT T   ATTTSA TSSSSSSSS  VS S   S 
   309  310 B G  G <   -     0   0    4  251    5             G GGGGGA G  GGSGGGGGGGGG GG G   AGGGGA GGGGGGGGG  GG G   G 
   310  311 B H  G <  S+     0   0    8  251    0             H HHHHHH H  HHHHHHHHHHHH HH H   HHHHHH HHHHHHHHH  HH H   H 
   311  312 B D    <   -     0   0   26  251   18             D DDDDEE D  EEDEEEEEEEEE EE E   EEEEEE EEEEEEEEE  EE E   E 
   312  313 B N  S    S+     0   0   31  251    0             N NNNNNN N  NNNNNNNNNNNN NN N   NNNNNN NNNNNNNNN  NN N   N 
   313  314 B R        +     0   0   40  251    1             R RRRRRR R  RRRRRRRRRRRR RR R   RRRRRR RRRRRRRRR  RR R   R 
   314  315 B V        +     0   0    2  251    1             V VVVVVV V  VVVVVVVVVVVV VV V   VVVVVV VVVVVVVVV  VV V   V 
   315  316 B S  S    S-     0   0    2  251    2             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   316  317 B C  E     -B  329   0A  10  251    6             C CCCCCC C  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   317  318 B L  E     -B  328   0A  15  250    4             I LIIILL I  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
   318  319 B G  E     -B  327   0A  10  250    3             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   319  320 B V  E     -B  326   0A  25  250    0             V VVVVVV V  VVVVVVVVVVVV VV V   VVVVVV VVVVVVVVV  VV V   V 
   320  321 B T    >   -     0   0    3  250   47             S TSSTSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   321  322 B D  T 3  S+     0   0   98  250   64             S DTTPSS S  ASSNGQVSAATA VV V   TAAANA VNNNNNNNN  NN N   N 
   322  323 B D  T 3  S-     0   0   51  249    7             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   323  324 B G  S <  S+     0   0    0  249    5             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   324  325 B M  S    S+     0   0   36  249   20             M MMMMMM M  MMLIMMMMMMMM MM M   MMMMIM MIIIIIIII  II I   I 
   325  326 B A        -     0   0    0  249   24             A AAAAAA A  AAASAAAAAAAA AA A   AAAASA ASSSSSSSS  SS S   S 
   326  327 B V  E     -BC 319 338A   0  248   33             C VCCCLL C  LLLLLLLLLLLL LL L   LLLLLL LLLLLLLLL  LL L   L 
   327  328 B A  E     -BC 318 337A   0  247   47             C ACCCCC C  CCCCCCCCCCCC CC C   CCCCCC CCCCCCCCC  CC C   C 
   328  329 B T  E     -BC 317 336A   7  247    1             T TTTTTT T  TTTTTTTTTTTT TT T   TTTTTT TTTTTTTTT  TT T   T 
   329  330 B G  E     -BC 316 335A   1  247    2             G GGGGGG G  GGGGGGGGGGGG GG G   GGGGGG GGGGGGGGG  GG G   G 
   330  331 B S    >   -     0   0    6  247    0             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   331  332 B W  T 3  S+     0   0    6  247    0             W WWWWWW W  WWWWWWWWWWWW WW W   WWWWWW WWWWWWWWW  WW W   W 
   332  333 B D  T 3  S-     0   0   17  247    0             D DDDDDD D  DDDDDDDDDDDD DD D   DDDDDD DDDDDDDDD  DD D   D 
   333  334 B S  S <  S+     0   0   12  247    2             S SSSSSS S  SSSSSSSSSSSS SS S   SSSSSS SSSSSSSSS  SS S   S 
   334  335 B F        -     0   0   78  247   39             F FFFFML F  TTLLLTTMTMTT TT T   RTTTLR TLLLLLLLL  FL L   L 
   335  336 B L  E     -AC  50 329A   1  247    3             L LLLLLL L  LLLLLLLLLLLL LL L   LLLLLL LVLLLVLLV  LL L   L 
   336  337 B K  E     -AC  49 328A  60  246   25             K RKKKKK K  RRKKKKKKRKRR RK R   LRRRKL RrKKKRKK   RK K   K 
   337  338 B I  E     -AC  48 327A   0  244   10             I IIIIVV I  VVIIIIVIVIVV VV V   VVVVVI ViVVVIII   IV V   V 
   338  339 B W  E      AC  46 326A   2  243    0             W WWWWWW W  WWWWWWWWWWWW WW W   WWWWWW WWWWW WW   WW W   W 
   339  340 B N              0   0   10  236   46             N NNNN   N  AANA  A ASAA AA A   AAAAAA A AAA AA   AA A   A 
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   85    5  PPPPPPPPPPP P      P PP            P    PPP                    P  P   
   342    3 G V        +     0   0   96   88   62  AAAAAAAAAAA A      A AV            V    VAV                    V  V   
   343    4 G I        -     0   0   38   92   33  LLLLLLLLLLL L      L LI            I    IVI                    I  I   
   344    5 G N    >   -     0   0  109   92   65  HHHHHHHHHHH H      H HN            N    NHN                    N  N   
   345    6 G I  G >  S+     0   0   25   93   47  IIIIIIIIIII I      I IV            V    IVV                    V  V   
   346    7 G E  G 3  S+     0   0  122  138   45  EEEEEEEEEEE E      E EE            E    DED                    E HE   
   347    8 G D  G <  S+     0   0  133  149   28  DDDDDDDDDDD D      D DD            E    DDD                    D DD   
   348    9 G L    <   -     0   0   35  155   20  LLLLLLLLLLL L      L LL            L    LLL                    L LL   
   349   10 G T     >  -     0   0   69  156   61  PPPPPPPPPPP P      S PT            T    TST                    T TT   
   350   11 G E  H  > S+     0   0  116  160   37  EEEEEEEEEEE E      E ED            D    DED                    D ED   
   351   12 G K  H >> S+     0   0   66  165   48  KKKKKKKKKKK K      K KK            L    KKK                    K KK   
   352   13 G D  H 3> S+     0   0   39  166   39  EEEEEEEEEEE E      E ED            D    DDD                    D ED   
   353   14 G K  H 3X S+     0   0   83  166   83  KKKKKKKKKKK K      K KK            K    KKK                    K VK   
   354   15 G L  H < S+     0   0    7  249    4  EEEEEEEEEEE E      E EE            E    EEE                    E EE   
   365   26 G V  H 3< S+     0   0   43  249   53  VVVVVVVVVVV V      V AV            V    VAV                    V VV   
   366   27 G T  T 3< S+     0   0  116  249   83  KKKKKKKKKKK K      K KK            K    KKK                    K KK   
   367   28 G L    <   -     0   0   49  249   60  LLLLLLLLLLL L      L LL            L    LLL                    L TL   
   368   29 G E        -     0   0  191  249   51  QQQQQQQQQQQ Q      Q QE            E    EQE                    E EE   
   369   30 G R        -     0   0   32  249    0  RRRRRRRRRRR R      R RR            R    RRR                    R RR   
   370   31 G M        -     0   0   53  249   83  QQQQQQQQQQQ Q      Q QW            A    WQW                    W EW   
   371   32 G L     >  -     0   0   75  248   80  QQQQQQQQQQQ Q      Q QL            K    LQL                    L ML   
   372   33 G V  H  > S+     0   0    4  248   13  VVVVVVVVVVV V      V VT            V    TVT                    T VT   
   373   34 G S  H  > S+     0   0   14  248    1  SSSSSSSSSSS S      S SS            S    SSS                    S SS   
   374   35 G K  H  > S+     0   0   93  248   37  KKKKKKKKKKK K      K KK            K    KKK                    K KK   
   375   36 G C  H  X S+     0   0    0  249   61  CCCCCCCCCCC C      C CC            C    CCC                    C TC   
   376   37 G C  H  X S+     0   0    0  249   62  SSSSSSSSSSS S      S SC            C    CSC                    C TC   
   377   38 G E  H  X S+     0   0   75  249   68  EEEEEEEEEEE E      E EE            E    EEE                    E KE   
   378   39 G E  H  X S+     0   0   60  249   24  EEEEEEEEEEE E      E EE            E    EEE                    E EE   
   379   40 G F  H  X S+     0   0    3  249   35  IIIIIIIIIII I      I II            I    IIM                    I II   
   380   41 G R  H  X S+     0   0   53  249   79  KKKKKKKKKKK K      K KK            S    KKK                    K KK   
   381   42 G D  H  X S+     0   0   67  249   66  NNNNNNNNNNN N      N ND            E    DKE                    E EE   
   382   43 G Y  H  X S+     0   0   43  249    2  YYYYYYYYYYY Y      Y YY            Y    YYY                    Y FY   
   383   44 G V  H >X S+     0   0    0  249   58  IIIIIIIIIII I      I II            I    III                    I VI   
   384   45 G E  H 3X S+     0   0   71  249   48  EEEEEEEEEEE E      E EV            Q    QEQ                    Q EQ   
   385   46 G E  H 3< S+     0   0  125  249   57  EEEEEEEEEEE E      E EA            S    AAE                    A SA   
   386   47 G R  H XX S+     0   0   94  249   68  RRRRRRRRRRR H      R RG            G    GRR                    L SG   
   387   48 G S  H >< S+     0   0   12  249   68  SSSSSSSSSSS S      S SM            A    ECV                    V SV   
   388   49 G G  T 3< S+     0   0   38  249   78  GGGGGGGGGGR G      G GD            D    EGE                    E AE   
   389   50 G E  T <4 S+     0   0  138  248   52  EEEEEEEEEEE E      D EE            E    EEE                    E EE   
   390   51 G D    XX> -     0   0    1  248    0  DDDDDDDDDDD D      D DD            D    DDD                    D DD   
   391   52 G P  H 3>5S+     0   0   17  249   27  PPPPPPPPPPP P      P PI            P    IPT                    T PT   
   392   53 G L  H 345S+     0   0    6  249    3  LLLLLLLLLLL L      L LL            L    LLL                    L LL   
   393   54 G V  H <45S+     0   0   24  249   30  VVVVVVVVVVV V      V VV            V    VVV                    V LV   
   394   55 G K  H  <5S-     0   0  149  249   78  KKKKKKKKKKK K      K KK            K    KKK                    K KK   
   395   56 G G     << -     0   0   38  249   34  GGGGGGGGGGG G      G GG            G    GGG                    G GG   
   396   57 G I        -     0   0   21  249   27  IIIIIIIIIII I      I II            I    III                    I II   
   397   58 G P    >>  -     0   0   80  249   19  PPPPPPPPPPP P      P PP            P    SPS                    S PS   
   398   59 G E  T 34 S+     0   0   75  249   62  EEEEEEEEEEE E      E EE            E    EEE                    E EE   
   399   60 G D  T 34 S+     0   0  151  249   60  DDDDDDDDDDD D      D DD            E    EDE                    E DE   
   400   61 G K  T <4 S+     0   0  163  249   65  KKKKKKKKKKK K      K KK            K    KKK                    K KK   
   401   62 G N     <  -     0   0    1  249    0  NNNNNNNNNNN N      N NN            N    NNN                    N NN   
   402   63 G P  S    S+     0   0   36  249    0  PPPPPPPPPPP P      P PP            P    PPP                    P PP   
   403   64 G F  S    S-     0   0    3  249    1  FFFFFFFFFFF F      F FF            F    FYF                    F FF   
   404   65 G K              0   0  108  247   34  KKKKKKKKKKK K      K KK            K    KKK                    K KK   
   405   66 G E              0   0  201  242    3  EEEEEEEEEEE E      E EE            E    EEE                    E EE   
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   54   14                                        F          F         F       F  
   408   14 P E        +     0   0  153  148   31                                        E          E         E       E  
   409   15 P G  S    S+     0   0   38  151   33                                        G          G         G       G  
   410   16 P Q  S    S-     0   0   94  155   93                                        Q          Q         Q       Q  
   411   17 P A        +     0   0    1  157   48                                        A          A         A       A  
   412   18 P S        +     0   0   28  161   65                                        T          T         T       T  
   413   19 P H  S    S+     0   0   42  167   41                                        H          H         H       H  
   414   20 P T  S  > S-     0   0    2  172    0                                        T          T         T       T S
   415   21 P G  H  > S-     0   0   10  177    0                                        G          G         GG      G G
   416   22 P P  H  > S+     0   0   14  183    0                                        P          P         PP      P P
   417   23 P K  H  > S+     0   0    6  183    0                                        K          K         KK      K K
   418   24 P G  H  X S+     0   0    0  183    0                                        G          G         GG      G G
   419   25 P V  H  X S+     0   0    0  183    0                                        V          V         VV      V V
   420   26 P I  H  X S+     0   0    4  183   16                                        I          I         II      I I
   421   27 P N  H  X S+     0   0   48  183   44                                        N          N         NN      N N
   422   28 P D  H  X S+     0   0   14  184    0                                        D          D         DD      D D
   423   29 P W  H  X S+     0   0    6  184    0                                        W          W         WW      W W
   424   30 P R  H  < S+     0   0   67  184   27                                        R          R         RR      R R
   425   31 P K  H >X S+     0   0   67  184   36                                        K          K         KK      K K
   426   32 P F  H >X>S+     0   0    1  184    2                                        F          F         FF      F F
   427   33 P K  H 3<5S+     0   0   30  184    8                                        K          K         KK      K K
   428   34 P L  H <45S+     0   0  139  179    1                                        L          L         LL      L L
   429   35 P E  H <<5S+     0   0   86  179   10                                        E          E         EE      E E
   430   36 P S  T  <5       0   0   57  180   65                                        s          s         ss      s s
   431   37 P E      <       0   0  118  186   66                                        r          r         rr      r r
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  161   42                                        F          F         IF      F F
   434   69 P S        +     0   0   52  162   66                                        C          C         RC      S C
   435   70 P R        -     0   0  103  127   86                                        R          R         RR      R R
   436   71 P K        +     0   0   22  130   11                                        K          K         KK      K K
   437   72 P M  S    S-     0   0   12  131   13                                        M          M         MM      M M
   438   73 P S     >  -     0   0   52  139   66                                        S          S         SS      S S
   439   74 P V  H  > S+     0   0  107  138   53                                        M          M         VM      M M
   440   75 P Q  H  > S+     0   0  133  139   51                                        Q          Q         QQ      Q Q
   441   76 P E  H  > S+     0   0   38  145   27                                        E          E         EE      E E
   442   77 P Y  H  X S+     0   0   36  157   63                                        Y          Y         YY      Y Y
   443   78 P E  H  < S+     0   0  111  165   67                                        E          E         EE      E E
   444   79 P L  H >X S+     0   0   45  167   54                                        L          L         LL      L L
   445   80 P I  H 3< S+     0   0   37  170   72                                        I          I         II      I I
   446   81 P H  T 3< S+     0   0  178  170   77                                        N          Q         HN      H Q
   447   82 P K  T <4 S+     0   0  140  169   68                                        D          D         QD      G D
   448   83 P D     <  -     0   0   58  188   39                                        E          D         EE      E D
   449   84 P K        -     0   0  205  170   80                                        K          K         KK      Q K
   450   85 P E        -     0   0   45  171   68                                        E          E         EE      E E
   451   86 P D    >>  -     0   0   87  189   32                                        D          D         DD      D D
   452   87 P E  H 3> S+     0   0  113  188   12                                        E          E         EE      E E
   453   88 P N  H 3> S+     0   0   73  189   59                                        S          S         RS      S S
   454   89 P C  H <> S+     0   0   32  190   71                                        C          C         CC      C C
   455   90 P L  H  X S+     0   0    4  190    2                                        L          L         LL      L L
   456   91 P R  H  X S+     0   0  131  190   62                                        Q          Q         RQ      Q Q
   457   92 P K  H  X S+     0   0  112  190   60                                        K          K         KK      K K
   458   93 P Y  H  X S+     0   0    7  190    6                                        Y          Y         YY      Y Y
   459   94 P R  H  X S+     0   0   31  190   33                                        R          R         RR      R R
   460   95 P R  H  X S+     0   0  130  190   46                                        K          K         RK      K K
   461   96 P Q  H  X S+     0   0   96  190   33                                        R          R         QR      R R
   462   97 P C  H  X S+     0   0   22  190   71                                        C          C         CC      C C
   463   98 P M  H  X S+     0   0   33  190   10                                        M          M         MM      M M
   464   99 P Q  H  X S+     0   0  115  190   54                                        Q          Q         HQ      Q Q
   465  100 P D  H  X S+     0   0   46  190   21                                        D          D         ND      D D
   466  101 P M  H  X S+     0   0   23  190    2                                        M          M         MM      M M
   467  102 P H  H  X S+     0   0   64  190   74                                        H          H         HH      H H
   468  103 P Q  H  < S+     0   0  143  190   60                                        Q          Q         QQ      Q Q
   469  104 P K  H  < S+     0   0  140  190   57                                        R          R         KR      R R
   470  105 P L  H  < S+     0   0   35  190   44                                        L          L         LL      L L
   471  106 P S     <  -     0   0   75  190   81                                        S          S         SS      S S
   472  107 P F        -     0   0   71  188   99                                        F          F         FF      F F
   473  108 P G        -     0   0   36  187   53                                        G          G         GG      G G
   474  109 P P        +     0   0   92  178   42                                        P          P         PP      P P
   475  110 P R        +     0   0  177  184   62                                        K          K         KK      R K
   476  111 P Y        +     0   0   51  185    4                                        Y          Y         YY      Y Y
   477  112 P G        +     0   0   12  189   60                                        G          G         GG      G G
   478  113 P F  S    S-     0   0  151  190  102                                        Y          Y         FY      S Y
   479  114 P V  E     -v  532   0H  28  190   13                                        L          L         LL      L L
   480  115 P Y  E     -v  533   0H  71  183   67                                        C          C         CC      Y C
   481  116 P E  E     -v  534   0H 108  190   44                                        E          E         EE      E E
   482  117 P L        -     0   0   12  190   33                                        L          L         LL      L L
   483  118 P E        +     0   0  134  190   75                                        Q          Q         EQ      Q Q
   484  119 P S  S >> S-     0   0   57  190   54                                        N          N         TN      N N
   485  120 P G  H 3> S+     0   0   15  189   40                                        G          G         GG      G G
   486  121 P E  H 3> S+     0   0  127  190   23                                        E          E         EE      E E
   487  122 P Q  H <> S+     0   0   72  190   62                                        Q          Q         QQ      Q Q
   488  123 P F  H  X S+     0   0   26  190    1                                        F          F         FF      F F
   489  124 P L  H  X S+     0   0   90  190    6                                        L          L         LL      L L
   490  125 P E  H  X S+     0   0  103  190   40                                        E          E         EE      E E
   491  126 P T  H  < S+     0   0   10  190   74                                        A          A         AA      V A
   492  127 P I  H  < S+     0   0   17  190   12                                        I          I         II      I I
   493  128 P E  H  < S+     0   0  139  190   19                                        E          E         EE      E E
   494  129 P K  S  < S+     0   0  172  190   33                                        K          K         KK      K K
   495  130 P E  S    S-     0   0   38  185    5                                        E          E         EE      E E
   496  131 P Q    >   -     0   0  116  190   67                                        R          R         QR      R R
   497  132 P K  T 3  S+     0   0  156  190   34                                        K          K         KK      K K
   498  133 P I  T 3  S+     0   0   68  190   87                                        T          T         ST      T T
   499  134 P T    <   -     0   0   10  190   37                                        T          T         TT      V T
   500  135 P T  E     -W  558   0H   7  189   62                                        T          T         TT      L T
   501  136 P I  E     -Wx 557 531H   3  190   15                                        V          V         VV      V V
   502  137 P V  E     -Wx 556 532H   0  190   35                                        I          I         II      I I
   503  138 P V  E     -Wx 555 533H   0  190   13                                        V          V         VV      V V
   504  139 P H  E     -Wx 554 534H   0  190    5                                        H          H         HH      H H
   505  140 P I  E     +Wx 553 535H   2  190    2                                        I          I         II      I I
   506  141 P Y  E     - x   0 536H   4  190    3                                        Y          Y         YY      Y Y
   507  142 P E    >   -     0   0   45  190   26                                        E          E         EE      E E
   508  143 P D  T 3  S+     0   0   95  190   50                                        D          D         ND      D D
   509  144 P G  T 3  S+     0   0   66  190   50                                        G          G         DG      G G
   510  145 P I  S X> S-     0   0   36  190   33                                        I          I         VI      I I
   511  146 P K  T 34 S+     0   0  191  190   72                                        K          K         EK      K K
   512  147 P G  T 3> S+     0   0   13  190   23                                        G          G         GG      G G
   513  148 P C  H <> S+     0   0    0  190   36                                        C          C         CC      C C
   514  149 P D  H  X S+     0   0   78  190   47                                        N          D         ED      E D
   515  150 P A  H  > S+     0   0   44  190   50                                        A          A         AA      A A
   516  151 P L  H  X S+     0   0    0  190   11                                        L          L         LL      L L
   517  152 P N  H  X S+     0   0   19  190   16                                        N          N         NN      N N
   518  153 P S  H  X S+     0   0   78  190   57                                        S          N         SS      N N
   519  154 P S  H  X S+     0   0    6  190   35                                        S          S         GS      S S
   520  155 P L  H  X S+     0   0    1  190   10                                        L          L         LL      L L
   521  156 P I  H  X S+     0   0  105  190   85                                        T          T         AT      T T
   522  157 P C  H  X S+     0   0   63  190   41                                        C          C         CC      C C
   523  158 P L  H  X S+     0   0    0  190    4                                        L          L         LL      L L
   524  159 P A  H  < S+     0   0    1  190   11                                        A          A         AA      A A
   525  160 P A  H  < S+     0   0   61  190   66                                        A          A         TA      A A
   526  161 P E  H  < S+     0   0   72  190   24                                        E          E         EE      E E
   527  162 P Y    ><  +     0   0    5  190    2                                        Y          Y         YY      Y Y
   528  163 P P  T 3  S+     0   0   28  190   28                                        T          A         PT      S A
   529  164 P M  T 3  S+     0   0   26  190   85                                        T          T         TT      T T
   530  165 P V  S <  S-     0   0    1  190    9                                        V          V         LV      M V
   531  166 P K  E     - x   0 501H  37  190    2                                        K          K         RK      R K
   532  167 P F  E     +vx 479 502H   0  190    1                                        F          F         FF      F F
   533  168 P C  E     -vx 480 503H   0  190   19                                        C          C         CC      C C
   534  169 P K  E     +vx 481 504H  51  190   38                                        K          K         KK      K K
   535  170 P I  E     - x   0 505H   1  190   21                                        I          I         II      I I
   536  171 P K  E >>  - x   0 506H  52  190   71                                        K          K         RK      K K
   537  172 P A  H >> S+     0   0   13  190   46                                        A          A         AA      A A
   538  173 P S  H 34 S+     0   0   88  190   29                                        S          S         SS      S S
   539  174 P N  H <4 S+     0   0   67  190   86                                        N          D         NK      N D
   540  175 P T  H << S-     0   0   25  190   72                                        T          T         TT      T T
   541  176 P G     <  +     0   0   66  189   23                                        G          G         GG      G G
   542  177 P A    >   -     0   0   39  190   57                                        A          A         AA      A A
   543  178 P G  T 3  S-     0   0   70  189   41                                        G          G         GG      G G
   544  179 P D  T 3  S+     0   0  151  189   78                                        D          D         DD      D D
   545  180 P R  S <  S+     0   0  167  189   57                                        R          R         RR      R R
   546  181 P F  S    S+     0   0   35  189    0                                        F          F         FF      F F
   547  182 P S    >>  -     0   0   34  189   69                                        S          S         SS      S S
   548  183 P S  T 34 S+     0   0   86  189   84                                        D          D         AD      T D
   549  184 P D  T 34 S+     0   0  126  189   66                                        E          E         GE      D E
   550  185 P V  T <4 S+     0   0   20  189   64                                        V          V         VV      V V
   551  186 P L     <  +     0   0    8  190   15                                        L          L         LL      L L
   552  187 P P  S    S+     0   0    1  190    0                                        P          P         PP      P P
   553  188 P T  E     -W  505   0H   1  190   42                                        T          T         TT      T T
   554  189 P L  E     -WY 504 566H   0  190    2                                        L          L         LL      L L
   555  190 P L  E     -WY 503 565H   4  190   10                                        L          L         LL      L L
   556  191 P V  E     +WY 502 564H   0  190   18                                        V          V         VI      V V
   557  192 P Y  E     +WY 501 562H  31  190    0                                        Y          Y         YY      Y Y
   558  193 P K  E >  S-WY 500 561H  25  190   13                                        K          K         KK      K K
   559  194 P G  T 3  S-     0   0   25  190   44                                        G          G         AG      G G
   560  195 P G  T 3  S+     0   0   48  190   21                                        G          G         GG      G G
   561  196 P E  E <   -Y  558   0H  38  190   37                                        E          E         EE      E E
   562  197 P L  E     +Y  557   0H  34  190   12                                        L          L         LL      L L
   563  198 P L  E     -     0   0H   2  190   21                                        L          L         LL      L L
   564  199 P S  E     -Y  556   0H   4  190   29                                        S          S         GS      S S
   565  200 P N  E     -Y  555   0H  41  190    0                                        N          N         NN      N N
   566  201 P F  E >   -Y  554   0H   3  189    1                                        F          F         FF      F F
   567  202 P I  T 3  S-     0   0   87  187   24                                        I          I         II      I I
   568  203 P S  T >  S-     0   0   11  187   69                                        S          S         NS      S S
   569  204 P V  G X  S+     0   0    0  187   34                                        V          V         VV      I V
   570  205 P T  G >  S+     0   0   17  187   36                                        S          S         TS      T S
   571  206 P E  G <  S+     0   0  156  187   34                                        E          E         EE      E E
   572  207 P Q  G <  S+     0   0   84  187   43                                        Q          Q         RQ      H Q
   573  208 P L  S <  S-     0   0   31  187   11                                        F          F         LF      F F
   574  209 P A    >   -     0   0   49  187   49                                        N          N         GN      R N
   575  210 P E  T 3  S+     0   0  201  187   27                                        E          D         EE      E D
   576  211 P E  T 3  S+     0   0  166  187   21                                        E          E         EE      E E
   577  212 P F    <   -     0   0   17  187    0                                        F          F         FF      F F
   578  213 P F    >>  -     0   0  146  187   24                                        F          F         FF      F F
   579  214 P T  H 3> S+     0   0   24  186   26                                        A          A         AA      A A
   580  215 P G  H 3> S+     0   0   32  186   71                                        V          V         GV      V V
   581  216 P D  H <> S+     0   0   57  186    4                                        D          D         DD      D D
   582  217 P V  H  X S+     0   0    0  186   23                                        V          V         VV      V V
   583  218 P E  H  X S+     0   0   32  186   10                                        E          E         EE      E E
   584  219 P S  H  X S+     0   0   58  186   51                                        S          S         SS      S S
   585  220 P F  H  < S+     0   0    2  187    1                                        F          F         LF      F F
   586  221 P L  H ><>S+     0   0    0  187    0                                        L          L         LL      L L
   587  222 P N  H ><5S+     0   0   61  187   83                                        N          N         CN      H N
   588  223 P E  T 3<5S+     0   0   70  187   16                                        E          E         EE      E E
   589  224 P Y  T < 5S-     0   0   20  183   49                                        Y          Y         YY      Y Y
   590  225 P G  T < 5S+     0   0    6  183    7                                        G          G         GG      G G
   591  226 P L      < +     0   0    2  183   19                                        L          L         LL      L L
   592  227 P L  S    S-     0   0   10  178    7                                        L          L         LL      L L
   593  228 P P        -     0   0   40  178   30                                        P          P         PP      P P
   594  229 P E              0   0   94  177   19                                        E          E         EE      E E
   595  230 P K              0   0  161  175   25                                        R          R         RR      K R
## ALIGNMENTS  351 -  420
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....6....:....7....:....8....:....9....:....0....:....1....:....2
     1    2 B S              0   0  117  195   58    A    DA    S A    EE E      D       A        N                      
     2    3 B E     >  -     0   0  107  209   43    K    KR  KKR R  KKKK K KKKK KK      R       EE                      
     3    4 B L  H  > S+     0   0   52  229   31  I III III  III I IIIII I IIII II      I       ML                      
     4    5 B D  H  > S+     0   0  104  229   51  T TAQ AAQ  QQQ Q QQQQQ S QQQQ AQ      Q       ED                      
     5    6 B Q  H  > S+     0   0  131  230   62  A SAI SAQ  IIQ A QTIQQ A LLLI GL      Q       QS                      
     6    7 B L  H  X S+     0   0   27  230   61  A AAA AAA  AAA A AAAAA A AAAA AA      A       LL                      
     7    8 B R  H  X S+     0   0  110  233    4  R RRR RRR  RRR R RRRRR R RRRR RR      R       KR                      
     8    9 B Q  H  X S+     0   0  117  233   49  R RRR RRR  RRR R RRRRR R RRRR RR      R       KQ                      
     9   10 B E  H  X S+     0   0   78  234    8  E EED EEE  DDE E DDDDD E DDDD ED      E       EE                      
    10   11 B A  H  X S+     0   0    1  234    8  A AAA AAA  AAA A AAAAA A AAAA AA      A       AA                      
    11   12 B E  H  X S+     0   0  121  234    8  E EEE DDE  EEE E EEEEE D EEEE DE      E       EE                      
    12   13 B Q  H  X S+     0   0  111  238   70  G GNA SGN  AAS G VNASS G AAAA GA      T       SS                      
    13   14 B L  H  X S+     0   0   14  238    4  L LLL LLL  LLL L MLLMM L LLLL LL      L       LL                      
    14   15 B K  H  X S+     0   0   99  238   24  K KKK KKK  KKK K KKKKK K KKKK KK      K       KK                      
    15   16 B N  H  X S+     0   0   33  239   51  E DAD EDD  DDD D EDDEE E DDDDNDD      D       EN                      
    16   17 B Q  H  X S+     0   0   82  239   58  K RRR KKR  RRR R QKRQQ K RRRRSKR      R       KA                      
    17   18 B I  H  X S+     0   0    7  240    4  I III ILI  III I IIIII I IIIIAII      I       II                      
    18   19 B R  H  X S+     0   0  135  242   52  K KKK RRK  KKK K RKKRR R KKKKRRK      K       MR                      
    19   20 B D  H  X S+     0   0   85  244   60  R RAR AAR  RRR R TRRAA A RRRRGAR      R       ED                      
    20   21 B A  H  X S+     0   0   36  243   62  K RKK KAK  KKK K NKKNN A KKKKSAK      K       AA                      
    21   22 B R  H >X S+     0   0   22  244   22  K KKK KRK  KKK K RKKRR R KKKKRRK      K       QR                      
    22   23 B K  H 3< S+     0   0  136  244   50  D DED EDD  DDD D EDDDD E DDDDSED      D       KK                      
    23   24 B A  H 3< S+     0   0   79  244   56  E EEE AQD  EED E VEEVV Q EEEEVQE      E       AA                      
    24   25 B C  H << S+     0   0   19  244   85  L LLL TTL  LLL L MLLMM T LLLLVTL      L       VA                      
    25   26 B A     <  +     0   0   46  244   56  A AAA AAA  AAA A NAANN A AAAASAA      A       AC                      
    26   27 B D        +     0   0   88  243    0  D DDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
    27   28 B A        -     0   0   17  243   50  A TAT TTG  TTA T TTTTT T TTTTTTT      T       AT                      
    28   29 B T    >>  -     0   0   59  244   35  D SDT SST  TTT S STTTT S TTTTTST      T       SS                      
    29   30 B L  H 3> S+     0   0    0  244    3  L LLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
    30   31 B S  H 34 S+     0   0   38  244   90  R RRR RRS  RRM S KRRKK R RRRRERR      R       PL                      
    31   32 B Q  H X4 S+     0   0  119  247   50  Q EQD AAN  EDN Q VDDTT A DDDDEAD      T       EQ                      
    32   33 B I  H 3< S+     0   0   28  248   52  L VVV MMI  VVL V FVVFF M VVVVIMV      V       LA                      
    33   34 B T  T >< S+     0   0    0  249   56  A AAA AAA  AAA A TAATT A AAAAAAA      A       AA                      
    34   35 B N  T <  S+     0   0  129  249   72  K QKR ATR  RRR H RRRRR T RRRRKSR      Q       SA                      
    35   36 B N  T 3  S+     0   0  111  249   55  d neq EDs  qqa s DddDD E ddddTDd      q       KS                      
    36   37 B I  S <  S-     0   0   21  249   49  v tlt VTq  ttq t LvvLL T vvvvQTv      h       VL                      
    37   38 B D        -     0   0  138  249   32  E DEE EPE  EEE E PEEPP P EEEEPPE      E       EE                      
    38   39 B P        -     0   0   89  250   59  A PPQ TPA  AQA A NAANG P AAAAGPA      P       PP                      
    39   40 B V        -     0   0   23  251   30  L LLL LLL  LLL L LLLLL L LLLLILL      I       VI                      
    40   41 B G        -     0   0   54  251   45  P PPP PPP  PPP P PPPPP A PPPPNPP      P       GG                      
    41   42 B R        -     0   0  115  251    6  R RRR RRK  RRK R KRRKK R RRRRKRR      K       KR                      
    42   43 B I        +     0   0    8  251   27  T ITL IIn  LLN I lLLmm L LLLLLAL      n       II                      
    43   44 B Q        -     0   0   54  251   59  H GNA VTm  AAq G nTTgg Q TTTTLAT      l       QQ                      
    44   45 B M        -     0   0   11  252    5  M MMM MLM  MMm M iMMii L MMMMILM      M       LM                      
    45   46 B R        -     0   0   49  252   18  K RKK KKK  RKK K KKKKK K KKKKRKK      K       RR                      
    46   47 B T  E     +A  338   0A  12  252   43  Q PVT PAT  TTT P ITTVV I TTTTLAT      A       ST                      
    47   48 B R  E     +     0   0A  56  252   11  R RRK RRR  KKR R RKKRR R KKKKRRK      K       RR                      
    48   49 B R  E     -A  337   0A  60  252    9  K RKR RRK  RRK R RRRRR R RRRRLRR      R       RR                      
    49   50 B T  E     -A  336   0A  30  252   20  T NNT ATT  TTT N TTTNN T TTTTTTT      T       TT                      
    50   51 B L  E     -A  335   0A   0  252    0  L LLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
    51   52 B R        +     0   0  159  252   22  K KKK KKK  KKK K KKKKK K KKKKRKK      K       RR                      
    52   53 B G        +     0   0   20  252    0  G GGG GGG  GGG G GGGGG G GGGGGGG      G       GG                      
    53   54 B H        -     0   0    4  252    0  H HHH HHH  HHH H HHHHH H HHHHHHH      H       HH                      
    54   55 B L  S    S+     0   0  116  252    4  L LLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
    55   56 B A  S    S-     0   0    0  252    4  A AAA AAA  AAA A AAAAA A AAAASAA      A       AA                      
    56   57 B K        -     0   0   15  252    0  K KKK KKK  KKK K KKKKK K KKKKKKK      K       KK                      
    57   58 B I  E     -D   73   0B   0  252    1  I III III  III I IIIII I IIIIIII      I       II                      
    58   59 B Y  E     -     0   0B   6  252    4  Y YYY YYY  YYY Y YYYYY Y YYYYYYY      Y       YY                      
    59   60 B A  E     -D   72   0B  13  252    5  S AAA AAA  AAA A AAAAA A AAAAAAA      A       AA                      
    60   61 B M  E     -D   71   0B  15  252    4  M MMM MLM  MMM M MMMMM L MMMMLLM      M       MM                      
    61   62 B H  E     -D   70   0B  44  252    4  H HHH HHH  HHH H HHHHH Q HHHHHHH      H       HH                      
    62   63 B W  E     -D   69   0B  11  252    0  W WWW WWW  WWW W WWWWW W WWWWWWW      W       WW                      
    63   64 B G    >   -     0   0    3  252   43  S SSS AAS  SSS S ASSAA S SSSSAAS      S       GG                      
    64   65 B T  T 3  S+     0   0   75  252   58  T TTT AAT  TTT T ETTEE N TTTTGAT      T       SN                      
    65   66 B D  T 3  S-     0   0   80  252    1  D DDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
    66   67 B S  S <  S+     0   0    3  252   50  R RRR KTR  RRR R SRRNN R RRRRSTR      R       SS                      
    67   68 B R  S    S+     0   0   94  252   20  R RRR RRR  RRR R TRRVV R RRRRRRR      R       RR                      
    68   69 B L  E     + E   0  82B  31  252   80  H HHH HHH  HHH H HHHHH H HHHHNHH      H       NN                      
    69   70 B L  E     -DE  62  81B   0  252   12  L LLL LIL  LLL L LLLLL L LLLLVLL      L       LL                      
    70   71 B L  E     -DE  61  80B   0  252    3  V VVV VVV  VVV V VVVVV V VVVVVVV      V       VV                      
    71   72 B S  E     -DE  60  79B   0  252    1  S SSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
    72   73 B A  E     -DE  59  78B   0  252    1  A AAA AAA  AAA A AAAAA A AAAAAAA      A       AA                      
    73   74 B S  E >>  -DE  57  77B   0  252    1  S SSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
    74   75 B Q  T 34 S+     0   0    1  252    1  Q QQQ QQQ  QQQ Q QQQQQ Q QQQQQQQ      Q       QQ                      
    75   76 B D  T 34 S-     0   0    9  252    1  D DDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
    76   77 B G  T <4 S+     0   0    7  252    1  G GGG GGG  GGG G GGGGG G GGGGGGG      G       GG                      
    77   78 B K  E  <  -EF  73  93B  52  252    7  K KKK KKK  KKK K KKKKK K KKKKKRK      K       KK                      
    78   79 B L  E     -EF  72  92B   0  252    2  L LLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
    79   80 B I  E     -EF  71  91B   0  252    3  I III III  III I LIILL I IIIIMII      I       II                      
    80   81 B I  E     -EF  70  90B   0  252   16  I III VVI  III I VIIVV V IIIIIVI      I       VV                      
    81   82 B W  E     -EF  69  88B   0  252    0  W WWW WWW  WWW W WWWWW W WWWWWWW      W       WW                      
    82   83 B D  E >>> -EF  68  87B  21  252    2  D DDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
    83   84 B S  T 345S+     0   0    0  252   52  A AAA AAA  AAA A GAAGG A AAAASAA      A       AS                      
    84   85 B Y  T 345S+     0   0   57  251   17  Y YYY YYY  YYY Y LYYLL Y YYYYFYY      Y       YH                      
    85   86 B T  T <45S-     0   0   56  252    5  T TTT TTT  TTT T TTTTT T TTTTTST      T       TT                      
    86   87 B T  T  <5 +     0   0   43  252    4  T TTT TTT  TTT T TTTTT T TTTTTTT      T       ST                      
    87   88 B N  E   < -F   82   0B  99  252    4  N NNN NNN  NNN N NNNNN N NNNNNNN      N       nN                      
    88   89 B K  E     +F   81   0B  95  249    1  K KKK KKK  KKK K KKKKK K KKKKKKK      K       vK                      
    89   90 B V  E    S+     0   0B  66  249   17  V VVV VVV  VVV V VVVVV V VVVVIVV      V       VV                      
    90   91 B H  E     -F   80   0B  57  249    2  H HHH HHH  HHH H HHHHH H HHHHHHH      H       HH                      
    91   92 B A  E     -F   79   0B  43  251    0  A AAA AAA  AAA A AAAAA A AAAAAAA      A       AA                      
    92   93 B I  E     -F   78   0B   0  252    0  IIIII III  III I IIIII I IIIIIVI      I       II                      
    93   94 B P  E     -F   77   0B  80  252    4  PPPPP PPP  PPP P PPPPP P PPPPPPP      P       PP                      
    94   95 B L        -     0   0   26  252    0  LLLLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
    95   96 B R  S    S+     0   0  190  252    6  RRRRR RRR  RRR R RRRRR R RRRRRRR      R       RR                      
    96   97 B S        -     0   0   17  252    3  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
    97   98 B S  S    S+     0   0    6  252    3  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
    98   99 B W        +     0   0    2  252    0  WWWWW WWW  WWW W WWWWW W WWWWWWW      W       WW                      
    99  100 B V  E     -G  115   0C   4  252    0  VVVVV VVV  VVV V VVVVV V VVVVVVV      V       VV                      
   100  101 B M  E     +     0   0C   5  252    0  MMMMM MMM  MMM M MMMMM M MMMMMMM      M       MM                      
   101  102 B T  E     -G  114   0C   8  252    0  TTTTT TTT  TTT T TTTTT T TTTTTTT      T       TT                      
   102  103 B C  E     -G  113   0C   0  252    1  CCCCC CAC  CCC C CCCCC C CCCCCVC      C       CC                      
   103  104 B A  E     -G  112   0C   0  252    3  AAAAA AAA  AAA A AAAAA A AAAAAAA      A       SA                      
   104  105 B Y  E     -G  111   0C   9  252    2  YYYYY YYY  YYY Y YYYYY Y YYYYLYY      Y       FY                      
   105  106 B A    >   -     0   0    0  252   22  AAAAS SAA  SSA A SSSSS S SSSSAAS      A       AA                      
   106  107 B P  T 3  S+     0   0   64  252    3  PPPPP PPP  PPP P PPPPP P PPPPDPP      P       PP                      
   107  108 B S  T 3  S-     0   0   47  252    6  SSSSS SSS  SSS S TSSTT S SSSSSSS      S       SS                      
   108  109 B G  S <  S+     0   0    8  252    6  GGGGG GGG  GGG G AGGAA G GGGGGGG      G       GG                      
   109  110 B N  S    S+     0   0   50  252   22  NNNNN NNN  NNN N NNNNN Q NNNNDAN      N       NS                      
   110  111 B Y  E     - H   0 124C  50  252   13  YYYFY FLY  YYY Y FYYFF Y YYYYYFY      Y       FY                      
   111  112 B V  E     -GH 104 123C   0  252    0  VVVVV VVV  VVV V VVVVV V VVVVVVV      V       VV                      
   112  113 B A  E     +GH 103 122C   0  252    2  AAAAA AAA  AAA A AAAAA S AAAAAAA      A       AA                      
   113  114 B C  E     +GH 102 121C   5  252    2  CCCCC CCC  CCC C CCCCC C CCCCCCC      C       CC                      
   114  115 B G  E     +GH 101 120C   1  252    0  GGGGG GGG  GGG G GGGGG G GGGGGGG      G       GG                      
   115  116 B G  E >  S-G   99   0C   0  252    0  GGGGG GGG  GGG G GGGGG G GGGGGGG      G       GG                      
   116  117 B L  T 3  S+     0   0    1  252    0  LLLLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
   117  118 B D  T 3  S-     0   0   50  252    0  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
   118  119 B N  S <  S+     0   0   30  252    0  NNNNN NNN  NNN N NNNNN N NNNNNNN      N       NN                      
   119  120 B I  E     - I   0 139C  39  252   24  IIIII IVI  III I IIIII I IIIITVI      I       VM                      
   120  121 B C  E     -HI 114 138C   0  252    3  CCCCC CCC  CCC C CCCCC C CCCCCCC      C       CC                      
   121  122 B S  E     -HI 113 137C   9  252    6  SSSSS SSS  SSS S SSSSS T SSSSTSS      S       TS                      
   122  123 B I  E     -HI 112 136C   0  252    2  VIIVI III  III I IIIII I IIIIVVI      I       VI                      
   123  124 B Y  E     -H  111   0C   3  252    0  YYYYY YYY  YYY Y YYYYY Y YYYYYYY      Y       YY                      
   124  125 B N  E     +H  110   0C  24  252   40  NNNNN NSN  NNN N NNNNN S NNNNNAN      N       SN                      
   125  126 B L        +     0   0   11  252    1  LLLLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
   126  127 B K  S    S+     0   0  109  252   43  SKSSS RRN  SSN S RSSRR R SSSSRAS      N       KK                      
   127  128 B T  S    S-     0   0   64  252   55  ATSTA sgs  AAs S SAASS g AAAALPA      q       ST                      
   128  129 B R  S    S+     0   0  267  250   17  RRRRR epr  RRr R RRRRR q RRRRR.R      r       RR                      
   129  130 B E  S    S-     0   0  173  251    9  DEEDE GGE  EED D EEEEE A EEEEE.E      D       EE                      
   130  131 B G        -     0   0   50  252   11  GGGGG gGG  GGG G VGGVQ g GGGGsgG      G       GG                      
   131  132 B N        +     0   0   30  252   52  PNPPP sQP  PPP P PPPPP q PPPPhqP      P       SN                      
   132  133 B V  S    S+     0   0   58  253   42  TVTTT VVT  TTT T ITTII V TTTTPAT      T       VV                      
   133  134 B R  S    S-     0   0  213  253   22  RRRRR KKR  RRR R RRRRR K RRRRKKR      R       KR                      
   134  135 B V        -     0   0   29  253   15  VVVVV GVV  VVV V VVVVV V VVVVVVV      V       AV                      
   135  136 B S  S    S-     0   0   43  253   48  ASAAA AAA  AAA A CAACC A AAAASRA      A       VS                      
   136  137 B R  E     -I  122   0C 105  253    7  RRRRR RRR  RRR R RRRRR R RRRRRRR      R       AR                      
   137  138 B E  E     -I  121   0C  75  253    3  EEEEE EEE  EEE E EEEEE E EEEEEEE      E       EE                      
   138  139 B L  E     +I  120   0C   1  252    1  LLLLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
   139  140 B A  E     +I  119   0C  61  252   57  SASSS SSS  SSS S NSSNN S SSSSPSS      S       VP                      
   140  141 B G        +     0   0   50  252   25  GGGGG AAG  GGG G SGGSS A GGGGGAG      G       GG                      
   141  142 B H        -     0   0    9  252    2  HHHHH HHH  HHH H HHHHH H HHHHHHH      H       HH                      
   142  143 B T  S    S+     0   0   64  252   42  STTSS SSS  SSS A TSSTT T SSSSNSS      A       NG                      
   143  144 B G  S    S-     0   0    0  252    2  GgGGG GGG  GGG G GGGGG G GGGGGGG      G       GG                      
   144  145 B Y        -     0   0    0  251    0  YyYYY YYY  YYY Y YYYYY Y YYYYYYY      Y       Y.                      
   145  146 B L  E     +J  160   0D   0  251    1  LLLLL LLL  LLL L LLLLL L LLLLLLL      L       L.                      
   146  147 B S  E     -     0   0D   3  251    0  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       S.                      
   147  148 B C  E     -J  159   0D   9  251    5  CCCCC CCC  CCC C CCCCC C CCCCCCC      C       C.                      
   148  149 B C  E     -J  158   0D   0  251    0  CCCCC CCC  CCC C CCCCC C CCCCCCC      C       C.                      
   149  150 B R  E     -J  157   0D  53  251    4  RRRRR RRR  RRR R RRRRR R RRRRRRR      R       R.                      
   150  151 B F  E     -J  156   0D  10  251    0  FFFFF FFF  FFF F FFFFF F FFFFFFF      F       F.                      
   151  152 B L  S    S-     0   0   26  251   24  LLVII III  III I LIILL I IIIILII      I       V.                      
   152  153 B D  S    S-     0   0   60  251   40  NDNNN NNN  NNN N NSSNN N SSSSRNS      N       D.                      
   153  154 B D  S    S+     0   0   60  251    2  DDDDD DDD  DDD D DDDDD D DDDDnDD      D       D.                      
   154  155 B N  S    S+     0   0   44  251   65  RNRRR RRR  RRR R RKKRR R KKKKgRK      R       H.                      
   155  156 B Q  E     + K   0 169D  60  251   47  RQRRR QQS  RRS K QRRQQ Q RRRRYQR      S       Q.                      
   156  157 B I  E     -JK 150 168D   0  251    1  IIIII III  III I IIIII I IIIIIII      I       I.                      
   157  158 B V  E     -JK 149 167D   0  251   22  LVILL VVL  LLL L VLLVV V LLLLIVL      L       V.                      
   158  159 B T  E     -JK 148 166D   0  251    1  TTTTT TTT  TTT T TTTTT T TTTTTTT      T       T.                      
   159  160 B S  E     -JK 147 165D   0  251    2  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       A.                      
   160  161 B S  E >   -J  145   0D   0  251    0  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       S.                      
   161  162 B G  T 3  S+     0   0    0  251    0  GGGGG GGG  GGG G GGGGG G GGGGGGG      G       G.                      
   162  163 B D  T 3  S-     0   0    5  251    0  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       D.                      
   163  164 B T  S <  S+     0   0    8  251   63  MTMMM MMM  MMM M MMMMM M MMMMTMM      M       T.                      
   164  165 B T        -     0   0    2  251   16  TTTTT TTT  TTT T STTTT T TTTTTTT      T       T.                      
   165  166 B C  E     -KL 159 179D   0  251    0  CCCCC CCC  CCC C CCCCC C CCCCCCC      C       C.                      
   166  167 B A  E     -KL 158 178D   0  252   62  MAMMV MMM  VVM M IVVII M VVVVGMV      M       A.                      
   167  168 B L  E     -KL 157 177D   6  252    6  LLLLL LLK  LLK M LLLLL L LLLLLLL      K       L.                      
   168  169 B W  E     -KL 156 175D   2  252    0  WWWWW WWW  WWW W WWWWW W WWWWWWW      W       W.                      
   169  170 B D  E >>> -KL 155 174D  37  252    0  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       D.                      
   170  171 B I  T 345S+     0   0    7  252    8  IIIII IIV  IIV I ILLVV I LLLLIIL      I       I.                      
   171  172 B E  T 345S+     0   0  144  252    6  DEEDE EEE  EEE E EEEEE E EEEEEEE      E       E.                      
   172  173 B T  T <45S-     0   0   78  252   36  TTSTT AQT  STT T NTTNN Q TTTTAQT      T       T.                      
   173  174 B G  T  <5 +     0   0   16  253    8  GGGGG GGG  GGG G GGGGG G GGGGAGG      G       KY                      
   174  175 B Q  E   < -L  169   0D 135  253   68  AQTAQ VTS  QQS S TSSTT I SSSSHTS      T       QL                      
   175  176 B Q  E     -L  168   0D  30  253   45  RQKKK RRK  KKK K KKKKK R KKKKCRK      K       QS                      
   176  177 B T  E     +     0   0D  64  253   73  ITVII VTV  IIV V IVVII V VVVVTTV      V       TC                      
   177  178 B T  E     -L  167   0D  20  253   47  TTTTT MMT  TTT T THHTT A HHHHRMH      I       TC                      
   178  179 B T  E     -L  166   0D   5  253   77  DTEEE EEE  EEE E EEEEE E EEEELEE      E       SR                      
   179  180 B F  E     +L  165   0D   1  253    0  FFFFF FFF  FFF F FFFFF F FFFFFFF      F       FF                      
   180  181 B T        +     0   0   34  253   72  ATASA SNA  AAA A SAASS Q AAAAENA      A       SL                      
   181  182 B G        +     0   0   37  253   30  DGDDD DDD  DDD D DDDDD D DDDDSDD      D       GD                      
   182  183 B H        -     0   0    7  253    0  HHHHH HHH  HHH H HHHHH H HHHHHHH      H       HD                      
   183  184 B T  S    S+     0   0   99  253   63  LTLLL TTL  LLL L NLLNN T LLLLTTL      L       CN                      
   184  185 B G  S    S-     0   0    0  253    1  GGGGG GGG  GGG G GGGGG G GGGGGGG      G       GQ                      
   185  186 B D        -     0   0    1  253    1  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       DI                      
   186  187 B V  E     -M  202   0E   0  253   22  VVVVV VVV  VVV V VVVVV V VVVVVVV      V       VV                      
   187  188 B M  E     +     0   0E   3  253    1  MMMMM MMM  MMM M MMMMM M MMMMMMM      M       MT                      
   188  189 B S  E     -M  201   0E  16  253    8  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
   189  190 B L  E     -M  200   0E   3  253   14  LLILL LII  LLI L VLLVV I LLLLVIL      I       LS                      
   190  191 B S  E     -M  199   0E  21  253   24  SSSSS SSS  SSS S SSSSS S SSSSDSS      S       AG                      
   191  192 B L  E     -M  198   0E  29  253   29  VLIII LLI  III I VIIIV L IIIIVLI      L       LH                      
   192  193 B A    >   -     0   0    4  253   57  NANNN GAN  NNN N SNNSS C NNNNTAN      N       SE                      
   193  194 B P  T 3  S+     0   0   85  253   13  PPPPP PPP  PPP P PPPPP P PPPPNPP      P       SS                      
   194  195 B D  T 3  S-     0   0   87  253   52  TDTTL NNT  LLT T DLLDD T LLLLDNL      T       DD                      
   195  196 B T  S <  S+     0   0   62  253   97  nSnnd QAn  ddn n KddKK d ddddNAd      n       MI                      
   196  197 B R  S    S+     0   0  142  252   61  nRnnn NNn  nnn n NnnNN n nnnnKNn      n       K.                      
   197  198 B L  E     - N   0 211E  37  252   71  ILVIQ VLT  QQT I YQQYY T QQQQVLQ      T       T.                      
   198  199 B F  E     -MN 191 210E   0  252    0  FFFFF FFF  FFF F FFFFF F FFFFFFF      F       F.                      
   199  200 B V  E     -MN 190 209E   0  252   11  VVVVV VVV  VVV V IVVII V VVVVIVV      I       V.                      
   200  201 B S  E     -MN 189 208E   0  252    0  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       S.                      
   201  202 B G  E     +MN 188 207E   0  252    0  GGGGG GGG  GGG G GGGGG G GGGGGGG      G       G.                      
   202  203 B A  E >   -M  186   0E   0  252    4  AAAAA AAA  AAA A AAAAA A AAAAAAA      A       A.                      
   203  204 B C  T 3  S+     0   0    5  252    2  CCCCC CCC  CCC C CCCCC C CCCCCCC      C       C.                      
   204  205 B D  T 3  S-     0   0   31  252    0  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       D.                      
   205  206 B A  S <  S+     0   0   20  252   16  AASAA AAA  AAA A AAAAA S AAAAAAA      S       K.                      
   206  207 B S  E     - O   0 222E   6  252   69  FSFFF TTF  FFF F TFFTT T FFFFSTF      F       T.                      
   207  208 B A  E     -NO 201 221E   0  252   35  AAAAA AAA  AAA A AAAAA A AAAAVAA      A       A.                      
   208  209 B K  E     -NO 200 220E  18  252    0  KKKKK KKK  KKK K KKKKK K KKKKKKK      K       K.                      
   209  210 B L  E     -NO 199 219E   2  252    8  LLLLL LVL  LLL L LLLLL I LLLLMVL      L       V.                      
   210  211 B W  E     -NO 198 217E   1  252    0  WWWWW WWW  WWW W WWWWW W WWWWWWW      W       F.                      
   211  212 B D  E >>> -NO 197 216E  11  252    1  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       S.                      
   212  213 B V  T 345S+     0   0   12  252   19  IVIVI III  IIV I IIILL I IIIIIII      I       I.                      
   213  214 B R  T 345S+     0   0  194  252    1  RRRRR RRR  RRR R RRRRR R RRRRRRR      R       S.                      
   214  215 B E  T <45S-     0   0  111  252   59  TEATQ STA  QQA S GQQSS I QQQQSTQ      A       D.                      
   215  216 B G  T  <5 +     0   0    8  252   25  GGGGQ GGG  QQG G GQQGG G QQQQGGQ      G       C.                      
   216  217 B M  E      -     0   0    1  252    0  FFFFF FFF  FFF F FFFFF F FFFFFFF      F       FF                      
   235  236 B P  T 3  S+     0   0   45  252    0  PPPPP PPP  PPP P PPPPP P PPPPPPP      P       PP                      
   236  237 B N  T 3  S-     0   0   42  252   27  DNDDN NND  NND D NNNNN N NNNNNNN      D       SN                      
   237  238 B G  S <  S+     0   0   12  252    8  GGGGG GGG  GGG G GGGGG G GGGGEGG      G       NG                      
   238  239 B N  S    S+     0   0   56  252   76  NNNNH DDH  NNH N LNNLL Q NNNNQDN      H       LQ                      
   239  240 B A  E     - Q   0 253F   0  252   11  AAAAA AAS  AAS A SAASS S AAAALAA      S       AA                      
   240  241 B F  E     -PQ 233 252F   0  252   16  FFFFF FFF  FFF F FFFFF F FFFFIFF      F       FF                      
   241  242 B A  E     -PQ 232 251F   0  252   51  GAGGG AAV  GGV G GGGGG A GGGGGAG      V       AA                      
   242  243 B T  E     -PQ 231 250F   0  252    0  TTTTT TTT  TTT T TTTTT T TTTTTTT      T       TT                      
   243  244 B G  E     +PQ 230 249F   0  252    0  GGGGG GGG  GGG G GGGGG G GGGGAGG      G       GG                      
   244  245 B S  E >   -P  228   0F   0  252    0  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
   245  246 B D  T 3  S+     0   0   13  252    0  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
   246  247 B D  T 3  S-     0   0   28  252    0  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
   247  248 B A  S <  S+     0   0    6  252   12  AATAA AAA  AAA A AAAAA A AAAAAAA      A       TA                      
   248  249 B T        -     0   0   16  252   42  TTTTS SST  SST S SSSSS T SSSSTSS      T       TT                      
   249  250 B C  E     -QR 243 263F   0  252    3  CCCCC CCC  CCC C CCCCC C CCCCCCC      C       CC                      
   250  251 B R  E     -QR 242 262F  23  252    3  RRRRR RKR  RRR R RRRRR K RRRRRKR      R       RR                      
   251  252 B L  E     -QR 241 261F   0  252    0  LLLLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
   252  253 B F  E     -QR 240 259F   1  251    0  FFFFF FFF  FFF F FFFFF F FFFFFFF      F       FF                      
   253  254 B D  E  >> -QR 239 258F   1  251    0  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
   254  255 B L  T >45S+     0   0   15  251   26  ILIII ILI  III I IIIII L IIIIILI      I       II                      
   255  256 B R  T 345S+     0   0   57  251    0  RRRRR RRR  RRR R RRRRR R RRRRRRR      R       RR                      
   256  257 B A  T 345S-     0   0    0  251    8  AAAAA AAA  AAA A AAAAA S AAAAAAA      A       SA                      
   257  258 B D  T <<5 +     0   0    0  251    0  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
   258  259 B Q  E      -     0   0  119  253   47  SHSSI HHS  IIH N HIIHH H IIIILHI      S       NH                      
   266  267 B D  T 3  S+     0   0  161  253   25  EDDDG DDE  GGE E DPPDD D PPPPDDP      E       DD                      
   267  268 B N  T 3  S+     0   0   66  253   48  QNQQE HNA  EES Q NEENN N EEEESNE      S       GN                      
   268  269 B I    <   +     0   0   23  253   21  IIVIP III  PPI V IPPII I PPPPIIP      I       NI                      
   269  270 B I        +     0   0   97  253   31  LILLV LLL  VVL L LVVLL L VVVVILV      L       EI                      
   270  271 B C  S    S-     0   0   10  253    6  CCCCC CCC  CCC C CCCCC C CCCCCRC      C       CC                      
   271  272 B G        -     0   0    1  253    0  GGGGG GGG  GGG G GGGGG G GGGGGGG      G       GG                      
   272  273 B I  E     +S  288   0G   0  253    1  IIIII III  III I IIIII I IIIIIII      I       VI                      
   273  274 B T  E     +     0   0G  13  253    4  TTTTT TTT  TTT T TTTTT T TTTTTTT      T       TT                      
   274  275 B S  E     +S  287   0G  18  252    0  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
   275  276 B V  E     +S  286   0G  10  252    5  VVVVV VVV  VVV V VVVVV V VVVVIVV      V       VV                      
   276  277 B S  E     -S  285   0G  15  252   21  ASAAA AAA  AAA A GAAGG S AAAAQAA      A       GA                      
   277  278 B F  E     -S  284   0G  12  252   13  FFFFF FFT  FFC F FFFFF F FFFFFFF      T       FF                      
   278  279 B S        -     0   0    3  252    1  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
   279  280 B K  S    S+     0   0  104  252   80  VKVVV IIV  VVV V IVVYF I VVVVLIV      V       SK                      
   280  281 B S  S    S-     0   0    2  252    0  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
   281  282 B G  S    S+     0   0    0  252    0  GGGGG GGG  GGG G GGGGG G GGGGGGG      G       GG                      
   282  283 B R        +     0   0    8  252    0  RRRRR RRR  RRR R RRRRR R RRRRRRR      R       RR                      
   283  284 B L  E     - T   0 297G   0  252   11  LLLLL LVL  LLL L FLLFF M LLLLMVL      L       LL                      
   284  285 B L  E     -ST 277 296G   0  252    3  LLLLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
   285  286 B L  E     -ST 276 295G   0  252   13  FLFFF FFF  FFF F FFFFF F FFFFFFF      F       FL                      
   286  287 B A  E     -ST 275 294G   0  252   11  AAAAA GAA  AAA A AAAAA A AAAAAAA      A       AA                      
   287  288 B G  E     -ST 274 293G   2  252    4  GGGGG GGG  GGG G GGGGG G GGGGGGG      G       GG                      
   288  289 B Y  E >   -S  272   0G   4  252    0  YYYYY YYY  YYY Y YYYYY Y YYYYYYY      Y       YY                      
   289  290 B D  T 3  S+     0   0    3  252    3  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
   290  291 B D  T 3  S-     0   0   37  252    1  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
   291  292 B F  S <  S+     0   0    3  252    3  FFYFF WYF  FFF F FFFFF Y FFFFFYF      F       FF                      
   292  293 B N        -     0   0   15  252   39  ENEEE TNE  EEE E SEETT N EEEENNE      E       KN                      
   293  294 B C  E     -TU 287 307G   0  252    5  CCCCC CCC  CCC C CCCCC T CCCCCCC      C       VC                      
   294  295 B N  E     -TU 286 306G   5  252   32  KNKKK NNK  KKK K NKKNN N KKKKQNK      K       QN                      
   295  296 B V  E     -TU 285 305G   0  252    9  VVVVV VVV  VVV V VVVVV V VVVVVVV      V       LV                      
   296  297 B W  E     -TU 284 303G   6  252    0  WWWWW WWW  WWW W WWWWW W WWWWWWW      W       FW                      
   297  298 B D  E  >  -T  283   0G   4  252    0  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
   298  299 B A  T  4 S+     0   0    0  252   64  VAVVV TTI  TVI T TVVTT T VVVVTTV      I       ST                      
   299  300 B L  T  4 S+     0   0    0  252   11  LLLLL LLT  LLT L LLLLL L LLLLLLL      T       IM                      
   300  301 B K  T  4 S-     0   0   29  252   17  RKRRR KKR  RRR R KRRKK K RRRRKKR      R       KK                      
   301  302 B A  S  < S+     0   0   17  252   42  GAGGG GGG  GGA G GGGGG G GGGGQGG      G       LA                      
   302  303 B D  S    S-     0   0   95  252   20  EDEEE EEE  EEE E EEEEE E EEEEDEE      D       EE                      
   303  304 B R  E     -U  296   0G  69  252   15  KRKRR RRK  RRK K RRRRR R RRRRRRR      K       KR                      
   304  305 B A  E     -     0   0G  14  252   58  VAVVV VIV  VVV V IVVVV V VVVVIIV      V       AS                      
   305  306 B G  E     -U  295   0G   4  252    5  GGGGG GGG  GGG G VGGLL G GGGGGGG      G       GG                      
   306  307 B V  E >   -U  294   0G   7  252   45  VVSTT VVS  TTS A STTSS V TTTTVVT      S       QI                      
   307  308 B L  E >  S+U  293   0G   2  251    1  LLLLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
   308  309 B A  G >  S-     0   0    4  251   52  AASSQ TAV  QQV S TQQTT Q QQQQAAQ      V       LA                      
   309  310 B G  G <   -     0   0    4  251    5  GGGGG GGG  GGG G GGGGG G GGGGSGG      G       GG                      
   310  311 B H  G <  S+     0   0    8  251    0  HHHHH HHH  HHH H HHHHH H HHHHHHH      H       HH                      
   311  312 B D    <   -     0   0   26  251   18  EDEDD EED  DDD E GDDGG D DDDDDED      E       ED                      
   312  313 B N  S    S+     0   0   31  251    0  NNNNN NNN  NNN N NNNNN N NNNNNNN      N       NN                      
   313  314 B R        +     0   0   40  251    1  RRRRR RRR  RRR R RRRRR R RRRRRRR      R       RR                      
   314  315 B V        +     0   0    2  251    1  VVVVV VVV  VVV V VVVVV V VVVVVIV      V       VV                      
   315  316 B S  S    S-     0   0    2  251    2  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
   316  317 B C  E     -B  329   0A  10  251    6  CCCCC CCC  CCC C CCCCC C CCCCCCC      C       CC                      
   317  318 B L  E     -B  328   0A  15  250    4  LLLLL LML  LLL L LLLLL L LLLLLML      L       LL                      
   318  319 B G  E     -B  327   0A  10  250    3  GGGGG GGG  GGG G GGGGG G GGGGGGG      G       GG                      
   319  320 B V  E     -B  326   0A  25  250    0  VVVVV VVV  VVV V VVVVV V VVVVVVV      V       VV                      
   320  321 B T    >   -     0   0    3  250   47  STSSS SSS  SSS S SSSPP S SSSSSSS      S       TT                      
   321  322 B D  T 3  S+     0   0   98  250   64  NDNNN TGN  NNN N VNNTT G NNNNKGN      N       EE                      
   322  323 B D  T 3  S-     0   0   51  249    7  DDDDD DDD  DDD D DDDDD D DDDDNDD      D       SN                      
   323  324 B G  S <  S+     0   0    0  249    5  GGGGA GGG  AAG G GAAGG G AAAAGGA      G       GG                      
   324  325 B M  S    S+     0   0   36  249   20  IMIIM MVM  MMM I MLLMM I LLLLEVL      I       NM                      
   325  326 B A        -     0   0    0  249   24  SASSS AAS  SSS S ASSAA A SSSSAAS      S       AA                      
   326  327 B V  E     -BC 319 338A   0  248   33  LVLLL LLL  LLL L LLLLL L LLLLLLL      L       LV                      
   327  328 B A  E     -BC 318 337A   0  247   47  CACCC CCC  CCC C CCCCC A CCCCCCC      C       AA                      
   328  329 B T  E     -BC 317 336A   7  247    1  TTTTT TTT  TTT T TTTTT T TTTTTTT      T       TT                      
   329  330 B G  E     -BC 316 335A   1  247    2  GGGGG GGG  GGG G GGGGG G GGGGGGG      G       GG                      
   330  331 B S    >   -     0   0    6  247    0  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
   331  332 B W  T 3  S+     0   0    6  247    0  WWWWW WWW  WWW W WWWWW W WWWWWWW      W       WW                      
   332  333 B D  T 3  S-     0   0   17  247    0  DDDDD DDD  DDD D DDDDD D DDDDDDD      D       DD                      
   333  334 B S  S <  S+     0   0   12  247    2  SSSSS SSS  SSS S SSSSS S SSSSSSS      S       SS                      
   334  335 B F        -     0   0   78  247   39  FFLLM TLL  MML L LMMLL L MMMMTLM      L       VF                      
   335  336 B L  E     -AC  50 329A   1  247    3  LLLLL LLL  LLL L LLLLL L LLLLLLL      L       LL                      
   336  337 B K  E     -AC  49 328A  60  246   25  RKKKR RKK  RRK K KRRKK K RRRRKKR      K       KR                      
   337  338 B I  E     -AC  48 327A   0  244   10  IIIVI VVI  IVL I IIIII I IIIIIVI      I       IV                      
   338  339 B W  E      AC  46 326A   2  243    0  WWWWW WWW  WWW W WWWWW W WWWWWWW      W       WW                      
   339  340 B N              0   0   10  236   46  ANAAA ASA  AAS A AAAAA S AAAANSA      A       NN                      
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   85    5                          P                  PP                         
   342    3 G V        +     0   0   96   88   62                          A                  II                         
   343    4 G I        -     0   0   38   92   33                          L                  II                         
   344    5 G N    >   -     0   0  109   92   65                          H                  DD                         
   345    6 G I  G >  S+     0   0   25   93   47                          I                  VV                         
   346    7 G E  G 3  S+     0   0  122  138   45            Q   Q         E        QQQQQ QQQQEEQ   QQ QQQQQQQQ QQQQ    Q
   347    8 G D  G <  S+     0   0  133  149   28            E   D         D       DDDDDD EEDENNE   DD DDDDDDDD DDED   DD
   348    9 G L    <   -     0   0   35  155   20       L    L   M         L       MLLLMM LLLLMML   LL LLLLLLLL LLLL   LL
   349   10 G T     >  -     0   0   69  156   61       T    S   T         P       TSSSTT SSSSTTS   SS SSSSSSSS TSSS   SS
   350   11 G E  H  > S+     0   0  116  160   37       E    E   E         E       EEEEEE EEEEDDE   EE EEEEEEEE EEEE   EE
   351   12 G K  H >> S+     0   0   66  165   48       K    K   K         K       KKKKKK KKKKLLK   KK KKKKKKKK KRKK   KK
   352   13 G D  H 3> S+     0   0   39  166   39       E    D   E         E       EEEDDE EEEEDDE   DD DDEDDDDD EEEE   EE
   353   14 G K  H 3X S+     0   0   83  166   83       L    L   L         K       LLLLLL LLLLKKI   LL LLLLLLLL LLLL   LL
   354   15 G L  H < S+     0   0    7  249    4       E    E   E         E       EEEEEE EEEEEEE   EE EEEEEEEE EEEE   EE
   365   26 G V  H 3< S+     0   0   43  249   53       V    V   V         V       VVVVVV VVVVVVV   VV VVVVVVVV VVVV   VM
   366   27 G T  T 3< S+     0   0  116  249   83       K    K   K         K       KKKKKK KKKKKKK   KK KKTKKKKK KKKK   QK
   367   28 G L    <   -     0   0   49  249   60       N    N   N         L       NNNNTN NNNNLLN   NN NNNNNNNN NNNN   NN
   368   29 G E        -     0   0  191  249   51       E    P   E         Q       EPPTEE PPPPEEP   TT TTPTTTTT EPPT   PP
   369   30 G R        -     0   0   32  249    0       R    R   R         R       RRRRRR RRRRRRR   RR RRRRRRRR RRRR   RR
   370   31 G M        -     0   0   53  249   83       S    T   Q         Q       QDDIIQ AADAAAA   II IIAIIIII QDTL   AD
   371   32 G L     >  -     0   0   75  248   80       M    L   M         .       MLPPMM LLLLKKL   PP PPPPPPPP MLPP   PP
   372   33 G V  H  > S+     0   0    4  248   13       I    I   V         .       VIIVVV IIIIVVI   II IIIIIIII IIII   II
   373   34 G S  H  > S+     0   0   14  248    1       S    S   S         .       SSSSSS SSSSSSS   SS SSSSSSSS SSSS   SS
   374   35 G K  H  > S+     0   0   93  248   37       K    K   K         .       KKKKKK KKKKKKK   KK KKKKKKKK KKKK   KK
   375   36 G C  H  X S+     0   0    0  249   61       T    T   T         Q       TTTAST TTTTCCT   AA AATAAAAA TTTT   TT
   376   37 G C  H  X S+     0   0    0  249   62       G    G   G         A       GGGGIA GGGGCCG   GG GGGGGGGG GGGG   GG
   377   38 G E  H  X S+     0   0   75  249   68       K    K   K         K       KKKKPK KKKKEEK   KK KKKKKKKK KKKK   KK
   378   39 G E  H  X S+     0   0   60  249   24       E    E   E         E       EEEEEE EEEEEEE   EE EEEEEEEE EEEE   DE
   379   40 G F  H  X S+     0   0    3  249   35       L    I   I         I       LIIIIL IIIIIII   II IIIIIIII LIII   II
   380   41 G R  H  X S+     0   0   53  249   79       K    K   K         K       KKKKKK KKKKTTK   KK KKKKKKKK KKKK   RK
   381   42 G D  H  X S+     0   0   67  249   66       D    D   E         N       EDDESD DDDDEED   EE EEDEEEEE EDDE   ED
   382   43 G Y  H  X S+     0   0   43  249    2       Y    Y   Y         Y       YYYYYY YYYYYYY   YY YYFYYYYY YYYY   YY
   383   44 G V  H >X S+     0   0    0  249   58       V    V   V         I       IVVVII VVVVIIV   VV VVVVVVVV IVVV   VV
   384   45 G E  H 3X S+     0   0   71  249   48       E    E   E         E       EEEEEE EEEEQQE   EE EEEEEEEE EEEE   EE
   385   46 G E  H 3< S+     0   0  125  249   57       A    A   S         E       SAAASS AAAAGGA   AA AAAAAAAA SAAA   AA
   386   47 G R  H XX S+     0   0   94  249   68       H    E   M         R       MQQQHM EEQEGGE   QQ QQQQQQQQ MQEE   QQ
   387   48 G S  H >< S+     0   0   12  249   68       A    A   A         S       AASAMA AAAAAAA   AA AAAAAAAA AAAA   AA
   388   49 G G  T 3< S+     0   0   38  249   78       G    G   G         R       GGGGSP GGGGDDG   GG GGVGGGGG AGGG   GG
   389   50 G E  T <4 S+     0   0  138  248   52       D    N   E         E       ETTNEE NNTNEEN   NN NNNNNNNN ETNN   NA
   390   51 G D    XX> -     0   0    1  248    0       D    D   D         D       DDDDDD DDDDDDD   DD DDDDDDDD DDDD   DD
   391   52 G P  H 3>5S+     0   0   17  249   27       P    P   P         P       PPPPPP PPPPPPP   PP PPPPPPPP PPPP   PP
   392   53 G L  H 345S+     0   0    6  249    3       L    L   L         L       LLLFLF LLLLLLL   FF FFLFFFFF LLLL   LL
   393   54 G V  H <45S+     0   0   24  249   30       L    L   L         V       LLLIVL LLLLVVL   LL LLLLLLLL LLLL   LL
   394   55 G K  H  <5S-     0   0  149  249   78       K    K   K         K       KKKKKK KKKKKKK   KK KKKKKKKK KKKK   KK
   395   56 G G     << -     0   0   38  249   34       G    G   G         G       GGGGGG GGGGGGG   GG GGGGGGGG GGGG   GG
   396   57 G I        -     0   0   21  249   27       I    I   V         I       VIIIVI IIIIIII   II IIIIIIII VIVV   II
   397   58 G P    >>  -     0   0   80  249   19       P    P   P         P       PPPPPP PPPPPPP   PP PPPPPPPP PPPP   PP
   398   59 G E  T 34 S+     0   0   75  249   62       E    E   E         E       EEEEEE EEEEEEE   EE EEEEEEEE EEEE   ED
   399   60 G D  T 34 S+     0   0  151  249   60       D    D   D         D       DDDDDD DDDDEED   DD DDDDDDDD DDDD   DD
   400   61 G K  T <4 S+     0   0  163  249   65       K    K   K         K       KKKKKK KKKKKKK   KK KKKKKKKK KKKK   RK
   401   62 G N     <  -     0   0    1  249    0       N    N   N         N       NNNNNN NNNNNNN   NN NNNNNNNN NNNN   NN
   402   63 G P  S    S+     0   0   36  249    0       P    P   P         P       PPPPPP PPPPPPP   PP PPPPPPPP PPPP   PP
   403   64 G F  S    S-     0   0    3  249    1       F    F   F         F       FFFFFF FFFFFFF   FF FFFFFFFF FFFF   FF
   404   65 G K              0   0  108  247   34       K    K   K         K       KKKKKK KKKKKKK   KK KKKKKKKK KKKK   KK
   405   66 G E              0   0  201  242    3       E    E   E         E       EEEEEE EEEEEEE   EE EEEEEEEE EEEE   EE
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   54   14           F      F                               F           F         
   408   14 P E        +     0   0  153  148   31           E      E                               E           D         
   409   15 P G  S    S+     0   0   38  151   33           G      G                               G           G         
   410   16 P Q  S    S-     0   0   94  155   93           Q      Q     E                         Q           P    EP   
   411   17 P A        +     0   0    1  157   48           A      A     A                         A           A    AAA  
   412   18 P S        +     0   0   28  161   65           T      S     I                         T           M    TTT  
   413   19 P H  S    S+     0   0   42  167   41           H      H     H                         H  H        N    HQQ  
   414   20 P T  S  > S-     0   0    2  172    0           T      T     T                         T  T        T    TTT  
   415   21 P G  H  > S-     0   0   10  177    0           G      G     G                         g  G        G    GGG  
   416   22 P P  H  > S+     0   0   14  183    0           P      P     P                         p  P        P    PPP  
   417   23 P K  H  > S+     0   0    6  183    0           K      K     K                         N  K        K    KKK  
   418   24 P G  H  X S+     0   0    0  183    0           G      G     G                         C  G        G    GGG  
   419   25 P V  H  X S+     0   0    0  183    0           V      V     V                         V  V        V    VVV  
   420   26 P I  H  X S+     0   0    4  183   16           I      I     I                         I  I        I    III  
   421   27 P N  H  X S+     0   0   48  183   44           N      S     N                         N  H        N    HHH  
   422   28 P D  H  X S+     0   0   14  184    0           D      D     D                         D  D        D    DDD  
   423   29 P W  H  X S+     0   0    6  184    0           W      W     W                         W  W        W    WWW  
   424   30 P R  H  < S+     0   0   67  184   27           R      R     R                         R  R        R    RRR  
   425   31 P K  H >X S+     0   0   67  184   36           K      K     K                         K  K        K    KKK  
   426   32 P F  H >X>S+     0   0    1  184    2           F      F     F                         F  F        F    FFF  
   427   33 P K  H 3<5S+     0   0   30  184    8           K      K     K                         K  K        K    KKK  
   428   34 P L  H <45S+     0   0  139  179    1           L      L     L                         L  L        L    LLL  
   429   35 P E  H <<5S+     0   0   86  179   10           E      E     E                         Q  I        E    EEE  
   430   36 P S  T  <5       0   0   57  180   65           s      s     a                         s  s        s    sss  
   431   37 P E      <       0   0  118  186   66           r      r     r                         r  k        r    ikk  
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  161   42           F      F     F                         F  L        F    RVV  
   434   69 P S        +     0   0   52  162   66           S      C     S                         C  S        S    KNN  
   435   70 P R        -     0   0  103  127   86           R      R     R                         R  R        R    MRR  
   436   71 P K        +     0   0   22  130   11           K      K     K                         K  K        K    SKK  
   437   72 P M  S    S-     0   0   12  131   13           M      M     M                         M  M        M    MMM  
   438   73 P S     >  -     0   0   52  139   66           S      S     S                         S  S        S    QSS  
   439   74 P V  H  > S+     0   0  107  138   53           M      M     M                         M  M        M    .VV  
   440   75 P Q  H  > S+     0   0  133  139   51           Q      Q     Q                         Q  Q        Q    .QQ  
   441   76 P E  H  > S+     0   0   38  145   27           E      E     E                         E  E        E    EEE  
   442   77 P Y  H  X S+     0   0   36  157   63           Y      Y     Y                         Y  Y        Y    YYY  
   443   78 P E  H  < S+     0   0  111  165   67           E      E     E                         E  E        E    EEE  
   444   79 P L  H >X S+     0   0   45  167   54           L      L     I                         L  L        L    IMM  
   445   80 P I  H 3< S+     0   0   37  170   72           I      I     I                         I  I        T    III  
   446   81 P H  T 3< S+     0   0  178  170   77           H      H     N                         H  N        Q    NQQ  
   447   82 P K  T <4 S+     0   0  140  169   68           D      A     D                         A  D        .    DEE  
   448   83 P D     <  -     0   0   58  188   39           E      T     D                         A  K        G    GEE  
   449   84 P K        -     0   0  205  170   80           Q      Q     K                         Q  .        K    K.D  
   450   85 P E        -     0   0   45  171   68           E      E     E                         E  E        E    E.E  
   451   86 P D    >>  -     0   0   87  189   32           D      D     D                         D  D        D    DDQ  
   452   87 P E  H 3> S+     0   0  113  188   12           E      E     E                         E  E        E    EE.  
   453   88 P N  H 3> S+     0   0   73  189   59           S      S     S                         S  H        N    TQ.  
   454   89 P C  H <> S+     0   0   32  190   71           C      C     C                         C  C        C    CCC  
   455   90 P L  H  X S+     0   0    4  190    2           L      L     L                         L  L        L    LLL  
   456   91 P R  H  X S+     0   0  131  190   62           R      Q     R                         Q  K        R    RRR  
   457   92 P K  H  X S+     0   0  112  190   60           K      Q     K                         Q  K        K    KKK  
   458   93 P Y  H  X S+     0   0    7  190    6           Y      Y     Y                         Y  Y        Y    YYY  
   459   94 P R  H  X S+     0   0   31  190   33           R      R     R                         R  R        R    QRR  
   460   95 P R  H  X S+     0   0  130  190   46           K      K     K                         K  K        K    KKK  
   461   96 P Q  H  X S+     0   0   96  190   33           R      R     R                         R  Q        Q    RQQ  
   462   97 P C  H  X S+     0   0   22  190   71           C      C     C                         C  C        S    CCC  
   463   98 P M  H  X S+     0   0   33  190   10           M      M     M                         M  M        M    MMM  
   464   99 P Q  H  X S+     0   0  115  190   54           Q      Q     Q                         Q  H        Q    LQQ  
   465  100 P D  H  X S+     0   0   46  190   21           D      D     D                         D  D        E    DDD  
   466  101 P M  H  X S+     0   0   23  190    2           M      M     M                         M  M        M    MMM  
   467  102 P H  H  X S+     0   0   64  190   74           H      H     H                         H  H        H    HHH  
   468  103 P Q  H  < S+     0   0  143  190   60           Q      Q     Q                         Q  Q        Q    QEE  
   469  104 P K  H  < S+     0   0  140  190   57           R      R     R                         R  R        K    RRR  
   470  105 P L  H  < S+     0   0   35  190   44           L      L     L                         L  L        L    LLL  
   471  106 P S     <  -     0   0   75  190   81           S      S     S                         S  S        S    SSS  
   472  107 P F        -     0   0   71  188   99           F      F     F                         F  F        F    FFF  
   473  108 P G        -     0   0   36  187   53           G      G     G                         G  G        G    GGG  
   474  109 P P        +     0   0   92  178   42           P      P     P                         P  P        P    PPP  
   475  110 P R        +     0   0  177  184   62           R      K     K                         K  K        K    QKK  
   476  111 P Y        +     0   0   51  185    4           Y      F     Y                         F  Y        F    YFF  
   477  112 P G        +     0   0   12  189   60           G      G     G                         G  G        E    GDD  
   478  113 P F  S    S-     0   0  151  190  102           Y      F     F                         F  Y        V    YSS  
   479  114 P V  E     -v  532   0H  28  190   13           L      L     L                         L  L        V    LVV  
   480  115 P Y  E     -v  533   0H  71  183   67           C      C     S                         C  V        Y    SFF  
   481  116 P E  E     -v  534   0H 108  190   44           E      E     E                         E  E        E    EDD  
   482  117 P L        -     0   0   12  190   33           L      L     L                         L  L        L    LLL  
   483  118 P E        +     0   0  134  190   75           Q      Q     Q                         Q  K        E    EEE  
   484  119 P S  S >> S-     0   0   57  190   54           N      N     N                         N  S        N    SSS  
   485  120 P G  H 3> S+     0   0   15  189   40           G      G     G                         G  G        G    GGG  
   486  121 P E  H 3> S+     0   0  127  190   23           E      E     E                         E  D        E    EEE  
   487  122 P Q  H <> S+     0   0   72  190   62           Q      Q     Q                         Q  E        Q    QAA  
   488  123 P F  H  X S+     0   0   26  190    1           F      F     F                         F  F        F    FFF  
   489  124 P L  H  X S+     0   0   90  190    6           L      L     L                         L  L        L    LLL  
   490  125 P E  H  X S+     0   0  103  190   40           E      E     E                         E  E        E    EDD  
   491  126 P T  H  < S+     0   0   10  190   74           V      A     A                         A  A        V    AVV  
   492  127 P I  H  < S+     0   0   17  190   12           I      V     V                         V  I        I    III  
   493  128 P E  H  < S+     0   0  139  190   19           E      E     E                         E  E        E    EEE  
   494  129 P K  S  < S+     0   0  172  190   33           K      K     K                         K  K        K    KNN  
   495  130 P E  S    S-     0   0   38  185    5           E      E     E                         E  E        E    EEE  
   496  131 P Q    >   -     0   0  116  190   67           R      H     R                         H  S        H    RHH  
   497  132 P K  T 3  S+     0   0  156  190   34           K      K     K                         K  K        K    KRR  
   498  133 P I  T 3  S+     0   0   68  190   87           T      T     T                         T  T        N    TLL  
   499  134 P T    <   -     0   0   10  190   37           V      T     T                         T  T        T    TTT  
   500  135 P T  E     -W  558   0H   7  189   62           M      T     T                         T  T        T    TLL  
   501  136 P I  E     -Wx 557 531H   3  190   15           V      V     V                         V  V        V    IVV  
   502  137 P V  E     -Wx 556 532H   0  190   35           I      I     I                         I  I        M    IVV  
   503  138 P V  E     -Wx 555 533H   0  190   13           V      V     V                         V  V        V    VVV  
   504  139 P H  E     -Wx 554 534H   0  190    5           H      H     H                         H  H        H    HHH  
   505  140 P I  E     +Wx 553 535H   2  190    2           I      I     I                         I  I        I    III  
   506  141 P Y  E     - x   0 536H   4  190    3           Y      Y     Y                         Y  F        Y    YYY  
   507  142 P E    >   -     0   0   45  190   26           E      E     E                         E  A        E    EEE  
   508  143 P D  T 3  S+     0   0   95  190   50           D      D     D                         D  D        D    DDD  
   509  144 P G  T 3  S+     0   0   66  190   50           G      G     D                         G  D        S    GGG  
   510  145 P I  S X> S-     0   0   36  190   33           V      V     V                         V  I        V    III  
   511  146 P K  T 34 S+     0   0  191  190   72           K      K     K                         K  K        K    KRR  
   512  147 P G  T 3> S+     0   0   13  190   23           G      G     G                         G  G        G    GGG  
   513  148 P C  H <> S+     0   0    0  190   36           C      C     C                         C  C        C    CCC  
   514  149 P D  H  X S+     0   0   78  190   47           E      E     E                         E  E        E    DDD  
   515  150 P A  H  > S+     0   0   44  190   50           A      A     P                         A  A        A    LAA  
   516  151 P L  H  X S+     0   0    0  190   11           L      L     L                         L  L        L    LLL  
   517  152 P N  H  X S+     0   0   19  190   16           N      N     N                         N  N        N    NNN  
   518  153 P S  H  X S+     0   0   78  190   57           N      S     N                         S  N        N    NNN  
   519  154 P S  H  X S+     0   0    6  190   35           S      S     S                         S  C        C    SCC  
   520  155 P L  H  X S+     0   0    1  190   10           L      L     L                         L  L        L    LLL  
   521  156 P I  H  X S+     0   0  105  190   85           T      T     T                         T  T        T    TTT  
   522  157 P C  H  X S+     0   0   63  190   41           C      C     C                         C  C        C    CCC  
   523  158 P L  H  X S+     0   0    0  190    4           L      L     L                         L  L        L    LLL  
   524  159 P A  H  < S+     0   0    1  190   11           A      A     A                         A  A        A    AAA  
   525  160 P A  H  < S+     0   0   61  190   66           A      A     A                         A  L        L    VAA  
   526  161 P E  H  < S+     0   0   72  190   24           E      E     E                         E  E        E    EEE  
   527  162 P Y    ><  +     0   0    5  190    2           Y      Y     Y                         Y  Y        Y    YYY  
   528  163 P P  T 3  S+     0   0   28  190   28           S      P     S                         P  P        T    SSS  
   529  164 P M  T 3  S+     0   0   26  190   85           T      T     T                         T  T        T    MTT  
   530  165 P V  S <  S-     0   0    1  190    9           L      V     V                         V  V        V    VVV  
   531  166 P K  E     - x   0 501H  37  190    2           R      K     K                         K  K        K    RKK  
   532  167 P F  E     +vx 479 502H   0  190    1           F      F     F                         F  F        F    FFF  
   533  168 P C  E     -vx 480 503H   0  190   19           C      C     C                         C  C        C    CCC  
   534  169 P K  E     +vx 481 504H  51  190   38           K      K     K                         K  K        K    KRR  
   535  170 P I  E     - x   0 505H   1  190   21           I      I     I                         I  I        I    III  
   536  171 P K  E >>  - x   0 506H  52  190   71           K      K     K                         K  K        K    KRR  
   537  172 P A  H >> S+     0   0   13  190   46           A      A     A                         A  A        A    AAA  
   538  173 P S  H 34 S+     0   0   88  190   29           S      S     S                         S  A        S    SSS  
   539  174 P N  H <4 S+     0   0   67  190   86           N      S     N                         S  D        S    DAA  
   540  175 P T  H << S-     0   0   25  190   72           T      T     T                         T  T        T    TTT  
   541  176 P G     <  +     0   0   66  189   23           G      G     G                         G  G        G    GGG  
   542  177 P A    >   -     0   0   39  190   57           A      A     A                         A  A        A    AAA  
   543  178 P G  T 3  S-     0   0   70  189   41           G      G     G                         G  G        Q    GGG  
   544  179 P D  T 3  S+     0   0  151  189   78           D      D     D                         D  E        D    DEE  
   545  180 P R  S <  S+     0   0  167  189   57           R      R     R                         R  R        R    RRR  
   546  181 P F  S    S+     0   0   35  189    0           F      F     F                         F  F        F    FFF  
   547  182 P S    >>  -     0   0   34  189   69           S      S     S                         S  S        P    SSS  
   548  183 P S  T 34 S+     0   0   86  189   84           A      S     T                         S  S        E    PEE  
   549  184 P D  T 34 S+     0   0  126  189   66           D      E     D                         E  E        K    EDD  
   550  185 P V  T <4 S+     0   0   20  189   64           V      V     V                         V  V        V    VVV  
   551  186 P L     <  +     0   0    8  190   15           L      L     L                         L  L        L    LLL  
   552  187 P P  S    S+     0   0    1  190    0           P      P     P                         P  P        P    PPP  
   553  188 P T  E     -W  505   0H   1  190   42           T      S     T                         S  T        T    TTT  
   554  189 P L  E     -WY 504 566H   0  190    2           L      L     L                         L  L        F    LLL  
   555  190 P L  E     -WY 503 565H   4  190   10           L      L     L                         L  L        L    LLL  
   556  191 P V  E     +WY 502 564H   0  190   18           V      V     V                         V  V        V    VVV  
   557  192 P Y  E     +WY 501 562H  31  190    0           Y      Y     Y                         Y  Y        Y    YYY  
   558  193 P K  E >  S-WY 500 561H  25  190   13           K      K     R                         K  K        K    RKK  
   559  194 P G  T 3  S-     0   0   25  190   44           G      A     A                         A  A        A    GAA  
   560  195 P G  T 3  S+     0   0   48  190   21           G      G     G                         G  G        G    GGG  
   561  196 P E  E <   -Y  558   0H  38  190   37           E      E     E                         E  E        E    EEE  
   562  197 P L  E     +Y  557   0H  34  190   12           L      L     L                         L  L        L    LMM  
   563  198 P L  E     -     0   0H   2  190   21           L      L     V                         L  I        I    VLL  
   564  199 P S  E     -Y  556   0H   4  190   29           S      S     S                         S  S        G    SGG  
   565  200 P N  E     -Y  555   0H  41  190    0           N      N     N                         N  N        N    NNN  
   566  201 P F  E >   -Y  554   0H   3  189    1           F      F     F                         F  F        F    FFF  
   567  202 P I  T 3  S-     0   0   87  187   24           I      I     I                         I  I        I    LLL  
   568  203 P S  T >  S-     0   0   11  187   69           N      S     S                         S  S        C    SCC  
   569  204 P V  G X  S+     0   0    0  187   34           F      V     V                         V  V        I    VVV  
   570  205 P T  G >  S+     0   0   17  187   36           T      S     T                         S  T        T    TTT  
   571  206 P E  G <  S+     0   0  156  187   34           E      E     D                         E  E        E    EKK  
   572  207 P Q  G <  S+     0   0   84  187   43           Q      Q     Q                         Q  N        H    QHH  
   573  208 P L  S <  S-     0   0   31  187   11           F      F     F                         F  L        F    FMM  
   574  209 P A    >   -     0   0   49  187   49           S      N     N                         S  N        N    NNN  
   575  210 P E  T 3  S+     0   0  201  187   27           E      E     E                         E  D        E    EEE  
   576  211 P E  T 3  S+     0   0  166  187   21           E      E     E                         E  E        E    EEE  
   577  212 P F    <   -     0   0   17  187    0           F      F     F                         F  F        F    FFF  
   578  213 P F    >>  -     0   0  146  187   24           Y      F     F                         F  F        F    FFF  
   579  214 P T  H 3> S+     0   0   24  186   26           A      A     A                         A  A        A    AAA  
   580  215 P G  H 3> S+     0   0   32  186   71           V      V     V                         V  V        V    VTT  
   581  216 P D  H <> S+     0   0   57  186    4           D      D     D                         D  D        D    DDD  
   582  217 P V  H  X S+     0   0    0  186   23           V      V     V                         V  V        V    VVV  
   583  218 P E  H  X S+     0   0   32  186   10           E      E     E                         E  E        E    EEE  
   584  219 P S  H  X S+     0   0   58  186   51           S      A     T                         A  S        S    TNN  
   585  220 P F  H  < S+     0   0    2  187    1           F      F     F                         F  F        F    FFF  
   586  221 P L  H ><>S+     0   0    0  187    0           L      L     L                         L  L        L    LLL  
   587  222 P N  H ><5S+     0   0   61  187   83           H      N     N                         N  N        N    KNN  
   588  223 P E  T 3<5S+     0   0   70  187   16           E      E     E                         E  E        E    EEE  
   589  224 P Y  T < 5S-     0   0   20  183   49           Y      Y     Y                         Y  Y        Y    YYY  
   590  225 P G  T < 5S+     0   0    6  183    7           G      G     G                         G  G        G    GGG  
   591  226 P L      < +     0   0    2  183   19           L      L     L                         L  L        L    LLL  
   592  227 P L  S    S-     0   0   10  178    7           L      L     L                         L  L        L    LLL  
   593  228 P P        -     0   0   40  178   30           P      P     P                         P  P        P    PPP  
   594  229 P E              0   0   94  177   19           E      E     E                         E  E        E    QEE  
   595  230 P K              0   0  161  175   25           K      R     K                         R  R        K     KK  
## ALIGNMENTS  421 -  490
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....3....:....4....:....5....:....6....:....7....:....8....:....9
     1    2 B S              0   0  117  195   58                                                                        
     2    3 B E     >  -     0   0  107  209   43                                                                        
     3    4 B L  H  > S+     0   0   52  229   31                                                                        
     4    5 B D  H  > S+     0   0  104  229   51                                                                        
     5    6 B Q  H  > S+     0   0  131  230   62                                                                        
     6    7 B L  H  X S+     0   0   27  230   61                                                                        
     7    8 B R  H  X S+     0   0  110  233    4                                                                        
     8    9 B Q  H  X S+     0   0  117  233   49                                                                        
     9   10 B E  H  X S+     0   0   78  234    8                                                                        
    10   11 B A  H  X S+     0   0    1  234    8                                                                        
    11   12 B E  H  X S+     0   0  121  234    8                                                                        
    12   13 B Q  H  X S+     0   0  111  238   70                                                                        
    13   14 B L  H  X S+     0   0   14  238    4                                                                        
    14   15 B K  H  X S+     0   0   99  238   24                                                                        
    15   16 B N  H  X S+     0   0   33  239   51                                                                        
    16   17 B Q  H  X S+     0   0   82  239   58                                                                        
    17   18 B I  H  X S+     0   0    7  240    4                                                                        
    18   19 B R  H  X S+     0   0  135  242   52                                                                        
    19   20 B D  H  X S+     0   0   85  244   60                                                                        
    20   21 B A  H  X S+     0   0   36  243   62                                                                        
    21   22 B R  H >X S+     0   0   22  244   22                                                                        
    22   23 B K  H 3< S+     0   0  136  244   50                                                                        
    23   24 B A  H 3< S+     0   0   79  244   56                                                                        
    24   25 B C  H << S+     0   0   19  244   85                                                                        
    25   26 B A     <  +     0   0   46  244   56                                                                        
    26   27 B D        +     0   0   88  243    0                                                                        
    27   28 B A        -     0   0   17  243   50                                                                        
    28   29 B T    >>  -     0   0   59  244   35                                                                        
    29   30 B L  H 3> S+     0   0    0  244    3                                                                        
    30   31 B S  H 34 S+     0   0   38  244   90                                                                        
    31   32 B Q  H X4 S+     0   0  119  247   50                                                                        
    32   33 B I  H 3< S+     0   0   28  248   52                                                                        
    33   34 B T  T >< S+     0   0    0  249   56                                                                        
    34   35 B N  T <  S+     0   0  129  249   72                                                                        
    35   36 B N  T 3  S+     0   0  111  249   55                                                                        
    36   37 B I  S <  S-     0   0   21  249   49                                                                        
    37   38 B D        -     0   0  138  249   32                                                                        
    38   39 B P        -     0   0   89  250   59                                                                        
    39   40 B V        -     0   0   23  251   30                                                                        
    40   41 B G        -     0   0   54  251   45                                                                        
    41   42 B R        -     0   0  115  251    6                                                                        
    42   43 B I        +     0   0    8  251   27                                                                        
    43   44 B Q        -     0   0   54  251   59                                                                        
    44   45 B M        -     0   0   11  252    5                                                                        
    45   46 B R        -     0   0   49  252   18                                                                        
    46   47 B T  E     +A  338   0A  12  252   43                                                                        
    47   48 B R  E     +     0   0A  56  252   11                                                                        
    48   49 B R  E     -A  337   0A  60  252    9                                                                        
    49   50 B T  E     -A  336   0A  30  252   20                                                                        
    50   51 B L  E     -A  335   0A   0  252    0                                                                        
    51   52 B R        +     0   0  159  252   22                                                                        
    52   53 B G        +     0   0   20  252    0                                                                        
    53   54 B H        -     0   0    4  252    0                                                                        
    54   55 B L  S    S+     0   0  116  252    4                                                                        
    55   56 B A  S    S-     0   0    0  252    4                                                                        
    56   57 B K        -     0   0   15  252    0                                                                        
    57   58 B I  E     -D   73   0B   0  252    1                                                                        
    58   59 B Y  E     -     0   0B   6  252    4                                                                        
    59   60 B A  E     -D   72   0B  13  252    5                                                                        
    60   61 B M  E     -D   71   0B  15  252    4                                                                        
    61   62 B H  E     -D   70   0B  44  252    4                                                                        
    62   63 B W  E     -D   69   0B  11  252    0                                                                        
    63   64 B G    >   -     0   0    3  252   43                                                                        
    64   65 B T  T 3  S+     0   0   75  252   58                                                                        
    65   66 B D  T 3  S-     0   0   80  252    1                                                                        
    66   67 B S  S <  S+     0   0    3  252   50                                                                        
    67   68 B R  S    S+     0   0   94  252   20                                                                        
    68   69 B L  E     + E   0  82B  31  252   80                                                                        
    69   70 B L  E     -DE  62  81B   0  252   12                                                                        
    70   71 B L  E     -DE  61  80B   0  252    3                                                                        
    71   72 B S  E     -DE  60  79B   0  252    1                                                                        
    72   73 B A  E     -DE  59  78B   0  252    1                                                                        
    73   74 B S  E >>  -DE  57  77B   0  252    1                                                                        
    74   75 B Q  T 34 S+     0   0    1  252    1                                                                        
    75   76 B D  T 34 S-     0   0    9  252    1                                                                        
    76   77 B G  T <4 S+     0   0    7  252    1                                                                        
    77   78 B K  E  <  -EF  73  93B  52  252    7                                                                        
    78   79 B L  E     -EF  72  92B   0  252    2                                                                        
    79   80 B I  E     -EF  71  91B   0  252    3                                                                        
    80   81 B I  E     -EF  70  90B   0  252   16                                                                        
    81   82 B W  E     -EF  69  88B   0  252    0                                                                        
    82   83 B D  E >>> -EF  68  87B  21  252    2                                                                        
    83   84 B S  T 345S+     0   0    0  252   52                                                                        
    84   85 B Y  T 345S+     0   0   57  251   17                                                                        
    85   86 B T  T <45S-     0   0   56  252    5                                                                        
    86   87 B T  T  <5 +     0   0   43  252    4                                                                        
    87   88 B N  E   < -F   82   0B  99  252    4                                                                        
    88   89 B K  E     +F   81   0B  95  249    1                                                                        
    89   90 B V  E    S+     0   0B  66  249   17                                                                        
    90   91 B H  E     -F   80   0B  57  249    2                                                                        
    91   92 B A  E     -F   79   0B  43  251    0                                                                        
    92   93 B I  E     -F   78   0B   0  252    0                                                                        
    93   94 B P  E     -F   77   0B  80  252    4                                                                        
    94   95 B L        -     0   0   26  252    0                                                                        
    95   96 B R  S    S+     0   0  190  252    6                                                                        
    96   97 B S        -     0   0   17  252    3                                                                        
    97   98 B S  S    S+     0   0    6  252    3                                                                        
    98   99 B W        +     0   0    2  252    0                                                                        
    99  100 B V  E     -G  115   0C   4  252    0                                                                        
   100  101 B M  E     +     0   0C   5  252    0                                                                        
   101  102 B T  E     -G  114   0C   8  252    0                                                                        
   102  103 B C  E     -G  113   0C   0  252    1                                                                        
   103  104 B A  E     -G  112   0C   0  252    3                                                                        
   104  105 B Y  E     -G  111   0C   9  252    2                                                                        
   105  106 B A    >   -     0   0    0  252   22                                                                        
   106  107 B P  T 3  S+     0   0   64  252    3                                                                        
   107  108 B S  T 3  S-     0   0   47  252    6                                                                        
   108  109 B G  S <  S+     0   0    8  252    6                                                                        
   109  110 B N  S    S+     0   0   50  252   22                                                                        
   110  111 B Y  E     - H   0 124C  50  252   13                                                                        
   111  112 B V  E     -GH 104 123C   0  252    0                                                                        
   112  113 B A  E     +GH 103 122C   0  252    2                                                                        
   113  114 B C  E     +GH 102 121C   5  252    2                                                                        
   114  115 B G  E     +GH 101 120C   1  252    0                                                                        
   115  116 B G  E >  S-G   99   0C   0  252    0                                                                        
   116  117 B L  T 3  S+     0   0    1  252    0                                                                        
   117  118 B D  T 3  S-     0   0   50  252    0                                                                        
   118  119 B N  S <  S+     0   0   30  252    0                                                                        
   119  120 B I  E     - I   0 139C  39  252   24                                                                        
   120  121 B C  E     -HI 114 138C   0  252    3                                                                        
   121  122 B S  E     -HI 113 137C   9  252    6                                                                        
   122  123 B I  E     -HI 112 136C   0  252    2                                                                        
   123  124 B Y  E     -H  111   0C   3  252    0                                                                        
   124  125 B N  E     +H  110   0C  24  252   40                                                                        
   125  126 B L        +     0   0   11  252    1                                                                        
   126  127 B K  S    S+     0   0  109  252   43                                                                        
   127  128 B T  S    S-     0   0   64  252   55                                                                        
   128  129 B R  S    S+     0   0  267  250   17                                                                        
   129  130 B E  S    S-     0   0  173  251    9                                                                        
   130  131 B G        -     0   0   50  252   11                                                                        
   131  132 B N        +     0   0   30  252   52                                                                        
   132  133 B V  S    S+     0   0   58  253   42                                                                        
   133  134 B R  S    S-     0   0  213  253   22                                                                        
   134  135 B V        -     0   0   29  253   15                                                                        
   135  136 B S  S    S-     0   0   43  253   48                                                                        
   136  137 B R  E     -I  122   0C 105  253    7                                                                        
   137  138 B E  E     -I  121   0C  75  253    3                                                                        
   138  139 B L  E     +I  120   0C   1  252    1                                                                        
   139  140 B A  E     +I  119   0C  61  252   57                                                                        
   140  141 B G        +     0   0   50  252   25                                                                        
   141  142 B H        -     0   0    9  252    2                                                                        
   142  143 B T  S    S+     0   0   64  252   42                                                                        
   143  144 B G  S    S-     0   0    0  252    2                                                                        
   144  145 B Y        -     0   0    0  251    0                                                                        
   145  146 B L  E     +J  160   0D   0  251    1                                                                        
   146  147 B S  E     -     0   0D   3  251    0                                                                        
   147  148 B C  E     -J  159   0D   9  251    5                                                                        
   148  149 B C  E     -J  158   0D   0  251    0                                                                        
   149  150 B R  E     -J  157   0D  53  251    4                                                                        
   150  151 B F  E     -J  156   0D  10  251    0                                                                        
   151  152 B L  S    S-     0   0   26  251   24                                                                        
   152  153 B D  S    S-     0   0   60  251   40                                                                        
   153  154 B D  S    S+     0   0   60  251    2                                                                        
   154  155 B N  S    S+     0   0   44  251   65                                                                        
   155  156 B Q  E     + K   0 169D  60  251   47                                                                        
   156  157 B I  E     -JK 150 168D   0  251    1                                                                        
   157  158 B V  E     -JK 149 167D   0  251   22                                                                        
   158  159 B T  E     -JK 148 166D   0  251    1                                                                        
   159  160 B S  E     -JK 147 165D   0  251    2                                                                        
   160  161 B S  E >   -J  145   0D   0  251    0                                                                        
   161  162 B G  T 3  S+     0   0    0  251    0                                                                        
   162  163 B D  T 3  S-     0   0    5  251    0                                                                        
   163  164 B T  S <  S+     0   0    8  251   63                                                                        
   164  165 B T        -     0   0    2  251   16                                                                        
   165  166 B C  E     -KL 159 179D   0  251    0                                                                        
   166  167 B A  E     -KL 158 178D   0  252   62                                                                        
   167  168 B L  E     -KL 157 177D   6  252    6                                                                        
   168  169 B W  E     -KL 156 175D   2  252    0                                                                        
   169  170 B D  E >>> -KL 155 174D  37  252    0                                                                        
   170  171 B I  T 345S+     0   0    7  252    8                                                                        
   171  172 B E  T 345S+     0   0  144  252    6                                                                        
   172  173 B T  T <45S-     0   0   78  252   36                                                                        
   173  174 B G  T  <5 +     0   0   16  253    8                                                                        
   174  175 B Q  E   < -L  169   0D 135  253   68                                                                        
   175  176 B Q  E     -L  168   0D  30  253   45                                                                        
   176  177 B T  E     +     0   0D  64  253   73                                                                        
   177  178 B T  E     -L  167   0D  20  253   47                                                                        
   178  179 B T  E     -L  166   0D   5  253   77                                                                        
   179  180 B F  E     +L  165   0D   1  253    0                                                                        
   180  181 B T        +     0   0   34  253   72                                                                        
   181  182 B G        +     0   0   37  253   30                                                                        
   182  183 B H        -     0   0    7  253    0                                                                        
   183  184 B T  S    S+     0   0   99  253   63                                                                        
   184  185 B G  S    S-     0   0    0  253    1                                                                        
   185  186 B D        -     0   0    1  253    1                                                                        
   186  187 B V  E     -M  202   0E   0  253   22                                                                        
   187  188 B M  E     +     0   0E   3  253    1                                                                        
   188  189 B S  E     -M  201   0E  16  253    8                                                                        
   189  190 B L  E     -M  200   0E   3  253   14                                                                        
   190  191 B S  E     -M  199   0E  21  253   24                                                                        
   191  192 B L  E     -M  198   0E  29  253   29                                                                        
   192  193 B A    >   -     0   0    4  253   57                                                                        
   193  194 B P  T 3  S+     0   0   85  253   13                                                                        
   194  195 B D  T 3  S-     0   0   87  253   52                                                                        
   195  196 B T  S <  S+     0   0   62  253   97                                                                        
   196  197 B R  S    S+     0   0  142  252   61                                                                        
   197  198 B L  E     - N   0 211E  37  252   71                                                                        
   198  199 B F  E     -MN 191 210E   0  252    0                                                                        
   199  200 B V  E     -MN 190 209E   0  252   11                                                                        
   200  201 B S  E     -MN 189 208E   0  252    0                                                                        
   201  202 B G  E     +MN 188 207E   0  252    0                                                                        
   202  203 B A  E >   -M  186   0E   0  252    4                                                                        
   203  204 B C  T 3  S+     0   0    5  252    2                                                                        
   204  205 B D  T 3  S-     0   0   31  252    0                                                                        
   205  206 B A  S <  S+     0   0   20  252   16                                                                        
   206  207 B S  E     - O   0 222E   6  252   69                                                                        
   207  208 B A  E     -NO 201 221E   0  252   35                                                                        
   208  209 B K  E     -NO 200 220E  18  252    0                                                                        
   209  210 B L  E     -NO 199 219E   2  252    8                                                                        
   210  211 B W  E     -NO 198 217E   1  252    0                                                                        
   211  212 B D  E >>> -NO 197 216E  11  252    1                                                                        
   212  213 B V  T 345S+     0   0   12  252   19                                                                        
   213  214 B R  T 345S+     0   0  194  252    1                                                                        
   214  215 B E  T <45S-     0   0  111  252   59                                                                        
   215  216 B G  T  <5 +     0   0    8  252   25                                                                        
   216  217 B M  E      -     0   0    1  252    0                                                                        
   235  236 B P  T 3  S+     0   0   45  252    0                                                                        
   236  237 B N  T 3  S-     0   0   42  252   27                                                                        
   237  238 B G  S <  S+     0   0   12  252    8                                                                        
   238  239 B N  S    S+     0   0   56  252   76                                                                        
   239  240 B A  E     - Q   0 253F   0  252   11                                                                        
   240  241 B F  E     -PQ 233 252F   0  252   16                                                                        
   241  242 B A  E     -PQ 232 251F   0  252   51                                                                        
   242  243 B T  E     -PQ 231 250F   0  252    0                                                                        
   243  244 B G  E     +PQ 230 249F   0  252    0                                                                        
   244  245 B S  E >   -P  228   0F   0  252    0                                                                        
   245  246 B D  T 3  S+     0   0   13  252    0                                                                        
   246  247 B D  T 3  S-     0   0   28  252    0                                                                        
   247  248 B A  S <  S+     0   0    6  252   12                                                                        
   248  249 B T        -     0   0   16  252   42                                                                        
   249  250 B C  E     -QR 243 263F   0  252    3                                                                        
   250  251 B R  E     -QR 242 262F  23  252    3                                                                        
   251  252 B L  E     -QR 241 261F   0  252    0                                                                        
   252  253 B F  E     -QR 240 259F   1  251    0                                                                        
   253  254 B D  E  >> -QR 239 258F   1  251    0                                                                        
   254  255 B L  T >45S+     0   0   15  251   26                                                                        
   255  256 B R  T 345S+     0   0   57  251    0                                                                        
   256  257 B A  T 345S-     0   0    0  251    8                                                                        
   257  258 B D  T <<5 +     0   0    0  251    0                                                                        
   258  259 B Q  E      -     0   0  119  253   47                                                                        
   266  267 B D  T 3  S+     0   0  161  253   25                                                                        
   267  268 B N  T 3  S+     0   0   66  253   48                                                                        
   268  269 B I    <   +     0   0   23  253   21                                                                        
   269  270 B I        +     0   0   97  253   31                                                                        
   270  271 B C  S    S-     0   0   10  253    6                                                                        
   271  272 B G        -     0   0    1  253    0                                                                        
   272  273 B I  E     +S  288   0G   0  253    1                                                                        
   273  274 B T  E     +     0   0G  13  253    4                                                                        
   274  275 B S  E     +S  287   0G  18  252    0                                                                        
   275  276 B V  E     +S  286   0G  10  252    5                                                                        
   276  277 B S  E     -S  285   0G  15  252   21                                                                        
   277  278 B F  E     -S  284   0G  12  252   13                                                                        
   278  279 B S        -     0   0    3  252    1                                                                        
   279  280 B K  S    S+     0   0  104  252   80                                                                        
   280  281 B S  S    S-     0   0    2  252    0                                                                        
   281  282 B G  S    S+     0   0    0  252    0                                                                        
   282  283 B R        +     0   0    8  252    0                                                                        
   283  284 B L  E     - T   0 297G   0  252   11                                                                        
   284  285 B L  E     -ST 277 296G   0  252    3                                                                        
   285  286 B L  E     -ST 276 295G   0  252   13                                                                        
   286  287 B A  E     -ST 275 294G   0  252   11                                                                        
   287  288 B G  E     -ST 274 293G   2  252    4                                                                        
   288  289 B Y  E >   -S  272   0G   4  252    0                                                                        
   289  290 B D  T 3  S+     0   0    3  252    3                                                                        
   290  291 B D  T 3  S-     0   0   37  252    1                                                                        
   291  292 B F  S <  S+     0   0    3  252    3                                                                        
   292  293 B N        -     0   0   15  252   39                                                                        
   293  294 B C  E     -TU 287 307G   0  252    5                                                                        
   294  295 B N  E     -TU 286 306G   5  252   32                                                                        
   295  296 B V  E     -TU 285 305G   0  252    9                                                                        
   296  297 B W  E     -TU 284 303G   6  252    0                                                                        
   297  298 B D  E  >  -T  283   0G   4  252    0                                                                        
   298  299 B A  T  4 S+     0   0    0  252   64                                                                        
   299  300 B L  T  4 S+     0   0    0  252   11                                                                        
   300  301 B K  T  4 S-     0   0   29  252   17                                                                        
   301  302 B A  S  < S+     0   0   17  252   42                                                                        
   302  303 B D  S    S-     0   0   95  252   20                                                                        
   303  304 B R  E     -U  296   0G  69  252   15                                                                        
   304  305 B A  E     -     0   0G  14  252   58                                                                        
   305  306 B G  E     -U  295   0G   4  252    5                                                                        
   306  307 B V  E >   -U  294   0G   7  252   45                                                                        
   307  308 B L  E >  S+U  293   0G   2  251    1                                                                        
   308  309 B A  G >  S-     0   0    4  251   52                                                                        
   309  310 B G  G <   -     0   0    4  251    5                                                                        
   310  311 B H  G <  S+     0   0    8  251    0                                                                        
   311  312 B D    <   -     0   0   26  251   18                                                                        
   312  313 B N  S    S+     0   0   31  251    0                                                                        
   313  314 B R        +     0   0   40  251    1                                                                        
   314  315 B V        +     0   0    2  251    1                                                                        
   315  316 B S  S    S-     0   0    2  251    2                                                                        
   316  317 B C  E     -B  329   0A  10  251    6                                                                        
   317  318 B L  E     -B  328   0A  15  250    4                                                                        
   318  319 B G  E     -B  327   0A  10  250    3                                                                        
   319  320 B V  E     -B  326   0A  25  250    0                                                                        
   320  321 B T    >   -     0   0    3  250   47                                                                        
   321  322 B D  T 3  S+     0   0   98  250   64                                                                        
   322  323 B D  T 3  S-     0   0   51  249    7                                                                        
   323  324 B G  S <  S+     0   0    0  249    5                                                                        
   324  325 B M  S    S+     0   0   36  249   20                                                                        
   325  326 B A        -     0   0    0  249   24                                                                        
   326  327 B V  E     -BC 319 338A   0  248   33                                                                        
   327  328 B A  E     -BC 318 337A   0  247   47                                                                        
   328  329 B T  E     -BC 317 336A   7  247    1                                                                        
   329  330 B G  E     -BC 316 335A   1  247    2                                                                        
   330  331 B S    >   -     0   0    6  247    0                                                                        
   331  332 B W  T 3  S+     0   0    6  247    0                                                                        
   332  333 B D  T 3  S-     0   0   17  247    0                                                                        
   333  334 B S  S <  S+     0   0   12  247    2                                                                        
   334  335 B F        -     0   0   78  247   39                                                                        
   335  336 B L  E     -AC  50 329A   1  247    3                                                                        
   336  337 B K  E     -AC  49 328A  60  246   25                                                                        
   337  338 B I  E     -AC  48 327A   0  244   10                                                                        
   338  339 B W  E      AC  46 326A   2  243    0                                                                        
   339  340 B N              0   0   10  236   46                                                                        
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   85    5                                                                        
   342    3 G V        +     0   0   96   88   62                                                                        
   343    4 G I        -     0   0   38   92   33                                                                        
   344    5 G N    >   -     0   0  109   92   65                                                                        
   345    6 G I  G >  S+     0   0   25   93   47                                 M                                      
   346    7 G E  G 3  S+     0   0  122  138   45   QQQ Q      Q          Q       EQQ                                    
   347    8 G D  G <  S+     0   0  133  149   28   DDE EDD  D D          D       EDDDD D D     D                        
   348    9 G L    <   -     0   0   35  155   20   LLL LMM  M M          M       MLLMM M M     M                        
   349   10 G T     >  -     0   0   69  156   61   SSS SSS  S T          S       ASSSS STS     S                        
   350   11 G E  H  > S+     0   0  116  160   37   EEE EDDE D E          E       EKEDD DPD     D                        
   351   12 G K  H >> S+     0   0   66  165   48   KKK KKKK K K          K       KKKKK KEK     K                        
   352   13 G D  H 3> S+     0   0   39  166   39   EDD DEEE D D          E       EEEEE EEE     E                        
   353   14 G K  H 3X S+     0   0   83  166   83   LIL IIIL I I          L       RLLII ITI     I                        
   354   15 G L  H < S+     0   0    7  249    4   EEE EEEE E E          E       EEEEE EEEE    E     EE                 
   365   26 G V  H 3< S+     0   0   43  249   53   VVV AVVV A V          V       AVVVV VVVV    V     VV                 
   366   27 G T  T 3< S+     0   0  116  249   83   KKK KNNK K K          K       AKTNS SKNN    S     NN                 
   367   28 G L    <   -     0   0   49  249   60   NNN NTTN N T          L       LNTTT TLTI    T     II                 
   368   29 G E        -     0   0  191  249   51   TTT TPAP T E          E       EPPPP PTPE    T     ED                 
   369   30 G R        -     0   0   32  249    0   RRR RRRR R R          R       RRRRR RRRR    R     RR                 
   370   31 G M        -     0   0   53  249   83   VEV EITA E A          Q       MAATT TETM    T     MM                 
   371   32 G L     >  -     0   0   75  248   80   PPP PAAP P P          M       KPPAA AKPM    A     MK                 
   372   33 G V  H  > S+     0   0    4  248   13   III VVVI V I          I       VVIVV VIVV    V     VV                 
   373   34 G S  H  > S+     0   0   14  248    1   SSS SSSS S S          S       SSSSA SSAS    S     SS                 
   374   35 G K  H  > S+     0   0   93  248   37   KKK KTAK K T          K       QRRGA AKAK    V     KK                 
   375   36 G C  H  X S+     0   0    0  249   61   STT TTTT T S          T       CTTSN NVNA    N     AA                 
   376   37 G C  H  X S+     0   0    0  249   62   GGG AAAG A L          A       CGGAC CACA    C     AA                 
   377   38 G E  H  X S+     0   0   75  249   68   KKK KPPK K S          K       EKKAA APAA    K     AA                 
   378   39 G E  H  X S+     0   0   60  249   24   DNE EEEE E E          E       DEEEE DDLD    E     DE                 
   379   40 G F  H  X S+     0   0    3  249   35   III IIII I M          L       LIITT TITL    T     LL                 
   380   41 G R  H  X S+     0   0   53  249   79   KKK CIIK C K          R       RKKII ILVM    M     ML                 
   381   42 G D  H  X S+     0   0   67  249   66   DDD EAAD E T          T       EDEAA AATA    E     AA                 
   382   43 G Y  H  X S+     0   0   43  249    2   YFF WFFY W Y          F       YYYFF YHFY    W     YY                 
   383   44 G V  H >X S+     0   0    0  249   58   VVV VVVV V I          I       VVVVV VVVC    V     CC                 
   384   45 G E  H 3X S+     0   0   71  249   48   EEE EEEE E E          E       LEEEE EEEE    E     EE                 
   385   46 G E  H 3< S+     0   0  125  249   57   ATA AGGA A S          S       QAAEE GSQN    A     NA                 
   386   47 G R  H XX S+     0   0   94  249   68   QQE QLLQ Q H          M       NQQRR LNMH    Q     HH                 
   387   48 G S  H >< S+     0   0   12  249   68   AAA SSSA S A          A       AAALL LMVA    T     AA                 
   388   49 G G  T 3< S+     0   0   38  249   78   GAG AAAE A T          A       AGEPP PAPK    E     KK                 
   389   50 G E  T <4 S+     0   0  138  248   52   NNN EEEN E E          E       NRRNN NDNE    G     EE                 
   390   51 G D    XX> -     0   0    1  248    0   DDD DDDD D D          D       DDDDD DDDD    D     DD                 
   391   52 G P  H 3>5S+     0   0   17  249   27   PPP PPPP P P          P       PPPPP PPPP    P     PP                 
   392   53 G L  H 345S+     0   0    6  249    3   LLL LLLL L L          I       LLLLL LLLL    L     LL                 
   393   54 G V  H <45S+     0   0   24  249   30   LLL VVVL V I          L       LLLII IVIV    I     VV                 
   394   55 G K  H  <5S-     0   0  149  249   78   KKK KKKQ K K          K       KRRKK KKKT    K     TT                 
   395   56 G G     << -     0   0   38  249   34   GGG GGGG G G          G       GGGGG GGGP    G     PP                 
   396   57 G I        -     0   0   21  249   27   VVV VVVI V V          V       VVVVV VVVV    V     VV                 
   397   58 G P    >>  -     0   0   80  249   19   PPP PPPS P P          P       PPPSP PPAP    S     PP                 
   398   59 G E  T 34 S+     0   0   75  249   62   EEE EEEE E D          E       DEEDD DEDS    D     SS                 
   399   60 G D  T 34 S+     0   0  151  249   60   DDD DDDD D D          D       DDDDE DDDS    D     SS                 
   400   61 G K  T <4 S+     0   0  163  249   65   KKK KKKK K R          K       KRRKK KKKE    K     EE                 
   401   62 G N     <  -     0   0    1  249    0   NNN NNNN N N          N       NNNNN NNNN    N     NN                 
   402   63 G P  S    S+     0   0   36  249    0   PPP PPPP P P          P       PPPPP PPPP    P     PP                 
   403   64 G F  S    S-     0   0    3  249    1   FFF FFFF F F          F       YFFYY YFYF    Y     FF                 
   404   65 G K              0   0  108  247   34   RKK KKKK K K          K       KKKKK KKKR    K     RR                 
   405   66 G E              0   0  201  242    3   EEE EEEE E E          E       EEE    E E          EE                 
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   54   14           L L  LL  LL LL   L         L                                 
   408   14 P E        +     0   0  153  148   31  E        E E EEEEEPP EE EEE         E    EEEE EEEEE  EEEEDEDEEEEEDEEEE
   409   15 P G  S    S+     0   0   38  151   33  V        E E LEELLEE EE LLE         E    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   410   16 P Q  S    S-     0   0   94  155   93  P        N N PTTPPTT SS PPSP        T    IIIV IIIII  IIIISISIIIIISIIII
   411   17 P A        +     0   0    1  157   48  A        A A AAAAAPP AA AAVA        A    SSSS SSSST  SSSSASASSSSSASSSS
   412   18 P S        +     0   0   28  161   65  N        T T NTTNNTT TT NNTTT T     T    VVVV VVVVV  VVVVVVVVIVVIVVVVV
   413   19 P H  S    S+     0   0   42  167   41  H   H    H H HHHHHQQ HH HHHQHHH     H    NNNN NNNNN  NNNNNNNNNNNNNNNNN
   414   20 P T  S  > S-     0   0    2  172    0  T   T    T T TTTTTTT TT TTTTTTT     T    TTTT TTTTT  TTTTTTTTTTTTTTTTT
   415   21 P G  H  > S-     0   0   10  177    0  G   G    G G GGGGGGG GG GGGGGGG     G    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   416   22 P P  H  > S+     0   0   14  183    0  P   P    P P PPPPPPPPPP PPPPPPP     P    PPPP PPPPP  PPPPPPPPPPPPPPPPP
   417   23 P K  H  > S+     0   0    6  183    0  K   K    K K KKKKKKKKKK KKKKKKK     K    KKKK KKKKK  KKKKKKKKKKKKKKKKK
   418   24 P G  H  X S+     0   0    0  183    0  G   G    G G GGGGGGGGGG GGGGGGG     G    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   419   25 P V  H  X S+     0   0    0  183    0  V   V    V V VVVVVVVVVV VVVVVVV     V    VVVV VVVVV  VVVVVVVVVVVVVVVVV
   420   26 P I  H  X S+     0   0    4  183   16  I   I    I I IIIIIIIIII IIIIIII     I    IIII IIIII  IIILIIIIIIIIIIIII
   421   27 P N  H  X S+     0   0   48  183   44  N   N    N N NNNNNNNNNN NNNHNNN     N    NNNN NNNNN  NNNNNNNNNNNNNNNNN
   422   28 P D  H  X S+     0   0   14  184    0  D   D    D D DDDDDDDDDD DDDDDDD     D    DDDD DDDDD  DDDDDDDDDDDDDDDDD
   423   29 P W  H  X S+     0   0    6  184    0  W   W    W W WWWWWWWWWW WWWWWWW     W    WWWW WWWWW  WWWWWWWWWWWWWWWWW
   424   30 P R  H  < S+     0   0   67  184   27  R   R    R R RRRRRRRRRR RRRRRRR     R    RRRR RRRRR  RRRRRRRRRRRRRRRRR
   425   31 P K  H >X S+     0   0   67  184   36  R   K    R R RRRRRRRRRR RRRKKKK     R    RRRR RRRRR  RRRRRRRRRRRRRRRRR
   426   32 P F  H >X>S+     0   0    1  184    2  F   F    F F FFFYFFFFFF FFFFFFF     F    FFFF FFFFF  FFFFFFFFFFFFFFYFF
   427   33 P K  H 3<5S+     0   0   30  184    8  K   K    K K KKKKKKKKKK KKKKKKK     K    kkkk kkkkk  kkkkkkkkkkkkkkkkk
   428   34 P L  H <45S+     0   0  139  179    1  L   L    L L LLLLLLLLLL LLLLLLL     L    llll lllll  lllllllllllllllll
   429   35 P E  H <<5S+     0   0   86  179   10  D   E    E E DEEDDEEEEE DDEEEEE     E    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   430   36 P S  T  <5       0   0   57  180   65  s   s    s s ssssssssss sssssss     s    tttt ttttt  ttttttttttttttttt
   431   37 P E      <       0   0  118  186   66  r   c    n n rnnrrnnnss rrnsmmm     m    kkkk kkkkq  keekkkkkkkkkkkkkk
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  161   42  L   V    L L VLLQVIILLL VVLVSSS     S    iiii iiiii  illiiiiiiiiiiiiii
   434   69 P S        +     0   0   52  162   66  N   g    N N NNNNNNNNNN NNNQAAA     V    SSSS SSSSS  SGGSNSNSSSSSNSSSS
   435   70 P R        -     0   0  103  127   86  R   r    R R RRRRRRRRRR RRR....     .    GGGG GGGEG  GAAGGGGGGGGGGGGGG
   436   71 P K        +     0   0   22  130   11  K   K    K K KKKKKKKKKK KKK....     .    KKKK KKKKK  KKKKKKKKKKKKKKKKK
   437   72 P M  S    S-     0   0   12  131   13  M   M    M M MMMMMMMMMM MMM....     .    MMMM MMMMM  MMMMMMMMMMMMMMMMM
   438   73 P S     >  -     0   0   52  139   66  S   S    S S SSSSSSSSSS SSS....     .    TTTT TTTTT  TTTTTTTTTTTTTTTTT
   439   74 P V  H  > S+     0   0  107  138   53  V   A    V V VVVAVVVVVV VVV....     .    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   440   75 P Q  H  > S+     0   0  133  139   51  Q   Q    Q Q QQQQQPPQQQ QQQ....     .    KKKK KKKKK  KKKKQKQKKKKKQKKKK
   441   76 P E  H  > S+     0   0   38  145   27  E   E    E E EEEEEEEEEE EEE....     .    EEEE EEEEE  EEEEEEEEEEEDEEEEE
   442   77 P Y  H  X S+     0   0   36  157   63  Y   Y    Y Y YYYYYYYYYY YYY.QQQ     Q    FFFF FFFFF  FFFFYFYFFFFFYFFFC
   443   78 P E  H  < S+     0   0  111  165   67  E   E    E E EEEEEEEEEE DDEEEEE     E    ASAA ATAAA  AAAANANAAAATNAAAG
   444   79 P L  H >X S+     0   0   45  167   54  L   L    L L MLLLMLLMMM MMMYYYY     Y    VMMM RMMMM  MMMMMMMMTMMMMMMIM
   445   80 P I  H 3< S+     0   0   37  170   72  I   I    L L ILLIILLLLL IILEEEE     E    MMMM MMMMM  MMMRIMIMVMMMIMMMM
   446   81 P H  T 3< S+     0   0  178  170   77  Q   K    K K QKKQQKKKKK QQKMLLL     L    NNNN NNNNN  NNNNHNHNDNNNHNNND
   447   82 P K  T <4 S+     0   0  140  169   68  D   E    E E DEEEDEEEEE EEEIIII     L    EEEE EEEEE  EEEENENEKEEENEEEK
   448   83 P D     <  -     0   0   58  188   39  E   E    E E EEEEEEEEEE EEEQKKK     K    DDDD DDDDD  DDDDDDDDNDDDDDDDN
   449   84 P K        -     0   0  205  170   80  .   .    . . .......... ...EEEE     E    QQRQ QQQRQ  QQQQEQEQLQQQEQQQL
   450   85 P E        -     0   0   45  171   68  .   .    . . .......... ...EEEE     E    DDDD DDDDD  DDDDDDDDDDDDDDDDD
   451   86 P D    >>  -     0   0   87  189   32  D   D    D D DDDDDDDDDD DDDDDDD     D    DDDD DDDDD  DDDDDDDDDDDDDDDDD
   452   87 P E  H 3> S+     0   0  113  188   12  E   E    E E EEEEEEEEEE EEEEEEE     E    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   453   88 P N  H 3> S+     0   0   73  189   59  R   K    G G RGGSRGGGGG RRGQKKK     G    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   454   89 P C  H <> S+     0   0   32  190   71  C   S    C C CCCCCCCCCC SSCCSSS     C    FFFF FFFFF  FFFFFFFFFFFFFFFFF
   455   90 P L  H  X S+     0   0    4  190    2  L   L    L L LLLLLLLLLL LLLLLLL     L    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   456   91 P R  H  X S+     0   0  131  190   62  K   R    K K KKKKKKKKKK KKKRRRR     K    QQQQ QQQQQ  QQQQQQQQQQQQQQQQQ
   457   92 P K  H  X S+     0   0  112  190   60  R   K    K K RSSRRKKKKK HHKKKKK     K    KQQQ QQQQQ  QQQQRQRQQQQQRQQQQ
   458   93 P Y  H  X S+     0   0    7  190    6  Y   Y    Y Y YYYYYYYYYY YYYYYYY     Y    YYYY YYYYY  YYYYYYYYYYYYYYYYY
   459   94 P R  H  X S+     0   0   31  190   33  R   R    R R RRRRRRRRRR RRRRRRR     R    RRRR RRRRR  RRRRRRRRRRRRRRRRR
   460   95 P R  H  X S+     0   0  130  190   46  K   K    R R KKKKKKKKKK KKKKKKK     R    KKKK KKKKK  KKKKKKKKKKKKKKKKK
   461   96 P Q  H  X S+     0   0   96  190   33  Q   Q    Q Q QRRQQRRRRR QQRQQQQ     R    QQQQ QQQQQ  QQQQQQQQQQQQQQQQQ
   462   97 P C  H  X S+     0   0   22  190   71  C   C    C C CCCCCCCCCC CCCCCCC     C    RRRR RRRRR  RRRRRRRRRRRRRRRRR
   463   98 P M  H  X S+     0   0   33  190   10  M   M    M M MMMMMMMMMM MMMMMMM     M    MMMM MMMMM  MMMIMMMMMMMMMMMMM
   464   99 P Q  H  X S+     0   0  115  190   54  Q   Q    E E QQQQQQQQQQ QQQQQQQ     E    EEEE DEEEE  EEEEEEEEEEEEEEEED
   465  100 P D  H  X S+     0   0   46  190   21  E   E    E E EEEEEDDEEE EEEDEEE     E    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   466  101 P M  H  X S+     0   0   23  190    2  M   M    M M MMMMMMMMMM MMMMMMM     M    MMMM MMMMM  MMMMMMMMMMMMMMMMM
   467  102 P H  H  X S+     0   0   64  190   74  H   H    H H HHHHHHHHHH HHHHHHH     H    RQRR RRRRR  QRRRRRRRRRRRRRRRR
   468  103 P Q  H  < S+     0   0  143  190   60  E   E    N N EDDEEDDEEE EEEEEEE     S    QQQQ QQQQQ  QQQQQQQQQQQQQQQQQ
   469  104 P K  H  < S+     0   0  140  190   57  R   R    K K RKKRRKKKKK RRKRRRR     K    QQQQ QQQQQ  QQQQQQQQQQQQQQQQQ
   470  105 P L  H  < S+     0   0   35  190   44  L   L    L L LLLLLLLLLL LLLLLLL     L    LLLL LLLLL  LLLLLLLLFLLLLLLLL
   471  106 P S     <  -     0   0   75  190   81  S   S    S S SSSSSSSSSS SSSSSSS     S    HHHH HHHHH  HHHHYHYHQHHHYHHHH
   472  107 P F        -     0   0   71  188   99  F   F    F F FFFFFFFFFF FFFFFFF     F    KRKK KKKKK  KRRKSKSKKKKKSKKKK
   473  108 P G        -     0   0   36  187   53  G   G    G G GGGGGGGGGG GGGGGGG     G    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   474  109 P P        +     0   0   92  178   42  P   P    P P PPPPPPPPPP PPPPPPP     P    PPPP PPPPP  PPPPQPQPPPPPQPPPP
   475  110 P R        +     0   0  177  184   62  K   K    R R KKKKKRRRRR SSRKKKK     K    QQQQ QQQQQ  QQQQQQQQQQQQQQQQQ
   476  111 P Y        +     0   0   51  185    4  F   F    F F FFFFFFFFFF FFFFFFF     F    FFFF FFFFF  FFFFFFFFFFFFFFFFF
   477  112 P G        +     0   0   12  189   60  E   E    E E EEEEEEEDEE EEDDEEE     E    KRKK KKKKK  RKKKKKKKKKKKKKKKK
   478  113 P F  S    S-     0   0  151  190  102  S   G    G G CGGCCGGGGG QQGSGGS     G    KQQQ QQQQQ  QQQQQQQQQQQQQQQQQ
   479  114 P V  E     -v  532   0H  28  190   13  V   V    V V VVVVVVVVVV VVVVVVV     V    VVVV VVVVV  VVVVVVVVVVVVVVVVV
   480  115 P Y  E     -v  533   0H  71  183   67  H   Y    H H HYYHHHHHHH HHHFYYY     H    FFFF FFFFF  FFFFFFFFFFFFFFFFL
   481  116 P E  E     -v  534   0H 108  190   44  E   D    D D EDDEEEEDDD EEDDDDD     D    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   482  117 P L        -     0   0   12  190   33  L   L    L L LLLLLLLLLL LLLLLLL     L    IIII IIIII  IIIIIIIIIIIIIIIII
   483  118 P E        +     0   0  134  190   75  E   D    D D EDDEEDDDDD EEDEDDD     D    PPPP PPPPP  PPPPTSTSPSSPTSPSP
   484  119 P S  S >> S-     0   0   57  190   54  S   S    S S SSSSSSSSSS SSSSSSS     S    SSSS SSSSS  SSSSSSSSSSSSSSSSS
   485  120 P G  H 3> S+     0   0   15  189   40  G   G    G G GGGGGGGGGG GGGGGGG     G    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   486  121 P E  H 3> S+     0   0  127  190   23  E   E    E E EEEEEEEEEE DDEEEEE     E    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   487  122 P Q  H <> S+     0   0   72  190   62  A   A    A A AAAAAAAAAA AAAAAAA     A    GGGG GGGGG  GGGGAGAGGGGGAGGGG
   488  123 P F  H  X S+     0   0   26  190    1  F   F    F F FFFFFFFFFF FFFFFFF     F    FFFF FFFFF  FFFFFFFFFFFFFFFFF
   489  124 P L  H  X S+     0   0   90  190    6  L   L    L L LLLLLLLLLL LLLLLLL     L    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   490  125 P E  H  X S+     0   0  103  190   40  E   E    E E EEEEEEEEEE EEEDEEE     E    DDED DDDDD  DDDDDDDDDDDDDDDDD
   491  126 P T  H  < S+     0   0   10  190   74  V   V    V V VVVVVVVVVV VVVVVVV     V    MMMM MMMMM  MMMMTMTMMMMMTMMMM
   492  127 P I  H  < S+     0   0   17  190   12  I   I    I I IIIIIIIIII IIIIIII     I    IIII IIIII  IIIIVIVIIIIIVIIII
   493  128 P E  H  < S+     0   0  139  190   19  E   E    E E EEEEEEEEEE EEEEEEE     E    DDDD DDDDD  DDDDDDDDDDDDDDDDD
   494  129 P K  S  < S+     0   0  172  190   33  K   K    K K KKKKKKKKKK KKKNKKK     K    KKKK KKKKK  KKKKKKKKKKKKKKKKK
   495  130 P E  S    S-     0   0   38  185    5  E   E    E E EEEEEEEEEE EEEEEEE     E    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   496  131 P Q    >   -     0   0  116  190   67  H   H    H H HHHHHHHHHH HHHHHHH     H    QQQQ QQQQQ  QQQQHQHQQQQQHQQQQ
   497  132 P K  T 3  S+     0   0  156  190   34  R   R    H H RHHRRYYHHH RRHRRRR     H    KKKK KKKKK  KKKKKKKKKKKKKKKKK
   498  133 P I  T 3  S+     0   0   68  190   87  L   L    S S LSSLLSSSSS LLSLLLL     S    SSSS SSSSS  SSSSSSSSNSSSSSSSS
   499  134 P T    <   -     0   0   10  190   37  T   T    T T TTTTTTTTTT TTTTTTT     T    TTTT TTTTT  TTTTTITITIITTITIT
   500  135 P T  E     -W  558   0H   7  189   62  L   .    V V LVVLLVVVVV LLVLVVV     V    LLLL PVLLL  LLLLLVLVLVVLLVLVL
   501  136 P I  E     -Wx 557 531H   3  190   15  V   V    V V VVVVVVVVVV VVVVVVV     V    IIII IIIII  IIIIIIIIIIIIIIIII
   502  137 P V  E     -Wx 556 532H   0  190   35  V   V    V V VVVVVVVVVV VVVVVVV     V    MMMM MMMMM  MMMMMMMMMMMMMMMMM
   503  138 P V  E     -Wx 555 533H   0  190   13  V   V    V V VVVVVVVVVV VVVVVVV     V    VVVV VVVVV  VVVVIVIVVVVVIVVVV
   504  139 P H  E     -Wx 554 534H   0  190    5  H   H    H H NHHHNHHHHH HHHHHHH     H    HHHH HHHHH  HHHHHHHHHHHHHHHHH
   505  140 P I  E     +Wx 553 535H   2  190    2  I   I    I I IIIIIIIIII IIIIIII     I    IIII IIIII  IIIIIIIIIIIIIIIII
   506  141 P Y  E     - x   0 536H   4  190    3  Y   Y    Y Y YYYYYYYYYY YYYYYYY     Y    YYYY YYYYY  YYYYYYYYYYYYYYYYY
   507  142 P E    >   -     0   0   45  190   26  Q   K    K K QKKQQKKKKK QQKEKKK     K    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   508  143 P D  T 3  S+     0   0   95  190   50  H   D    I I QNNHQVVVVV HHVDDDD     D    DDDD DDDDD  DDDDDDDDDDDDDDDDD
   509  144 P G  T 3  S+     0   0   66  190   50  G   G    G G DGGGDGGGGG GGGGGGG     G    GGGG GGGGG  GGGGDGDGGGGGDGGGG
   510  145 P I  S X> S-     0   0   36  190   33  V   V    I I VIIVVVVVVV VVVIVVV     V    IIII IIIII  IIIIIIIIIIIIIIIIV
   511  146 P K  T 34 S+     0   0  191  190   72  K   P    K K KKKKKKKKKK KKKRPPP     K    PPPP PPPPP  PPPPPPPPPPPPPPPPP
   512  147 P G  T 3> S+     0   0   13  190   23  G   G    G G GGGGGGGGGG GGGGGGG     G    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   513  148 P C  H <> S+     0   0    0  190   36  C   C    C C CCCCCCCCCC CCCCCCC     C    TTTT TTNTT  TTTTATATTTTTTTTTT
   514  149 P D  H  X S+     0   0   78  190   47  E   E    E E EEEEEEEEEE EEEDEEE     E    EDED EEEEE  DEEEEEEEEEEEEEEEE
   515  150 P A  H  > S+     0   0   44  190   50  E   A    Q Q QAAQQEEEEE QQEAAAA     Q    AAAA AAAAA  AAAASASAAAAASAAAA
   516  151 P L  H  X S+     0   0    0  190   11  L   L    L L MLLMMLLLLL LLLLLLL     L    MMMM MMMMM  MMMMLMLMMMMMLMMMM
   517  152 P N  H  X S+     0   0   19  190   16  N   N    N N NNNNNNNNNN NNNNNNN     N    NHNN NNNHN  HNNNHNNNNNNHNNNNN
   518  153 P S  H  X S+     0   0   78  190   57  S   S    S S SSSSSSSSSS SSSNSSS     S    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   519  154 P S  H  X S+     0   0    6  190   35  C   S    C C CCCCCCCCCC CCCCSSS     C    CCCC CCCCC  CCCCCCCCCCCCCCCCC
   520  155 P L  H  X S+     0   0    1  190   10  L   L    L L LLLLLLLLLL LLLLLLL     L    MMMM MMMMM  MMMMMMMMMMMMMMMMM
   521  156 P I  H  X S+     0   0  105  190   85  D   D    D D DDDDDDDDDD DDDTDDD     D    IIII VIIII  IIIIIIIIIIIIIIIII
   522  157 P C  H  X S+     0   0   63  190   41  C   C    C C CCCCCCCCCC CCCCCCC     C    CCCC CCCCC  CCCCCCCCCCCCCCCCC
   523  158 P L  H  X S+     0   0    0  190    4  L   L    L L LLLLLLLLLL LLLLLLL     L    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   524  159 P A  H  < S+     0   0    1  190   11  A   A    A A AAASAAAAAA AAAAAAA     A    AAAA AAAAA  AAAAAAAAAAAAAAAAA
   525  160 P A  H  < S+     0   0   61  190   66  T   T    T T TTTSTIITTT SSTATTT     T    AAAA ATAAA  AAAAAAAATAAAAAGAA
   526  161 P E  H  < S+     0   0   72  190   24  E   E    E E EEEEEEEQQQ EEQEEEE     E    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   527  162 P Y    ><  +     0   0    5  190    2  Y   Y    Y Y YYYYYYYYYY YYYYYYY     Y    YYYY YYYYY  YYYYYYYYYYYYYYYYY
   528  163 P P  T 3  S+     0   0   28  190   28  P   A    P P PPPPPPPPPP SSPSAAA     P    PPPP PPPPP  PPPPPPPPPPPPPPPPP
   529  164 P M  T 3  S+     0   0   26  190   85  S   S    T T TTTTTTTTTT GGTTSSS     T    AAAA AAAAA  AAAATATAAAAATAAAT
   530  165 P V  S <  S-     0   0    1  190    9  V   V    V V VVVVVVVVVV IIVVVVV     V    VVVV VVVVV  VVVVVVVVVVVVVVVVV
   531  166 P K  E     - x   0 501H  37  190    2  K   K    K K KKKKKKKKKK KKKKKKK     K    KKKK KKKKK  KKKKKKKKKKKKKKKKK
   532  167 P F  E     +vx 479 502H   0  190    1  F   F    F F FFFFFFFFFF FFFFFFF     F    FFFF FFFFF  FFFFFFFFFFFFFFFFF
   533  168 P C  E     -vx 480 503H   0  190   19  C   C    C C CCCCCCCCCC CCCCCCC     C    CCCC CCCCC  CCCCCCCCCCCCCCCCC
   534  169 P K  E     +vx 481 504H  51  190   38  R   R    R R RRRRRRRRRR RRRRRRR     K    RRRR RRRRR  RRRRKRRRRRRRRRRKR
   535  170 P I  E     - x   0 505H   1  190   21  I   I    I I IIIIIIIIII IIIIIII     I    VVVV VVVVV  VVVVVVVVVVVVVVVVV
   536  171 P K  E >>  - x   0 506H  52  190   71  D   C    D D DDDDDDDDDD DDDRCCC     D    KKKK KKKKK  KKKKKKKKKKKKKKKKR
   537  172 P A  H >> S+     0   0   13  190   46  A   A    A A AAAAAAAAAA AAAAAAA     A    SSSS SSSSS  SSSSSSSSSSSSSSSSS
   538  173 P S  H 34 S+     0   0   88  190   29  V   C    V V VVVVVVVVVV EEVSCCC     V    SSSS SSSSS  SSSSSSSSSSSSSSSSS
   539  174 P N  H <4 S+     0   0   67  190   86  A   D    S S AAAAAAASSS AASADDD     S    VVVV VVVVV  VVVVLVLVVVVVLVVVV
   540  175 P T  H << S-     0   0   25  190   72  T   T    S S TSSTTSSSSS TTSTTTT     S    IIII IIIII  IIIIIIIIIIIIIIIII
   541  176 P G     <  +     0   0   66  189   23  G   G    G G GGGGGGGGGG GGGGGGG     G    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   542  177 P A    >   -     0   0   39  190   57  A   A    A A AAAAAAAAAA AAAAAAA     A    AAAA AAAAA  AAAAAAAAAAAAAAAAA
   543  178 P G  T 3  S-     0   0   70  189   41  A   G    A A AAAAASSSAA LLSGGGG     A    SSSS SSSSS  SSSSSSSSSSSSSSSSS
   544  179 P D  T 3  S+     0   0  151  189   78  E   D    E E EEEEEEEEEE EEEEDDD     E    SSSS SSSSS  GSSSASASSSSSTSSSS
   545  180 P R  S <  S+     0   0  167  189   57  R   R    R R RRRRRRRRRR RRRRRRR     R    RRRR RRRRR  RRRRRRRRRRRRRRRQR
   546  181 P F  S    S+     0   0   35  189    0  F   F    F F FFFFFFFFFF FFFFFFF     F    FFFF FFFFF  FFFFFFFFFFFFFFFFF
   547  182 P S    >>  -     0   0   34  189   69  S   C    S S SSSSSSSSSS SSSSCCC     S    TTTT TTTTT  TTTTTTTTTTTTTTTTT
   548  183 P S  T 34 S+     0   0   86  189   84  S   D    D D SDDSSDDDDD PPDEDDD     D    RSRR RRRRR  RRRRNRNRRRRRNRRRR
   549  184 P D  T 34 S+     0   0  126  189   66  E   D    E E EEEEEEEDDD EEDDDDD     E    NSNN NNNNN  NNNNNNNNNNNNNNNNN
   550  185 P V  T <4 S+     0   0   20  189   64  V   V    Y Y VYYVVVVVVV VVVVVVV     Y    AAAA AAAAA  AAAAAAAAAAAAAAAAA
   551  186 P L     <  +     0   0    8  190   15  L   L    L L LLLLLLLLLL LLLLLLL     L    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   552  187 P P  S    S+     0   0    1  190    0  P   P    P P PPPPPPPPPP PPPPPPP     P    PPPP PPPPP  PPPPPPPPPPPPPPPPP
   553  188 P T  E     -W  505   0H   1  190   42  T   A    T T TTTTTTTATT AAATAAA     T    AAAA AAAAA  AAAAAAAAAAAAAAAAA
   554  189 P L  E     -WY 504 566H   0  190    2  L   L    L L LLLLLLLLLL LLLLLLL     L    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   555  190 P L  E     -WY 503 565H   4  190   10  L   L    L L LLLLLLLLLL LLLLLLL     L    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   556  191 P V  E     +WY 502 564H   0  190   18  V   V    V V VVVVVVVVVV VVVVVVV     V    ILII IIIII  IIIIVIVIIIIIVIIII
   557  192 P Y  E     +WY 501 562H  31  190    0  Y   Y    Y Y YYYYYYYYYY YYYYYYY     Y    YYYY YYYYY  YYYYYYYYYYYYYYYYY
   558  193 P K  E >  S-WY 500 561H  25  190   13  K   K    K K KKKKKKKKKK KKKKKKK     K    KKKK KKKKK  KKKKKKKKKKKKKKKKK
   559  194 P G  T 3  S-     0   0   25  190   44  A   A    A A SAAASAAAAA AAAAAAA     A    GGGG GGGGG  GGGAAGAGAGGGAGGGA
   560  195 P G  T 3  S+     0   0   48  190   21  G   G    G G GGGGGGGGGG GGGGGGG     G    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   561  196 P E  E <   -Y  558   0H  38  190   37  E   E    E E EEEEEEEEEE EEEEEEE     E    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   562  197 P L  E     +Y  557   0H  34  190   12  L   L    L L LLLLLLLLLL LLLMLLL     L    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   563  198 P L  E     -     0   0H   2  190   21  L   L    L L LLLLLLLLLL LLLLLLL     I    IIII IIIVI  IIIIIIIIIIIVIIIII
   564  199 P S  E     -Y  556   0H   4  190   29  G   G    G G GGGGGGGGGG GGGGGGG     G    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   565  200 P N  E     -Y  555   0H  41  190    0  N   N    N N NNNNNNNNNN NNNNNNN     N    NNNN NNNNN  NNNNNNNNNNNNNNNNN
   566  201 P F  E >   -Y  554   0H   3  189    1  F   F    F F FFFFFFFFFF FFFFFFF     F    FFFF FFFFF  FFFFFFFFFFFFFFFFF
   567  202 P I  T 3  S-     0   0   87  187   24  L   L    L L LLLLLLLLLL LLLLLLL     L    VVVV VVVVV  VVVVVVVVVVVVVVVVV
   568  203 P S  T >  S-     0   0   11  187   69  A   A    S S SSSASAAAAA AAACAAA     S    RRRR RRRRR  RRRRRRRRRRRRRRRRR
   569  204 P V  G X  S+     0   0    0  187   34  V   V    C C ICCIICCCCC VVCVVVV     C    VVVV VVVVV  VVVVIVIVVVVVIVIVV
   570  205 P T  G >  S+     0   0   17  187   36  T   T    T T TTTTTTTTTT TTTTTTT     T    TTTT TTTTT  TTTTTTTTTTTTTTTTT
   571  206 P E  G <  S+     0   0  156  187   34  K   Q    Q Q KQQKKQQQQQ KKQKQQQ     Q    DDDD DDDDD  DDDDDDDDDDDDDDDDD
   572  207 P Q  G <  S+     0   0   84  187   43  H   H    H H HHHNHHHHHH HHHHHHH     H    QQQQ QQQQQ  QQQQQQQQQQQQQQQQQ
   573  208 P L  S <  S-     0   0   31  187   11  F   F    L L FLLFFLLLLL FFLMFFF     M    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   574  209 P A    >   -     0   0   49  187   49  N   S    S S NNNNNTTNSS NNNNSSS     N    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   575  210 P E  T 3  S+     0   0  201  187   27  E   E    E E EEEEEEEEEE EEEEEEE     E    EEEE EEEEE  EEEEEDEDEDDEEDEDE
   576  211 P E  T 3  S+     0   0  166  187   21  E   E    E E EEEEEEEEEE NNEEEEE     E    DDDD DDDDD  DDDDDDDDDDDDDDDDD
   577  212 P F    <   -     0   0   17  187    0  F   F    F F FFFFFFFFFF FFFFFFF     F    FFFF FFFFF  FFFFFFFFFFFFFFFFF
   578  213 P F    >>  -     0   0  146  187   24  F   F    F F FFFFFFFFFF FFFFFFF     F    FFFF FFFFF  FFFFFFFFFFFFFFFFF
   579  214 P T  H 3> S+     0   0   24  186   26  A   A    A A AAAAAAAAAA AAAAAAA     A    AAAA AAAAA  AAAAAAAAAAAAAAAAA
   580  215 P G  H 3> S+     0   0   32  186   71  T   T    T T TTTTTTTTTT TTTTTTT     T    VVVV VVVVV  VVVVVVVVVVVVVVVVV
   581  216 P D  H <> S+     0   0   57  186    4  D   D    D D DDDDDDDDDD DDDDDDD     D    DDDD DDDDD  DDDDDDDDDDDDDDDDD
   582  217 P V  H  X S+     0   0    0  186   23  V   V    V V VVVVVVVVVV VVVVVVV     V    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   583  218 P E  H  X S+     0   0   32  186   10  E   E    E E EEEEEEEEEE EEEEEEE     E    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   584  219 P S  H  X S+     0   0   58  186   51  A   A    A A AGGGAAAAAA GGANAAA     A    AAAA AAAAA  AAAAAAAAAAAAAAAAA
   585  220 P F  H  < S+     0   0    2  187    1  F   F    F F FFFFFFFFFF FFFFFFF     F    FFFF FFFFF  FFFFFFFFFFFFFFFFF
   586  221 P L  H ><>S+     0   0    0  187    0  L   L    L L LLLLLLLLLL LLLLLLL     L    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   587  222 P N  H ><5S+     0   0   61  187   83  N   N    N N NNNNNNNNNN NNNNNNN     N    QQQQ QQQQQ  QQQQQQQQQQQQQQQQQ
   588  223 P E  T 3<5S+     0   0   70  187   16  E   A    S S ESSEESSSSS EESEAAA     S    EEEE EEEEE  EEEEEEEEEEEEEEEEE
   589  224 P Y  T < 5S-     0   0   20  183   49  Y   Y    Y Y YYYYYYYYYY YYYYYYY     Y    FFFF FFFFF  FFFFCFCFFFFFCFFFF
   590  225 P G  T < 5S+     0   0    6  183    7  G   G    G G GGGGGGGGGG GGGGGGG     G    GGGG GGGGG  GGGGGGGGGGGGGGGGG
   591  226 P L      < +     0   0    2  183   19  L   L    L L LLLLLLLLLL LLLLLLL     L    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   592  227 P L  S    S-     0   0   10  178    7  L   L    L L LLLLLLLLLL LLLLLLL     L    LLLL LLLLL  LLLLLLLLLLLLLLLLL
   593  228 P P        -     0   0   40  178   30  P   P    P P PPPPPPPPPP PPPPPPP     P    PPPP PPPPP  PPPPPPPPPPPPPPPPP
   594  229 P E              0   0   94  177   19  E   E    E E EEEEEEEEEE EEEEEEE     E    EEEE EEEEE  DEEEEEEEEEEEEEEEE
   595  230 P K              0   0  161  175   25  K   K    K K KKKKKKKKKK KKKKKKK     K    KKKK KKKKK  KKKKKKKKKKKKKKKKK
## ALIGNMENTS  491 -  560
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....0....:....1....:....2....:....3....:....4....:....5....:....6
     1    2 B S              0   0  117  195   58                                                                        
     2    3 B E     >  -     0   0  107  209   43                                                                        
     3    4 B L  H  > S+     0   0   52  229   31                                                                        
     4    5 B D  H  > S+     0   0  104  229   51                                                                        
     5    6 B Q  H  > S+     0   0  131  230   62                                                                        
     6    7 B L  H  X S+     0   0   27  230   61                                                                        
     7    8 B R  H  X S+     0   0  110  233    4                                                                        
     8    9 B Q  H  X S+     0   0  117  233   49                                                                        
     9   10 B E  H  X S+     0   0   78  234    8                                                                        
    10   11 B A  H  X S+     0   0    1  234    8                                                                        
    11   12 B E  H  X S+     0   0  121  234    8                                                                        
    12   13 B Q  H  X S+     0   0  111  238   70                                                                        
    13   14 B L  H  X S+     0   0   14  238    4                                                                        
    14   15 B K  H  X S+     0   0   99  238   24                                                                        
    15   16 B N  H  X S+     0   0   33  239   51                                                                        
    16   17 B Q  H  X S+     0   0   82  239   58                                                                        
    17   18 B I  H  X S+     0   0    7  240    4                                                                        
    18   19 B R  H  X S+     0   0  135  242   52                                                                        
    19   20 B D  H  X S+     0   0   85  244   60                                                                        
    20   21 B A  H  X S+     0   0   36  243   62                                                                        
    21   22 B R  H >X S+     0   0   22  244   22                                                                        
    22   23 B K  H 3< S+     0   0  136  244   50                                                                        
    23   24 B A  H 3< S+     0   0   79  244   56                                                                        
    24   25 B C  H << S+     0   0   19  244   85                                                                        
    25   26 B A     <  +     0   0   46  244   56                                                                        
    26   27 B D        +     0   0   88  243    0                                                                        
    27   28 B A        -     0   0   17  243   50                                                                        
    28   29 B T    >>  -     0   0   59  244   35                                                                        
    29   30 B L  H 3> S+     0   0    0  244    3                                                                        
    30   31 B S  H 34 S+     0   0   38  244   90                                                                        
    31   32 B Q  H X4 S+     0   0  119  247   50                                                                        
    32   33 B I  H 3< S+     0   0   28  248   52                                                                        
    33   34 B T  T >< S+     0   0    0  249   56                                                                        
    34   35 B N  T <  S+     0   0  129  249   72                                                                        
    35   36 B N  T 3  S+     0   0  111  249   55                                                                        
    36   37 B I  S <  S-     0   0   21  249   49                                                                        
    37   38 B D        -     0   0  138  249   32                                                                        
    38   39 B P        -     0   0   89  250   59                                                                        
    39   40 B V        -     0   0   23  251   30                                                                        
    40   41 B G        -     0   0   54  251   45                                                                        
    41   42 B R        -     0   0  115  251    6                                                                        
    42   43 B I        +     0   0    8  251   27                                                                        
    43   44 B Q        -     0   0   54  251   59                                                                        
    44   45 B M        -     0   0   11  252    5                                                                        
    45   46 B R        -     0   0   49  252   18                                                                        
    46   47 B T  E     +A  338   0A  12  252   43                                                                        
    47   48 B R  E     +     0   0A  56  252   11                                                                        
    48   49 B R  E     -A  337   0A  60  252    9                                                                        
    49   50 B T  E     -A  336   0A  30  252   20                                                                        
    50   51 B L  E     -A  335   0A   0  252    0                                                                        
    51   52 B R        +     0   0  159  252   22                                                                        
    52   53 B G        +     0   0   20  252    0                                                                        
    53   54 B H        -     0   0    4  252    0                                                                        
    54   55 B L  S    S+     0   0  116  252    4                                                                        
    55   56 B A  S    S-     0   0    0  252    4                                                                        
    56   57 B K        -     0   0   15  252    0                                                                        
    57   58 B I  E     -D   73   0B   0  252    1                                                                        
    58   59 B Y  E     -     0   0B   6  252    4                                                                        
    59   60 B A  E     -D   72   0B  13  252    5                                                                        
    60   61 B M  E     -D   71   0B  15  252    4                                                                        
    61   62 B H  E     -D   70   0B  44  252    4                                                                        
    62   63 B W  E     -D   69   0B  11  252    0                                                                        
    63   64 B G    >   -     0   0    3  252   43                                                                        
    64   65 B T  T 3  S+     0   0   75  252   58                                                                        
    65   66 B D  T 3  S-     0   0   80  252    1                                                                        
    66   67 B S  S <  S+     0   0    3  252   50                                                                        
    67   68 B R  S    S+     0   0   94  252   20                                                                        
    68   69 B L  E     + E   0  82B  31  252   80                                                                        
    69   70 B L  E     -DE  62  81B   0  252   12                                                                        
    70   71 B L  E     -DE  61  80B   0  252    3                                                                        
    71   72 B S  E     -DE  60  79B   0  252    1                                                                        
    72   73 B A  E     -DE  59  78B   0  252    1                                                                        
    73   74 B S  E >>  -DE  57  77B   0  252    1                                                                        
    74   75 B Q  T 34 S+     0   0    1  252    1                                                                        
    75   76 B D  T 34 S-     0   0    9  252    1                                                                        
    76   77 B G  T <4 S+     0   0    7  252    1                                                                        
    77   78 B K  E  <  -EF  73  93B  52  252    7                                                                        
    78   79 B L  E     -EF  72  92B   0  252    2                                                                        
    79   80 B I  E     -EF  71  91B   0  252    3                                                                        
    80   81 B I  E     -EF  70  90B   0  252   16                                                                        
    81   82 B W  E     -EF  69  88B   0  252    0                                                                        
    82   83 B D  E >>> -EF  68  87B  21  252    2                                                                        
    83   84 B S  T 345S+     0   0    0  252   52                                                                        
    84   85 B Y  T 345S+     0   0   57  251   17                                                                        
    85   86 B T  T <45S-     0   0   56  252    5                                                                        
    86   87 B T  T  <5 +     0   0   43  252    4                                                                        
    87   88 B N  E   < -F   82   0B  99  252    4                                                                        
    88   89 B K  E     +F   81   0B  95  249    1                                                                        
    89   90 B V  E    S+     0   0B  66  249   17                                                                        
    90   91 B H  E     -F   80   0B  57  249    2                                                                        
    91   92 B A  E     -F   79   0B  43  251    0                                                                        
    92   93 B I  E     -F   78   0B   0  252    0                                                                        
    93   94 B P  E     -F   77   0B  80  252    4                                                                        
    94   95 B L        -     0   0   26  252    0                                                                        
    95   96 B R  S    S+     0   0  190  252    6                                                                        
    96   97 B S        -     0   0   17  252    3                                                                        
    97   98 B S  S    S+     0   0    6  252    3                                                                        
    98   99 B W        +     0   0    2  252    0                                                                        
    99  100 B V  E     -G  115   0C   4  252    0                                                                        
   100  101 B M  E     +     0   0C   5  252    0                                                                        
   101  102 B T  E     -G  114   0C   8  252    0                                                                        
   102  103 B C  E     -G  113   0C   0  252    1                                                                        
   103  104 B A  E     -G  112   0C   0  252    3                                                                        
   104  105 B Y  E     -G  111   0C   9  252    2                                                                        
   105  106 B A    >   -     0   0    0  252   22                                                                        
   106  107 B P  T 3  S+     0   0   64  252    3                                                                        
   107  108 B S  T 3  S-     0   0   47  252    6                                                                        
   108  109 B G  S <  S+     0   0    8  252    6                                                                        
   109  110 B N  S    S+     0   0   50  252   22                                                                        
   110  111 B Y  E     - H   0 124C  50  252   13                                                                        
   111  112 B V  E     -GH 104 123C   0  252    0                                                                        
   112  113 B A  E     +GH 103 122C   0  252    2                                                                        
   113  114 B C  E     +GH 102 121C   5  252    2                                                                        
   114  115 B G  E     +GH 101 120C   1  252    0                                                                        
   115  116 B G  E >  S-G   99   0C   0  252    0                                                                        
   116  117 B L  T 3  S+     0   0    1  252    0                                                                        
   117  118 B D  T 3  S-     0   0   50  252    0                                                                        
   118  119 B N  S <  S+     0   0   30  252    0                                                                        
   119  120 B I  E     - I   0 139C  39  252   24                                                                        
   120  121 B C  E     -HI 114 138C   0  252    3                                                                        
   121  122 B S  E     -HI 113 137C   9  252    6                                                                        
   122  123 B I  E     -HI 112 136C   0  252    2                                                                        
   123  124 B Y  E     -H  111   0C   3  252    0                                                                        
   124  125 B N  E     +H  110   0C  24  252   40                                                                        
   125  126 B L        +     0   0   11  252    1                                                                        
   126  127 B K  S    S+     0   0  109  252   43                                                                        
   127  128 B T  S    S-     0   0   64  252   55                                                                        
   128  129 B R  S    S+     0   0  267  250   17                                                                        
   129  130 B E  S    S-     0   0  173  251    9                                                                        
   130  131 B G        -     0   0   50  252   11                                                                        
   131  132 B N        +     0   0   30  252   52                                                                        
   132  133 B V  S    S+     0   0   58  253   42                                                                        
   133  134 B R  S    S-     0   0  213  253   22                                                                        
   134  135 B V        -     0   0   29  253   15                                                                        
   135  136 B S  S    S-     0   0   43  253   48                                                                        
   136  137 B R  E     -I  122   0C 105  253    7                                                                        
   137  138 B E  E     -I  121   0C  75  253    3                                                                        
   138  139 B L  E     +I  120   0C   1  252    1                                                                        
   139  140 B A  E     +I  119   0C  61  252   57                                                                        
   140  141 B G        +     0   0   50  252   25                                                                        
   141  142 B H        -     0   0    9  252    2                                                                        
   142  143 B T  S    S+     0   0   64  252   42                                                                        
   143  144 B G  S    S-     0   0    0  252    2                                                                        
   144  145 B Y        -     0   0    0  251    0                                                                        
   145  146 B L  E     +J  160   0D   0  251    1                                                                        
   146  147 B S  E     -     0   0D   3  251    0                                                                        
   147  148 B C  E     -J  159   0D   9  251    5                                                                        
   148  149 B C  E     -J  158   0D   0  251    0                                                                        
   149  150 B R  E     -J  157   0D  53  251    4                                                                        
   150  151 B F  E     -J  156   0D  10  251    0                                                                        
   151  152 B L  S    S-     0   0   26  251   24                                                                        
   152  153 B D  S    S-     0   0   60  251   40                                                                        
   153  154 B D  S    S+     0   0   60  251    2                                                                        
   154  155 B N  S    S+     0   0   44  251   65                                                                        
   155  156 B Q  E     + K   0 169D  60  251   47                                                                        
   156  157 B I  E     -JK 150 168D   0  251    1                                                                        
   157  158 B V  E     -JK 149 167D   0  251   22                                                                        
   158  159 B T  E     -JK 148 166D   0  251    1                                                                        
   159  160 B S  E     -JK 147 165D   0  251    2                                                                        
   160  161 B S  E >   -J  145   0D   0  251    0                                                                        
   161  162 B G  T 3  S+     0   0    0  251    0                                                                        
   162  163 B D  T 3  S-     0   0    5  251    0                                                                        
   163  164 B T  S <  S+     0   0    8  251   63                                                                        
   164  165 B T        -     0   0    2  251   16                                                                        
   165  166 B C  E     -KL 159 179D   0  251    0                                                                        
   166  167 B A  E     -KL 158 178D   0  252   62                                                                        
   167  168 B L  E     -KL 157 177D   6  252    6                                                                        
   168  169 B W  E     -KL 156 175D   2  252    0                                                                        
   169  170 B D  E >>> -KL 155 174D  37  252    0                                                                        
   170  171 B I  T 345S+     0   0    7  252    8                                                                        
   171  172 B E  T 345S+     0   0  144  252    6                                                                        
   172  173 B T  T <45S-     0   0   78  252   36                                                                        
   173  174 B G  T  <5 +     0   0   16  253    8                                                                        
   174  175 B Q  E   < -L  169   0D 135  253   68                                                                        
   175  176 B Q  E     -L  168   0D  30  253   45                                                                        
   176  177 B T  E     +     0   0D  64  253   73                                                                        
   177  178 B T  E     -L  167   0D  20  253   47                                                                        
   178  179 B T  E     -L  166   0D   5  253   77                                                                        
   179  180 B F  E     +L  165   0D   1  253    0                                                                        
   180  181 B T        +     0   0   34  253   72                                                                        
   181  182 B G        +     0   0   37  253   30                                                                        
   182  183 B H        -     0   0    7  253    0                                                                        
   183  184 B T  S    S+     0   0   99  253   63                                                                        
   184  185 B G  S    S-     0   0    0  253    1                                                                        
   185  186 B D        -     0   0    1  253    1                                                                        
   186  187 B V  E     -M  202   0E   0  253   22                                                                        
   187  188 B M  E     +     0   0E   3  253    1                                                                        
   188  189 B S  E     -M  201   0E  16  253    8                                                                        
   189  190 B L  E     -M  200   0E   3  253   14                                                                        
   190  191 B S  E     -M  199   0E  21  253   24                                                                        
   191  192 B L  E     -M  198   0E  29  253   29                                                                        
   192  193 B A    >   -     0   0    4  253   57                                                                        
   193  194 B P  T 3  S+     0   0   85  253   13                                                                        
   194  195 B D  T 3  S-     0   0   87  253   52                                                                        
   195  196 B T  S <  S+     0   0   62  253   97                                                                        
   196  197 B R  S    S+     0   0  142  252   61                                                                        
   197  198 B L  E     - N   0 211E  37  252   71                                                                        
   198  199 B F  E     -MN 191 210E   0  252    0                                                                        
   199  200 B V  E     -MN 190 209E   0  252   11                                                                        
   200  201 B S  E     -MN 189 208E   0  252    0                                                                        
   201  202 B G  E     +MN 188 207E   0  252    0                                                                        
   202  203 B A  E >   -M  186   0E   0  252    4                                                                        
   203  204 B C  T 3  S+     0   0    5  252    2                                                                        
   204  205 B D  T 3  S-     0   0   31  252    0                                                                        
   205  206 B A  S <  S+     0   0   20  252   16                                                                        
   206  207 B S  E     - O   0 222E   6  252   69                                                                        
   207  208 B A  E     -NO 201 221E   0  252   35                                                                        
   208  209 B K  E     -NO 200 220E  18  252    0                                                                        
   209  210 B L  E     -NO 199 219E   2  252    8                                                                        
   210  211 B W  E     -NO 198 217E   1  252    0                                                                        
   211  212 B D  E >>> -NO 197 216E  11  252    1                                                                        
   212  213 B V  T 345S+     0   0   12  252   19                                                                        
   213  214 B R  T 345S+     0   0  194  252    1                                                                        
   214  215 B E  T <45S-     0   0  111  252   59                                                                        
   215  216 B G  T  <5 +     0   0    8  252   25                                                                        
   216  217 B M  E      -     0   0    1  252    0                                                                        
   235  236 B P  T 3  S+     0   0   45  252    0                                                                        
   236  237 B N  T 3  S-     0   0   42  252   27                                                                        
   237  238 B G  S <  S+     0   0   12  252    8                                                                        
   238  239 B N  S    S+     0   0   56  252   76                                                                        
   239  240 B A  E     - Q   0 253F   0  252   11                                                                        
   240  241 B F  E     -PQ 233 252F   0  252   16                                                                        
   241  242 B A  E     -PQ 232 251F   0  252   51                                                                        
   242  243 B T  E     -PQ 231 250F   0  252    0                                                                        
   243  244 B G  E     +PQ 230 249F   0  252    0                                                                        
   244  245 B S  E >   -P  228   0F   0  252    0                                                                        
   245  246 B D  T 3  S+     0   0   13  252    0                                                                        
   246  247 B D  T 3  S-     0   0   28  252    0                                                                        
   247  248 B A  S <  S+     0   0    6  252   12                                                                        
   248  249 B T        -     0   0   16  252   42                                                                        
   249  250 B C  E     -QR 243 263F   0  252    3                                                                        
   250  251 B R  E     -QR 242 262F  23  252    3                                                                        
   251  252 B L  E     -QR 241 261F   0  252    0                                                                        
   252  253 B F  E     -QR 240 259F   1  251    0                                                                        
   253  254 B D  E  >> -QR 239 258F   1  251    0                                                                        
   254  255 B L  T >45S+     0   0   15  251   26                                                                        
   255  256 B R  T 345S+     0   0   57  251    0                                                                        
   256  257 B A  T 345S-     0   0    0  251    8                                                                        
   257  258 B D  T <<5 +     0   0    0  251    0                                                                        
   258  259 B Q  E      -     0   0  119  253   47                                                                        
   266  267 B D  T 3  S+     0   0  161  253   25                                                                        
   267  268 B N  T 3  S+     0   0   66  253   48                                                                        
   268  269 B I    <   +     0   0   23  253   21                                                                        
   269  270 B I        +     0   0   97  253   31                                                                        
   270  271 B C  S    S-     0   0   10  253    6                                                                        
   271  272 B G        -     0   0    1  253    0                                                                        
   272  273 B I  E     +S  288   0G   0  253    1                                                                        
   273  274 B T  E     +     0   0G  13  253    4                                                                        
   274  275 B S  E     +S  287   0G  18  252    0                                                                        
   275  276 B V  E     +S  286   0G  10  252    5                                                                        
   276  277 B S  E     -S  285   0G  15  252   21                                                                        
   277  278 B F  E     -S  284   0G  12  252   13                                                                        
   278  279 B S        -     0   0    3  252    1                                                                        
   279  280 B K  S    S+     0   0  104  252   80                                                                        
   280  281 B S  S    S-     0   0    2  252    0                                                                        
   281  282 B G  S    S+     0   0    0  252    0                                                                        
   282  283 B R        +     0   0    8  252    0                                                                        
   283  284 B L  E     - T   0 297G   0  252   11                                                                        
   284  285 B L  E     -ST 277 296G   0  252    3                                                                        
   285  286 B L  E     -ST 276 295G   0  252   13                                                                        
   286  287 B A  E     -ST 275 294G   0  252   11                                                                        
   287  288 B G  E     -ST 274 293G   2  252    4                                                                        
   288  289 B Y  E >   -S  272   0G   4  252    0                                                                        
   289  290 B D  T 3  S+     0   0    3  252    3                                                                        
   290  291 B D  T 3  S-     0   0   37  252    1                                                                        
   291  292 B F  S <  S+     0   0    3  252    3                                                                        
   292  293 B N        -     0   0   15  252   39                                                                        
   293  294 B C  E     -TU 287 307G   0  252    5                                                                        
   294  295 B N  E     -TU 286 306G   5  252   32                                                                        
   295  296 B V  E     -TU 285 305G   0  252    9                                                                        
   296  297 B W  E     -TU 284 303G   6  252    0                                                                        
   297  298 B D  E  >  -T  283   0G   4  252    0                                                                        
   298  299 B A  T  4 S+     0   0    0  252   64                                                                        
   299  300 B L  T  4 S+     0   0    0  252   11                                                                        
   300  301 B K  T  4 S-     0   0   29  252   17                                                                        
   301  302 B A  S  < S+     0   0   17  252   42                                                                        
   302  303 B D  S    S-     0   0   95  252   20                                                                        
   303  304 B R  E     -U  296   0G  69  252   15                                                                        
   304  305 B A  E     -     0   0G  14  252   58                                                                        
   305  306 B G  E     -U  295   0G   4  252    5                                                                        
   306  307 B V  E >   -U  294   0G   7  252   45                                                                        
   307  308 B L  E >  S+U  293   0G   2  251    1                                                                        
   308  309 B A  G >  S-     0   0    4  251   52                                                                        
   309  310 B G  G <   -     0   0    4  251    5                                                                        
   310  311 B H  G <  S+     0   0    8  251    0                                                                        
   311  312 B D    <   -     0   0   26  251   18                                                                        
   312  313 B N  S    S+     0   0   31  251    0                                                                        
   313  314 B R        +     0   0   40  251    1                                                                        
   314  315 B V        +     0   0    2  251    1                                                                        
   315  316 B S  S    S-     0   0    2  251    2                                                                        
   316  317 B C  E     -B  329   0A  10  251    6                                                                        
   317  318 B L  E     -B  328   0A  15  250    4                                                                        
   318  319 B G  E     -B  327   0A  10  250    3                                                                        
   319  320 B V  E     -B  326   0A  25  250    0                                                                        
   320  321 B T    >   -     0   0    3  250   47                                                                        
   321  322 B D  T 3  S+     0   0   98  250   64                                                                        
   322  323 B D  T 3  S-     0   0   51  249    7                                                                        
   323  324 B G  S <  S+     0   0    0  249    5                                                                        
   324  325 B M  S    S+     0   0   36  249   20                                                                        
   325  326 B A        -     0   0    0  249   24                                                                        
   326  327 B V  E     -BC 319 338A   0  248   33                                                                        
   327  328 B A  E     -BC 318 337A   0  247   47                                                                        
   328  329 B T  E     -BC 317 336A   7  247    1                                                                        
   329  330 B G  E     -BC 316 335A   1  247    2                                                                        
   330  331 B S    >   -     0   0    6  247    0                                                                        
   331  332 B W  T 3  S+     0   0    6  247    0                                                                        
   332  333 B D  T 3  S-     0   0   17  247    0                                                                        
   333  334 B S  S <  S+     0   0   12  247    2                                                                        
   334  335 B F        -     0   0   78  247   39                                                                        
   335  336 B L  E     -AC  50 329A   1  247    3                                                                        
   336  337 B K  E     -AC  49 328A  60  246   25                                                                        
   337  338 B I  E     -AC  48 327A   0  244   10                                                                        
   338  339 B W  E      AC  46 326A   2  243    0                                                                        
   339  340 B N              0   0   10  236   46                                                                        
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   85    5                                                                        
   342    3 G V        +     0   0   96   88   62                                                                        
   343    4 G I        -     0   0   38   92   33                                                                        
   344    5 G N    >   -     0   0  109   92   65                                                                        
   345    6 G I  G >  S+     0   0   25   93   47                                                                        
   346    7 G E  G 3  S+     0   0  122  138   45                               N         NN                          N  
   347    8 G D  G <  S+     0   0  133  149   28                               N         NN                          N  
   348    9 G L    <   -     0   0   35  155   20                               M MM      MM M                        M M
   349   10 G T     >  -     0   0   69  156   61                               A AA      AA T                        A P
   350   11 G E  H  > S+     0   0  116  160   37                               K KK      KK T                        K E
   351   12 G K  H >> S+     0   0   66  165   48                               I II      II V                        I V
   352   13 G D  H 3> S+     0   0   39  166   39                               A AA      AA E                        A D
   353   14 G K  H 3X S+     0   0   83  166   83                               D EE      DD E                        E R
   354   15 G L  H < S+     0   0    7  249    4                E     EE  E    E EE EEEE EE EEEEEEEEEEEEE EEEEEEEEEEEE E
   365   26 G V  H 3< S+     0   0   43  249   53                A     AA  A    V VV AAAA VV AAAAAAAAAAAAA AAAAAAAAAAAV L
   366   27 G T  T 3< S+     0   0  116  249   83                S     NS  S    N NN NYYY NN NANCGSGGYGGGS SGGSAGGGGGSN G
   367   28 G L    <   -     0   0   49  249   60                V     II  I    I II VMMM II ILIMILIIMIIIL VVVGVVVVVVVI I
   368   29 G E        -     0   0  191  249   51                Q     EE  E    E EE EDDD ED NKEDECEEDDEEC EEEREEEEEEED E
   369   30 G R        -     0   0   32  249    0                R     RR  R    R RR RRRR RR RRRRRRRRRRRRR RRRRRRRRRRRR R
   370   31 G M        -     0   0   53  249   83                I     II  I    M MM IMMM MM IIIVIIVIIMVII IIISIIIIIIIM Q
   371   32 G L     >  -     0   0   75  248   80                Q     KK  K    M KK KKKK MM CLKKKKKKKKKKK KKKRKKKKKKKK K
   372   33 G V  H  > S+     0   0    4  248   13                V     VV  V    V VV VVVV VV VVVVVVVVVVVVV VVVVVVVVVVVV V
   373   34 G S  H  > S+     0   0   14  248    1                S     SS  S    S SS SSSS SS SSSSSSSSSSSSS SSSSSSSSSSSS S
   374   35 G K  H  > S+     0   0   93  248   37                Q     KK  K    K KK KKKK KK KQKQKKKKKKKKK QQQQQQQQQQQK V
   375   36 G C  H  X S+     0   0    0  249   61                A     AA  A    A AA AAAA AA AAAAAAAAAAAAA AAAAAAAAAAAA V
   376   37 G C  H  X S+     0   0    0  249   62                C     SS  S    A AA SAAA AA IISASAASAAASA AAAAAAAAAAAA A
   377   38 G E  H  X S+     0   0   75  249   68                E     AS  A    A AA AAAA AA EEAASATSAGSSA AAAAAAAAAAAA N
   378   39 G E  H  X S+     0   0   60  249   24                E     DE  D    E EE DDDD DE EDDDDDDDDDDDD EEEEEEEEEEED S
   379   40 G F  H  X S+     0   0    3  249   35                L     LL  L    L LL LLLL LL LILLLLLLLLLLL LLLLLLLLLLLL L
   380   41 G R  H  X S+     0   0   53  249   79                I     MM  M    M LL MLLL MM KKMLMMLMLLLMM QQQQQQQQQQQL K
   381   42 G D  H  X S+     0   0   67  249   66                K     RR  S    A AA HAAA AA QRHAGTQGAQQGT QQQQQQQQQQQA E
   382   43 G Y  H  X S+     0   0   43  249    2                Y     YY  Y    Y FF YYYY YY YFYYYYFYYFFYY YYYYYYYYYYYY Y
   383   44 G V  H >X S+     0   0    0  249   58                C     CC  C    C CC CCCC CC CACCCCCCCCCCC CCCCCCCCCCCC C
   384   45 G E  H 3X S+     0   0   71  249   48                Q     EG  E    E EE SDDD EE LMSEEDTEDAMED LMMMMMMMMILE I
   385   46 G E  H 3< S+     0   0  125  249   57                E     EE  E    A SA EAAA NS EDEAQAEQAEEQA QQQQQQQQQQQT S
   386   47 G R  H XX S+     0   0   94  249   68                H     HH  H    H HH HHHH HH NHHHHHQHHQQHH NNNNNNNNNNNH E
   387   48 G S  H >< S+     0   0   12  249   68                Q     AA  A    A VV AIII AA QMAVAAAAIAAAA AAAAAAAAAAAG S
   388   49 G G  T 3< S+     0   0   38  249   78                K     KK  R    K KK KGGG KK ETKRRCKRGKKRC ACCCCCCCCCGK D
   389   50 G E  T <4 S+     0   0  138  248   52                T     NN  S    E EE YEEE EE NHYENESNESSNE KKKKKKKKKKKE .
   390   51 G D    XX> -     0   0    1  248    0                D     DD  D    D DD DDDD DD DDDDDDDDDDDDD DDDDDDDDDDDD .
   391   52 G P  H 3>5S+     0   0   17  249   27                V     PP  P    P PP PPPP PP FHRPPPPPPPPPP AAAAAAAAAAAP P
   392   53 G L  H 345S+     0   0    6  249    3                L     LL  L    L LL LLLL LL LLLLLLFLLFFLL LLLLLLLLLLLL L
   393   54 G V  H <45S+     0   0   24  249   30                V     LL  L    V VV LIII VV VILVLILLILLLI LLLLLLLLLLLV V
   394   55 G K  H  <5S-     0   0  149  249   78                T     VM  M    T TP MIII TT SITTVTVVIVVVT VVVVVVVIVLVT D
   395   56 G G     << -     0   0   38  249   34                G     GG  G    P PP GPPP PP GGGPGPGGPGGGP GGGGGGGGGGGP G
   396   57 G I        -     0   0   21  249   27                I     II  I    V VL IVVV VV TFIVVVIVVIIVV VVVIVVVVVVVV V
   397   58 G P    >>  -     0   0   80  249   19                S     PP  P    P PP PPPP PP IaPPPPPPPPPPP PPPPPPPPPPPP P
   398   59 G E  T 34 S+     0   0   75  249   62                P     TA  T    S AA AAAA SS YeAAATAAAAAAT TAATAAAAAATS K
   399   60 G D  T 34 S+     0   0  151  249   60                S     SS  S    S AA SSSS SS DKSSSSASSAASS GGGGGGGGGGGS R
   400   61 G K  T <4 S+     0   0  163  249   65                E     EE  E    E EE EEEE EE DAEEEETEETTEE SSSSSSSSSSSE D
   401   62 G N     <  -     0   0    1  249    0                N     NN  N    N NN NNNN NN NNNNNNNNNNNNN NNNNNNNNNNNN N
   402   63 G P  S    S+     0   0   36  249    0                P     PP  P    P PP PPPP PP PPPPPPPPPPPPP PPPPPPPPPPPP P
   403   64 G F  S    S-     0   0    3  249    1                F     FF  F    F FF FFFF FF FFFFFFFFFFFFF FFFFFFFFFFFF F
   404   65 G K              0   0  108  247   34                K     KK       R RR KRRR RR RRKRKRKKRKKKR RRRRRRRRRRRR  
   405   66 G E              0   0  201  242    3                E     DD       E EE DEEE EE EEDEDEEDEEEDE EEEEEEEEEEEE  
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   54   14                                                                        
   408   14 P E        +     0   0  153  148   31  EDDEDEDDEDEEEE DDDDE  EE EDDD D  D    D  D             E            D 
   409   15 P G  S    S+     0   0   38  151   33  GGGGGGGGGGGGGG GGGGG  GG GGGG G  G    G  G             G            G 
   410   16 P Q  S    S-     0   0   94  155   93  ISSIIIITITIIII LSSSI  II ISSS S  S    S  S             S            S 
   411   17 P A        +     0   0    1  157   48  SAASTSTASASSSS TVAAS  SS SAAS A  A    A  A             V            A 
   412   18 P S        +     0   0   28  161   65  VVVVVVVVVVVIII VIVVV  VV VVVV V  V    I  I             V            V 
   413   19 P H  S    S+     0   0   42  167   41  NNNNNNNNNNNNNN NNNNN  NN NNNN N  N    N  N             N            N 
   414   20 P T  S  > S-     0   0    2  172    0  TTTTTTTTTTTTTT TTTTT  TT TTTT T  T    T  T             T            T 
   415   21 P G  H  > S-     0   0   10  177    0  GGGGGGGGGGGGGG GGGGG  GG GGGG G  G    G  G             G            G 
   416   22 P P  H  > S+     0   0   14  183    0  PPPPPPPPPPPPPP PPPPP  PP PPPP P  P    P  P             P            P 
   417   23 P K  H  > S+     0   0    6  183    0  KKKKKKKKKKKKKK KKKKK  KK KKKK K  K    K  K             K            K 
   418   24 P G  H  X S+     0   0    0  183    0  GGGGGGGGGGGGGG GGGGG  GG GGGG G  G    G  G             G            G 
   419   25 P V  H  X S+     0   0    0  183    0  VVVVVVVVVVVVVV VVVVV  VV VVVV V  V    V  V             V            V 
   420   26 P I  H  X S+     0   0    4  183   16  IIIIIIIIIIIIII IIIII  II IIII I  I    I  I             I            I 
   421   27 P N  H  X S+     0   0   48  183   44  NNNHNNNNNNNNNN NNNNN  HN NNNN N  N    N  N             N            H 
   422   28 P D  H  X S+     0   0   14  184    0  DDDDDDDDDDDDDD DDDDD  DD DDDD D  D    D  D             D            D 
   423   29 P W  H  X S+     0   0    6  184    0  WWWWWWWWWWWWWW WWWWW  WW WWWW W  W    W  W             W            W 
   424   30 P R  H  < S+     0   0   67  184   27  RRRRRRRRRRRRRR RRRRR  RR RRRR R  R    R  R             R            R 
   425   31 P K  H >X S+     0   0   67  184   36  RRRRRRRRRRRRRR RRKRR  RR RKKK K  K    R  R             R            R 
   426   32 P F  H >X>S+     0   0    1  184    2  FFFYFFFFFFFFFF FFYFF  YF FYYY Y  Y    F  F             Y            F 
   427   33 P K  H 3<5S+     0   0   30  184    8  kkkkkkkkkkkkkk kkkkk  kk kkkk k  k    k  k             k            k 
   428   34 P L  H <45S+     0   0  139  179    1  llllllllllllll lllll  ll llll l  l    l  l             l            l 
   429   35 P E  H <<5S+     0   0   86  179   10  EEEEEEEEEEEEEE EEEEE  EE EEEE E  E    E  E             E            E 
   430   36 P S  T  <5       0   0   57  180   65  tttttttttttttt ttvtt  tt tvvv v  v    t  t             t            t 
   431   37 P E      <       0   0  118  186   66  kkkkkkkkkkkkkk kkkkk  kk kkkk k  a    k  k             k            a 
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  161   42  iiiiimiiiiiiii iiiii  ii iiii i  l    l  l             l            l 
   434   69 P S        +     0   0   52  162   66  SNNSNSNNSNSSSS NNKNS  SS SQKQ Q  K    N  N             Q            g 
   435   70 P R        -     0   0  103  127   86  GGGGGSGGGGGGGG G.SGG  GG GGGG G  G    .  .             .            l 
   436   71 P K        +     0   0   22  130   11  KKKKKKKKKKKKKK K.KKK  KK KKKK K  K    .  .             G            Q 
   437   72 P M  S    S-     0   0   12  131   13  MMMMMMMMMMMMMM M.MMI  MI IMMM M  M    .  .             K            K 
   438   73 P S     >  -     0   0   52  139   66  TTTTTTTTTTTTTT TGTTT  TT TTTT T  T    .  .             M            R 
   439   74 P V  H  > S+     0   0  107  138   53  LLLLLLLLLLLLLL LKMLL  LL LMMM M  M    .  .             T            G 
   440   75 P Q  H  > S+     0   0  133  139   51  KQQKKKKQKQKKKK KMQQK  KK KQQQ Q  Q    .  .             M            L 
   441   76 P E  H  > S+     0   0   38  145   27  EEEDEEEEDEDEEE ETEEE  DE EEEE E  E    D  D             Q            E 
   442   77 P Y  H  X S+     0   0   36  157   63  FYYFYFYYLYLFFF YMYYM  FM MYYY Y  Y    K  K             E            E 
   443   78 P E  H  < S+     0   0  111  165   67  ANNAGAGNANAGGG GQNNA  AA ANNN N  N    L  L             Y            A 
   444   79 P L  H >X S+     0   0   45  167   54  MMMMVVMMVMVTTT IEMMM  MM MMMM M  M    A  A             K            E 
   445   80 P I  H 3< S+     0   0   37  170   72  MIILVMMIMIMKKK MYLIM  LM MLLL L  L    L  L             M            D 
   446   81 P H  T 3< S+     0   0  178  170   77  NHHNNNKHNHNDDD QNQHT  NT TQQQ Q  Q    H  H             M            D 
   447   82 P K  T <4 S+     0   0  140  169   68  ENNEDEEDEDEKKK DMENG  EG GEEE E  E    Q  Q             N            D 
   448   83 P D     <  -     0   0   58  188   39  DDDDKDEGDGDNNN GFDDD  DD DDED E  E    E  E             D            D 
   449   84 P K        -     0   0  205  170   80  QEEQQQQEQEQLLL QEEEQ  QQ QEEE E  E    A  A             G            D 
   450   85 P E        -     0   0   45  171   68  DDDDDDDDDDDDDD DDDDD  DD DDDD D  D    D  D             D            D 
   451   86 P D    >>  -     0   0   87  189   32  DDDDDDDDDDDDDD DDDDD  DD DDDD D  D    D  D             D            D 
   452   87 P E  H 3> S+     0   0  113  188   12  EEEEEEEEEEEEEE EEEEE  EE EEEE E  E    E  E             E            E 
   453   88 P N  H 3> S+     0   0   73  189   59  EEEEEAEEEAEEEE AEDEE  EE EDDD E  A    E  E             E            A 
   454   89 P C  H <> S+     0   0   32  190   71  FFFFFFFFFFFFFF FFFFF  FF FFFF F  F    F  F             F            F 
   455   90 P L  H  X S+     0   0    4  190    2  LLLLLLLLLLLLLL LLLLL  LL LLLL L  L    L  L             L            L 
   456   91 P R  H  X S+     0   0  131  190   62  QQQQQQQQQQQQQQ QQRQQ  QQ QQQQ Q  Q    Q  Q             Q            Q 
   457   92 P K  H  X S+     0   0  112  190   60  QRRQQQQQQQQQQQ QQQRQ  QQ QHHQ H  H    Q  Q             Q            Q 
   458   93 P Y  H  X S+     0   0    7  190    6  YYYYYYYYYYYYYY YYYYY  YY YYYY Y  Y    Y  Y             Y            Y 
   459   94 P R  H  X S+     0   0   31  190   33  RRRRRRRRRRRRRR RRRRR  RR RRRR R  R    R  R             R            R 
   460   95 P R  H  X S+     0   0  130  190   46  KKKKKKKKKKKKKK KRMKQ  KQ QMMM M  M    K  K             K            Q 
   461   96 P Q  H  X S+     0   0   96  190   33  QQQQQQQQQQQQQQ QQQQQ  QQ QQQK Q  Q    Q  Q             Q            Q 
   462   97 P C  H  X S+     0   0   22  190   71  RRRRRRRRRRRRRR RRRRR  RR RRRR R  R    R  R             R            R 
   463   98 P M  H  X S+     0   0   33  190   10  MMMMMMMMMMMMMM MMIMM  MM MIII I  I    M  M             I            M 
   464   99 P Q  H  X S+     0   0  115  190   54  EEEEDEDEEEEEEE EEEEE  EE EEEE E  E    E  E             E            E 
   465  100 P D  H  X S+     0   0   46  190   21  EEEEEEEEEEEEEE EEEEE  EE EEEE E  E    E  E             E            E 
   466  101 P M  H  X S+     0   0   23  190    2  MMMMMMMMMMMMMM MMMMM  MM MMMM M  M    M  M             M            M 
   467  102 P H  H  X S+     0   0   64  190   74  RRRRRRRRRRRRRR RRRRR  RR RRRR R  R    R  R             K            R 
   468  103 P Q  H  < S+     0   0  143  190   60  QQQQQRQQQQQQQQ QKRQR  QR RRRR R  R    Q  Q             K            R 
   469  104 P K  H  < S+     0   0  140  190   57  QQQQQQQQQQQQQQ QQQQR  QR RQQQ Q  Q    Q  Q             Q            Q 
   470  105 P L  H  < S+     0   0   35  190   44  LLLLLLLLLLLFFF LLLLL  LL LLLF L  L    L  L             L            L 
   471  106 P S     <  -     0   0   75  190   81  HYYHHHHHYHYHHH HYCYH  HH HCCC C  C    H  H             S            Y 
   472  107 P F        -     0   0   71  188   99  KSSKSRSSQSQKKK STRSK  .K KRSR R  R    P  P             Q            g 
   473  108 P G        -     0   0   36  187   53  GGGGgGgGGGGGGG GGGGG  GG GGGG G  G    G  G             P            g 
   474  109 P P        +     0   0   92  178   42  PQQPhPhQPQPPPP PKKQP  PP PKKK K  K    Q  Q             Q            q 
   475  110 P R        +     0   0  177  184   62  QQQQQQQQQQQQQQ QRRQQ  QQ QRRR R  R    Q  Q             L            Q 
   476  111 P Y        +     0   0   51  185    4  FFFFFFFFFFFFFF FFFFF  FF FFFF F  F    F  F             F            F 
   477  112 P G        +     0   0   12  189   60  KKKKSKRKKKKKKK KEEKR  KR RAAQ E  A    K  K             K            R 
   478  113 P F  S    S-     0   0  151  190  102  QKQQQQQQQQQQQQ QSRKQ  QQ QQQQ Q  Q    Q  Q             K            R 
   479  114 P V  E     -v  532   0H  28  190   13  VVVVVVVVVVVVVV VVVVV  VV VVVV V  V    V  V             V            V 
   480  115 P Y  E     -v  533   0H  71  183   67  FFFFFFFFFFFFFF FYQFF  FF FYYY Y  Y    F  F             F            F 
   481  116 P E  E     -v  534   0H 108  190   44  EEEEEEEEEEEEEE EEEEE  EE EEEE E  E    E  E             D            E 
   482  117 P L        -     0   0   12  190   33  IIIIIIIIIIIIII ILLII  II ILLL L  L    I  I             I            L 
   483  118 P E        +     0   0  134  190   75  STTPTPTTPSPPPP PSGTP  PP PSAN N  S    Q  K             A            T 
   484  119 P S  S >> S-     0   0   57  190   54  SSSSSSSSSSSSSS SSGSS  SS SSSS S  G    S  S             S            S 
   485  120 P G  H 3> S+     0   0   15  189   40  GGGGGGGGGGGGGG GGGGG  GG GGGG G  G    G  G             G            G 
   486  121 P E  H 3> S+     0   0  127  190   23  EEEEEEEEEEEEEE EEEEE  EE EEEE E  E    E  E             E            E 
   487  122 P Q  H <> S+     0   0   72  190   62  GAAGAGAEGGGGGG GEEAR  GR RDDD E  D    A  A             E            A 
   488  123 P F  H  X S+     0   0   26  190    1  FFFFFFFFFFFFFF FFFFF  FF FFFF F  F    F  F             F            F 
   489  124 P L  H  X S+     0   0   90  190    6  LLLLLLLLLLLLLL LLLLV  LV VLLL L  L    L  L             L            L 
   490  125 P E  H  X S+     0   0  103  190   40  DDDDDDDDDDDDDD EDEDD  DD DEEE E  E    D  D             D            E 
   491  126 P T  H  < S+     0   0   10  190   74  MTTMTMTTMTMMMM TTATM  MM MAAA A  A    T  T             M            A 
   492  127 P I  H  < S+     0   0   17  190   12  IVVIVIVVIVIIII VILVI  II ILLL L  L    V  V             V            V 
   493  128 P E  H  < S+     0   0  139  190   19  DDDDDDDDDDDDDD DEDDD  DD DDDD D  D    D  D             D            D 
   494  129 P K  S  < S+     0   0  172  190   33  KKKKKKKKKKKKKK KRKKQ  KQ QKKK K  K    R  R             K            G 
   495  130 P E  S    S-     0   0   38  185    5  EEEEEEEEEEEEEE EEEEE  EE EEEE E  E    G  G             E            G 
   496  131 P Q    >   -     0   0  116  190   67  QHHPQQQHQHQQQQ PQDHR  PR RDDD D  D    N  N             H            P 
   497  132 P K  T 3  S+     0   0  156  190   34  KKKKKKKKRKRKKK KKKKK  KK KKKK K  K    K  K             M            R 
   498  133 P I  T 3  S+     0   0   68  190   87  SSSGNSSNSNSSSS SNSSS  GS SSSS S  S    K  K             K            G 
   499  134 P T    <   -     0   0   10  190   37  ITTTTTTTTTTTTT TTTTT  TT TTTT T  T    T  T             T            A 
   500  135 P T  E     -W  558   0H   7  189   62  VLLLLLLLLLLLLL LLLLL  LL LLLL L  L    L  L             R            L 
   501  136 P I  E     -Wx 557 531H   3  190   15  IIIIIIIIIIIIII VVIII  II IVVI V  V    V  V             V            V 
   502  137 P V  E     -Wx 556 532H   0  190   35  MMMMVMVMMMMMMM IMMMI  MI IMMM M  M    M  M             L            L 
   503  138 P V  E     -Wx 555 533H   0  190   13  VIIVIVIIVIVVVV IIIIV  VV VIII I  I    I  I             I            V 
   504  139 P H  E     -Wx 554 534H   0  190    5  HHHHHHHHHHHHHH HHHHH  HH HHHH H  H    H  H             L            H 
   505  140 P I  E     +Wx 553 535H   2  190    2  IIIIIIIIIIIIII IIIII  II IIII I  I    I  I             I            L 
   506  141 P Y  E     - x   0 536H   4  190    3  YYYYYYYYYYYYYY YYYYY  YY YYYY Y  Y    Y  Y             Y            Y 
   507  142 P E    >   -     0   0   45  190   26  EEEEEEEEEEEEEE EEEEE  EE EEEE E  E    E  E             E            E 
   508  143 P D  T 3  S+     0   0   95  190   50  DDDDDDDDDDDDDD DDPDD  DD DSPP P  P    D  D             D            E 
   509  144 P G  T 3  S+     0   0   66  190   50  GDDGDGDDGDGGGG DDEDG  GG GDDD D  E    H  H             D            G 
   510  145 P I  S X> S-     0   0   36  190   33  IIIIIVIIIIIVVV IIIII  II IIIA V  V    L  L             V            V 
   511  146 P K  T 34 S+     0   0  191  190   72  PPPPPPPPPPPPPP PPPPP  PP PPPP P  P    P  P             L            P 
   512  147 P G  T 3> S+     0   0   13  190   23  GGGGGGGGGGGGGG GSGGG  GG GGGG G  G    G  G             G            G 
   513  148 P C  H <> S+     0   0    0  190   36  TSTTATASTSTTTT ACCST  TT TCCC C  C    A  A             C            A 
   514  149 P D  H  X S+     0   0   78  190   47  EEEEEEEEEEEEEE EEDED  ED DEEE E  E    E  E             E            E 
   515  150 P A  H  > S+     0   0   44  190   50  ASSAAAASASAAAA PSASA  AA ASSA A  A    A  A             A            A 
   516  151 P L  H  X S+     0   0    0  190   11  MLLMMMMVMVMMMM MMMLM  MM MMMM M  M    L  L             A            L 
   517  152 P N  H  X S+     0   0   19  190   16  NNNNNHNNNNNNNN NNSNH  NH HSSS S  S    D  D             N            D 
   518  153 P S  H  X S+     0   0   78  190   57  GGGGGGGGGGGGGG GGGGG  GG GGGG G  G    G  G             G            G 
   519  154 P S  H  X S+     0   0    6  190   35  CCCCCCCCCCCCCC CCSCC  CC CSSS S  S    C  C             S            C 
   520  155 P L  H  X S+     0   0    1  190   10  MMMMMMMMMMMMMM MLLMM  MM MLLL L  L    M  M             I            L 
   521  156 P I  H  X S+     0   0  105  190   85  IIIIIIIMLILIII IILIV  IV VMMM M  M    L  L             I            A 
   522  157 P C  H  X S+     0   0   63  190   41  CCCCCCCCCCCCCC CCCCC  CC CCCC C  C    C  C             C            C 
   523  158 P L  H  X S+     0   0    0  190    4  LLLLLLLLLLLLLL LLLLL  LL LLLL L  L    L  L             L            L 
   524  159 P A  H  < S+     0   0    1  190   11  AAAAAAAAAAAAAA AAAAA  AA AAAA A  A    A  A             A            A 
   525  160 P A  H  < S+     0   0   61  190   66  AAAAAGAAAAATTT AAHAS  AS SQQQ Q  Q    A  A             S            G 
   526  161 P E  H  < S+     0   0   72  190   24  EEEEEEEEEEEEEE EEEEE  EE EEEE E  E    E  E             E            Q 
   527  162 P Y    ><  +     0   0    5  190    2  YYYYYYYYYYYYYY YYYYY  YY YYYH Y  Y    Y  Y             Y            Y 
   528  163 P P  T 3  S+     0   0   28  190   28  PPPPSPTPPPPPPP PPPPP  PP PPPP P  P    P  P             P            P 
   529  164 P M  T 3  S+     0   0   26  190   85  ATTASASTATAAAA AVLTA  AA ALLL L  L    T  T             G            G 
   530  165 P V  S <  S-     0   0    1  190    9  VVVVVVVVVVVVVV VVVVV  VV VVVV V  V    V  V             V            V 
   531  166 P K  E     - x   0 501H  37  190    2  KKKKKKKKKKKKKK KKKKK  KK KKKK K  K    K  K             K            K 
   532  167 P F  E     +vx 479 502H   0  190    1  FFFFFFFFFFFFFF FFFFF  FF FFFF F  F    F  F             F            F 
   533  168 P C  E     -vx 480 503H   0  190   19  CCCCCCCCCCCCCC CCCCC  CC CCCC C  C    C  C             C            C 
   534  169 P K  E     +vx 481 504H  51  190   38  RKRRRRRRRRRRRR KRCKR  RR RSSS S  S    R  R             R            R 
   535  170 P I  E     - x   0 505H   1  190   21  VVVVVVVVVVVVVV VIVVV  VV VVVV V  V    V  V             V            D 
   536  171 P K  E >>  - x   0 506H  52  190   71  KKKKKRKKRKRRRR KKRKK  KK KRRR R  R    R  R             K            A 
   537  172 P A  H >> S+     0   0   13  190   46  SSSSSSSSSSSSSS SSSSS  SS SSSS S  S    S  S             S            A 
   538  173 P S  H 34 S+     0   0   88  190   29  SSSSSSSSSSSSSS SSSSS  SS SSSS S  S    S  S             S            P 
   539  174 P N  H <4 S+     0   0   67  190   86  VLLVLVLLVLVVVV LAALV  VV VAAA A  A    L  L             L            W 
   540  175 P T  H << S-     0   0   25  190   72  IIIIIIIIIIIIII IIIII  II IIII I  I    I  I             L            W 
   541  176 P G     <  +     0   0   66  189   23  GGGGGGGGGGGGGG GGSGG  XG GSSS S  S    G  G             G            G 
   542  177 P A    >   -     0   0   39  190   57  AAAAAAAAAAAAAA AAIAA  AA ATTI T  T    T  T             T            P 
   543  178 P G  T 3  S-     0   0   70  189   41  SSSSSSSSSSSSSS SSSSS  .S SSSS S  S    S  S             S            A 
   544  179 P D  T 3  S+     0   0  151  189   78  STTSSSSTSTSSSS TSATR  .R RAAD A  A    S  S             A            P 
   545  180 P R  S <  S+     0   0  167  189   57  RRRRRRRRRRRRRR RRLRR  .R RLLL L  L    R  R             K            R 
   546  181 P F  S    S+     0   0   35  189    0  FFFFFFFFFFFFFF FFFFF  .F FFFF F  F    F  F             F            F 
   547  182 P S    >>  -     0   0   34  189   69  TTTTTTTTTTTTTT TTRTT  .T TRRR R  R    T  T             T            A 
   548  183 P S  T 34 S+     0   0   86  189   84  RNTRNRNNrNRRRR NEENR  .R RDDE D  D    G  G             T            A 
   549  184 P D  T 34 S+     0   0  126  189   66  NNNNNNNNnNNNNN NNSNN  .N NSSS S  S    N  N             Y            A 
   550  185 P V  T <4 S+     0   0   20  189   64  AAAAAAAAAAAAAA AAAAA  .A AAAA A  A    A  A             A            A 
   551  186 P L     <  +     0   0    8  190   15  LLLLLLLLLLLLLL LLLLL  LL LLLL L  L    L  L             L            L 
   552  187 P P  S    S+     0   0    1  190    0  PPPPPPPPPPPPPP PPPPP  PP PPPP P  P    P  P             P            P 
   553  188 P T  E     -W  505   0H   1  190   42  AAAAAAAAAAAAAA AAAAA  AA AAAA A  A    A  A             A            A 
   554  189 P L  E     -WY 504 566H   0  190    2  LLLLLLLLLLLLLL LLLLL  LL LLLL L  L    L  L             L            L 
   555  190 P L  E     -WY 503 565H   4  190   10  LLLLLLLLLLLLLL LLLLL  LL LLLL L  L    L  L             L            L 
   556  191 P V  E     +WY 502 564H   0  190   18  IIVIIIIMIIIIII IVVII  II IVVV V  V    V  V             V            V 
   557  192 P Y  E     +WY 501 562H  31  190    0  YYYYYYYYYYYYYY YYYYY  YY YCYY Y  Y    Y  Y             Y            Y 
   558  193 P K  E >  S-WY 500 561H  25  190   13  KKKKKKKKKKKKKK RKKKK  KK KKKK K  K    K  K             K            K 
   559  194 P G  T 3  S-     0   0   25  190   44  GAAGGGGGGGGAAA GGGAG  GG GAGG A  G    G  G             A            G 
   560  195 P G  T 3  S+     0   0   48  190   21  GGGGGGGGGGGGGG GGGGG  GG GGGG G  G    G  G             G            G 
   561  196 P E  E <   -Y  558   0H  38  190   37  EEEEEEEEEEEEEE EEDED  ED DDDD D  D    E  E             E            E 
   562  197 P L  E     +Y  557   0H  34  190   12  LLLLLLLLLLLLLL LLLLL  LL LLLL L  L    L  L             L            L 
   563  198 P L  E     -     0   0H   2  190   21  IIIIIIIIIIIIII IIIIV  IV VIII I  I    I  I             I            V 
   564  199 P S  E     -Y  556   0H   4  190   29  GGGGGGGGGGGGGG GGGGG  GG GGGG G  G    G  G             G            G 
   565  200 P N  E     -Y  555   0H  41  190    0  NNNNNNNNNNNNNN NNNNN  NN NNNN N  N    N  N             N            N 
   566  201 P F  E >   -Y  554   0H   3  189    1  FFFFFFFFFFFFFF FFF F  FF FFFF F  F    F  F             F            F 
   567  202 P I  T 3  S-     0   0   87  187   24  VVVVVVVVVVVVVV VVV V  VV VVVV V  V    V  V             V            V 
   568  203 P S  T >  S-     0   0   11  187   69  RRRRRRRRRRRRRR RRR R  RR RRRR R  R    R  R             R            R 
   569  204 P V  G X  S+     0   0    0  187   34  VIIVVVVIVIVVVV VIL V  VV VVVL L  L    I  I             I            I 
   570  205 P T  G >  S+     0   0   17  187   36  TTTTTTTTTTTTTT TST T  TT TTTT T  T    T  T             T            T 
   571  206 P E  G <  S+     0   0  156  187   34  DDDDDDDDDDDDDD DDD D  DD DDDD D  D    D  D             D            D 
   572  207 P Q  G <  S+     0   0   84  187   43  QQQQQQQQQQQQQQ QQQ Q  QQ QQQQ Q  Q    Q  Q             Q            Q 
   573  208 P L  S <  S-     0   0   31  187   11  LLLLLLLLLLLLLL LLL L  LL LLLL L  L    L  L             L            L 
   574  209 P A    >   -     0   0   49  187   49  GGGGGGGGGGGGGG GGG G  GG GGGG G  G    G  G             G            G 
   575  210 P E  T 3  S+     0   0  201  187   27  DEEEEEEEEEEEEE EME E  EE EEEE E  D    E  E             V            L 
   576  211 P E  T 3  S+     0   0  166  187   21  DDDDDDDDDDDDDD DDD D  DD DDDD D  D    D  D             D            D 
   577  212 P F    <   -     0   0   17  187    0  FFFFFFFFFFFFFF FFF F  FF FFFF F  F    F  F             F            F 
   578  213 P F    >>  -     0   0  146  187   24  FFFFFFFFFFFFFF FFF F  FF FLFF F  F    F  F             F            F 
   579  214 P T  H 3> S+     0   0   24  186   26  AAAAAAAAAAAAAA AAA A  .A AAAA A  A    A  A             A            A 
   580  215 P G  H 3> S+     0   0   32  186   71  VVVVVVVVVVVVVV VVV V  .V VVVV V  V    A  A             V            D 
   581  216 P D  H <> S+     0   0   57  186    4  DDDDDDDDDDDDDD DDD D  .D DDDD D  D    D  D             D            D 
   582  217 P V  H  X S+     0   0    0  186   23  LLLLLLLLLLLLLL LLL L  .L LVVV L  L    L  L             L            L 
   583  218 P E  H  X S+     0   0   32  186   10  EEEEEEEEEEEEEE EEE E  .E EEEE E  E    E  E             E            E 
   584  219 P S  H  X S+     0   0   58  186   51  AAAAAAAAAAAAAA AAA A  .A AAAA A  A    A  A             A            S 
   585  220 P F  H  < S+     0   0    2  187    1  FFFFFFFFFFFFFF FFL F  FF FLLL L  L    F  F             F            F 
   586  221 P L  H ><>S+     0   0    0  187    0  LLLLLLLLLLLLLL LLL L  LL LLLL L  L    L  L             L            L 
   587  222 P N  H ><5S+     0   0   61  187   83  QQQQQQQQQQQQQQ QRQ Q  QQ QQQQ Q  Q    Q  Q             H            Q 
   588  223 P E  T 3<5S+     0   0   70  187   16  EEEEEEEEEEEEEE EEE E  EE EEEE E  E    E  E             E            E 
   589  224 P Y  T < 5S-     0   0   20  183   49  FCCFCFCCFCFFFF CCY C  FC CYYY Y  Y    F  F             C            C 
   590  225 P G  T < 5S+     0   0    6  183    7  GGGGGGGGGGGGGG GSG G  GG GGGG G  G    S  S             G            G 
   591  226 P L      < +     0   0    2  183   19  LLLLLLLLLLLLLL LLL L  LL LLML L  L    L  L             L            L 
   592  227 P L  S    S-     0   0   10  178    7  LLLLLLLLLLLLLL LLL L  LL LLLL L  L    L  L             L            L 
   593  228 P P        -     0   0   40  178   30  PPPPPPPPPPPPPP PPP P  PP PPPP P  P    P  P             P            P 
   594  229 P E              0   0   94  177   19  EEEEEEEEEEEEEE DEE A  EA ADDE E  D    E  E             E            E 
   595  230 P K              0   0  161  175   25  KKKKKKKKKKKKKK KKK K  KK KKKK K  K    K  K             K            K 
## ALIGNMENTS  561 -  630
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....7....:....8....:....9....:....0....:....1....:....2....:....3
     1    2 B S              0   0  117  195   58                                                                        
     2    3 B E     >  -     0   0  107  209   43                                                                        
     3    4 B L  H  > S+     0   0   52  229   31                                                                        
     4    5 B D  H  > S+     0   0  104  229   51                                                                        
     5    6 B Q  H  > S+     0   0  131  230   62                                  Q                                     
     6    7 B L  H  X S+     0   0   27  230   61                                  A                                     
     7    8 B R  H  X S+     0   0  110  233    4                                  K                                     
     8    9 B Q  H  X S+     0   0  117  233   49                                  Q                                     
     9   10 B E  H  X S+     0   0   78  234    8                                  E                                     
    10   11 B A  H  X S+     0   0    1  234    8                                  A                                     
    11   12 B E  H  X S+     0   0  121  234    8                                  K                                     
    12   13 B Q  H  X S+     0   0  111  238   70                                  A                                     
    13   14 B L  H  X S+     0   0   14  238    4                                  L                                     
    14   15 B K  H  X S+     0   0   99  238   24                                  F                                     
    15   16 B N  H  X S+     0   0   33  239   51                                  G                                     
    16   17 B Q  H  X S+     0   0   82  239   58                                  E                                     
    17   18 B I  H  X S+     0   0    7  240    4                                  V                                     
    18   19 B R  H  X S+     0   0  135  242   52                                  E                                     
    19   20 B D  H  X S+     0   0   85  244   60                                  D                                     
    20   21 B A  H  X S+     0   0   36  243   62                                  I                                     
    21   22 B R  H >X S+     0   0   22  244   22                                  H                                     
    22   23 B K  H 3< S+     0   0  136  244   50                                  L                                     
    23   24 B A  H 3< S+     0   0   79  244   56                                  R                                     
    24   25 B C  H << S+     0   0   19  244   85                                  I                                     
    25   26 B A     <  +     0   0   46  244   56                                  R                                     
    26   27 B D        +     0   0   88  243    0                                  D                                     
    27   28 B A        -     0   0   17  243   50                                  T                                     
    28   29 B T    >>  -     0   0   59  244   35                                  T                                     
    29   30 B L  H 3> S+     0   0    0  244    3                                  L                                     
    30   31 B S  H 34 S+     0   0   38  244   90                                  V                                     
    31   32 B Q  H X4 S+     0   0  119  247   50                                  K                                     
    32   33 B I  H 3< S+     0   0   28  248   52                                  A                                     
    33   34 B T  T >< S+     0   0    0  249   56                                  A                                     
    34   35 B N  T <  S+     0   0  129  249   72                                  S                                     
    35   36 B N  T 3  S+     0   0  111  249   55                                  S                                     
    36   37 B I  S <  S-     0   0   21  249   49                                  I                                     
    37   38 B D        -     0   0  138  249   32                                  R                                     
    38   39 B P        -     0   0   89  250   59                                  P                                     
    39   40 B V        -     0   0   23  251   30                                  L                                     
    40   41 B G        -     0   0   54  251   45                                  N                                     
    41   42 B R        -     0   0  115  251    6                                  A                                     
    42   43 B I        +     0   0    8  251   27                                  g                                     
    43   44 B Q        -     0   0   54  251   59                                  i                                     
    44   45 B M        -     0   0   11  252    5                                  l                                     
    45   46 B R        -     0   0   49  252   18                                  K                                     
    46   47 B T  E     +A  338   0A  12  252   43                                  L                                     
    47   48 B R  E     +     0   0A  56  252   11                                  Y                                     
    48   49 B R  E     -A  337   0A  60  252    9                                  H                                     
    49   50 B T  E     -A  336   0A  30  252   20                                  T                                     
    50   51 B L  E     -A  335   0A   0  252    0                                  L                                     
    51   52 B R        +     0   0  159  252   22                                  R                                     
    52   53 B G        +     0   0   20  252    0                                  G                                     
    53   54 B H        -     0   0    4  252    0                                  H                                     
    54   55 B L  S    S+     0   0  116  252    4                                  Q                                     
    55   56 B A  S    S-     0   0    0  252    4                                  N                                     
    56   57 B K        -     0   0   15  252    0                                  K                                     
    57   58 B I  E     -D   73   0B   0  252    1                                  V                                     
    58   59 B Y  E     -     0   0B   6  252    4                                  A                                     
    59   60 B A  E     -D   72   0B  13  252    5                                  Q                                     
    60   61 B M  E     -D   71   0B  15  252    4                                  V                                     
    61   62 B H  E     -D   70   0B  44  252    4                                  R                                     
    62   63 B W  E     -D   69   0B  11  252    0                                  W                                     
    63   64 B G    >   -     0   0    3  252   43                                  S                                     
    64   65 B T  T 3  S+     0   0   75  252   58                                  S                                     
    65   66 B D  T 3  S-     0   0   80  252    1                                  N                                     
    66   67 B S  S <  S+     0   0    3  252   50                                  S                                     
    67   68 B R  S    S+     0   0   94  252   20                                  S                                     
    68   69 B L  E     + E   0  82B  31  252   80                                  Q                                     
    69   70 B L  E     -DE  62  81B   0  252   12                                  V                                     
    70   71 B L  E     -DE  61  80B   0  252    3                                  L                                     
    71   72 B S  E     -DE  60  79B   0  252    1                                  S                                     
    72   73 B A  E     -DE  59  78B   0  252    1                                  A                                     
    73   74 B S  E >>  -DE  57  77B   0  252    1                                  S                                     
    74   75 B Q  T 34 S+     0   0    1  252    1                                  Q                                     
    75   76 B D  T 34 S-     0   0    9  252    1                                  D                                     
    76   77 B G  T <4 S+     0   0    7  252    1                                  G                                     
    77   78 B K  E  <  -EF  73  93B  52  252    7                                  Y                                     
    78   79 B L  E     -EF  72  92B   0  252    2                                  L                                     
    79   80 B I  E     -EF  71  91B   0  252    3                                  I                                     
    80   81 B I  E     -EF  70  90B   0  252   16                                  L                                     
    81   82 B W  E     -EF  69  88B   0  252    0                                  W                                     
    82   83 B D  E >>> -EF  68  87B  21  252    2                                  D                                     
    83   84 B S  T 345S+     0   0    0  252   52                                  i                                     
    84   85 B Y  T 345S+     0   0   57  251   17                                  f                                     
    85   86 B T  T <45S-     0   0   56  252    5                                  K                                     
    86   87 B T  T  <5 +     0   0   43  252    4                                  K                                     
    87   88 B N  E   < -F   82   0B  99  252    4                                  K                                     
    88   89 B K  E     +F   81   0B  95  249    1                                  .                                     
    89   90 B V  E    S+     0   0B  66  249   17                                  .                                     
    90   91 B H  E     -F   80   0B  57  249    2                                  .                                     
    91   92 B A  E     -F   79   0B  43  251    0                                  A                                     
    92   93 B I  E     -F   78   0B   0  252    0                                  I                                     
    93   94 B P  E     -F   77   0B  80  252    4                                  F                                     
    94   95 B L        -     0   0   26  252    0                                  L                                     
    95   96 B R  S    S+     0   0  190  252    6                                  E                                     
    96   97 B S        -     0   0   17  252    3                                  N                                     
    97   98 B S  S    S+     0   0    6  252    3                                  Q                                     
    98   99 B W        +     0   0    2  252    0                                  W                                     
    99  100 B V  E     -G  115   0C   4  252    0                                  V                                     
   100  101 B M  E     +     0   0C   5  252    0                                  L                                     
   101  102 B T  E     -G  114   0C   8  252    0                                  T                                     
   102  103 B C  E     -G  113   0C   0  252    1                                  C                                     
   103  104 B A  E     -G  112   0C   0  252    3                                  A                                     
   104  105 B Y  E     -G  111   0C   9  252    2                                  I                                     
   105  106 B A    >   -     0   0    0  252   22                                  A                                     
   106  107 B P  T 3  S+     0   0   64  252    3                                  P                                     
   107  108 B S  T 3  S-     0   0   47  252    6                                  N                                     
   108  109 B G  S <  S+     0   0    8  252    6                                  C                                     
   109  110 B N  S    S+     0   0   50  252   22                                  E                                     
   110  111 B Y  E     - H   0 124C  50  252   13                                  N                                     
   111  112 B V  E     -GH 104 123C   0  252    0                                  V                                     
   112  113 B A  E     +GH 103 122C   0  252    2                                  V                                     
   113  114 B C  E     +GH 102 121C   5  252    2                                  S                                     
   114  115 B G  E     +GH 101 120C   1  252    0                                  G                                     
   115  116 B G  E >  S-G   99   0C   0  252    0                                  G                                     
   116  117 B L  T 3  S+     0   0    1  252    0                                  L                                     
   117  118 B D  T 3  S-     0   0   50  252    0                                  D                                     
   118  119 B N  S <  S+     0   0   30  252    0                                  N                                     
   119  120 B I  E     - I   0 139C  39  252   24                                  T                                     
   120  121 B C  E     -HI 114 138C   0  252    3                                  L                                     
   121  122 B S  E     -HI 113 137C   9  252    6                                  T                                     
   122  123 B I  E     -HI 112 136C   0  252    2                                  V                                     
   123  124 B Y  E     -H  111   0C   3  252    0                                  Y                                     
   124  125 B N  E     +H  110   0C  24  252   40                                  N                                     
   125  126 B L        +     0   0   11  252    1                                  V                                     
   126  127 B K  S    S+     0   0  109  252   43                                  S                                     
   127  128 B T  S    S-     0   0   64  252   55                                  s                                     
   128  129 B R  S    S+     0   0  267  250   17                                  y                                     
   129  130 B E  S    S-     0   0  173  251    9                                  E                                     
   130  131 B G        -     0   0   50  252   11                                  q                                     
   131  132 B N        +     0   0   30  252   52                                  y                                     
   132  133 B V  S    S+     0   0   58  253   42                                  S                                     
   133  134 B R  S    S-     0   0  213  253   22                                  S                                     
   134  135 B V        -     0   0   29  253   15                                  V                                     
   135  136 B S  S    S-     0   0   43  253   48                                  S                                     
   136  137 B R  E     -I  122   0C 105  253    7                                  A                                     
   137  138 B E  E     -I  121   0C  75  253    3                                  V                                     
   138  139 B L  E     +I  120   0C   1  252    1                                  F                                     
   139  140 B A  E     +I  119   0C  61  252   57                                  K                                     
   140  141 B G        +     0   0   50  252   25                                  G                                     
   141  142 B H        -     0   0    9  252    2                                  H                                     
   142  143 B T  S    S+     0   0   64  252   42                                  R                                     
   143  144 B G  S    S-     0   0    0  252    2                                  A                                     
   144  145 B Y        -     0   0    0  251    0                                  Y                                     
   145  146 B L  E     +J  160   0D   0  251    1                                  I                                     
   146  147 B S  E     -     0   0D   3  251    0                                  S                                     
   147  148 B C  E     -J  159   0D   9  251    5                                  D                                     
   148  149 B C  E     -J  158   0D   0  251    0                                  C                                     
   149  150 B R  E     -J  157   0D  53  251    4                                  D                                     
   150  151 B F  E     -J  156   0D  10  251    0                                  F                                     
   151  152 B L  S    S-     0   0   26  251   24                                  T                                     
   152  153 B D  S    S-     0   0   60  251   40                                  S                                     
   153  154 B D  S    S+     0   0   60  251    2                                  N                                     
   154  155 B N  S    S+     0   0   44  251   65                                  H                                     
   155  156 B Q  E     + K   0 169D  60  251   47                                  H                                     
   156  157 B I  E     -JK 150 168D   0  251    1                                  L                                     
   157  158 B V  E     -JK 149 167D   0  251   22                                  V                                     
   158  159 B T  E     -JK 148 166D   0  251    1                                  T                                     
   159  160 B S  E     -JK 147 165D   0  251    2                                  S                                     
   160  161 B S  E >   -J  145   0D   0  251    0                                  S                                     
   161  162 B G  T 3  S+     0   0    0  251    0                                  G                                     
   162  163 B D  T 3  S-     0   0    5  251    0                                  D                                     
   163  164 B T  S <  S+     0   0    8  251   63                                  M                                     
   164  165 B T        -     0   0    2  251   16                                  T                                     
   165  166 B C  E     -KL 159 179D   0  251    0                                  C                                     
   166  167 B A  E     -KL 158 178D   0  252   62                                  A                                     
   167  168 B L  E     -KL 157 177D   6  252    6                                  M                                     
   168  169 B W  E     -KL 156 175D   2  252    0                                  W                                     
   169  170 B D  E >>> -KL 155 174D  37  252    0                                  D                                     
   170  171 B I  T 345S+     0   0    7  252    8                                  M                                     
   171  172 B E  T 345S+     0   0  144  252    6                                  A                                     
   172  173 B T  T <45S-     0   0   78  252   36                                  K                                     
   173  174 B G  T  <5 +     0   0   16  253    8                                  G                                     
   174  175 B Q  E   < -L  169   0D 135  253   68                                  S                                     
   175  176 B Q  E     -L  168   0D  30  253   45                                  K                                     
   176  177 B T  E     +     0   0D  64  253   73                                  V                                     
   177  178 B T  E     -L  167   0D  20  253   47                                  R                                     
   178  179 B T  E     -L  166   0D   5  253   77                                  D                                     
   179  180 B F  E     +L  165   0D   1  253    0                                  F                                     
   180  181 B T        +     0   0   34  253   72                                  V                                     
   181  182 B G        +     0   0   37  253   30                                  E                                     
   182  183 B H        -     0   0    7  253    0                                  H                                     
   183  184 B T  S    S+     0   0   99  253   63                                  L                                     
   184  185 B G  S    S-     0   0    0  253    1                                  G                                     
   185  186 B D        -     0   0    1  253    1                                  D                                     
   186  187 B V  E     -M  202   0E   0  253   22                                  V                                     
   187  188 B M  E     +     0   0E   3  253    1                                  L                                     
   188  189 B S  E     -M  201   0E  16  253    8                                  C                                     
   189  190 B L  E     -M  200   0E   3  253   14                                  L                                     
   190  191 B S  E     -M  199   0E  21  253   24                                  s                                     
   191  192 B L  E     -M  198   0E  29  253   29                                  i                                     
   192  193 B A    >   -     0   0    4  253   57                                  S                                     
   193  194 B P  T 3  S+     0   0   85  253   13                                  S                                     
   194  195 B D  T 3  S-     0   0   87  253   52                                  Q                                     
   195  196 B T  S <  S+     0   0   62  253   97                                  s                                     
   196  197 B R  S    S+     0   0  142  252   61                                  p                                     
   197  198 B L  E     - N   0 211E  37  252   71                                  L                                     
   198  199 B F  E     -MN 191 210E   0  252    0                                  F                                     
   199  200 B V  E     -MN 190 209E   0  252   11                                  V                                     
   200  201 B S  E     -MN 189 208E   0  252    0                                  S                                     
   201  202 B G  E     +MN 188 207E   0  252    0                                  G                                     
   202  203 B A  E >   -M  186   0E   0  252    4                                  S                                     
   203  204 B C  T 3  S+     0   0    5  252    2                                  A                                     
   204  205 B D  T 3  S-     0   0   31  252    0                                  D                                     
   205  206 B A  S <  S+     0   0   20  252   16                                  G                                     
   206  207 B S  E     - O   0 222E   6  252   69                                  Y                                     
   207  208 B A  E     -NO 201 221E   0  252   35                                  A                                     
   208  209 B K  E     -NO 200 220E  18  252    0                                  K                                     
   209  210 B L  E     -NO 199 219E   2  252    8                                  V                                     
   210  211 B W  E     -NO 198 217E   1  252    0                                  W                                     
   211  212 B D  E >>> -NO 197 216E  11  252    1                                  D                                     
   212  213 B V  T 345S+     0   0   12  252   19                                  P                                     
   213  214 B R  T 345S+     0   0  194  252    1                                  R                                     
   214  215 B E  T <45S-     0   0  111  252   59                                  C                                     
   215  216 B G  T  <5 +     0   0    8  252   25                                  Q                                     
   216  217 B M  E      -     0   0    1  252    0                                  F                                     
   235  236 B P  T 3  S+     0   0   45  252    0                                  P                                     
   236  237 B N  T 3  S-     0   0   42  252   27                                  E                                     
   237  238 B G  S <  S+     0   0   12  252    8                                  N                                     
   238  239 B N  S    S+     0   0   56  252   76                                  H                                     
   239  240 B A  E     - Q   0 253F   0  252   11                                  S                                     
   240  241 B F  E     -PQ 233 252F   0  252   16                                  F                                     
   241  242 B A  E     -PQ 232 251F   0  252   51                                  V                                     
   242  243 B T  E     -PQ 231 250F   0  252    0                                  T                                     
   243  244 B G  E     +PQ 230 249F   0  252    0                                  G                                     
   244  245 B S  E >   -P  228   0F   0  252    0                                  S                                     
   245  246 B D  T 3  S+     0   0   13  252    0                                  D                                     
   246  247 B D  T 3  S-     0   0   28  252    0                                  D                                     
   247  248 B A  S <  S+     0   0    6  252   12                                  G                                     
   248  249 B T        -     0   0   16  252   42                                  I                                     
   249  250 B C  E     -QR 243 263F   0  252    3                                  I                                     
   250  251 B R  E     -QR 242 262F  23  252    3                                  R                                     
   251  252 B L  E     -QR 241 261F   0  252    0                                  L                                     
   252  253 B F  E     -QR 240 259F   1  251    0                                  F                                     
   253  254 B D  E  >> -QR 239 258F   1  251    0                                  D                                     
   254  255 B L  T >45S+     0   0   15  251   26                                  M                                     
   255  256 B R  T 345S+     0   0   57  251    0                                  R                                     
   256  257 B A  T 345S-     0   0    0  251    8                                  S                                     
   257  258 B D  T <<5 +     0   0    0  251    0                                  D                                     
   258  259 B Q  E      -     0   0  119  253   47                                  s                                     
   266  267 B D  T 3  S+     0   0  161  253   25                                  N                                     
   267  268 B N  T 3  S+     0   0   66  253   48                                  Y                                     
   268  269 B I    <   +     0   0   23  253   21                                  N                                     
   269  270 B I        +     0   0   97  253   31                                  I                                     
   270  271 B C  S    S-     0   0   10  253    6                                  P                                     
   271  272 B G        -     0   0    1  253    0                                  G                                     
   272  273 B I  E     +S  288   0G   0  253    1                                  I                                     
   273  274 B T  E     +     0   0G  13  253    4                                  V                                     
   274  275 B S  E     +S  287   0G  18  252    0                                  S                                     
   275  276 B V  E     +S  286   0G  10  252    5                                  L                                     
   276  277 B S  E     -S  285   0G  15  252   21                                  D                                     
   277  278 B F  E     -S  284   0G  12  252   13                                  L                                     
   278  279 B S        -     0   0    3  252    1                                  S                                     
   279  280 B K  S    S+     0   0  104  252   80                                  K                                     
   280  281 B S  S    S-     0   0    2  252    0                                  S                                     
   281  282 B G  S    S+     0   0    0  252    0                                  G                                     
   282  283 B R        +     0   0    8  252    0                                  R                                     
   283  284 B L  E     - T   0 297G   0  252   11                                  L                                     
   284  285 B L  E     -ST 277 296G   0  252    3                                  I                                     
   285  286 B L  E     -ST 276 295G   0  252   13                                  Y                                     
   286  287 B A  E     -ST 275 294G   0  252   11                                  G                                     
   287  288 B G  E     -ST 274 293G   2  252    4                                  C                                     
   288  289 B Y  E >   -S  272   0G   4  252    0                                  Y                                     
   289  290 B D  T 3  S+     0   0    3  252    3                                  A                                     
   290  291 B D  T 3  S-     0   0   37  252    1                                  D                                     
   291  292 B F  S <  S+     0   0    3  252    3                                  Y                                     
   292  293 B N        -     0   0   15  252   39                                  G                                     
   293  294 B C  E     -TU 287 307G   0  252    5                                  C                                     
   294  295 B N  E     -TU 286 306G   5  252   32                                  I                                     
   295  296 B V  E     -TU 285 305G   0  252    9                                  I                                     
   296  297 B W  E     -TU 284 303G   6  252    0                                  W                                     
   297  298 B D  E  >  -T  283   0G   4  252    0                                  D                                     
   298  299 B A  T  4 S+     0   0    0  252   64                                  T                                     
   299  300 B L  T  4 S+     0   0    0  252   11                                  L                                     
   300  301 B K  T  4 S-     0   0   29  252   17                                  K                                     
   301  302 B A  S  < S+     0   0   17  252   42                                  G                                     
   302  303 B D  S    S-     0   0   95  252   20                                  Q                                     
   303  304 B R  E     -U  296   0G  69  252   15                                  V                                     
   304  305 B A  E     -     0   0G  14  252   58                                  V                                     
   305  306 B G  E     -U  295   0G   4  252    5                                  G                                     
   306  307 B V  E >   -U  294   0G   7  252   45                                  K                                     
   307  308 B L  E >  S+U  293   0G   2  251    1                                  L                                     
   308  309 B A  G >  S-     0   0    4  251   52                                  g                                     
   309  310 B G  G <   -     0   0    4  251    5                                  g                                     
   310  311 B H  G <  S+     0   0    8  251    0                                  H                                     
   311  312 B D    <   -     0   0   26  251   18                                  S                                     
   312  313 B N  S    S+     0   0   31  251    0                                  N                                     
   313  314 B R        +     0   0   40  251    1                                  K                                     
   314  315 B V        +     0   0    2  251    1                                  V                                     
   315  316 B S  S    S-     0   0    2  251    2                                  N                                     
   316  317 B C  E     -B  329   0A  10  251    6                                  Q                                     
   317  318 B L  E     -B  328   0A  15  250    4                                  V                                     
   318  319 B G  E     -B  327   0A  10  250    3                                  R                                     
   319  320 B V  E     -B  326   0A  25  250    0                                  V                                     
   320  321 B T    >   -     0   0    3  250   47                                  S                                     
   321  322 B D  T 3  S+     0   0   98  250   64                                  P                                     
   322  323 B D  T 3  S-     0   0   51  249    7                                  D                                     
   323  324 B G  S <  S+     0   0    0  249    5                                  G                                     
   324  325 B M  S    S+     0   0   36  249   20                                  I                                     
   325  326 B A        -     0   0    0  249   24                                  A                                     
   326  327 B V  E     -BC 319 338A   0  248   33                                  L                                     
   327  328 B A  E     -BC 318 337A   0  247   47                                  C                                     
   328  329 B T  E     -BC 317 336A   7  247    1                                  T                                     
   329  330 B G  E     -BC 316 335A   1  247    2                                  A                                     
   330  331 B S    >   -     0   0    6  247    0                                  S                                     
   331  332 B W  T 3  S+     0   0    6  247    0                                  W                                     
   332  333 B D  T 3  S-     0   0   17  247    0                                  D                                     
   333  334 B S  S <  S+     0   0   12  247    2                                  Q                                     
   334  335 B F        -     0   0   78  247   39                                  T                                     
   335  336 B L  E     -AC  50 329A   1  247    3                                  I                                     
   336  337 B K  E     -AC  49 328A  60  246   25                                  K                                     
   337  338 B I  E     -AC  48 327A   0  244   10                                  V                                     
   338  339 B W  E      AC  46 326A   2  243    0                                  W                                     
   339  340 B N              0   0   10  236   46                                  A                                     
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   85    5                                                                        
   342    3 G V        +     0   0   96   88   62                                                                   V    
   343    4 G I        -     0   0   38   92   33                                                                   M    
   344    5 G N    >   -     0   0  109   92   65                                                                   S    
   345    6 G I  G >  S+     0   0   25   93   47                                                                   N    
   346    7 G E  G 3  S+     0   0  122  138   45        N      N                              N         N          N    
   347    8 G D  G <  S+     0   0  133  149   28        N      N                              N         N          SN   
   348    9 G L    <   -     0   0   35  155   20        M      M                              T         M          TM   
   349   10 G T     >  -     0   0   69  156   61        A      A                              T         A          TA   
   350   11 G E  H  > S+     0   0  116  160   37        K      K                              N         K       D  SKD  
   351   12 G K  H >> S+     0   0   66  165   48        I      I                              I         I  KKK MK  III K
   352   13 G D  H 3> S+     0   0   39  166   39        A   Q  A                              S         A  DDD ED  SAG D
   353   14 G K  H 3X S+     0   0   83  166   83        E   Q  D                              Q         E  AAA NM  QEH A
   354   15 G L  H < S+     0   0    7  249    4  EEEEEEEEEEEEEEEEEEEEEEEEEEQEEEEE EEEEEEEEEEEEEEEEEQEEEE  QQQ EQ  EEE Q
   365   26 G V  H 3< S+     0   0   43  249   53  AAAATAVAAAAAAVAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAV  AAA AA  AVA V
   366   27 G T  T 3< S+     0   0  116  249   83  SSGAGSNGGSQCCNSGGGAGCGCGSCGGSSCC CCCCCGCASACYCGCCCSCCCN  SSS AT  YNG E
   367   28 G L    <   -     0   0   49  249   60  VVVVLVIVVFIMMIVIIILIMIMVVMVMIVMM MMMMMVMVVIMMMIMMMMMMMI  MMM IM  LII M
   368   29 G E        -     0   0  191  249   51  EEEEEEDEEQTDDEEDTDKDDDDEEDEDEEDD DDDDDEDEEEDDDDDDDEDDDD  EEE QE  DEE D
   369   30 G R        -     0   0   32  249    0  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRTRRRRRRRRRRRRRRRR  RRR RR  RRR R
   370   31 G M        -     0   0   53  249   83  IIIIIIMIIIMVVMIVIVIVVVVIIVIVIIVV VVVVVIVIIMIIVVVVIWIIVM  WWW KW  IMM W
   371   32 G L     >  -     0   0   75  248   80  KMKKRKKKKKRKKMKKKKTKKKKKKKKKKKKK KKKKKNKRKKKKKKKKKTKKKK  PPP KP  KKK P
   372   33 G V  H  > S+     0   0    4  248   13  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVLVVVV  LLL VL  VVV L
   373   34 G S  H  > S+     0   0   14  248    1  SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSS  SSS SS  SSS S
   374   35 G K  H  > S+     0   0   93  248   37  QQQQQQKQQRQQQKQKKKKKQKQQQQQQKQQQ QQQQQQQQQQKKQKQQKKKKQK  KKK EK  KQK K
   375   36 G C  H  X S+     0   0    0  249   61  AAAAAAAAAACAAAAAAAAAAAAAAAAAAAAA AAAAAEAAAAAAAAAAASAAAA  SSS VS  AAA S
   376   37 G C  H  X S+     0   0    0  249   62  AAAAAAAAASIAAAAAAAVAAAAAAAAASAAA AAAAAAAAEAAAAAAAAIAAAA  III SI  AAA I
   377   38 G E  H  X S+     0   0   75  249   68  AAAAAAAAAVEAAAAATTEAATAAAAASSAAA ASAAAAAAAMAAATSAAAAAAA  AAA KA  AAT V
   378   39 G E  H  X S+     0   0   60  249   24  EEEEEEDEEDDDDDEDDDDDDDDEEDEDDEDD DDDDDEDEEGDDDDDDDADDDD  AAA EA  DED A
   379   40 G F  H  X S+     0   0    3  249   35  LLLLLLLLLLLLLLLLLLILLLLLLLLLLLLL LLLLLLLLLLLLLLLLLMLLLL  MMM LM  LLL M
   380   41 G R  H  X S+     0   0   53  249   79  QQQQQQLQQMVLLMQLLLMLLLLQQLQLMQLL LLLLLQLQQQLLLLLLMRMMLL  RRR LR  LLL R
   381   42 G D  H  X S+     0   0   67  249   66  QQQQQQAQQNKAAAQQQQKQAQAQQAQARQAA AAAAAQAQQQAAAQAAAEAAAA  EEE EE  AAQ E
   382   43 G Y  H  X S+     0   0   43  249    2  YYYYYYYYYYYYYFYFFFYFYFYYYYYYYYYY YYYYYYYYYYYYYFYYYYYYYY  YYY YY  YFF Y
   383   44 G V  H >X S+     0   0    0  249   58  CCCCCCCCCCCCCCCCCCICCCCCCCCCCCCC CCCCCCCCCCCCCCCCCVCCCC  VVV CI  CCC V
   384   45 G E  H 3X S+     0   0   71  249   48  LMMMMLEIMSDEEEMTTTTMEMEMMEMEGLEE EEEEEMEMMVDEETEEDEDDEE  EEE EE  DET E
   385   46 G E  H 3< S+     0   0  125  249   57  QQQQQQAQQENAAAQEEEEEAEAQQAQAEQAA AAAAAQAQQQAAAEAAAEAAAA  EEE KE  ATE E
   386   47 G R  H XX S+     0   0   94  249   68  NNNNNNHNNHYHHHNQQQHQHQHNNHNHHNHH HHHHHNHNNNHHHQHHHNHHHH  NNN NH  HHQ N
   387   48 G S  H >< S+     0   0   12  249   68  AAAAAAAAAAAVVAAAAAEAVAVAAVAVAAVV VVVVVAVAAAIIVAVVTEVVLA  EEE KE  MAA E
   388   49 G G  T 3< S+     0   0   38  249   78  GCCCCGKCCRERRKCKKKQKRKRCCRCRKGRR RRRRRCRCCCRGRKRRRKRRRK  KKK GK  GKK K
   389   50 G E  T <4 S+     0   0  138  248   52  KKKKKKEKKNEEEEKSSSESESEKKEKESKEE EEEEEKEKKKEEESEEENEEEE  NNN GT  EDS T
   390   51 G D    XX> -     0   0    1  248    0  DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD DDDDDDDDNDDDDDDDDDDDDD  DDD DD  DDD D
   391   52 G P  H 3>5S+     0   0   17  249   27  AAAAAAPAAPVPPPAPPPCPPPPAAPAPPAPP PPPPPAPAAAPPPPPPPPPPPP  PPP LP  PPP P
   392   53 G L  H 345S+     0   0    6  249    3  LLLLLLLLLLLLLLLFFFLFLFLLLLLLLLLL LLLLLLLLLLLLLFLLLLLLLL  LLL LL  LLF L
   393   54 G V  H <45S+     0   0   24  249   30  LLLLLLVLLLIIIVLLLLLLILILLILILLII IIIIILILLLIIILIIIIIIIV  III VI  IVL I
   394   55 G K  H  <5S-     0   0  149  249   78  VVVVVVTLVMKIIVVVVMLVIVIVVIVIMVII IIIIIVIVVVIIIVIIVHLLIT  HHH SH  MTV H
   395   56 G G     << -     0   0   38  249   34  GGGGDGPGGGGPPPGGGGGGPGPGSPGPGGPP PPPPPGPGGGPPPGPPPAPPPP  AAA GA  PPG A
   396   57 G I        -     0   0   21  249   27  VVVVVVVVVIFVVVMIIIFIVIVVVVVVLVVV VVVVVVVVVLVVVIVVVPVVVV  PPP PP  VVI P
   397   58 G P    >>  -     0   0   80  249   19  PPPPPPPPPPpPPSPPPPsPPPPPPPPPGPPP PPPPPPPPPPPPPPPPPDPPPS  DDD tD  PPP D
   398   59 G E  T 34 S+     0   0   75  249   62  TAAAATSAAApAASAAAAqAAAAAAAAAAAVA AAAAAAAAAAAAAAAAAKAAAS  KKK eK  TAA K
   399   60 G D  T 34 S+     0   0  151  249   60  GGGGGGSGGSSSSSGAAAKASASGGSGSSGSS SSSSSGSGGGSSSASSSKSSSA  KKK SK  SAA K
   400   61 G K  T <4 S+     0   0  163  249   65  SSSSSSESSDDEEESTTTSTETESSESEESEE EEEEESESSSEEETEEENEEEE  NNN HS  EET N
   401   62 G N     <  -     0   0    1  249    0  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNN  NNN NN  NNN N
   402   63 G P  S    S+     0   0   36  249    0  PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPPPPP  PPP PP  PPP P
   403   64 G F  S    S-     0   0    3  249    1  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFYFFFFFFFFFWFFFF  WWW FW  FFF W
   404   65 G K              0   0  108  247   34  RRRRRRRRRKKRRRRKKKRKRKRRLRRRKRRR RRRRRRRRRRRRRKRRRARRRR  AAA QA  RRK A
   405   66 G E              0   0  201  242    3  EEEEEEEEEDEEEEEEEEEEEEEEEEEEDEEE EEEEEEEEEEEEEEEEEEEEEE  EEE EE  EDE E
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   54   14                                                                        
   408   14 P E        +     0   0  153  148   31                                                              E  DD   N 
   409   15 P G  S    S+     0   0   38  151   33                                                              G  GG   G 
   410   16 P Q  S    S-     0   0   94  155   93                                                              T  ST   S 
   411   17 P A        +     0   0    1  157   48                                                          P   S  SS   A 
   412   18 P S        +     0   0   28  161   65                                                          D   S  VS   T 
   413   19 P H  S    S+     0   0   42  167   41                                                          Q   N  NN   N 
   414   20 P T  S  > S-     0   0    2  172    0                                                          T   T  TT   T 
   415   21 P G  H  > S-     0   0   10  177    0                                                          G   G  GG   G 
   416   22 P P  H  > S+     0   0   14  183    0                                                          P   P  PP   P 
   417   23 P K  H  > S+     0   0    6  183    0                                                          K   K  KK   K 
   418   24 P G  H  X S+     0   0    0  183    0                                                          G   G  GG   G 
   419   25 P V  H  X S+     0   0    0  183    0                                                          V   V  VV   V 
   420   26 P I  H  X S+     0   0    4  183   16                                                          L   I  II   I 
   421   27 P N  H  X S+     0   0   48  183   44                                                          E   K  NK   E 
   422   28 P D  H  X S+     0   0   14  184    0                                                          D   D  DD   D 
   423   29 P W  H  X S+     0   0    6  184    0                                                          W   W  WW   W 
   424   30 P R  H  < S+     0   0   67  184   27                                                          R   Q  RQ   R 
   425   31 P K  H >X S+     0   0   67  184   36                                                          R   R  KR   R 
   426   32 P F  H >X>S+     0   0    1  184    2                                                          F   Y  YY   F 
   427   33 P K  H 3<5S+     0   0   30  184    8                                                          k   k  kk   k 
   428   34 P L  H <45S+     0   0  139  179    1                                                         Ll   l  ll   l 
   429   35 P E  H <<5S+     0   0   86  179   10                                                         EE   E  EE   E 
   430   36 P S  T  <5       0   0   57  180   65                                                         tt   a  na   a 
   431   37 P E      <       0   0  118  186   66                                                         ke   t  kt   e 
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  161   42                                                         l.   .  l.   . 
   434   69 P S        +     0   0   52  162   66                                                         N.   .  T.   . 
   435   70 P R        -     0   0  103  127   86                                                         ..   .  G.   . 
   436   71 P K        +     0   0   22  130   11                                                         ..   .  K.   . 
   437   72 P M  S    S-     0   0   12  131   13                                                         ..   .  L.   . 
   438   73 P S     >  -     0   0   52  139   66                                                         ..   .  N.   . 
   439   74 P V  H  > S+     0   0  107  138   53                                                         ..   .  L.   . 
   440   75 P Q  H  > S+     0   0  133  139   51                                                         ..   .  R.   . 
   441   76 P E  H  > S+     0   0   38  145   27                                                         D.   .  V.   . 
   442   77 P Y  H  X S+     0   0   36  157   63                                                         K.   .  D.   I 
   443   78 P E  H  < S+     0   0  111  165   67                                                         L.   D  ED   E 
   444   79 P L  H >X S+     0   0   45  167   54                                                         A.   P  EP   D 
   445   80 P I  H 3< S+     0   0   37  170   72                                                         LE   D  EE   E 
   446   81 P H  T 3< S+     0   0  178  170   77                                                         HE   L  EL   F 
   447   82 P K  T <4 S+     0   0  140  169   68                                                         QD   A  EA   N 
   448   83 P D     <  -     0   0   58  188   39                                                         EV   N  DN   E 
   449   84 P K        -     0   0  205  170   80                                                         AE   L  DL   L 
   450   85 P E        -     0   0   45  171   68                                                         DL   L  DL   I 
   451   86 P D    >>  -     0   0   87  189   32                                                         DD   A  DS   D 
   452   87 P E  H 3> S+     0   0  113  188   12                                                         EE   D  ED   E 
   453   88 P N  H 3> S+     0   0   73  189   59                                                         AD   E  AE   E 
   454   89 P C  H <> S+     0   0   32  190   71                                                         FF   F  FF   F 
   455   90 P L  H  X S+     0   0    4  190    2                                                         LL   L  LL   L 
   456   91 P R  H  X S+     0   0  131  190   62                                                         QR   L  QL   Q 
   457   92 P K  H  X S+     0   0  112  190   60                                                         QW   E  QE   Q 
   458   93 P Y  H  X S+     0   0    7  190    6                                                         YY   Y  YY   Y 
   459   94 P R  H  X S+     0   0   31  190   33                                                         RR   Q  RQ   Q 
   460   95 P R  H  X S+     0   0  130  190   46                                                         QE   R  LK   K 
   461   96 P Q  H  X S+     0   0   96  190   33                                                         QQ   Q  QQ   Q 
   462   97 P C  H  X S+     0   0   22  190   71                                                         RR   R  RR   R 
   463   98 P M  H  X S+     0   0   33  190   10                                                         ML   M  MM   L 
   464   99 P Q  H  X S+     0   0  115  190   54                                                         ER   K  EK   Q 
   465  100 P D  H  X S+     0   0   46  190   21                                                         EE   E  QE   E 
   466  101 P M  H  X S+     0   0   23  190    2                                                         MM   M  MM   L 
   467  102 P H  H  X S+     0   0   64  190   74                                                         RQ   L  RL   M 
   468  103 P Q  H  < S+     0   0  143  190   60                                                         RQ   S  RA   A 
   469  104 P K  H  < S+     0   0  140  190   57                                                         QK   K  QK   Q 
   470  105 P L  H  < S+     0   0   35  190   44                                                         LA   A  LT   L 
   471  106 P S     <  -     0   0   75  190   81                                                         HA   E  CE   E 
   472  107 P F        -     0   0   71  188   99                                                         PS   K  GK   K 
   473  108 P G        -     0   0   36  187   53                                                         GL   L  GL   V 
   474  109 P P        +     0   0   92  178   42                                                         QP   .  R.   P 
   475  110 P R        +     0   0  177  184   62                                                         QT   Q  R.   K 
   476  111 P Y        +     0   0   51  185    4                                                         FF   F  FF   F 
   477  112 P G        +     0   0   12  189   60                                                         KG   G  EG   G 
   478  113 P F  S    S-     0   0  151  190  102                                                         QH   K  KR   K 
   479  114 P V  E     -v  532   0H  28  190   13                                                         VV   V  VV   V 
   480  115 P Y  E     -v  533   0H  71  183   67                                                         FF   I  MI   V 
   481  116 P E  E     -v  534   0H 108  190   44                                                         ED   N  DD   T 
   482  117 P L        -     0   0   12  190   33                                                         IL   L  IL   L 
   483  118 P E        +     0   0  134  190   75                                                         ET   E  SE   N 
   484  119 P S  S >> S-     0   0   57  190   54                                                         SR   S  SN   S 
   485  120 P G  H 3> S+     0   0   15  189   40                                                         A.   T  GT   R 
   486  121 P E  H 3> S+     0   0  127  190   23                                                         ES   D  ED   V 
   487  122 P Q  H <> S+     0   0   72  190   62                                                         AQ   Q  EQ   E 
   488  123 P F  H  X S+     0   0   26  190    1                                                         FY   F  FF   F 
   489  124 P L  H  X S+     0   0   90  190    6                                                         LV   L  LL   L 
   490  125 P E  H  X S+     0   0  103  190   40                                                         ED   Q  RQ   D 
   491  126 P T  H  < S+     0   0   10  190   74                                                         TA   A  AA   A 
   492  127 P I  H  < S+     0   0   17  190   12                                                         VI   I  VI   I 
   493  128 P E  H  < S+     0   0  139  190   19                                                         DD   D  DD   D 
   494  129 P K  S  < S+     0   0  172  190   33                                                         QK   E  EG   K 
   495  130 P E  S    S-     0   0   38  185    5                                                         GE   E  EE   E 
   496  131 P Q    >   -     0   0  116  190   67                                                         NN   D  GD   D 
   497  132 P K  T 3  S+     0   0  156  190   34                                                         KK   K  KK   K 
   498  133 P I  T 3  S+     0   0   68  190   87                                                         KH   S  SS   K 
   499  134 P T    <   -     0   0   10  190   37                                                         TV   V  TI   V 
   500  135 P T  E     -W  558   0H   7  189   62                                                         PL   T  LI   T 
   501  136 P I  E     -Wx 557 531H   3  190   15                                                         VI   I  VV   V 
   502  137 P V  E     -Wx 556 532H   0  190   35                                                         MI   I  LI   I 
   503  138 P V  E     -Wx 555 533H   0  190   13                                                         II   V  VV   I 
   504  139 P H  E     -Wx 554 534H   0  190    5                                                         HH   H  HH   H 
   505  140 P I  E     +Wx 553 535H   2  190    2                                                         II   I  II   I 
   506  141 P Y  E     - x   0 536H   4  190    3                                                         YF   Y  YY   Y 
   507  142 P E    >   -     0   0   45  190   26                                                         EE   E  EE   N 
   508  143 P D  T 3  S+     0   0   95  190   50                                                         EQ   D  PD   N 
   509  144 P G  T 3  S+     0   0   66  190   50                                                         HF   N  EN   V 
   510  145 P I  S X> S-     0   0   36  190   33                                                         IV   I  VV   T 
   511  146 P K  T 34 S+     0   0  191  190   72                                                         PP   P  PS   I 
   512  147 P G  T 3> S+     0   0   13  190   23                                                         GG   G  AG   A 
   513  148 P C  H <> S+     0   0    0  190   36                                                         AC   C  CC   C 
   514  149 P D  H  X S+     0   0   78  190   47                                                         ED   E  QE   E 
   515  150 P A  H  > S+     0   0   44  190   50                                                         AA   A  AA   T 
   516  151 P L  H  X S+     0   0    0  190   11                                                         LV   M  MM   M 
   517  152 P N  H  X S+     0   0   19  190   16                                                         DN   D  DN   D 
   518  153 P S  H  X S+     0   0   78  190   57                                                         GG   G  GG   G 
   519  154 P S  H  X S+     0   0    6  190   35                                                         CC   C  SC   C 
   520  155 P L  H  X S+     0   0    1  190   10                                                         MF   L  LL   L 
   521  156 P I  H  X S+     0   0  105  190   85                                                         LQ   I  LI   N 
   522  157 P C  H  X S+     0   0   63  190   41                                                         CC   S  CS   I 
   523  158 P L  H  X S+     0   0    0  190    4                                                         LL   L  LL   L 
   524  159 P A  H  < S+     0   0    1  190   11                                                         AA   A  AA   A 
   525  160 P A  H  < S+     0   0   61  190   66                                                         AQ   E  LE   S 
   526  161 P E  H  < S+     0   0   72  190   24                                                         ED   E  QE   D 
   527  162 P Y    ><  +     0   0    5  190    2                                                         YH   Y  YY   Y 
   528  163 P P  T 3  S+     0   0   28  190   28                                                         PP   P  PP   P 
   529  164 P M  T 3  S+     0   0   26  190   85                                                         TR   H  MY   A 
   530  165 P V  S <  S-     0   0    1  190    9                                                         VV   V  VV   V 
   531  166 P K  E     - x   0 501H  37  190    2                                                         KK   K  KK   K 
   532  167 P F  E     +vx 479 502H   0  190    1                                                         FF   F  FF   F 
   533  168 P C  E     -vx 480 503H   0  190   19                                                         CC   C  CC   C 
   534  169 P K  E     +vx 481 504H  51  190   38                                                         RR   R  RK   R 
   535  170 P I  E     - x   0 505H   1  190   21                                                         VI   I  VI   I 
   536  171 P K  E >>  - x   0 506H  52  190   71                                                         RQ   L  RL   S 
   537  172 P A  H >> S+     0   0   13  190   46                                                         SS   G  GG   A 
   538  173 P S  H 34 S+     0   0   88  190   29                                                         AS   L  SS   D 
   539  174 P N  H <4 S+     0   0   67  190   86                                                         LE   T  AI   I 
   540  175 P T  H << S-     0   0   25  190   72                                                         IA   A  VA   T 
   541  176 P G     <  +     0   0   66  189   23                                                         GD   A  GG   G 
   542  177 P A    >   -     0   0   39  190   57                                                         AV   L  TL   L 
   543  178 P G  T 3  S-     0   0   70  189   41                                                         SS   S  SS   S 
   544  179 P D  T 3  S+     0   0  151  189   78                                                         SQ   T  AK   R 
   545  180 P R  S <  S+     0   0  167  189   57                                                         RT   Q  LQ   H 
   546  181 P F  S    S+     0   0   35  189    0                                                         FF   F  FF   F 
   547  182 P S    >>  -     0   0   34  189   69                                                         TT   K  RK   R 
   548  183 P S  T 34 S+     0   0   86  189   84                                                         SS   K  SK   V 
   549  184 P D  T 34 S+     0   0  126  189   66                                                         NK   F  SF   D 
   550  185 P V  T <4 S+     0   0   20  189   64                                                         AG   G  AG   G 
   551  186 P L     <  +     0   0    8  190   15                                                         LL   T  LV   V 
   552  187 P P  S    S+     0   0    1  190    0                                                         PP   P  PP   P 
   553  188 P T  E     -W  505   0H   1  190   42                                                         AA   A  AT   A 
   554  189 P L  E     -WY 504 566H   0  190    2                                                         LI   L  LL   L 
   555  190 P L  E     -WY 503 565H   4  190   10                                                         LL   L  LL   L 
   556  191 P V  E     +WY 502 564H   0  190   18                                                         VA   V  LV   V 
   557  192 P Y  E     +WY 501 562H  31  190    0                                                         YY   Y  YY   Y 
   558  193 P K  E >  S-WY 500 561H  25  190   13                                                         KR   K  RK   K 
   559  194 P G  T 3  S-     0   0   25  190   44                                                         GG   E  GN   E 
   560  195 P G  T 3  S+     0   0   48  190   21                                                         GG   G  GG   G 
   561  196 P E  E <   -Y  558   0H  38  190   37                                                         EQ   Q  DQ   Q 
   562  197 P L  E     +Y  557   0H  34  190   12                                                         LL   L  LV   I 
   563  198 P L  E     -     0   0H   2  190   21                                                         IV   I  VI   I 
   564  199 P S  E     -Y  556   0H   4  190   29                                                         GA   G  GG   G 
   565  200 P N  E     -Y  555   0H  41  190    0                                                         NN   N  NN   N 
   566  201 P F  E >   -Y  554   0H   3  189    1                                                         FF   F  LF   F 
   567  202 P I  T 3  S-     0   0   87  187   24                                                         VL   V   I   V 
   568  203 P S  T >  S-     0   0   11  187   69                                                         RR   H   H   K 
   569  204 P V  G X  S+     0   0    0  187   34                                                         II   V   V   M 
   570  205 P T  G >  S+     0   0   17  187   36                                                         TT   T   T   S 
   571  206 P E  G <  S+     0   0  156  187   34                                                         DD   D   D   N 
   572  207 P Q  G <  S+     0   0   84  187   43                                                         QQ   H   H   E 
   573  208 P L  S <  S-     0   0   31  187   11                                                         LL   L   L   L 
   574  209 P A    >   -     0   0   49  187   49                                                         GG   G   G   G 
   575  210 P E  T 3  S+     0   0  201  187   27                                                         QE   I   V   N 
   576  211 P E  T 3  S+     0   0  166  187   21                                                         DD   D   D   D 
   577  212 P F    <   -     0   0   17  187    0                                                         FF   F   F   F 
   578  213 P F    >>  -     0   0  146  187   24                                                         FF   Y   Y   F 
   579  214 P T  H 3> S+     0   0   24  186   26                                                         AA   S   S   A 
   580  215 P G  H 3> S+     0   0   32  186   71                                                         AG   S   S   S 
   581  216 P D  H <> S+     0   0   57  186    4                                                         DD   D   D   D 
   582  217 P V  H  X S+     0   0    0  186   23                                                         LL   V   V   V 
   583  218 P E  H  X S+     0   0   32  186   10                                                         EE   E   E   E 
   584  219 P S  H  X S+     0   0   58  186   51                                                         SS   A   A   R 
   585  220 P F  H  < S+     0   0    2  187    1                                                         FF   F   F   Y 
   586  221 P L  H ><>S+     0   0    0  187    0                                                         LL   L   L   L 
   587  222 P N  H ><5S+     0   0   61  187   83                                                         QV   I   I   I 
   588  223 P E  T 3<5S+     0   0   70  187   16                                                         EE   E   E   E 
   589  224 P Y  T < 5S-     0   0   20  183   49                                                         F    H   H   Y 
   590  225 P G  T < 5S+     0   0    6  183    7                                                         S    G   G   G 
   591  226 P L      < +     0   0    2  183   19                                                         L    I   I   M 
   592  227 P L  S    S-     0   0   10  178    7                                                         L    L   L   L 
   593  228 P P        -     0   0   40  178   30                                                         P    T   A   P 
   594  229 P E              0   0   94  177   19                                                         E    D   D   E 
   595  230 P K              0   0  161  175   25                                                         K    K   K   K 
## ALIGNMENTS  631 -  689
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....4....:....5....:....6....:....7....:....8....:....9....:....0
     1    2 B S              0   0  117  195   58                                                             
     2    3 B E     >  -     0   0  107  209   43                                     Q                       
     3    4 B L  H  > S+     0   0   52  229   31                                     I                       
     4    5 B D  H  > S+     0   0  104  229   51                                     E                       
     5    6 B Q  H  > S+     0   0  131  230   62                                     K                       
     6    7 B L  H  X S+     0   0   27  230   61                                     E                       
     7    8 B R  H  X S+     0   0  110  233    4                                     R                       
     8    9 B Q  H  X S+     0   0  117  233   49                                     N                       
     9   10 B E  H  X S+     0   0   78  234    8                                     Q                       
    10   11 B A  H  X S+     0   0    1  234    8                                     G                       
    11   12 B E  H  X S+     0   0  121  234    8                                     K                       
    12   13 B Q  H  X S+     0   0  111  238   70                                     V                       
    13   14 B L  H  X S+     0   0   14  238    4                                     L                       
    14   15 B K  H  X S+     0   0   99  238   24                                     Y                       
    15   16 B N  H  X S+     0   0   33  239   51                                     N                       
    16   17 B Q  H  X S+     0   0   82  239   58                                     E                       
    17   18 B I  H  X S+     0   0    7  240    4                                     V                       
    18   19 B R  H  X S+     0   0  135  242   52                                     L                       
    19   20 B D  H  X S+     0   0   85  244   60                                     H                       
    20   21 B A  H  X S+     0   0   36  243   62                                     L                       
    21   22 B R  H >X S+     0   0   22  244   22                                     K                       
    22   23 B K  H 3< S+     0   0  136  244   50                                     Q                       
    23   24 B A  H 3< S+     0   0   79  244   56                                     R                       
    24   25 B C  H << S+     0   0   19  244   85                                     T                       
    25   26 B A     <  +     0   0   46  244   56                                     Q                       
    26   27 B D        +     0   0   88  243    0                                     D                       
    27   28 B A        -     0   0   17  243   50                                     T                       
    28   29 B T    >>  -     0   0   59  244   35                                     K                       
    29   30 B L  H 3> S+     0   0    0  244    3                                     I                       
    30   31 B S  H 34 S+     0   0   38  244   90                                     Q                       
    31   32 B Q  H X4 S+     0   0  119  247   50                                     Y                       
    32   33 B I  H 3< S+     0   0   28  248   52                                     V                       
    33   34 B T  T >< S+     0   0    0  249   56                                     S                       
    34   35 B N  T <  S+     0   0  129  249   72                                     Q                       
    35   36 B N  T 3  S+     0   0  111  249   55                                     N                       
    36   37 B I  S <  S-     0   0   21  249   49                                     V                       
    37   38 B D        -     0   0  138  249   32                                     T                       
    38   39 B P        -     0   0   89  250   59                                     T                       
    39   40 B V        -     0   0   23  251   30                                     I                       
    40   41 B G        -     0   0   54  251   45                                     P                       
    41   42 B R        -     0   0  115  251    6                                     R                       
    42   43 B I        +     0   0    8  251   27                                     n                       
    43   44 B Q        -     0   0   54  251   59                                     c                       
    44   45 B M        -     0   0   11  252    5                                     l                       
    45   46 B R        -     0   0   49  252   18                                     K                       
    46   47 B T  E     +A  338   0A  12  252   43                                     L                       
    47   48 B R  E     +     0   0A  56  252   11                                     Y                       
    48   49 B R  E     -A  337   0A  60  252    9                                     N                       
    49   50 B T  E     -A  336   0A  30  252   20                                     T                       
    50   51 B L  E     -A  335   0A   0  252    0                                     L                       
    51   52 B R        +     0   0  159  252   22                                     K                       
    52   53 B G        +     0   0   20  252    0                                     G                       
    53   54 B H        -     0   0    4  252    0                                     H                       
    54   55 B L  S    S+     0   0  116  252    4                                     Q                       
    55   56 B A  S    S-     0   0    0  252    4                                     N                       
    56   57 B K        -     0   0   15  252    0                                     K                       
    57   58 B I  E     -D   73   0B   0  252    1                                     V                       
    58   59 B Y  E     -     0   0B   6  252    4                                     A                       
    59   60 B A  E     -D   72   0B  13  252    5                                     K                       
    60   61 B M  E     -D   71   0B  15  252    4                                     V                       
    61   62 B H  E     -D   70   0B  44  252    4                                     C                       
    62   63 B W  E     -D   69   0B  11  252    0                                     W                       
    63   64 B G    >   -     0   0    3  252   43                                     S                       
    64   65 B T  T 3  S+     0   0   75  252   58                                     K                       
    65   66 B D  T 3  S-     0   0   80  252    1                                     D                       
    66   67 B S  S <  S+     0   0    3  252   50                                     S                       
    67   68 B R  S    S+     0   0   94  252   20                                     T                       
    68   69 B L  E     + E   0  82B  31  252   80                                     K                       
    69   70 B L  E     -DE  62  81B   0  252   12                                     V                       
    70   71 B L  E     -DE  61  80B   0  252    3                                     L                       
    71   72 B S  E     -DE  60  79B   0  252    1                                     S                       
    72   73 B A  E     -DE  59  78B   0  252    1                                     A                       
    73   74 B S  E >>  -DE  57  77B   0  252    1                                     S                       
    74   75 B Q  T 34 S+     0   0    1  252    1                                     Q                       
    75   76 B D  T 34 S-     0   0    9  252    1                                     D                       
    76   77 B G  T <4 S+     0   0    7  252    1                                     G                       
    77   78 B K  E  <  -EF  73  93B  52  252    7                                     F                       
    78   79 B L  E     -EF  72  92B   0  252    2                                     M                       
    79   80 B I  E     -EF  71  91B   0  252    3                                     I                       
    80   81 B I  E     -EF  70  90B   0  252   16                                     V                       
    81   82 B W  E     -EF  69  88B   0  252    0                                     W                       
    82   83 B D  E >>> -EF  68  87B  21  252    2                                     D                       
    83   84 B S  T 345S+     0   0    0  252   52                                     A                       
    84   85 B Y  T 345S+     0   0   57  251   17                                     .                       
    85   86 B T  T <45S-     0   0   56  252    5                                     V                       
    86   87 B T  T  <5 +     0   0   43  252    4                                     T                       
    87   88 B N  E   < -F   82   0B  99  252    4                                     g                       
    88   89 B K  E     +F   81   0B  95  249    1                                     k                       
    89   90 B V  E    S+     0   0B  66  249   17                                     K                       
    90   91 B H  E     -F   80   0B  57  249    2                                     H                       
    91   92 B A  E     -F   79   0B  43  251    0                                     A                       
    92   93 B I  E     -F   78   0B   0  252    0                                     I                       
    93   94 B P  E     -F   77   0B  80  252    4                                     Q                       
    94   95 B L        -     0   0   26  252    0                                     L                       
    95   96 B R  S    S+     0   0  190  252    6                                     E                       
    96   97 B S        -     0   0   17  252    3                                     N                       
    97   98 B S  S    S+     0   0    6  252    3                                     P                       
    98   99 B W        +     0   0    2  252    0                                     W                       
    99  100 B V  E     -G  115   0C   4  252    0                                     V                       
   100  101 B M  E     +     0   0C   5  252    0                                     L                       
   101  102 B T  E     -G  114   0C   8  252    0                                     T                       
   102  103 B C  E     -G  113   0C   0  252    1                                     C                       
   103  104 B A  E     -G  112   0C   0  252    3                                     S                       
   104  105 B Y  E     -G  111   0C   9  252    2                                     Y                       
   105  106 B A    >   -     0   0    0  252   22                                     S                       
   106  107 B P  T 3  S+     0   0   64  252    3                                     A                       
   107  108 B S  T 3  S-     0   0   47  252    6                                     N                       
   108  109 B G  S <  S+     0   0    8  252    6                                     E                       
   109  110 B N  S    S+     0   0   50  252   22                                     K                       
   110  111 B Y  E     - H   0 124C  50  252   13                                     L                       
   111  112 B V  E     -GH 104 123C   0  252    0                                     L                       
   112  113 B A  E     +GH 103 122C   0  252    2                                     A                       
   113  114 B C  E     +GH 102 121C   5  252    2                                     S                       
   114  115 B G  E     +GH 101 120C   1  252    0                                     G                       
   115  116 B G  E >  S-G   99   0C   0  252    0                                     G                       
   116  117 B L  T 3  S+     0   0    1  252    0                                     L                       
   117  118 B D  T 3  S-     0   0   50  252    0                                     D                       
   118  119 B N  S <  S+     0   0   30  252    0                                     N                       
   119  120 B I  E     - I   0 139C  39  252   24                                     N                       
   120  121 B C  E     -HI 114 138C   0  252    3                                     C                       
   121  122 B S  E     -HI 113 137C   9  252    6                                     T                       
   122  123 B I  E     -HI 112 136C   0  252    2                                     I                       
   123  124 B Y  E     -H  111   0C   3  252    0                                     Y                       
   124  125 B N  E     +H  110   0C  24  252   40                                     K                       
   125  126 B L        +     0   0   11  252    1                                     V                       
   126  127 B K  S    S+     0   0  109  252   43                                     K                       
   127  128 B T  S    S-     0   0   64  252   55                                     A                       
   128  129 B R  S    S+     0   0  267  250   17                                     .                       
   129  130 B E  S    S-     0   0  173  251    9                                     D                       
   130  131 B G        -     0   0   50  252   11                                     t                       
   131  132 B N        +     0   0   30  252   52                                     n                       
   132  133 B V  S    S+     0   0   58  253   42                                     Y                       
   133  134 B R  S    S-     0   0  213  253   22                                     P                       
   134  135 B V        -     0   0   29  253   15                                     V                       
   135  136 B S  S    S-     0   0   43  253   48                                     A                       
   136  137 B R  E     -I  122   0C 105  253    7                                     E                       
   137  138 B E  E     -I  121   0C  75  253    3                                     E                       
   138  139 B L  E     +I  120   0C   1  252    1                                     M                       
   139  140 B A  E     +I  119   0C  61  252   57                                     N                       
   140  141 B G        +     0   0   50  252   25                                     G                       
   141  142 B H        -     0   0    9  252    2                                     R                       
   142  143 B T  S    S+     0   0   64  252   42                                     Y                       
   143  144 B G  S    S-     0   0    0  252    2                                     p                       
   144  145 B Y        -     0   0    0  251    0                                     y                       
   145  146 B L  E     +J  160   0D   0  251    1                                     I                       
   146  147 B S  E     -     0   0D   3  251    0                                     S                       
   147  148 B C  E     -J  159   0D   9  251    5                                     E                       
   148  149 B C  E     -J  158   0D   0  251    0                                     C                       
   149  150 B R  E     -J  157   0D  53  251    4                                     E                       
   150  151 B F  E     -J  156   0D  10  251    0                                     F                       
   151  152 B L  S    S-     0   0   26  251   24                                     I                       
   152  153 B D  S    S-     0   0   60  251   40                                     G                       
   153  154 B D  S    S+     0   0   60  251    2                                     N                       
   154  155 B N  S    S+     0   0   44  251   65                                     D                       
   155  156 B Q  E     + K   0 169D  60  251   47                                     S                       
   156  157 B I  E     -JK 150 168D   0  251    1                                     I                       
   157  158 B V  E     -JK 149 167D   0  251   22                                     V                       
   158  159 B T  E     -JK 148 166D   0  251    1                                     T                       
   159  160 B S  E     -JK 147 165D   0  251    2                                     G                       
   160  161 B S  E >   -J  145   0D   0  251    0                                     S                       
   161  162 B G  T 3  S+     0   0    0  251    0                                     G                       
   162  163 B D  T 3  S-     0   0    5  251    0                                     D                       
   163  164 B T  S <  S+     0   0    8  251   63                                     M                       
   164  165 B T        -     0   0    2  251   16                                     T                       
   165  166 B C  E     -KL 159 179D   0  251    0                                     C                       
   166  167 B A  E     -KL 158 178D   0  252   62                                     A                       
   167  168 B L  E     -KL 157 177D   6  252    6                                     L                       
   168  169 B W  E     -KL 156 175D   2  252    0                                     W                       
   169  170 B D  E >>> -KL 155 174D  37  252    0                                     D                       
   170  171 B I  T 345S+     0   0    7  252    8                                     L                       
   171  172 B E  T 345S+     0   0  144  252    6                                     T                       
   172  173 B T  T <45S-     0   0   78  252   36                                     K                       
   173  174 B G  T  <5 +     0   0   16  253    8                                     G                       
   174  175 B Q  E   < -L  169   0D 135  253   68                                     S                       
   175  176 B Q  E     -L  168   0D  30  253   45                                     K                       
   176  177 B T  E     +     0   0D  64  253   73                                     S                       
   177  178 B T  E     -L  167   0D  20  253   47                                     R                       
   178  179 B T  E     -L  166   0D   5  253   77                                     D                       
   179  180 B F  E     +L  165   0D   1  253    0                                     F                       
   180  181 B T        +     0   0   34  253   72                                     I                       
   181  182 B G        +     0   0   37  253   30                                     E                       
   182  183 B H        -     0   0    7  253    0                                     H                       
   183  184 B T  S    S+     0   0   99  253   63                                     S                       
   184  185 B G  S    S-     0   0    0  253    1                                     G                       
   185  186 B D        -     0   0    1  253    1                                     D                       
   186  187 B V  E     -M  202   0E   0  253   22                                     V                       
   187  188 B M  E     +     0   0E   3  253    1                                     L                       
   188  189 B S  E     -M  201   0E  16  253    8                                     C                       
   189  190 B L  E     -M  200   0E   3  253   14                                     L                       
   190  191 B S  E     -M  199   0E  21  253   24                                     t                       
   191  192 B L  E     -M  198   0E  29  253   29                                     p                       
   192  193 B A    >   -     0   0    4  253   57                                     Q                       
   193  194 B P  T 3  S+     0   0   85  253   13                                     N                       
   194  195 B D  T 3  S-     0   0   87  253   52                                     I                       
   195  196 B T  S <  S+     0   0   62  253   97                                     l                       
   196  197 B R  S    S+     0   0  142  252   61                                     n                       
   197  198 B L  E     - N   0 211E  37  252   71                                     L                       
   198  199 B F  E     -MN 191 210E   0  252    0                                     F                       
   199  200 B V  E     -MN 190 209E   0  252   11                                     I                       
   200  201 B S  E     -MN 189 208E   0  252    0                                     S                       
   201  202 B G  E     +MN 188 207E   0  252    0                                     G                       
   202  203 B A  E >   -M  186   0E   0  252    4                                     S                       
   203  204 B C  T 3  S+     0   0    5  252    2                                     S                       
   204  205 B D  T 3  S-     0   0   31  252    0                                     D                       
   205  206 B A  S <  S+     0   0   20  252   16                                     G                       
   206  207 B S  E     - O   0 222E   6  252   69                                     Y                       
   207  208 B A  E     -NO 201 221E   0  252   35                                     A                       
   208  209 B K  E     -NO 200 220E  18  252    0                                     K                       
   209  210 B L  E     -NO 199 219E   2  252    8                                     I                       
   210  211 B W  E     -NO 198 217E   1  252    0                                     W                       
   211  212 B D  E >>> -NO 197 216E  11  252    1                                     D                       
   212  213 B V  T 345S+     0   0   12  252   19                                     L                       
   213  214 B R  T 345S+     0   0  194  252    1                                     R                       
   214  215 B E  T <45S-     0   0  111  252   59                                     S                       
   215  216 B G  T  <5 +     0   0    8  252   25                                     P                       
   216  217 B M  E      -     0   0    1  252    0                                     F                       
   235  236 B P  T 3  S+     0   0   45  252    0                                     P                       
   236  237 B N  T 3  S-     0   0   42  252   27                                     D                       
   237  238 B G  S <  S+     0   0   12  252    8                                     G                       
   238  239 B N  S    S+     0   0   56  252   76                                     N                       
   239  240 B A  E     - Q   0 253F   0  252   11                                     A                       
   240  241 B F  E     -PQ 233 252F   0  252   16                                     F                       
   241  242 B A  E     -PQ 232 251F   0  252   51                                     A                       
   242  243 B T  E     -PQ 231 250F   0  252    0                                     T                       
   243  244 B G  E     +PQ 230 249F   0  252    0                                     G                       
   244  245 B S  E >   -P  228   0F   0  252    0                                     S                       
   245  246 B D  T 3  S+     0   0   13  252    0                                     D                       
   246  247 B D  T 3  S-     0   0   28  252    0                                     D                       
   247  248 B A  S <  S+     0   0    6  252   12                                     G                       
   248  249 B T        -     0   0   16  252   42                                     V                       
   249  250 B C  E     -QR 243 263F   0  252    3                                     I                       
   250  251 B R  E     -QR 242 262F  23  252    3                                     R                       
   251  252 B L  E     -QR 241 261F   0  252    0                                     L                       
   252  253 B F  E     -QR 240 259F   1  251    0                                     F                       
   253  254 B D  E  >> -QR 239 258F   1  251    0                                     D                       
   254  255 B L  T >45S+     0   0   15  251   26                                     L                       
   255  256 B R  T 345S+     0   0   57  251    0                                     R                       
   256  257 B A  T 345S-     0   0    0  251    8                                     S                       
   257  258 B D  T <<5 +     0   0    0  251    0                                     D                       
   258  259 B Q  E      -     0   0  119  253   47                                     s                       
   266  267 B D  T 3  S+     0   0  161  253   25                                     V                       
   267  268 B N  T 3  S+     0   0   66  253   48                                     L                       
   268  269 B I    <   +     0   0   23  253   21                                     E                       
   269  270 B I        +     0   0   97  253   31                                     N                       
   270  271 B C  S    S-     0   0   10  253    6                                     Q                       
   271  272 B G        -     0   0    1  253    0                                     G                       
   272  273 B I  E     +S  288   0G   0  253    1                                     I                       
   273  274 B T  E     +     0   0G  13  253    4                                     F                       
   274  275 B S  E     +S  287   0G  18  252    0                                     S                       
   275  276 B V  E     +S  286   0G  10  252    5                                     L                       
   276  277 B S  E     -S  285   0G  15  252   21                                     D                       
   277  278 B F  E     -S  284   0G  12  252   13                                     F                       
   278  279 B S        -     0   0    3  252    1                                     G                       
   279  280 B K  S    S+     0   0  104  252   80                                     K                       
   280  281 B S  S    S-     0   0    2  252    0                                     S                       
   281  282 B G  S    S+     0   0    0  252    0                                     G                       
   282  283 B R        +     0   0    8  252    0                                     R                       
   283  284 B L  E     - T   0 297G   0  252   11                                     F                       
   284  285 B L  E     -ST 277 296G   0  252    3                                     L                       
   285  286 B L  E     -ST 276 295G   0  252   13                                     Y                       
   286  287 B A  E     -ST 275 294G   0  252   11                                     S                       
   287  288 B G  E     -ST 274 293G   2  252    4                                     C                       
   288  289 B Y  E >   -S  272   0G   4  252    0                                     Y                       
   289  290 B D  T 3  S+     0   0    3  252    3                                     S                       
   290  291 B D  T 3  S-     0   0   37  252    1                                     E                       
   291  292 B F  S <  S+     0   0    3  252    3                                     Y                       
   292  293 B N        -     0   0   15  252   39                                     G                       
   293  294 B C  E     -TU 287 307G   0  252    5                                     C                       
   294  295 B N  E     -TU 286 306G   5  252   32                                     V                       
   295  296 B V  E     -TU 285 305G   0  252    9                                     V                       
   296  297 B W  E     -TU 284 303G   6  252    0                                     W                       
   297  298 B D  E  >  -T  283   0G   4  252    0                                     D                       
   298  299 B A  T  4 S+     0   0    0  252   64                                     I                       
   299  300 B L  T  4 S+     0   0    0  252   11                                     L                       
   300  301 B K  T  4 S-     0   0   29  252   17                                     K                       
   301  302 B A  S  < S+     0   0   17  252   42                                     G                       
   302  303 B D  S    S-     0   0   95  252   20                                     E                       
   303  304 B R  E     -U  296   0G  69  252   15                                     T                       
   304  305 B A  E     -     0   0G  14  252   58                                     V                       
   305  306 B G  E     -U  295   0G   4  252    5                                     G                       
   306  307 B V  E >   -U  294   0G   7  252   45                                     T                       
   307  308 B L  E >  S+U  293   0G   2  251    1                                     I                       
   308  309 B A  G >  S-     0   0    4  251   52                                     g                       
   309  310 B G  G <   -     0   0    4  251    5                                     e                       
   310  311 B H  G <  S+     0   0    8  251    0                                     H                       
   311  312 B D    <   -     0   0   26  251   18                                     G                       
   312  313 B N  S    S+     0   0   31  251    0                                     N                       
   313  314 B R        +     0   0   40  251    1                                     K                       
   314  315 B V        +     0   0    2  251    1                                     I                       
   315  316 B S  S    S-     0   0    2  251    2                                     S                       
   316  317 B C  E     -B  329   0A  10  251    6                                     R                       
   317  318 B L  E     -B  328   0A  15  250    4                                     V                       
   318  319 B G  E     -B  327   0A  10  250    3                                     A                       
   319  320 B V  E     -B  326   0A  25  250    0                                     V                       
   320  321 B T    >   -     0   0    3  250   47                                     S                       
   321  322 B D  T 3  S+     0   0   98  250   64                                     S                       
   322  323 B D  T 3  S-     0   0   51  249    7                                     D                       
   323  324 B G  S <  S+     0   0    0  249    5                                     G                       
   324  325 B M  S    S+     0   0   36  249   20                                     I                       
   325  326 B A        -     0   0    0  249   24                                     G                       
   326  327 B V  E     -BC 319 338A   0  248   33                                     L                       
   327  328 B A  E     -BC 318 337A   0  247   47                                     A                       
   328  329 B T  E     -BC 317 336A   7  247    1                                     T                       
   329  330 B G  E     -BC 316 335A   1  247    2                                     C                       
   330  331 B S    >   -     0   0    6  247    0                                     S                       
   331  332 B W  T 3  S+     0   0    6  247    0                                     W                       
   332  333 B D  T 3  S-     0   0   17  247    0                                     D                       
   333  334 B S  S <  S+     0   0   12  247    2                                     S                       
   334  335 B F        -     0   0   78  247   39                                     T                       
   335  336 B L  E     -AC  50 329A   1  247    3                                     I                       
   336  337 B K  E     -AC  49 328A  60  246   25                                     K                       
   337  338 B I  E     -AC  48 327A   0  244   10                                     I                       
   338  339 B W  E      AC  46 326A   2  243    0                                     W                       
   339  340 B N              0   0   10  236   46                                     S                       
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   85    5                                         S                   
   342    3 G V        +     0   0   96   88   62      V                                  A                   
   343    4 G I        -     0   0   38   92   33      M L  L                      M M    L                   
   344    5 G N    >   -     0   0  109   92   65      P T  T                      A A    E                   
   345    6 G I  G >  S+     0   0   25   93   47      N S  S                      S S    R                   
   346    7 G E  G 3  S+     0   0  122  138   45      N N NN                      N N    Q                   
   347    8 G D  G <  S+     0   0  133  149   28      S S NS                      N N    R                   
   348    9 G L    <   -     0   0   35  155   20     MT T MT                      T T    L                   
   349   10 G T     >  -     0   0   69  156   61     ST T AT                      A T    R                   
   350   11 G E  H  > S+     0   0  116  160   37    DQS N KN                      S S    E                   
   351   12 G K  H >> S+     0   0   66  165   48    KVI I II                      I I    I                   
   352   13 G D  H 3> S+     0   0   39  166   39    DQS S AS                      A A    E                   
   353   14 G K  H 3X S+     0   0   83  166   83    TAQ Q EQ                      Q Q    E                   
   354   15 G L  H < S+     0   0    7  249    4    QEE E EE                      E E    E                   
   365   26 G V  H 3< S+     0   0   43  249   53    AAA A VA                      A A    V                   
   366   27 G T  T 3< S+     0   0  116  249   83    QNY Y NY                      N N    A                   
   367   28 G L    <   -     0   0   49  249   60    MVL M LM                      I I    I                   
   368   29 G E        -     0   0  191  249   51    EDD D DD                      D D    R                   
   369   30 G R        -     0   0   32  249    0    RRR R RR                      R R    R                   
   370   31 G M        -     0   0   53  249   83    WII M MM                      I I    I                   
   371   32 G L     >  -     0   0   75  248   80    PTK K KK                      K K    K                   
   372   33 G V  H  > S+     0   0    4  248   13    LVV V VV                      V V    V                   
   373   34 G S  H  > S+     0   0   14  248    1    SSS S SS                      S S    S                   
   374   35 G K  H  > S+     0   0   93  248   37    KEK K QK                      K K    K                   
   375   36 G C  H  X S+     0   0    0  249   61    SAA A AA                      A A    A                   
   376   37 G C  H  X S+     0   0    0  249   62    ICA A AA                      A A    V                   
   377   38 G E  H  X S+     0   0   75  249   68    QEA A AA                      A A    E                   
   378   39 G E  H  X S+     0   0   60  249   24    ADD D ED                      E D    D                   
   379   40 G F  H  X S+     0   0    3  249   35    LLL L LL                      L L    L                   
   380   41 G R  H  X S+     0   0   53  249   79    RIL L LL                      M M    K                   
   381   42 G D  H  X S+     0   0   67  249   66    DKA A AA                      S A    K                   
   382   43 G Y  H  X S+     0   0   43  249    2    YYY Y FY                      Y Y    Y                   
   383   44 G V  H >X S+     0   0    0  249   58    ICC C CC                      C C    T                   
   384   45 G E  H 3X S+     0   0   71  249   48    ESD D ED                      E E    E                   
   385   46 G E  H 3< S+     0   0  125  249   57    EEA A TA                      A A    A                   
   386   47 G R  H XX S+     0   0   94  249   68    NNH H HH                      H H    H                   
   387   48 G S  H >< S+     0   0   12  249   68    EQM I AI                      A A    E                   
   388   49 G G  T 3< S+     0   0   38  249   78    KKG G KG                      K K    Q                   
   389   50 G E  T <4 S+     0   0  138  248   52    NNE E DE                      E E    K                   
   390   51 G D    XX> -     0   0    1  248    0    DDD D DD                      D D    D                   
   391   52 G P  H 3>5S+     0   0   17  249   27    PIP P PP                      P P    Y                   
   392   53 G L  H 345S+     0   0    6  249    3    LLL L LL                      L L    L                   
   393   54 G V  H <45S+     0   0   24  249   30    IVI I VI                      L L    W                   
   394   55 G K  H  <5S-     0   0  149  249   78    HTI I TI                      S T    K                   
   395   56 G G     << -     0   0   38  249   34    AGP P PP                      P P    G                   
   396   57 G I        -     0   0   21  249   27    PIV V VV                      V V    F                   
   397   58 G P    >>  -     0   0   80  249   19    DTP P PP                      P P    k                   
   398   59 G E  T 34 S+     0   0   75  249   62    KPA A AA                      A A    i                   
   399   60 G D  T 34 S+     0   0  151  249   60    KSS S AS                      S S    R                   
   400   61 G K  T <4 S+     0   0  163  249   65    NEE E EE                      E E    E                   
   401   62 G N     <  -     0   0    1  249    0    NNN N NN                      N N    N                   
   402   63 G P  S    S+     0   0   36  249    0    PPP P PP                      P P    P                   
   403   64 G F  S    S-     0   0    3  249    1    WYF F FF                      F F    F                   
   404   65 G K              0   0  108  247   34    AKR R RR                      R R    R                   
   405   66 G E              0   0  201  242    3    EEE E DE                      E E    E                   
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   54   14              Y          Y                           Y       
   408   14 P E        +     0   0  153  148   31  DD   E D  EEP  EQS E S N Q QD G     E G QQQQ   Q D PA   SQE
   409   15 P G  S    S+     0   0   38  151   33  GG   G G  SGG GGQG GGG K Q QG G     GGG QQQQ   Q G GG   GQP
   410   16 P Q  S    S-     0   0   94  155   93  TS   C T  CCY NCGS TTS F G GT S     STV SSSS   S T YC   SGY
   411   17 P A        +     0   0    1  157   48  SS   S S  SSS SSSS SAA S S SS S     SAS SSSS   S S CS   TSS
   412   18 P S        +     0   0   28  161   65  SV   V S  VVT SVTT SGT TTTTTS I     TGK TTTT   T V TT   TTT
   413   19 P H  S    S+     0   0   42  167   41  NN   N N  NNNNNNNN NNNQNNNNNN N     NNN NNNN   N N NNH  NNN
   414   20 P T  S  > S-     0   0    2  172    0  TT   T T  TTTTTTTTTTTTTTTTTTT T  T  TTT TTTT   TTT TTTT TTT
   415   21 P G  H  > S-     0   0   10  177    0  GG   G G  GGGGGGGGGGGGGGGGGGG G  G  GGG GGGG   GGG GGGGGGGG
   416   22 P P  H  > S+     0   0   14  183    0  PP   P P  PPPPPPPPPPPPPPPPPPP PP P  PPP PPPPPPPPPPPPPPPPPPP
   417   23 P K  H  > S+     0   0    6  183    0  KK   K K  KKKKKKKKKKKKKKKKKKK KK K  KKK KKKKKKKKKKKKKKKKKKK
   418   24 P G  H  X S+     0   0    0  183    0  GG   G G  GGGGGGGGGGGGGGGGGGG GG G  GGG GGGGGGGGGGGGGGGGGGG
   419   25 P V  H  X S+     0   0    0  183    0  VV   V V  VVVVVVVVVVVVVVVVVVV VV V  VVV VVVVVVVVVVVVVVVVVVV
   420   26 P I  H  X S+     0   0    4  183   16  II   L I  LLLVILVIVIILIIVVVVL LL L  III VVVVLLLVLLLLLIVLIVL
   421   27 P N  H  X S+     0   0   48  183   44  RN   K K  KKQEKKKKEKQEENKQQQN EE A  EQS KKKKEEEKERETKEASKKN
   422   28 P D  H  X S+     0   0   14  184    0  DD   D D  DDDDDDDDDDDDDDDDDDDDDD D  DDD DDDDDDDDDDDDDDDDDDD
   423   29 P W  H  X S+     0   0    6  184    0  WW   W W  WWWWWWWWWWWWWWWWWWWWWW W  WWW WWWWWWWWWWWWWWYYWWW
   424   30 P R  H  < S+     0   0   67  184   27  QR   Q Q  QQRQQQQQQQQRRRQQQQEQRR R  RQQ QQQQRRRQRQRRQRKKQQK
   425   31 P K  H >X S+     0   0   67  184   36  RK   R R  RRRRRRRRRRRRNERRRRQRLS R  KRR RRRRSSSRRRSEQTRQRRR
   426   32 P F  H >X>S+     0   0    1  184    2  FY   F Y  YYFFFFFFFYFFYFFFFFYYYF F  FFY FFFFFFFFYFFYYYFYFFY
   427   33 P K  H 3<5S+     0   0   30  184    8  kk   k k  qrkkkkkkkkkkkkkkkkkkkH k  kkk kkkkhhhkkkhkkkkkkkq
   428   34 P L  H <45S+     0   0  139  179    1  il   l l  llllllllllllllllll.lm. l  lll llll...lll.lillllll
   429   35 P E  H <<5S+     0   0   86  179   10  EE   E E  QQEQEEEEQEEEEEEEEE.EK. E  EEE EEEE...EEE.EQEEEEEK
   430   36 P S  T  <5       0   0   57  180   65  nn   s a  nstatsnianaaftaaaa.acn t  sat aaaa...att.tsysrtaq
   431   37 P E      <       0   0  118  186   66  tk   e t  qeqeeeeeeeeekdeeeektak e  ees eeeekkkeeekelkhtqee
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  161   42  .l   . .  ...fl.f...fll..fffi.li .  .f. lllliiill.i....tllI
   434   69 P S        +     0   0   52  162   66  .T   . .  ...AD.A...EDq..AAANDcA .  .Q. DDDDAAADD.A....hASV
   435   70 P R        -     0   0  103  127   86  .G   . .  ............s.......q. .  ... ...............f...
   436   71 P K        +     0   0   22  130   11  .K   . .  ............L.......Q. .  ... ...............D...
   437   72 P M  S    S-     0   0   12  131   13  .L   . .  ............T.......P. .  ... ...............I...
   438   73 P S     >  -     0   0   52  139   66  .N   . .  ..Q.........C.....D.VE .  ... ....EEE...E....V...
   439   74 P V  H  > S+     0   0  107  138   53  .L   . .  ..F.........D.....M.EA .  ... ....AAA...A....S...
   440   75 P Q  H  > S+     0   0  133  139   51  .R   . .  ..M.........P.....A.DK .  ... ....KKK...K....S..Q
   441   76 P E  H  > S+     0   0   38  145   27  .V   . .  ..E....L....N.....L.ER L  ... ....RRR...R....E..D
   442   77 P Y  H  X S+     0   0   36  157   63  .D   A .  ..Q..A.DI...AKL...T.EG D  ... ....GGG...GD..SF..E
   443   78 P E  H  < S+     0   0  111  165   67  DE   A D  E.I..A.ADD..KLD...C.KM Q  D.. ....MMM...MF..TE..L
   444   79 P L  H >X S+     0   0   45  167   54  PE   L P  V.Q..L.ENP..GLA...KPVL L  P.. ....LLL...LL..LV..D
   445   80 P I  H 3< S+     0   0   37  170   72  EE   D E  AEL..D.MED..YQE...SDFS Q  E.. ....SSS..ESK..NL..K
   446   81 P H  T 3< S+     0   0  178  170   77  FE   E L  ITE..E.ALL..DEM...ELAG L  L.. ....GGG..LGE..AE..L
   447   82 P K  T <4 S+     0   0  140  169   68  AE   L A  APM..L.EAA..SLD...AEEN E  A.. ....NNN..ENL..SS..L
   448   83 P D     <  -     0   0   58  188   39  ED   Q N  QQGEEQELEEEEDEEEEEENLE S  EEE EEEEEEEE.EEEE.DLEEA
   449   84 P K        -     0   0  205  170   80  LD   E L  EEELLELMLLLLDSLLLLELEE M  LLF LLLLEEELDLEEQ.DDLLD
   450   85 P E        -     0   0   45  171   68  MD   E L  EEFMMEMNMLMIEFMMMMLLNG L  LML MMMMGGGMFLGLF.SDMMD
   451   86 P D    >>  -     0   0   87  189   32  AD   D N  DDESNDSDSNEDDESSSSDTDV E  DDS SSSSVVVSDHVEL.DDSSD
   452   87 P E  H 3> S+     0   0  113  188   12  DE   D D  DDDEDDEDEDEEKDEEEEDDND D  DED EEEEDDDEEDDDD.DDDED
   453   88 P N  H 3> S+     0   0   73  189   59  EA   D E  DDEDDDDTDDGGEEDDDDQDEE E  DDD DDDDEEEDEDEEPEEEDDP
   454   89 P C  H <> S+     0   0   32  190   71  FF   F F  FFFFFFFVFFFFFFFFFFFFLE F  FFF FFFFEEEFFFEFYFFFFFF
   455   90 P L  H  X S+     0   0    4  190    2  LL   L L  LLLLLLLLLLLLMLLLLLLLLL M  LLL LLLLLLLLMLLIVMLILLL
   456   91 P R  H  X S+     0   0  131  190   62  LQ   Q L  RRKQLQQLQLLMDKQQHQALKQ R  LLE QQQQQQQQKKQKLDTALQN
   457   92 P K  H  X S+     0   0  112  190   60  AQ   E E  EEEQEEQQQNEKWEQQQQEEQR R  HED QQQQRRRQEVREEWQMQQE
   458   93 P Y  H  X S+     0   0    7  190    6  YY   Y Y  YYYYYYYFYYYYYYYYYYYYFI Y  YYY YYYYIIIYYYIYYYYYYYY
   459   94 P R  H  X S+     0   0   31  190   33  QR   M Q  MMRQQMQQQQQQNRQQQQRQAR R  QQR QQQQRRRQRLRRSNRRQQM
   460   95 P R  H  X S+     0   0  130  190   46  KL   L R  RRNKKLKQKKRQKQKKKKKKQE E  KRK KKKKEEEKAQELVKQQKKK
   461   96 P Q  H  X S+     0   0   96  190   33  QQ   K Q  RKKQKKQQQQKQKKQQQQKQKE E  QKK QQQQEEEQKKEKKKNNKQK
   462   97 P C  H  X S+     0   0   22  190   71  RR   R R  RRRRRRRRRRRRRRRRRRRRRR R  RRR RRRRRRRRRRRRKRRRRRR
   463   98 P M  H  X S+     0   0   33  190   10  MM   M M  MMIMMMMMMMMMIIMMMMMMML M  IMM MMMMLLLMIMLLMIIMMMM
   464   99 P Q  H  X S+     0   0  115  190   54  RE   E K  EEEAIEARAQAQVEAAAAKKKQ N  EAE AAAAQQQAEEQEQMNRAAA
   465  100 P D  H  X S+     0   0   46  190   21  EQ   E E  EEEEEEEEEEEEEEEEEEEEEQ Q  EEE EEEEQQQESEQEEEEEEEE
   466  101 P M  H  X S+     0   0   23  190    2  MM   M M  MMMMMMMMMMMLLMMMMMMMLL M  MMM MMMMLLLMMMLMMLLLMMM
   467  102 P H  H  X S+     0   0   64  190   74  IR   M L  MMRMLMLLLLLMQRLLLLMLGK I  ILL LLLLKKKLRLKRLKRKLLM
   468  103 P Q  H  < S+     0   0  143  190   60  AR   S A  AARRKSRERLAASIRRRRAAQD L  QAI RRRRDDDRNTDKANKMARE
   469  104 P K  H  < S+     0   0  140  190   57  KQ   Q K  QEAQLQQHQQMQKAQQQQKKKR N  QMS QQQQRRRQAKRAKKASLQE
   470  105 P L  H  < S+     0   0   35  190   44  AL   I T  IIVCTITCCTMLFLTTTTTTYV I  TMR TTTTVVVTVIVLSFNLATV
   471  106 P S     <  -     0   0   75  190   81  EC   N E  NNQGGNGGGNEQAQGGGGQEGA Q  NDN GGGGAAAGVKADTAEEGGQ
   472  107 P F        -     0   0   71  188   99  KG   A K  ASNHRAHRHHrKSNHHHHE.HS K  LkL HHHHSSSHkSsNLSsrKHl
   473  108 P G        -     0   0   36  187   53  LG   R F  RRISMRNqNNgAkVNHHHAKqK n  SgP HHHHKKKH.LgVNk..LNr
   474  109 P P        +     0   0   92  178   42  .R   P .  PPPQQPQkVI.PaPQQQQPLa. p  K.. QQQQ...QpP.PKvppPQr
   475  110 P R        +     0   0  177  184   62  RR   K C  HKQNTKQRQKRKGKQQQQEYS. R  KCT QQQQ...QQV.KQGTVTQK
   476  111 P Y        +     0   0   51  185    4  FF   F F  FFFFFFFFFFYFIFFFFFFFY. F  FFF FFFF...FFF.FFIFFFFF
   477  112 P G        +     0   0   12  189   60  GE   G G  GGGGGGGGGGGGTGGGGGGGGG G  GGG GGGGGGGGGG.GGANGGGG
   478  113 P F  S    S-     0   0  151  190  102  SK   H K  QHKKNHKTKEEKFRKKKKKKHK K  DED QQQQKKKQKRKREFKTTKQ
   479  114 P V  E     -v  532   0H  28  190   13  VV   L V  LLVVVLVVVVLLgVVVVVVVVV L  LLV VVVVVVVVVVVVVgIVLVL
   480  115 P Y  E     -v  533   0H  71  183   67  IM   I I  VS.MIIQILIIQv.QVLLFIFI .  MIY QQQQTIIQ.IT.Yv..TQI
   481  116 P E  E     -v  534   0H 108  190   44  ND   C D  QRYNGCQSHVDTTVQQQQDDEE L  FHS QQQQEEEQVNEVTTYCDQR
   482  117 P L        -     0   0   12  190   33  LI   L L  LLNLLLLLLLLLTELLLLLLLM R  LLL LLLLMMMLHLMELNDTILL
   483  118 P E        +     0   0  134  190   75  ES   E D  EELNCETNTKKKLLTGSALENE L  RKA TTTTEEETLNELSLLLQST
   484  119 P S  S >> S-     0   0   57  190   54  ES   D N  DDSSNDSNSSTNTSTTTTTSHT N  NDN SSSSTTTSNSTTNTVTNTK
   485  120 P G  H 3> S+     0   0   15  189   40  AG   G T  GGKHGGHGHSGQHSHHHHGARK K  SGG HHHHKKKHKAKSGGASGHG
   486  121 P E  H 3> S+     0   0  127  190   23  EE   Q D  QQPEEQEDKGDDTSEEEEDDEE N  KGN EEEEEEEEQDEDQEDSDGE
   487  122 P Q  H <> S+     0   0   72  190   62  QE   A Q  AAEEDAEEEEDDNNEEEEDQDQ N  DEE EEEEQQQETEQSENTNEED
   488  123 P F  H  X S+     0   0   26  190    1  YF   F F  FFFFFFFFFLFFYFFFFFFFMF F  FFF FFFFFFFFFFFFFYFFFFF
   489  124 P L  H  X S+     0   0   90  190    6  LL   L L  LLVLLLLLLLLLVVLLLLLLLL V  LLL LLLLLLLLLLLVLVIVLLL
   490  125 P E  H  X S+     0   0  103  190   40  KR   D Q  DDENNDENDDQSEDAASSVQNS D  EQD AAAASSSAEDSEDEEQKSE
   491  126 P T  H  < S+     0   0   10  190   74  AA   A A  AACCAACACAAAEECCCCAAAA A  AAA CCCCAAACAAAAAEEESCA
   492  127 P I  H  < S+     0   0   17  190   12  IV   V I  VVIVIVIIVIIIIIVVVVVIVI I  IVI VVVVIIIVIVIVIIIIVVI
   493  128 P E  H  < S+     0   0  139  190   19  DD   D D  DDDEDDEDEDDDEDEEEEEDDE D  DDD EEEEEEEEDDEDDEDDDEE
   494  129 P K  S  < S+     0   0  172  190   33  EE   K G  KRRKKKQNNKKKNKQQEQNEVK S  KKN QQQQKKKQKKKKKSNSEQK
   495  130 P E  S    S-     0   0   38  185    5  EE   E E  EEEEEEEEEEEEEEEEEEEED. E  EEE EEEE...EEE.EEETTEEE
   496  131 P Q    >   -     0   0  116  190   67  DG   K D  KKKNNKNDNHNDEKNNNNNDSC R  DDN NNNNCCCNDQCKNKNDQNA
   497  132 P K  T 3  S+     0   0  156  190   34  KK   T K  SSAKKTKKKKKVKPKKKKPKAR K  KKK KKKKRRRKAKRPKKKPKKK
   498  133 P I  T 3  S+     0   0   68  190   87  SS   G S  GGSHNGHTHSNKVQHHHHYSVN E  TNA HHHHNNNHCDNGNFDSTHD
   499  134 P T    <   -     0   0   10  190   37  VT   V V  VVVTVVTITVTVVVTTTTVVTA V  VAV TTTTAAATTVAVVVTVVTV
   500  135 P T  E     -W  558   0H   7  189   62  TL   T I  TTTTTTTTTTTTTTTTTTTTTL T  TTT TTTTLLLTITLTTTTTTTL
   501  136 P I  E     -Wx 557 531H   3  190   15  IV   V V  VVIIIVIIIIVVIIVIIIVVIL V  VVI IIIILLLIVILVVIVVVII
   502  137 P V  E     -Wx 556 532H   0  190   35  IL   V I  IIVIIVIIIVVVIIIIIIIIFL I  IVV IIIILLLIVVLIIIIVIII
   503  138 P V  E     -Wx 555 533H   0  190   13  IV   I V  VVIIIIIVIVVIIIIIIIVVVI I  III IIIIIIIIVIIVIIVVIIC
   504  139 P H  E     -Wx 554 534H   0  190    5  HH   H H  HHHHHHHHHHHHHHHHHHHHHH H  HHH HHHHHHHHHHHHHHFHHHH
   505  140 P I  E     +Wx 553 535H   2  190    2  II   I I  IIVIIIIIIIIIILIIIIVIII I  III IIIIIIIIILILIIIIIII
   506  141 P Y  E     - x   0 536H   4  190    3  YY   Y Y  YYYYYYYYYYYYYYYYYYYYYY E  YYY YYYYYYYYYYYFYYYYYYS
   507  142 P E    >   -     0   0   45  190   26  QE   S E  AAEDESEEEERGEEEEEEEEEE D  ERE EEEEEEEEKEEEEDEEDEN
   508  143 P D  T 3  S+     0   0   95  190   50  KP   E D  QQDKDERNRDEHDNRRRRHNDE Q  EET RRRREEERKDENEDNPRKE
   509  144 P G  T 3  S+     0   0   66  190   50  DE   G N  GGGSKGNKGNKNNNNSSTNNEA S  HKT QQQQAAAQGNANKNGDYSS
   510  145 P I  S X> S-     0   0   36  190   33  VV   I V  IMVVVILLLVYVIVLQQQVVAV L  VYI LLLLVVVLVNVVVVNNDLY
   511  146 P K  T 34 S+     0   0  191  190   72  PP   Q S  PPKSSQSLSEGKPESTSSPPQD Q  HDP AAAADDDATSDESPKSTSE
   512  147 P G  T 3> S+     0   0   13  190   23  GA   G G  GGAAAGAAAAPAAAAAAATGGG A  PPA AAAAGGGAASGADASAAAG
   513  148 P C  H <> S+     0   0    0  190   36  CC   C C  CCCCCCCCCCCCCCCCCCCCCC C  CCC CCCCCCCCCCCCCCCCCCC
   514  149 P D  H  X S+     0   0   78  190   47  TQ   Q E  EENGKQSKSRTEDETAASSEAV E  RIK AAAAVVVAEEVEKEARKSI
   515  150 P A  H  > S+     0   0   44  190   50  AA   T A  AAATRTTTTTKSAATTTTIAAT S  LKV TTTTTTTTTATANAKKNTA
   516  151 P L  H  X S+     0   0    0  190   11  MM   M M  MMMLMMLMLMMMMMLLLLMMMM M  MMM LLLLMMMLMMMMMMVVMLM
   517  152 P N  H  X S+     0   0   19  190   16  ND   N N  NNNNNNNNNNNDNNNNNNNNDN N  NNN NNNNNNNNNNNNNNNNNNN
   518  153 P S  H  X S+     0   0   78  190   57  GG   G G  GGGKVGKRKVDGGGNKSNSGES G  QEQ KKKKSSSKKGSGHGTDKKG
   519  154 P S  H  X S+     0   0    6  190   35  CS   C C  CCCCECCCCCACCCCCCCCCCV C  CAC CCCCVVVCCCVCCCCYSCC
   520  155 P L  H  X S+     0   0    1  190   10  LL   L L  LLLLLLLLLLLLILLLLLLLFL L  LLL LLLLLLLLILLLLILLLLL
   521  156 P I  H  X S+     0   0  105  190   85  IL   R I  QQQDTRDDEKKSQSDDDDKIQC H  ISS DDDDCCCDDTCLDQEEEES
   522  157 P C  H  X S+     0   0   63  190   41  TC   C S  CCCTKCSEAQQIVCSTTTVSAS C  QKS SSSSSSSSESSCVVKTESL
   523  158 P L  H  X S+     0   0    0  190    4  LL   L L  LLLLLLLLLLLLLLLLLLLLLV L  LLL LLLLVVVLLLVLILILLLL
   524  159 P A  H  < S+     0   0    1  190   11  AA   A A  AAAAAAAAACAASAAAAACAAA A  SAS AAAAAAAASSAACAFCAAA
   525  160 P A  H  < S+     0   0   61  190   66  QL   E E  GEKTKEQRGKKSQQGTNSREEA Q  KKK SSTSAAASTEAQKQQTQSS
   526  161 P E  H  < S+     0   0   72  190   24  EQ   E E  EEEEEEDNQTEDKEDEDEEESK E  IEQ DDDDKKKDADKENKSEEDQ
   527  162 P Y    ><  +     0   0    5  190    2  YY   C Y  YYYYYCYYYYYYYYYYYYFYYY Y  YYY YYYYYYYYYYYYYYYYYYY
   528  163 P P  T 3  S+     0   0   28  190   28  PP   P S  PPPPSPPLAELPRPPPPPQPPP P  NTS PPPPPPPPPPPPPRPPKPP
   529  164 P M  T 3  S+     0   0   26  190   85  FM   Q Y  QQTTMQSNMNNANTSSSSKRQQ F  TNN SSSSQQQSDQQTDTHHNSF
   530  165 P V  S <  S-     0   0    1  190    9  VV   V V  VVVVVVIVVVVVVVIIIITVFV V  VVV IIIIVVVIVVVFVVVVVII
   531  166 P K  E     - x   0 501H  37  190    2  KK   K K  KKKKKKKKKKKKKKKKKKKKKK K  KKK KKKKKKKKKKKKKKKRKKK
   532  167 P F  E     +vx 479 502H   0  190    1  FF   F F  FFFFFFFFFFFFFFFFFFFFFL F  FFF FFFFLLLFFFLFFFFFFFF
   533  168 P C  E     -vx 480 503H   0  190   19  CC   C C  CCCACCACACCCCCAAAACCCA C  ACC AAAAAAAACCACCCCCCAT
   534  169 P K  E     +vx 481 504H  51  190   38  RR   I R  IARKKIKKKSKRKKKKKKKRRR A  AKK KKKKRRRKKRRKKKRRRKS
   535  170 P I  E     - x   0 505H   1  190   21  IV   V I  VVMIIVIIIIFIVIIIIILILV A  IFI IIIIVVVIILVLVVIIFIL
   536  171 P K  E >>  - x   0 506H  52  190   71  LR   E L  EERCVECICVIAKRCCCCILRK N  LIV CCCCKKKCEKKKLKRQMCD
   537  172 P A  H >> S+     0   0   13  190   46  AG   A G  AAASGASGSGCVAASSSSGGAS A  ASG SSSSSSSSTASAGAAASSA
   538  173 P S  H 34 S+     0   0   88  190   29  SS   S S  SSSSSSSSSSTDSSSSSSSSSS A  PSS SSSSSSSSSSSSSSSSSSR
   539  174 P N  H <4 S+     0   0   67  190   86  AA   A V  AADVIAVVVRDVEDVVVVSIAV D  LDS VVVVVVVVHIVEKEENVVS
   540  175 P T  H << S-     0   0   25  190   72  VV   A A  AAAAAAAAAAAAATAAAAAAVL I  AAA AAAALLLAIALAAAAAAAA
   541  176 P G     <  +     0   0   66  189   23  GG   G G  GGQGGGGGGGGGQSGGGGGGGK Q  SGG GGGGKKKGQGKKGRHHGGG
   542  177 P A    >   -     0   0   39  190   57  VT   M L  MMLMIMMMMMLLVLMMMMMLMT T  VLM MMMMTTTMMLTLVVLLLMM
   543  178 P G  T 3  S-     0   0   70  189   41  SS   S S  SSSSSSSSSSSSSSSSSSSSSS S  SSS SSSSSSSSSSSSSSSSSSS
   544  179 P D  T 3  S+     0   0  151  189   78  KA   R K  RRGRKRRKRMNRRHRRRRLKRA Q  RNH RRRRAAARLKASKSHYSRE
   545  180 P R  S <  S+     0   0  167  189   57  HL   H Q  HHNDLHDTERMHNKDDDDNQET L  ELR DDDDTTTDNHTKSNRQFDR
   546  181 P F  S    S+     0   0   35  189    0  FF   F F  FFFFFFFFFFFFFFFFFFFFFF F  FFF FFFFFFFFFFFFFFFFFFF
   547  182 P S    >>  -     0   0   34  189   69  KR   E K  EESRKERKRKKSVSRRRRKKCS T  RKK RRRRSSSRSKSSKVSSKRK
   548  183 P S  T 34 S+     0   0   86  189   84  KS   R E  RRSQSRTINTAVETTTTTMKKS E  ATV TTTTSSSTLISKLERRSTK
   549  184 P D  T 34 S+     0   0  126  189   66  ES   K F  KKRKSKKSKDSENSKKKKCFAN K  GSD KKKKNNNKANNIKNCSNKQ
   550  185 P V  T <4 S+     0   0   20  189   64  GA   G G  GGGGGGGGGGGGGGGGGGGGGA G  GGG GGGGAAAGGGAGGGGGGGG
   551  186 P L     <  +     0   0    8  190   15  VL   V V  VVVLIVLILVVVLVLLLLVVLL L  LVV LLLLLLLLVILVVLVVVLV
   552  187 P P  S    S+     0   0    1  190    0  PP   P P  PPPPPPPPPPPPPPPPPPPPPP P  PPP PPPPPPPPPPPPPPPPPPP
   553  188 P T  E     -W  505   0H   1  190   42  AA   A T  AAAAAAAAAAAAAAAAAAAATT A  AAA AAAATTTAAATAAAAAAAA
   554  189 P L  E     -WY 504 566H   0  190    2  LL   L L  LLLLLLLLLLLLLLLLLLLLLL L  LLL LLLLLLLLLLLLLLIILLL
   555  190 P L  E     -WY 503 565H   4  190   10  LL   L L  LLLLLLLLLLLLLLLLLLLLQQ L  LLL LLLLQQQLLLQLLLVVLLL
   556  191 P V  E     +WY 502 564H   0  190   18  VL   V V  VVVVVVVVVIIVAIVVVVAVAV V  VIV VVVVVVVVVIVIVAVVVVI
   557  192 P Y  E     +WY 501 562H  31  190    0  YY   Y Y  YYYYYYYYYYYYYYYYYYYYYY Y  YYY YYYYYYYYYYYYYYYYYYY
   558  193 P K  E >  S-WY 500 561H  25  190   13  KR   K K  KKKKKKKKKKKKKKKKKKRKKY K  KKK KKKKYYYKKKYKKKKKKKK
   559  194 P G  T 3  S-     0   0   25  190   44  GG   N N  NNNAANAGAGGGNGAAAAAKNN A  SGE AAAANNNAKSNNSNNRGAN
   560  195 P G  T 3  S+     0   0   48  190   21  GG   G G  GGKQGGQGQGGGNGQQQQGGKD G  GGG QQQQDDDQGGDSGNGGGQG
   561  196 P E  E <   -Y  558   0H  38  190   37  QD   N Q  SNEAQNANAQQQEEAAAAQQDA Q  NQQ AAAAAAAAEQAETVEEQAS
   562  197 P L  E     +Y  557   0H  34  190   12  IL   L V  LLMVVLVLVLMIILLLLLLVLL L  IMI VVVVLLLVLILLLILVMVL
   563  198 P L  E     -     0   0H   2  190   21  IV   I I  IIVIIIIIIVIIIIIIIIVIVV I  III IIIIVVVIVMVIVIIIIVV
   564  199 P S  E     -Y  556   0H   4  190   29  GG   G G  GGGGGGGGGGGGGGGGGGGGLG G  GGG GGGGGGGGGGGGGGGGGGG
   565  200 P N  E     -Y  555   0H  41  190    0  NN   N N  NNNNNNNNNNNNNNNNNNNNNN N  NNN NNNNNNNNNNNNNNNNNNN
   566  201 P F  E >   -Y  554   0H   3  189    1  FL   F F  FFFFFFFFFFFFFFFFFFFFFF F  FFF FFFFFFFFFFFFFFLMFFF
   567  202 P I  T 3  S-     0   0   87  187   24  V    V V  VVIVVVVVVIVVVVVVVVVVVV I  VVV VVVVVVVVVVVVVVLLVVV
   568  203 P S  T >  S-     0   0   11  187   69  H    R H  RRARRRRRRRKQARRRRRRHRR R  KKR RRRRRRRRRKRNKASRRRR
   569  204 P V  G X  S+     0   0    0  187   34  I    L V  LLLVVLLLILLLLLLLLLIMII V  LLI LLLLIIILLMILILIIVLL
   570  205 P T  G >  S+     0   0   17  187   36  T    T T  TTSTTTTSTSVAASTTTTTTIT S  TVT TTTTTTTTSGTATSTDTTT
   571  206 P E  G <  S+     0   0  156  187   34  N    D D  DDDDDDDDDDDTDDDDDDDDDD D  NDD DDDDDDDDDKDSEEKRDDD
   572  207 P Q  G <  S+     0   0   84  187   43  T    E H  EEDDDEDDDDDETEDDDDEHYH V  DDE DDDDHHHDEEHHETDDDDE
   573  208 P L  S <  S-     0   0   31  187   11  L    F L  FFLLLFLLLLLLLLLLLLLLLL F  LLL LLLLLLLLFFLLLLLLLLF
   574  209 P A    >   -     0   0   49  187   49  G    G G  GGGSGGSgSGSGGGSSSSGGGG G  GSG SSSSGGGSGGGGGGDGSSG
   575  210 P E  T 3  S+     0   0  201  187   27  D    D T  DDDDDDDdDTDNEEDDDDDMDE E  DDD DDDDEEEDDDEENELNDDE
   576  211 P E  T 3  S+     0   0  166  187   21  D    D D  DDDDDDDEDDEDDDDDDDDDED D  NEE DDDDDDDDEDDDDDEEQDD
   577  212 P F    <   -     0   0   17  187    0  F    F F  FFFFFFFFFFFFFFFFFFFFFF F  FFF FFFFFFFFFFFFFFFFFFF
   578  213 P F    >>  -     0   0  146  187   24  Y    F Y  FFFFCFFFFEDFYYFFFFYYET F  QDY FFFFTTTFFYTYSYCYNFY
   579  214 P T  H 3> S+     0   0   24  186   26  A    A S  AAAPHAAAEPYAAVAAAAASTT A  AFE AAAATTTAPATAYAPASAA
   580  215 P G  H 3> S+     0   0   32  186   71  S    V S  LVGSSVSSSESSATSSSSGSES T  EAG SSSSSSSSNSSVGTNSSSS
   581  216 P D  H <> S+     0   0   57  186    4  D    D D  DDDDDDDDDDDNDDDDDDDDDQ E  DDD DDDDQQQDDDQDDDDDDDD
   582  217 P V  H  X S+     0   0    0  186   23  V    V V  VVVVIVVVVIVVLIVVVVVVVV V  VVV VVVVVVVVVVVVVVLLVVV
   583  218 P E  H  X S+     0   0   32  186   10  E    E E  EEEEEEEEEQEEEEEEEEEEEV E  QEE EEEEVVVEAEVEEEEEEEE
   584  219 P S  H  X S+     0   0   58  186   51  S    A A  SSGSSASSSSSKAGSSSSNMRA S  SSN SSSSAAASSTASNSNNGSS
   585  220 P F  H  < S+     0   0    2  187    1  F    F F  FFYFFFFFFFFFFFFFFFFFFF F  FFF FFFFFFFFFFFYFFYFFFF
   586  221 P L  H ><>S+     0   0    0  187    0  L    L L  LLLLLLLLLLLLLLLLLLLLLL L  LLL LLLLLLLLLLLLLLLLLLL
   587  222 P N  H ><5S+     0   0   61  187   83  I    V I  VVVIIVIIIVVIHHIIIIIIIY Q  VVV IIIIYYYIVIYQIHIVIII
   588  223 P E  T 3<5S+     0   0   70  187   16  E    E E  EEEEEEEEEEEESEEEEEEEEE E  EEE EEEEEEEEEDEEESEEEEE
   589  224 P Y  T < 5S-     0   0   20  183   49  H    H H  HHHNHHHHNHNYY HHHHHH H H  HNH HHHHHHHH HHYNYYRAHH
   590  225 P G  T < 5S+     0   0    6  183    7  G    G G  GGGGGGGAGGGGS GGGGGG D G  GGG GGGGDDDG GDGGGGGGGG
   591  226 P L      < +     0   0    2  183   19  L    F I  FFMIMFIMIMIML IIIIVM I L  LII IIIIIIII LIYITFFMIF
   592  227 P L  S    S-     0   0   10  178    7  L    L L  LLLLLLLILLILL IIIILL   L  LIL IIII   I L LLLLLLIL
   593  228 P P        -     0   0   40  178   30  R    P V  PPPVPPVPIENPP VVVVSI   P  ENL VVVV   V P PLPPPPVP
   594  229 P E              0   0   94  177   19  D    D D  DDEDDDDDDDDE  DDDDDD   N  DDD DDDD   D D DDTDDDDD
   595  230 P K              0   0  161  175   25  K    R K  QQRKKRRKKKKN  RKRKKK   K  KKR RRRR   R K KK KKKRQ
## SEQUENCE PROFILE AND ENTROPY
 SeqNo PDBNo   V   L   I   M   F   W   Y   G   A   P   S   T   C   H   R   K   Q   E   N   D  NOCC NDEL NINS ENTROPY RELENT WEIGHT
    1    2 B   0   0   0   0   0   0   0  16   9   1  55   0   0   0   0   0   0   5  13   2   195    0    0   1.340     44  0.41
    2    3 B   0   0   0   0   0   0   0   1   0   0   0   0   0   1   2  16   0  78   0   2   209    0    0   0.759     25  0.56
    3    4 B   1  58  25  14   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   229    0    0   1.047     34  0.69
    4    5 B   0   0   0   0   0   0   0   0  10   0   0   6   0   0   0   0   8  46   0  28   229    0    0   1.387     46  0.49
    5    6 B   0   2   2   0   0   0   0   0  19   0  10   0   0   0   0   0  63   2   1   0   230    0    0   1.193     39  0.38
    6    7 B   0  72   0   2   0   0   0   0  24   0   0   0   0   0   0   0   0   0   0   0   230    0    0   0.733     24  0.39
    7    8 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  96   4   0   0   0   0   233    0    0   0.164      5  0.96
    8    9 B   0   1   0   0   0   0   0   0   1   0   0   0   0   0  24   3  69   0   1   0   233    0    0   0.905     30  0.51
    9   10 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  93   0   6   234    0    0   0.296      9  0.92
   10   11 B   0   0   0   0   0   0   0   0  95   0   2   1   0   0   0   0   0   0   0   0   234    0    0   0.281      9  0.92
   11   12 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0  94   0   5   234    0    0   0.266      8  0.92
   12   13 B   2   0   0   0   0   0   0   9   6   0  11   6   0   0   1   0  59   2   3   0   238    0    0   1.477     49  0.30
   13   14 B   0  96   2   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   238    0    0   0.223      7  0.95
   14   15 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  26  72   0   0   0   0   238    0    0   0.656     21  0.76
   15   16 B   0   0   0   0   0   0   0   0   1   0   3   0   0   0   0  12   0  12  56  15   239    0    0   1.316     43  0.48
   16   17 B   0   0   0   0   0   0   0   0   8   0   0   2   1   0  10  14  61   3   0   0   239    0    0   1.323     44  0.41
   17   18 B   1   1  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   240    0    0   0.150      5  0.96
   18   19 B   0   0   0   1   0   0   0   0  11   0   0   2   0   0  63  14   8   1   0   0   242    0    0   1.189     39  0.47
   19   20 B   0   0   1   0   0   0   0   0  14   0   0   0   0   1  11   0   2   6   0  65   244    0    0   1.178     39  0.40
   20   21 B   0   0   0   0   0   0   0   0  73   0   1   0   0   0   7  16   0   0   1   0   243    0    0   0.917     30  0.38
   21   22 B   0   0   0   0   0   0   0   0   1   0   0   0   0   0  82  16   0   0   0   0   244    0    0   0.544     18  0.78
   22   23 B   0   1   0   0   0   0   0   0   0   0   1   0   0   0   1  72   1   8   0  16   244    0    0   0.923     30  0.49
   23   24 B   4   0   0   0   0   0   0   0  68   0   6   1   0   0   1   0   5  12   1   2   244    0    0   1.217     40  0.44
   24   25 B   3  15   0   2   0   0   0   0  16   0   5   3  54   0   0   0   0   0   0   0   244    0    0   1.427     47  0.14
   25   26 B   0   1   0   0   0   0   0  12  53   0   7   0  10   0   2   1   3   0  10   0   244    0    0   1.534     51  0.44
   26   27 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   243    0    0   0.027      0  0.99
   27   28 B   3   0   2   0   0   0   0   0  25   0  15  53   0   0   0   0   0   0   0   0   243    0    0   1.243     41  0.49
   28   29 B   0   0   0   0   0   0   0   0   0   0  20  77   0   0   0   0   0   0   0   1   244    0    0   0.642     21  0.64
   29   30 B   0  96   2   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   244    0    0   0.203      6  0.97
   30   31 B  12   5   2   0   0   0   0   0  23   0  18  11   0   0  20   2   4   1   0   0   244    0    0   2.031     67  0.10
   31   32 B   0   0   0   0   0   0   0   0  11   0   1   3   0   0   0   1  64  14   1   4   247    0    0   1.215     40  0.49
   32   33 B  17  11  44  11   1   0   0   0  15   0   0   0   0   0   0   0   0   0   0   0   248    0    0   1.532     51  0.47
   33   34 B  11   0   0   0   0   0   0   0  34   0   1  52   2   0   0   0   0   0   0   0   249    0    0   1.095     36  0.44
   34   35 B   0   0   1   0   0   0   0   2  39   0  25   7   0   1   6   2   6   1  10   0   249    0    0   1.786     59  0.28
   35   36 B   0   0   0   0   0   0   0  30   0   0  10   0   0   0   0   0   2   8  40   8   249    0    0   1.558     52  0.44
   36   37 B  16  39  20  14   0   0   0   0   0   0   0   8   0   0   0   0   1   0   0   0   249    0    0   1.553     51  0.51
   37   38 B   0   0   0   0   0   0   0   0   2   3   0   1   0   0   0   0   0  38   0  55   249    0    0   0.980     32  0.67
   38   39 B  14   0   0   0   0   0   0   1  11  54  16   2   0   0   0   0   2   0   1   0   250    0    0   1.406     46  0.40
   39   40 B  61  25  14   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.944     31  0.70
   40   41 B   0   0   0   0   0   0   0  75   0  24   0   0   0   0   0   0   0   0   1   0   251    0    0   0.664     22  0.54
   41   42 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  96   3   0   0   0   0   251    0    0   0.167      5  0.93
   42   43 B  14   6  76   1   0   0   0   1   0   0   0   1   0   0   0   0   0   0   2   0   251    0    0   0.868     28  0.72
   43   44 B   7   2   0   1   0   0   0   6   2   0   0   3   0   0   0   0  76   0   1   0   251    0    0   1.025     34  0.41
   44   45 B   0   4   2  93   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.291      9  0.95
   45   46 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  84  16   0   0   0   0   252    0    0   0.444     14  0.81
   46   47 B   2   1   1   0   0   0   0   0   2  14   0  79   0   0   0   0   0   0   0   0   252    0    0   0.758     25  0.57
   47   48 B   0   0   0   0   0   0   1   0   0   0   0   0   0   0  94   5   0   0   0   0   252    0    0   0.237      7  0.88
   48   49 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  95   4   0   0   0   0   252    0    0   0.231      7  0.91
   49   50 B   0   0   0   0   0   0   0   0   5   0   0  90   0   0   0   0   0   0   5   0   252    0    0   0.406     13  0.80
   50   51 B   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
   51   52 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  80  20   0   0   0   0   252    0    0   0.523     17  0.78
   52   53 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
   53   54 B   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   252    0    0   0.000      0  1.00
   54   55 B   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   252    0    0   0.046      1  0.96
   55   56 B   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   1   0   252    0    0   0.072      2  0.96
   56   57 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   252    0    0   0.000      0  1.00
   57   58 B   1   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.046      1  0.99
   58   59 B   0   0   0   0   0   0  99   0   1   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.046      1  0.95
   59   60 B   0   0   0   0   0   0   0   0  98   0   1   0   0   0   0   0   0   0   0   0   252    0    0   0.098      3  0.95
   60   61 B   1   2   0  96   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.184      6  0.96
   61   62 B   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   252    0    0   0.078      2  0.96
   62   63 B   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
   63   64 B   0   0   0   0   0   0   0  56  24   0  19   0   0   0   0   0   0   0   0   0   252    0    0   1.009     33  0.56
   64   65 B   0   0   0   0   0   0   8   0   6   0  18  58   1   0   0   0   2   1   4   0   252    0    0   1.352     45  0.41
   65   66 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   252    0    0   0.026      0  0.99
   66   67 B   0   0   0   0   0   0   0   0   0   0  76   1   0   0  17   4   0   0   1   0   252    0    0   0.772     25  0.49
   67   68 B   1   0   0   0   0   0   0   0   0   0   0   1   0   0  84  13   0   0   0   0   252    0    0   0.536     17  0.80
   68   69 B   0  56   0   0   0   0   2   0   0   0   1   0   0  25   0   0   0   0  17   0   252    0    0   1.118     37  0.20
   69   70 B   2  94   0   1   0   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   252    0    0   0.299      9  0.88
   70   71 B  98   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.116      3  0.96
   71   72 B   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   252    0    0   0.052      1  0.98
   72   73 B   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.052      1  0.99
   73   74 B   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   252    0    0   0.052      1  0.99
   74   75 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   252    0    0   0.052      1  0.99
   75   76 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   252    0    0   0.052      1  0.98
   76   77 B   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.052      1  0.99
   77   78 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  98   0   0   0   0   252    0    0   0.124      4  0.92
   78   79 B   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.078      2  0.98
   79   80 B   1   2  97   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.153      5  0.97
   80   81 B  45   1  54   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.769     25  0.84
   81   82 B   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.052      1  0.99
   82   83 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   252    0    0   0.078      2  0.97
   83   84 B   0   0   0   0   0   0   0   4  24   0  62  10   0   0   0   0   0   0   0   0   252    0    0   1.038     34  0.47
   84   85 B   0   2   1   0   2   0  88   0   0   0   0   0   0   6   0   0   0   0   0   0   251    0    0   0.518     17  0.82
   85   86 B   0   0   1   0   0   0   0   0   0   0   0  98   0   0   0   0   0   0   0   0   252    0    0   0.124      4  0.94
   86   87 B   0   0   0   0   0   0   0   0   0   0   0  98   0   0   0   0   0   0   0   0   252    0    0   0.104      3  0.96
   87   88 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  98   0   252    0    0   0.104      3  0.96
   88   89 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   249    0    0   0.026      0  0.99
   89   90 B  82   0   3  15   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   249    0    0   0.569     18  0.83
   90   91 B   0   0   0   0   0   0   0   0   0   0   0   0   0  98   0   0   0   0   2   0   249    0    0   0.082      2  0.97
   91   92 B   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.000      0  1.00
   92   93 B   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.026      0  1.00
   93   94 B   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   252    0    0   0.052      1  0.95
   94   95 B   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
   95   96 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  97   2   0   1   0   0   252    0    0   0.144      4  0.93
   96   97 B   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   1   0   252    0    0   0.046      1  0.97
   97   98 B   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   252    0    0   0.052      1  0.96
   98   99 B   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
   99  100 B 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  100  101 B   0   1   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.046      1  0.99
  101  102 B   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  102  103 B   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   252    0    0   0.052      1  0.98
  103  104 B   0   0   0   0   0   0   0   0  98   0   2   0   0   0   0   0   0   0   0   0   252    0    0   0.082      2  0.96
  104  105 B   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.078      2  0.97
  105  106 B   0   0   0   0   0   0   0   0  88   0  12   0   0   0   0   0   0   0   0   0   252    0    0   0.365     12  0.78
  106  107 B   0   0   0   0   0   0   0   0   1  98   0   0   0   0   0   0   0   0   0   0   252    0    0   0.098      3  0.96
  107  108 B   0   0   0   0   0   0   0   0   0   0  98   1   0   0   0   0   0   0   1   0   252    0    0   0.111      3  0.94
  108  109 B   0   0   0   0   0   0   0  97   2   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.164      5  0.94
  109  110 B   0   0   0   0   0   0   0   0   0   0  13   0   0   0   0   0   0   0  85   0   252    0    0   0.507     16  0.78
  110  111 B   0   3   0   0  36   0  59   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.876     29  0.87
  111  112 B 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.026      0  0.99
  112  113 B   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.052      1  0.97
  113  114 B   0   0   0   0   0   0   0   0   0   0   1   0  99   0   0   0   0   0   0   0   252    0    0   0.046      1  0.98
  114  115 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  115  116 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  116  117 B   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  117  118 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   252    0    0   0.000      0  1.00
  118  119 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   252    0    0   0.000      0  1.00
  119  120 B   2   0  81  16   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   252    0    0   0.593     19  0.76
  120  121 B   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   252    0    0   0.026      0  0.97
  121  122 B   0   0   0   0   0   0   0   0   0   0  98   2   0   0   0   0   0   0   0   0   252    0    0   0.097      3  0.94
  122  123 B   4   0  96   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.154      5  0.97
  123  124 B   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  124  125 B   0   0   0   0   0   0   0   0   0   0  35   0   2   0   0   0   0   0  62   0   252    0    0   0.784     26  0.59
  125  126 B   1  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.046      1  0.98
  126  127 B   0   0   0   0   0   0   0   0   0   0  11   0   0   1   6  77   0   0   4   0   252    0    0   0.848     28  0.57
  127  128 B   0   0   0   0   0   0   0   3   7   0  23  63   0   0   0   0   1   0   2   0   252    0    0   1.102     36  0.44
  128  129 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  88  10   0   0   0   0   250    0    0   0.453     15  0.82
  129  130 B   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0  91   0   8   251    0    0   0.358     11  0.90
  130  131 B   1   0   0   0   0   0   0  95   1   1   0   1   0   0   0   0   1   0   0   0   252    0    0   0.300     10  0.88
  131  132 B   0   0   0   0   0   0   0   2   0  13   4   3   0   0   0   0   1   0  76   0   252    0    0   0.880     29  0.48
  132  133 B  80   0   2   0   0   0   0   0   2   0   1  12   0   0   0   0   0   0   1   0   253    0    0   0.792     26  0.57
  133  134 B   0   0   0   0   0   0   0   0   0   0   1   0   0   0  77  21   0   0   0   0   253    0    0   0.607     20  0.77
  134  135 B  92   0   1   0   0   0   0   5   0   0   1   0   0   0   0   0   0   0   0   0   253    0    0   0.345     11  0.85
  135  136 B   0   0   0   2   0   0   0   1  22   0  70   2   1   0   0   0   0   0   0   0   253    0    0   0.916     30  0.52
  136  137 B   0   0   0   0   0   0   0   0   1   0   0   0   0   0  98   0   0   0   0   0   253    0    0   0.123      4  0.93
  137  138 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   253    0    0   0.077      2  0.96
  138  139 B   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.078      2  0.99
  139  140 B   0   0   0   0   0   0   0   1  19  43  33   0   0   0   0   0   1   0   2   0   252    0    0   1.252     41  0.43
  140  141 B   0   0   0   0   0   0   0  76  22   0   2   0   0   0   0   0   0   0   0   0   252    0    0   0.632     21  0.75
  141  142 B   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   252    0    0   0.052      1  0.98
  142  143 B   0   0   0   0   0   0   0   3   2   0  16  77   0   0   0   0   0   0   1   0   252    0    0   0.799     26  0.57
  143  144 B   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.052      1  0.97
  144  145 B   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.000      0  1.00
  145  146 B   0  99   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.046      1  0.98
  146  147 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   251    0    0   0.000      0  1.00
  147  148 B   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   251    0    0   0.052      1  0.94
  148  149 B   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   251    0    0   0.000      0  1.00
  149  150 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   251    0    0   0.052      1  0.96
  150  151 B   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.000      0  1.00
  151  152 B   5  75  20   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.725     24  0.75
  152  153 B   0   0   0   0   0   0   0   0   0   0   6   0   0   0   0   0   0   0  21  72   251    0    0   0.806     26  0.60
  153  154 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  99   251    0    0   0.065      2  0.97
  154  155 B   0   0   0   0   0   0   0   3   0   0   9   2   0   1  20   3   1   0  60   1   251    0    0   1.276     42  0.35
  155  156 B   0   0   0   0   0   0   0   0   0   0   3   0   0   0  11   0  70   4  11   0   251    0    0   1.029     34  0.53
  156  157 B   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.052      1  0.99
  157  158 B  63  15  23   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.912     30  0.78
  158  159 B   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   251    0    0   0.052      1  0.99
  159  160 B   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   251    0    0   0.078      2  0.97
  160  161 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   251    0    0   0.000      0  1.00
  161  162 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.026      0  1.00
  162  163 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   251    0    0   0.000      0  1.00
  163  164 B   1   0   0  41   0   0   0   0   0   0   0  56   2   0   0   0   0   0   0   0   251    0    0   0.822     27  0.37
  164  165 B   0   0   0   0   0   0   0   0   0   0  10  89   0   0   0   0   0   0   0   0   251    0    0   0.384     12  0.84
  165  166 B   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   251    0    0   0.000      0  1.00
  166  167 B   6   0   2  17   0   0   0   6  67   0   0   1   1   0   0   0   0   0   0   0   252    0    0   1.088     36  0.38
  167  168 B   0  97   0   1   0   0   0   0   0   0   0   0   0   0   0   2   0   0   0   0   252    0    0   0.172      5  0.93
  168  169 B   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  169  170 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   252    0    0   0.000      0  1.00
  170  171 B   3   3  93   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.318     10  0.91
  171  172 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  96   0   3   252    0    0   0.218      7  0.93
  172  173 B   0   0   0   0   0   0   0   0   8   0   7  82   0   0   0   1   1   0   1   0   252    0    0   0.688     22  0.63
  173  174 B   0   0   0   0   0   0   0  93   5   0   1   0   0   0   0   0   0   0   0   0   253    0    0   0.317     10  0.92
  174  175 B   7   3   0   1   0   0   0   0   2   0   8   6   0   1   0   0  71   0   0   0   253    0    0   1.106     36  0.32
  175  176 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  10  14  74   0   0   0   253    0    0   0.816     27  0.54
  176  177 B  21   0   6   0   0   0   0   0   1   0   1  48   9   0   0  13   0   0   0   0   253    0    0   1.493     49  0.26
  177  178 B  14   0   2   2   0   0   0   1   2   0   0  73   1   3   1   0   0   0   0   0   253    0    0   1.049     35  0.53
  178  179 B  14   0   0   0   0   0   0  10   8   0  12  29   0   0   0   0   2  23   0   2   253    0    0   1.852     61  0.22
  179  180 B   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   253    0    0   0.000      0  1.00
  180  181 B  11   5   3   0   0   0   0   0  28   0   9  37   0   0   0   0   2   0   5   0   253    0    0   1.710     57  0.28
  181  182 B   0   0   0   0   0   0   0  75   0   0   0   0   0   0   0   0   0   1   0  24   253    0    0   0.616     20  0.69
  182  183 B   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   253    0    0   0.026      0  0.99
  183  184 B   0  13   0   0   0   0   0   0   0   0  20  63   0   0   0   0   2   0   2   0   253    0    0   1.055     35  0.37
  184  185 B   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   253    0    0   0.052      1  0.99
  185  186 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   253    0    0   0.026      0  0.99
  186  187 B  87   0   0   0   0   0   0   0   0   0   0   0  13   0   0   0   0   0   0   0   253    0    0   0.395     13  0.77
  187  188 B   0   1   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   253    0    0   0.072      2  0.99
  188  189 B   0   0   0   0   0   0   0   0   4   0  95   0   1   0   0   0   0   0   0   0   253    0    0   0.225      7  0.92
  189  190 B   3  88   9   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   253    0    0   0.454     15  0.85
  190  191 B   0   0   0   0   0   0   0   1  15   0  84   0   0   0   0   0   0   0   0   0   253    0    0   0.511     17  0.76
  191  192 B  17  70  11   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   253    0    0   0.887     29  0.71
  192  193 B   0   0   0   0   0   0   0   6  35   0  44   1   1   0   0   0   0   0  12   0   253    0    0   1.295     43  0.43
  193  194 B   0   0   0   0   0   0   0   0   0  94   2   0   0   0   0   0   0   1   2   0   253    0    0   0.316     10  0.87
  194  195 B   0   4   0   0   0   0   0   0   0   0   2   9   0   0   0   0   5   0   8  72   253    0    0   1.062     35  0.48
  195  196 B   0   5   0  17  15   0   3  11   3   1   3  14   3   0   1   2   7   0  10   4   253    0    0   2.434     81  0.03
  196  197 B   0   0   0   0   1   0   0   0   0   0   0   0   0   1  49  19   0   0  28   0   252    0    0   1.181     39  0.38
  197  198 B  12  26   4   1   2   0   1   0   0   0   1  45   3   0   0   0   4   0   0   0   252    0    0   1.570     52  0.29
  198  199 B   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  199  200 B  79   0  20   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   252    0    0   0.548     18  0.89
  200  201 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  201  202 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  202  203 B   0   0   0   0   0   0   0   1  98   0   1   0   0   0   0   0   0   0   0   0   252    0    0   0.111      3  0.96
  203  204 B   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   252    0    0   0.052      1  0.97
  204  205 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   252    0    0   0.000      0  1.00
  205  206 B   0   0   0   0   2   0   0   1  94   0   2   1   0   0   0   0   0   0   0   0   252    0    0   0.348     11  0.83
  206  207 B   0   0   0   0  12   0   1   0   1   0  66  18   0   0   0   0   0   0   0   0   252    0    0   1.017     33  0.30
  207  208 B   2   0  10   0   0   0   0   0  73   0  15   0   0   0   0   0   0   0   0   0   252    0    0   0.815     27  0.65
  208  209 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   252    0    0   0.000      0  1.00
  209  210 B   5  93   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.309     10  0.91
  210  211 B   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.026      0  1.00
  211  212 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   252    0    0   0.026      0  0.99
  212  213 B  41   2  56   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   252    0    0   0.852     28  0.80
  213  214 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   252    0    0   0.026      0  0.99
  214  215 B   1   0   0   0   0   0   0   0   4   0   7  10   0   0   0   0   4  36   0  37   252    0    0   1.523     50  0.40
  215  216 B   0   0   0   0   0   0   0  82   0   0  12   0   1   0   0   0   4   0   0   0   252    0    0   0.651     21  0.74
  216  217 B   3   0   0  50   0   0   0   0   0   0   2  13   0   0   5  20   4   0   0   0   252    0    0   1.549     51  0.24
  217  218 B   1   0   0   0   0   0   0   0  15   0   2   0  82   0   0   0   0   0   0   0   252    0    0   0.570     19  0.66
  218  219 B  18   0   2   0   0   0   0   0   0   0   1   6   0   0  59  14   0   0   0   0   251    0    0   1.211     40  0.25
  219  220 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   251    0    0   0.026      0  1.00
  220  221 B   0   0   0   0   0   0   0   0   0   0  16  84   0   0   0   0   0   0   0   0   251    0    0   0.445     14  0.78
  221  222 B   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.000      0  1.00
  222  223 B   1   0  10   0   0   0   0   2  10  12   8  55   0   0   0   0   0   0   0   0   251    0    0   1.437     47  0.41
  223  224 B   0   0   0   0   0   0   0  95   4   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.219      7  0.90
  224  225 B   0   0   0   0   0   0   0   0   0   0   1   0   0  99   0   0   0   0   0   0   251    0    0   0.046      1  0.95
  225  226 B  12   0   3   0   0   0   0   0   0   0   0   0   0   0   0   0   0  80   1   4   251    0    0   0.707     23  0.68
  226  227 B   0   0   0   0   0   0   0   0   1   0  99   0   0   0   0   0   0   0   0   0   251    0    0   0.065      2  0.97
  227  228 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   251    0    0   0.000      0  1.00
  228  229 B   1   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.046      1  0.99
  229  230 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   252    0    0   0.026      0  0.98
  230  231 B   0   0   0   0   0   0   0   0  99   0   0   0   1   0   0   0   0   0   0   0   252    0    0   0.072      2  0.96
  231  232 B  54   0  45   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.735     24  0.85
  232  233 B   0   0   0   0   0   0   0   2  17   0  12  12  35   0   0   1  19   0   1   0   251    0    0   1.733     57  0.14
  233  234 B   0   0   0   1  94   0   4   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.277      9  0.94
  234  235 B   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  235  236 B   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  236  237 B   0   0   0   0   0   0   0   0   0   0  11   0   0   0   0   0   0   0  79   9   252    0    0   0.684     22  0.72
  237  238 B   0   0   0   0   0   0   1  96   0   0   0   0   0   0   0   0   0   0   2   0   252    0    0   0.197      6  0.91
  238  239 B   0   2   0   1   4   0  21   0   0   0   1   0   0  10   0   0   7  12  33   9   252    0    0   1.891     63  0.24
  239  240 B   0   0   0   0   0   0   0   0  94   0   5   0   0   0   0   0   0   0   0   0   252    0    0   0.229      7  0.88
  240  241 B   2   0  12   0  86   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.460     15  0.84
  241  242 B   2   0   2   0   0   0   0  18  56   0   0  11  12   0   0   0   0   0   0   0   252    0    0   1.293     43  0.48
  242  243 B   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   252    0    0   0.026      0  0.99
  243  244 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.026      0  0.99
  244  245 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  245  246 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   252    0    0   0.000      0  1.00
  246  247 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   252    0    0   0.000      0  1.00
  247  248 B   0   0   0   0   0   0   0   1  94   0   0   5   0   0   0   0   0   0   0   0   252    0    0   0.249      8  0.88
  248  249 B   0   0   0   0   0   0   0   0   0   0  26  73   0   0   0   0   0   0   0   0   252    0    0   0.649     21  0.58
  249  250 B   0   0   1   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   252    0    0   0.046      1  0.96
  250  251 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  97   3   0   0   0   0   252    0    0   0.141      4  0.96
  251  252 B   0  98   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.107      3  0.99
  252  253 B   0   0   0   0  98   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.098      3  1.00
  253  254 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   251    0    0   0.000      0  1.00
  254  255 B   0  62  37   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.710     23  0.74
  255  256 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   251    0    0   0.000      0  1.00
  256  257 B   0   0   0   0   0   0   0   0  96   0   4   0   0   0   0   0   0   0   0   0   251    0    0   0.167      5  0.92
  257  258 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   251    0    0   0.000      0  1.00
  258  259 B   0   0   0   0   0   0   0   0   0   0   0   0   1   0  24   0  75   0   0   0   251    0    0   0.614     20  0.55
  259  260 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   252    0    0   0.078      2  0.98
  260  261 B   1  96   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.228      7  0.96
  261  262 B   0  19   7  26   0   0   0   4  16   0   2   6   0   0   0   0   1   0  19   0   252    0    0   1.921     64  0.13
  262  263 B  11  10   5  32   0   0   0   0   4   0   9  20   3   0   0   0   5   0   0   0   253    0    0   1.952     65  0.20
  263  264 B   0   0   0   0   9   0  91   0   0   0   0   0   0   0   0   0   0   0   0   0   253    0    0   0.314     10  0.99
  264  265 B   0   0   0   0   0   0   0   2   2   0  73  11   1   0   0   0  11   0   0   0   253    0    0   0.960     32  0.45
  265  266 B   0   0   4   0   0   0   0   0   0   0   8   0   0  81   0   0   1   0   2   3   253    0    0   0.760     25  0.53
  266  267 B   0   0   0   0   0   0   0   1   0   3   2   0   0   0   0   0   0  15   0  78   253    0    0   0.756     25  0.75
  267  268 B   0   0   0   0   0   0   0   1   0   0  15   1   0   0   0   0   7   4  71   0   253    0    0   1.006     33  0.51
  268  269 B   6   0  89   0   0   0   0   0   0   4   0   0   0   0   0   0   0   0   1   0   253    0    0   0.449     14  0.78
  269  270 B   6  19  71   2   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   253    0    0   0.912     30  0.68
  270  271 B   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   253    0    0   0.077      2  0.94
  271  272 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   253    0    0   0.026      0  1.00
  272  273 B   3   0  97   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   253    0    0   0.127      4  0.98
  273  274 B   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   253    0    0   0.052      1  0.96
  274  275 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  275  276 B  95   2   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.224      7  0.95
  276  277 B   0   0   0   0   0   0   0   4  83   0  11   0   0   0   0   0   0   0   0   1   252    0    0   0.593     19  0.79
  277  278 B   0   1   0   0  95   0   0   0   0   2   0   1   0   0   0   0   0   0   0   0   252    0    0   0.252      8  0.87
  278  279 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   252    0    0   0.026      0  0.99
  279  280 B  14  12   8   0   1   0   0   0   1   0   0   0   0   0  15  50   0   0   0   0   252    0    0   1.490     49  0.19
  280  281 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  281  282 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  282  283 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   252    0    0   0.026      0  1.00
  283  284 B   2  89   6   1   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.458     15  0.89
  284  285 B   0  96   2   1   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.234      7  0.96
  285  286 B   0  61   0   0  38   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.731     24  0.86
  286  287 B   0   0   0   0   0   0   0   8  91   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.312     10  0.88
  287  288 B   0   0   0   0   0   0   0  99   0   0   0   0   1   0   0   0   0   0   0   0   252    0    0   0.072      2  0.96
  288  289 B   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.000      0  1.00
  289  290 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   252    0    0   0.052      1  0.97
  290  291 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   252    0    0   0.052      1  0.99
  291  292 B   0   0   0   0  88   6   6   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.437     14  0.97
  292  293 B   0   0   0   0   0   0   0   1   0   0   0   7   0   0   0   0   0  12  79   0   252    0    0   0.740     24  0.60
  293  294 B   2   0   0   0   0   0   0   0   0   0   0   0  98   0   0   0   0   0   0   0   252    0    0   0.123      4  0.94
  294  295 B   0   0   0   0   0   0   0   0   0   0   3   0   0   0   0  12   1   0  83   0   252    0    0   0.592     19  0.67
  295  296 B  79   0  20   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.529     17  0.91
  296  297 B   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.026      0  1.00
  297  298 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   252    0    0   0.000      0  1.00
  298  299 B  11   0   2   0   0   0   0   0  27   0  22  39   0   0   0   0   0   0   0   0   252    0    0   1.369     45  0.36
  299  300 B   0  65   2  31   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0   252    0    0   0.772     25  0.88
  300  301 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  17  83   0   0   0   0   252    0    0   0.476     15  0.83
  301  302 B   0   0   0   0   0   0   0  56  26   0   5   2   3   0   1   0   6   0   0   0   252    0    0   1.267     42  0.58
  302  303 B   0   0   0   0   0   0   0   3   0   0   0   0   0   0   0   0   0  57   0  40   252    0    0   0.832     27  0.79
  303  304 B   0   0   0   0   0   0   0   0   0   0   0   1   0   0  90   8   0   0   0   0   252    0    0   0.358     11  0.85
  304  305 B  37   0   2   0   0   0   0   0  56   0   4   0   0   0   0   0   0   0   0   0   252    0    0   0.929     31  0.42
  305  306 B   0   1   0   0   0   0   0  98   1   0   0   0   0   0   0   0   0   0   0   0   252    0    0   0.118      3  0.95
  306  307 B  68   0  16   0   0   0   0   0   1   0   8   5   0   0   0   0   0   0   0   0   252    0    0   1.036     34  0.55
  307  308 B   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.052      1  0.98
  308  309 B   2   0   0   0   0   0   0   1  67   0  18   7   0   0   0   0   4   0   0   0   251    0    0   1.079     36  0.48
  309  310 B   0   0   0   0   0   0   0  97   1   0   1   0   0   0   0   0   0   0   0   0   251    0    0   0.163      5  0.95
  310  311 B   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   251    0    0   0.000      0  1.00
  311  312 B   0   0   0   0   0   0   0   2   0   0   1   0   0   0   0   0   0  17   0  80   251    0    0   0.581     19  0.81
  312  313 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   251    0    0   0.026      0  0.99
  313  314 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   1   0   0   0   0   251    0    0   0.072      2  0.98
  314  315 B  99   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   251    0    0   0.072      2  0.98
  315  316 B   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   251    0    0   0.052      1  0.97
  316  317 B   0   0   0   0   0   0   0   0   0   0   0   0  99   0   1   0   0   0   0   0   251    0    0   0.072      2  0.94
  317  318 B   1  96   2   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   250    0    0   0.191      6  0.95
  318  319 B   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   250    0    0   0.052      1  0.96
  319  320 B  99   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   250    0    0   0.047      1  1.00
  320  321 B   0   0   0   0   0   0   0   0   0   1  28  71   0   0   0   0   0   0   0   0   250    0    0   0.641     21  0.52
  321  322 B   3   0   0   0   0   0   0   2  14   1   4   3   0   0   0   2   0  16  12  42   250    0    0   1.756     58  0.35
  322  323 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   6  94   249    0    0   0.254      8  0.93
  323  324 B   0   0   0   0   0   0   0  96   4   0   0   0   0   0   0   0   0   0   0   0   249    0    0   0.168      5  0.94
  324  325 B   1   3   9  86   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   249    0    0   0.569     19  0.79
  325  326 B   0   0   0   0   0   0   0   1  87   0  12   0   0   0   0   0   0   0   0   0   249    0    0   0.421     14  0.75
  326  327 B  70  26   1   0   0   0   0   0   1   0   0   0   2   0   0   0   0   0   0   0   248    0    0   0.777     25  0.67
  327  328 B   0   0   0   0   0   0   0   2  66   0   0   0  32   0   0   0   0   0   0   0   247    0    0   0.725     24  0.52
  328  329 B   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   247    0    0   0.053      1  0.99
  329  330 B   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   247    0    0   0.053      1  0.97
  330  331 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   247    0    0   0.000      0  1.00
  331  332 B   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   247    0    0   0.000      0  1.00
  332  333 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   247    0    0   0.000      0  1.00
  333  334 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   247    0    0   0.026      0  0.98
  334  335 B   0  12   0   5  74   0   0   0   0   0   0   7   0   0   1   0   0   0   0   0   247    0    0   0.878     29  0.60
  335  336 B   1  98   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   247    0    0   0.113      3  0.97
  336  337 B   0   1   0   0   0   0   0   0   0   0   0   0   0   0  36  63   0   0   0   0   246    0    0   0.723     24  0.75
  337  338 B  20   0  80   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   244    0    0   0.527     17  0.89
  338  339 B   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   243    0    0   0.000      0  1.00
  339  340 B   0   0   0   0   0   0   0   0  20   0   3   0   0   0   0   0   0   0  78   0   236    0    0   0.612     20  0.53
  340          0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     0    0    0   0.000      0  1.00
  341    2 G   0   0   0   0   0   0   0   0   0  99   1   0   0   0   0   0   0   0   0   0    85    0    0   0.064      2  0.94
  342    3 G  49   0   2   0   0   0   0   0  49   0   0   0   0   0   0   0   0   0   0   0    88    0    0   0.786     26  0.38
  343    4 G   1  43  51   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    92    0    0   0.891     29  0.67
  344    5 G   0   0   0   0   0   0   0   0   2   1   1   2   0  41   0   0   0   1  49   2    92    0    0   1.112     37  0.34
  345    6 G   9   0  83   1   0   0   0   0   0   0   4   0   0   0   1   0   0   0   2   0    93    0    0   0.683     22  0.52
  346    7 G   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0  26  60  11   2   138    0    0   1.016     33  0.54
  347    8 G   0   0   0   0   0   0   0   0   0   0   3   0   0   0   1   0   0   7   9  81   149    0    0   0.709     23  0.72
  348    9 G   0  75   0  20   0   0   0   0   0   0   0   5   0   0   0   0   0   0   0   0   155    0    0   0.674     22  0.79
  349   10 G   0   0   0   0   0   0   0   0   8  24  30  37   0   0   1   0   0   0   0   0   156    0    0   1.310     43  0.38
  350   11 G   0   0   0   0   0   0   0   0   0   1   3   1   0   0   0   8   1  74   2  12   160    0    0   0.929     31  0.62
  351   12 G   2   2  12   1   0   0   0   0   0   0   0   0   0   0   1  82   0   1   0   0   165    0    0   0.654     21  0.51
  352   13 G   0   0   0   0   0   0   0   1   8   0   3   0   0   0   0   0   1  45   0  43   166    0    0   1.112     37  0.60
  353   14 G   1  21   7   1   0   0   0   0   3   0   0   1   0   1   1  51   5   5   1   2   166    0    0   1.590     53  0.16
  354   15 G   0  78   1   5   0   0   0   0  15   0   0   1   0   0   0   1   1   1   0   0   196    0    0   0.766     25  0.61
  355   16 G   1   1   0   0   0   0   0   0   0   0   0   0   0   0  35  52  11   0   0   0   246    0    0   1.036     34  0.58
  356   17 G   0   2   0  53   0   0   0   0   0   0   0   0   0   0  18  26   1   0   0   0   249    0    0   1.153     38  0.38
  357   18 G   0  13   0   2   0   0   0   0  17   0   0   8   0   0   0   0   4  54   1   0   249    0    0   1.396     46  0.27
  358   19 G  88   5   5   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   249    0    0   0.504     16  0.88
  359   20 G   0   0   0   0   0   0   0   0   1   0   0   2   0   0   0   0   3  74   2  17   249    0    0   0.892     29  0.77
  360   21 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  96   0   3   0   249    0    0   0.180      6  0.93
  361   22 G   0  97   0   3   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   249    0    0   0.128      4  0.99
  362   23 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0  31  69   1   0   0   0   249    0    0   0.659     21  0.78
  363   24 G   2  18   5  17   1   0   2   0   0   0   0   2   0   0   2  49   1   0   0   0   249    0    0   1.574     52  0.22
  364   25 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   3  97   0   0   249    0    0   0.142      4  0.95
  365   26 G  57   2   0   0   0   0   0   0  41   0   0   1   0   0   0   0   0   0   0   0   249    0    0   0.815     27  0.47
  366   27 G   0   0   0   0   0   0   4  12   4   0  10  13   9   0   0  37   1   0  10   0   249    0    0   1.881     62  0.16
  367   28 G  11  39  16  15   0   0   0   0   0   0   0   4   0   0   0   0   0   0  14   0   249    0    0   1.649     55  0.40
  368   29 G   0   0   0   0   0   0   0   0   0   8   0   8   1   0   1   1  16  44   0  20   249    0    0   1.550     51  0.49
  369   30 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   249    0    0   0.026      0  0.99
  370   31 G  12   0  27  20   0   5   0   0   5   0   1   3   0   0   0   0  22   2   0   2   249    1    0   1.915     63  0.17
  371   32 G   0  18   0   7   0   0   0   0   2  15   0   1   0   0   2  38  15   0   0   0   248    0    0   1.712     57  0.20
  372   33 G  81   3  13   0   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0   248    0    0   0.625     20  0.86
  373   34 G   0   0   0   0   0   0   0   0   1   0  99   0   0   0   0   0   0   0   0   0   248    0    0   0.047      1  0.99
  374   35 G   1   0   0   0   0   0   0   0   2   0   0   1   0   0   1  73  21   1   0   0   248    0    0   0.818     27  0.62
  375   36 G   1   0   0   1   0   0   0   0  46   0   5  12  32   0   0   0   0   0   2   0   249    0    0   1.340     44  0.39
  376   37 G   1   0   4   0   0   0   0  14  39   0  21   0  20   0   0   0   0   0   0   0   249    0    0   1.529     51  0.38
  377   38 G   1   0   0   0   0   0   0   0  36   2   4   2   0   0   0  17   0  37   0   0   249    0    0   1.448     48  0.31
  378   39 G   0   0   0   0   0   0   0   0   3   0   0   0   0   0   0   0   0  66   0  29   249    0    0   0.831     27  0.75
  379   40 G  11  45  38   3   1   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0   249    0    0   1.210     40  0.65
  380   41 G   1  20   3  10   0   0   0   0   0   0   0   1   1   0  16  38  11   0   0   0   249    0    0   1.693     56  0.20
  381   42 G   0   0   0   0   0   0   0   1  21   0   1   4   0   1   2   2  16  14  17  21   249    0    0   1.946     64  0.33
  382   43 G   0   0   0   0  10   1  88   0   0   0   0   0   0   0   0   0   0   0   0   0   249    0    0   0.424     14  0.97
  383   44 G  31   0  27   0   0   0   0   0   0   0   0   0  42   0   0   0   0   0   0   0   249    0    0   1.124     37  0.41
  384   45 G   1   3   1  10   0   0   0   1   0   0   2   3   0   0   0   0   3  71   0   6   249    0    0   1.171     39  0.51
  385   46 G   0   0   0   0   0   0   0   2  33   0   5   2   0   0   0   0  13  41   2   2   249    0    0   1.476     49  0.42
  386   47 G   0   2   0   2   0   0   0   2   0   0   0   0   0  28  30   1  14   4  16   0   249    0    0   1.750     58  0.31
  387   48 G  10   2   3   2   0   0   0   0  42   0  33   1   0   0   0   0   1   4   0   0   249    0    0   1.521     50  0.32
  388   49 G   0   0   0   0   0   0   0  47   4   2   0   1  10   0  12  16   1   4   0   2   249    1    0   1.675     55  0.21
  389   50 G   0   0   0   0   0   0   1   1   0   0   5   3   0   0   1  12   0  58  17   3   248    0    0   1.373     45  0.48
  390   51 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   248    0    0   0.026      0  1.00
  391   52 G   1   0   1   0   0   0   0   0  11  83   0   1   0   0   0   0   0   0   0   0   249    0    0   0.677     22  0.72
  392   53 G   0  91   0   0   8   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   249    0    0   0.315     10  0.96
  393   54 G  44  35  20   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   249    0    0   1.073     35  0.70
  394   55 G  16   2  12   3   0   0   0   0   0   0   1   8   0   3   1  54   0   0   0   0   249    0    0   1.512     50  0.21
  395   56 G   0   0   0   0   0   0   0  76   3  20   0   0   0   0   0   0   0   0   0   0   249    0    0   0.673     22  0.65
  396   57 G  43   1  50   0   2   0   0   0   0   3   0   0   0   0   0   0   0   0   0   0   249    0    0   0.983     32  0.73
  397   58 G   0   0   0   0   0   0   0   0   1  90   4   1   0   0   0   0   0   0   0   3   249    0    5   0.477     15  0.81
  398   59 G   0   0   0   0   0   0   0   0  31   1   4   4   0   0   0   3   0  52   0   3   249    0    0   1.325     44  0.38
  399   60 G   0   0   0   0   0   0   0  11   6   0  24   0   0   0   1   4   0   4   0  51   249    0    0   1.389     46  0.39
  400   61 G   0   0   0   0   0   0   0   0   0   0  12   4   0   0   3  51   0  25   2   2   249    0    0   1.397     46  0.35
  401   62 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   249    0    0   0.000      0  1.00
  402   63 G   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   249    0    0   0.000      0  1.00
  403   64 G   0   0   0   0  94   3   4   0   0   0   0   0   0   0   0   0   0   0   0   0   249    0    0   0.283      9  0.98
  404   65 G   0   0   0   0   0   0   0   0   3   0   0   0   0   0  33  63   0   0   0   0   247    0    0   0.802     26  0.66
  405   66 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  95   0   5   242    0    0   0.185      6  0.97
  406          0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     0    0    0   0.000      0  1.00
  407   13 P   0  19   0   0  76   0   6   0   0   0   0   0   0   0   0   0   0   0   0   0    54    0    0   0.682     22  0.86
  408   14 P   0   0   0   0   0   0   0   1   1   3   2   0   0   0   0   0   6  66   1  20   148    0    0   1.089     36  0.69
  409   15 P   1   3   0   0   0   0   0  81   0   1   1   0   0   0   0   1   6   7   0   0   151    0    0   0.761     25  0.67
  410   16 P   1   1  23   0   1   0   2   3   0   6  21  10   3   0   0   0  26   1   2   0   155    0    0   1.953     65  0.07
  411   17 P   3   0   0   0   0   0   0   0  50   2  42   3   1   0   0   0   0   0   0   0   157    0    0   1.023     34  0.51
  412   18 P  35   0   6   1   0   0   0   1   0   0   7  45   0   0   0   1   0   0   4   1   161    0    0   1.365     45  0.35
  413   19 P   0   0   0   0   0   0   0   0   0   0   0   0   0  37   0   0   4   0  59   0   167    0    0   0.814     27  0.58
  414   20 P   0   0   0   0   0   0   0   0   0   0   1  99   0   0   0   0   0   0   0   0   172    0    0   0.036      1  0.99
  415   21 P   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   177    0    1   0.000      0  1.00
  416   22 P   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   183    0    0   0.000      0  1.00
  417   23 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   1   0   183    0    0   0.034      1  0.99
  418   24 P   0   0   0   0   0   0   0  99   0   0   0   0   1   0   0   0   0   0   0   0   183    0    0   0.034      1  0.99
  419   25 P 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   183    0    0   0.000      0  1.00
  420   26 P   8  12  80   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   183    0    0   0.627     20  0.84
  421   27 P   0   0   0   0   0   0   0   0   1   0   2   1   0   6   1  11   3   8  67   0   183    0    0   1.190     39  0.55
  422   28 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   184    0    0   0.000      0  1.00
  423   29 P   0   0   0   0   0  99   1   0   0   0   0   0   0   0   0   0   0   0   0   0   184    0    0   0.060      2  0.99
  424   30 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0  81   2  17   1   0   0   184    0    0   0.566     18  0.72
  425   31 P   0   1   0   0   0   0   0   0   0   0   3   1   0   0  58  35   2   1   1   0   184    0    0   0.985     32  0.63
  426   32 P   0   0   0   0  84   0  16   0   0   0   0   0   0   0   0   0   0   0   0   0   184    0    0   0.445     14  0.98
  427   33 P   0   0   0   0   0   0   0   0   0   0   0   0   0   3   1  96   1   0   0   0   184    6  105   0.218      7  0.91
  428   34 P   0  98   1   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   179    0    0   0.096      3  0.99
  429   35 P   0   0   1   0   0   0   0   0   0   0   0   0   0   0   1   1   3  91   0   3   179    0    0   0.421     14  0.89
  430   36 P   3   0   1   0   1   0   1   0  12   0  43  34   1   0   1   0   1   0   4   0   180    0  179   1.393     46  0.34
  431   37 P   0   1   1   2   0   0   0   0   2   0   2   3   1   1  27  37   2  18   4   1   186   25   86   1.730     57  0.33
  432          0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     0    0    0   0.000      0  1.00
  433   68 P  12  22  38   2  22   0   0   0   0   0   2   1   0   0   1   0   1   0   0   0   161    0    0   1.551     51  0.58
  434   69 P   1   0   0   0   0   0   0   4   9   0  45   1   4   1   1   2   4   1  21   6   162   35    5   1.770     59  0.34
  435   70 P   0   1   0   1   1   0   0  39   2   0   2   0   0   0  54   0   1   1   0   0   127    0    0   1.046     34  0.14
  436   71 P   0   1   0   0   0   0   0   1   0   0   1   0   0   0   0  95   2   0   0   1   130    0    0   0.259      8  0.88
  437   72 P   1   2   3  92   0   0   0   0   0   1   0   1   0   0   0   2   0   0   0   0   131    0    0   0.426     14  0.86
  438   73 P   1   0   0   1   0   0   0   1   0   0  51  37   1   0   1   0   1   4   1   1   139    1    0   1.191     39  0.34
  439   74 P  19  35  23  13   1   0   0   1   5   0   1   1   0   0   0   1   0   1   0   1   138    0    0   1.688     56  0.47
  440   75 P   0   1   0   2   0   0   0   0   1   2   1   0   0   0   1  31  60   0   0   1   139    0    0   1.036     34  0.48
  441   76 P   1   2   0   0   0   0   0   0   0   0   0   1   0   0   3   0   1  85   1   6   145    0    0   0.671     22  0.73
  442   77 P   0   2   1   3  19   0  57   3   2   0   1   1   1   0   0   3   3   3   0   3   157    0    0   1.551     51  0.37
  443   78 P   0   3   1   3   1   0   1   4  19   0   1   2   1   0   0   1   1  48   8   6   165    0    0   1.729     57  0.33
  444   79 P   5  43   2  30   0   0   3   1   2   4   0   2   0   0   1   1   1   3   1   1   167    0    0   1.709     57  0.46
  445   80 P   2  14  41  19   1   0   1   0   1   0   4   1   0   0   1   3   1  10   1   4   170    0    0   1.848     61  0.27
  446   81 P   0   8   1   2   1   0   0   3   2   0   0   2   0  32   0   7  11   6  21   4   170    1    0   2.039     68  0.22
  447   82 P   0   4   2   1   0   0   0   2   7   1   2   0   0   0   4  13  13  34   8  11   169    0    0   2.080     69  0.31
  448   83 P   1   2   0   0   1   0   0   3   1   0   1   1   0   0   0   3   3  41   5  40   188   19    0   1.419     47  0.61
  449   84 P   0  19   0   1   1   0   0   1   2   0   1   0   0   0   1  29  21  20   0   5   170    0    0   1.746     58  0.20
  450   85 P   0   7   1  11   2   0   0   3   0   0   1   0   0   0   0   0   0  38   1  36   171    0    0   1.484     49  0.31
  451   86 P   3   1   0   0   0   0   0   0   1   0   8   1   0   1   0   0   1   3   2  81   189    1    0   0.793     26  0.67
  452   87 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0  83   1  16   188    0    0   0.503     16  0.87
  453   88 P   0   0   0   0   0   0   0   7   4   1   6   3   0   1   3   3   2  36  19  16   189    0    0   1.912     63  0.41
  454   89 P   1   1   0   0  55   0   1   0   0   0   3   0  38   0   0   0   0   3   0   0   190    0    0   0.985     32  0.28
  455   90 P   1  96   1   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.193      6  0.97
  456   91 P   0   7   0   1   0   0   0   0   1   0   0   1   0   1  31  13  45   1   1   1   190    0    0   1.400     46  0.37
  457   92 P   1   0   0   1   0   2   0   0   1   0   1   0   0   4   9  36  36   9   1   1   190    0    0   1.555     51  0.39
  458   93 P   0   0   3   0   1   0  96   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.180      6  0.93
  459   94 P   0   1   0   3   0   0   0   0   1   0   1   0   0   0  80   0  15   0   1   0   190    0    0   0.687     22  0.67
  460   95 P   1   3   0   3   0   0   0   0   1   0   0   0   0   0  26  56   6   4   1   0   190    0    0   1.258     42  0.54
  461   96 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0  11  11  75   3   1   0   190    0    0   0.849     28  0.66
  462   97 P   0   0   0   0   0   0   0   0   0   0   1   0  41   0  58   1   0   0   0   0   190    0    0   0.735     24  0.29
  463   98 P   0   4   8  88   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.447     14  0.89
  464   99 P   1   1   1   1   0   0   0   0   9   0   0   0   0   1   2   3  43  37   1   2   190    0    0   1.425     47  0.46
  465  100 P   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   4  65   1  30   190    0    0   0.831     27  0.78
  466  101 P   0   6   0  94   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.236      7  0.98
  467  102 P   0  13   2   5   0   0   0   1   0   0   0   0   0  41  33   4   2   0   0   0   190    0    0   1.450     48  0.25
  468  103 P   0   1   1   1   0   0   0   0   7   0   3   1   0   0  15   3  53  10   2   5   190    0    0   1.600     53  0.39
  469  104 P   0   1   0   1   0   0   0   0   3   0   1   0   0   1  17  35  41   1   1   0   190    0    0   1.376     45  0.42
  470  105 P   4  73   3   1   4   0   1   0   2   0   1   9   2   0   1   0   0   0   1   0   190    0    0   1.125     37  0.55
  471  106 P   1   0   0   0   0   0   5   9   4   0  42   1   4  21   0   1   4   5   4   1   190    2    0   1.849     61  0.19
  472  107 P   0   2   0   0  41   0   0   2   2   2  12   1   0   8   7  20   2   1   2   0   188    3    5   1.799     60  0.00
  473  108 P   2   3   1   1   1   0   0  75   1   1   1   0   0   4   3   4   1   0   4   0   187   12    9   1.149     38  0.47
  474  109 P   1   1   1   0   0   0   0   0   1  74   0   0   0   1   2   6  15   0   0   0   178    0    0   0.947     31  0.58
  475  110 P   1   1   0   0   0   0   1   1   0   0   2   3   1   1  35  18  36   1   1   0   184    0    0   1.501     50  0.37
  476  111 P   0   0   1   0  70   0  29   0   0   0   0   0   0   0   0   0   0   0   0   0   185    0    0   0.655     21  0.95
  477  112 P   0   0   0   0   0   0   0  53   2   0   1   1   0   0   4  23   1  13   1   3   189    0    0   1.350     45  0.39
  478  113 P   1   0   0   0  25   0   4   7   0   0   4   2   2   3   3  15  32   2   1   1   190    0    0   1.964     65 -0.02
  479  114 P  86  12   1   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   190    7    2   0.458     15  0.86
  480  115 P   3   2  10   2  31   0  30   0   0   0   2   2   4   8   1   0   5   0   0   0   183    0    0   1.895     63  0.32
  481  116 P   2   1   0   0   1   0   1   1   0   0   1   3   2   1   1   0   6  66   2  14   190    0    0   1.320     44  0.55
  482  117 P   0  65  28   3   0   0   0   0   0   0   0   1   0   1   1   0   0   1   1   1   190    0    0   0.960     32  0.66
  483  118 P   0   5   0   0   0   0   0   1   2  15   8  11   1   0   1   3   6  35   4   8   190    0    0   2.043     68  0.24
  484  119 P   1   0   0   0   0   0   0   1   0   0  56  26   0   1   1   1   0   1  12   3   190    1    0   1.204     40  0.46
  485  120 P   0   0   0   0   0   0   0  80   3   0   3   2   0   7   1   4   1   0   0   0   189    0    0   0.840     28  0.59
  486  121 P   1   0   0   0   0   0   0   2   0   1   2   1   0   0   0   3   3  81   1   8   190    0    0   0.841     28  0.77
  487  122 P   0   0   0   0   0   0   0  18  21   0   1   1   0   0   2   0  34  16   3   6   190    0    0   1.696     56  0.38
  488  123 P   0   1   0   1  97   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.168      5  0.98
  489  124 P   6  94   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.254      8  0.94
  490  125 P   1   0   0   0   0   0   0   0   4   0   5   0   0   0   1   1   4  49   2  34   190    0    0   1.307     43  0.59
  491  126 P  14   0   0  19   0   0   0   0  28   0   1  28   7   0   0   0   0   3   0   0   190    0    0   1.622     54  0.25
  492  127 P  23   3  74   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.667     22  0.87
  493  128 P   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0  53   0  47   190    0    0   0.721     24  0.80
  494  129 P   1   0   0   0   0   0   0   2   0   0   2   0   0   0   3  78   7   4   5   0   190    5    0   0.907     30  0.66
  495  130 P   0   0   0   0   0   0   0   2   0   0   0   1   0   0   0   0   0  96   0   1   185    0    0   0.197      6  0.94
  496  131 P   0   4   0   0   0   0   0   1   1   2   1   0   3  19   6   6  35   1  12   9   190    0    0   1.954     65  0.33
  497  132 P   1   0   0   1   0   0   1   0   2   2   1   1   0   5  11  76   0   0   0   0   190    0    0   0.940     31  0.66
  498  133 P   3   7  20   0   1   0   1   4   1   0  36   7   1   7   0   3   1   1   8   2   190    0    0   2.027     67  0.12
  499  134 P  15   0   5   0   0   0   0   0   4   0   0  76   0   0   0   0   0   0   0   0   190    1    0   0.759     25  0.63
  500  135 P  12  35   2   1   0   0   0   0   0   1   0  50   0   0   1   0   0   0   0   0   189    0    0   1.134     37  0.38
  501  136 P  37   3  60   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.770     25  0.84
  502  137 P  39   5  28  27   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   1.250     41  0.64
  503  138 P  69   0  31   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   190    0    0   0.646     21  0.86
  504  139 P   0   1   0   0   1   0   0   0   0   0   0   0   0  96   0   0   0   0   3   0   190    0    0   0.187      6  0.94
  505  140 P   1   2  97   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.160      5  0.97
  506  141 P   0   0   0   0   2   0  97   0   0   0   1   0   0   0   0   0   0   1   0   0   190    0    0   0.147      4  0.96
  507  142 P   0   0   0   0   0   0   0   1   2   0   1   0   0   0   1   8   4  81   1   2   190    0    0   0.823     27  0.73
  508  143 P   3   0   1   0   0   0   0   0   0   4   1   1   0   3   6   2   3   9   5  62   190    0    0   1.476     49  0.50
  509  144 P   1   0   0   0   1   0   1  61   3   0   4   1   0   2   0   3   3   3   7  13   190    0    0   1.480     49  0.50
  510  145 P  32   7  54   1   0   0   2   0   1   0   0   1   0   0   0   0   2   0   2   1   190    0    0   1.210     40  0.66
  511  146 P   0   1   1   0   0   0   0   1   3  38   7   2   0   1   3  37   2   3   0   3   190    0    0   1.593     53  0.28
  512  147 P   0   0   0   0   0   0   0  80  16   2   2   1   0   0   0   0   0   0   0   1   190    0    0   0.656     21  0.77
  513  148 P   0   0   0   0   0   0   0   0   5   0   2  19  74   0   0   0   0   0   1   0   190    0    0   0.794     26  0.64
  514  149 P   3   0   1   0   0   0   0   1   5   0   3   2   0   0   2   3   2  51   1  29   190    0    0   1.471     49  0.52
  515  150 P   1   1   1   0   0   0   0   0  65   1   7  13   0   0   1   2   4   4   1   0   190    0    0   1.315     43  0.49
  516  151 P   3  52   0  45   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.824     27  0.89
  517  152 P   0   0   0   0   0   0   0   0   0   0   3   0   0   5   0   0   0   0  87   5   190    0    0   0.531     17  0.84
  518  153 P   1   0   0   0   0   0   0  42   0   0  36   1   0   1   1   6   1   1   8   2   190    0    0   1.423     47  0.43
  519  154 P   3   0   0   0   0   0   1   1   1   0  34   0  61   0   0   0   0   1   0   0   190    0    0   0.897     29  0.64
  520  155 P   0  68   2  26   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.827     27  0.90
  521  156 P   2   5  26   3   0   0   0   0   3   0   3  25   3   1   1   2   4   3   2  18   190    0    0   2.083     69  0.14
  522  157 P   2   1   1   0   0   0   1   0   1   0  10   3  77   0   0   2   2   2   0   0   190    0    0   0.971     32  0.59
  523  158 P   3  96   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.180      6  0.96
  524  159 P   0   0   0   0   1   0   0   0  94   0   3   0   2   0   0   0   0   0   0   0   190    0    0   0.274      9  0.89
  525  160 P   3   2   2   0   0   0   0   3  49   0   8  14   0   1   1   4   8   5   1   0   190    0    0   1.768     59  0.33
  526  161 P   0   0   1   0   0   0   0   0   1   0   1   1   0   0   0   4   5  81   1   7   190    0    0   0.813     27  0.75
  527  162 P   0   0   0   0   1   0  97   0   0   0   0   0   1   1   0   0   0   0   0   0   190    0    0   0.149      4  0.97
  528  163 P   0   1   0   0   0   0   0   0   4  82   8   3   0   0   1   1   1   1   1   0   190    0    0   0.790     26  0.72
  529  164 P   1   4   6  17   2   0   1   2  19   0   9  25   0   2   1   1   6   0   4   1   190    0    0   2.185     72  0.15
  530  165 P  89   1   7   1   1   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   190    0    0   0.443     14  0.91
  531  166 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   3  97   0   0   0   0   190    0    0   0.122      4  0.97
  532  167 P   0   3   0   0  97   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.122      4  0.99
  533  168 P   0   0   0   0   0   0   0   0  10   0   0   1  89   0   0   0   0   0   0   0   190    0    0   0.357     11  0.81
  534  169 P   0   0   2   0   0   0   0   0   2   0   4   0   1   0  47  45   0   0   0   0   190    0    0   0.993     33  0.62
  535  170 P  37   3  57   1   2   0   0   0   1   0   0   0   0   0   0   0   0   0   0   1   190    0    0   0.931     31  0.78
  536  171 P   2   4   2   1   0   0   0   0   1   0   1   0   9   0  14  54   1   3   1   9   190    0    0   1.593     53  0.29
  537  172 P   1   0   0   0   0   0   0   6  51   0  41   1   1   0   0   0   0   0   0   0   190    0    0   0.966     32  0.53
  538  173 P   8   1   0   0   0   0   0   0   2   1  84   1   2   0   1   0   0   1   0   1   190    0    0   0.723     24  0.71
  539  174 P  30   8   3   0   0   1   0   0  15   0   7   1   0   1   1   2   0   3  24   7   190    0    0   1.948     65  0.14
  540  175 P   2   3  31   0   0   1   0   0  22   0   6  36   0   0   0   0   0   0   0   0   190    0    0   1.444     48  0.27
  541  176 P   0   0   0   0   0   0   0  88   1   0   4   0   0   1   1   3   2   0   0   1   189    0    0   0.570     19  0.77
  542  177 P   3   8   2  13   0   0   0   0  66   1   0   8   0   0   0   0   0   0   0   0   190    1    0   1.137     37  0.43
  543  178 P   0   1   0   0   0   0   0  29   6   0  60   0   0   0   1   0   1   2   0   0   189    0    0   1.029     34  0.58
  544  179 P   0   1   0   1   0   0   1   1   8   1  21   4   0   2  13   4   1  12   1  30   189    0    0   2.021     67  0.21
  545  180 P   0   6   0   1   1   0   0   0   0   0   1   4   0   4  69   2   3   2   3   6   189    0    0   1.271     42  0.43
  546  181 P   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   189    0    0   0.000      0  1.00
  547  182 P   1   0   0   0   0   0   0   0   1   1  45  28   3   0  12   8   0   2   0   0   189    0    0   1.461     48  0.30
  548  183 P   2   8   1   1   0   0   0   1   3   2  24  11   0   0  21   4   1   6   6  12   189    0    1   2.197     73  0.15
  549  184 P   0   0   1   0   2   0   1   1   2   0   8   0   1   0   1  12   1  14  30  29   189    0    0   1.798     60  0.34
  550  185 P  39   0   0   0   0   0   3  25  34   0   0   0   0   0   0   0   0   0   0   0   189    0    0   1.176     39  0.35
  551  186 P  13  85   2   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   190    0    0   0.490     16  0.85
  552  187 P   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   190    0    0   0.000      0  1.00
  553  188 P   0   0   0   0   0   0   0   0  59   0   1  40   0   0   0   0   0   0   0   0   190    0    0   0.726     24  0.58
  554  189 P   0  98   2   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.114      3  0.98
  555  190 P   1  96   0   0   0   0   0   0   0   0   0   0   0   0   0   0   3   0   0   0   190    0    0   0.198      6  0.90
  556  191 P  64   2  31   1   0   0   0   0   3   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.836     27  0.81
  557  192 P   0   0   0   0   0   0  99   0   0   0   0   0   1   0   0   0   0   0   0   0   190    0    0   0.033      1  1.00
  558  193 P   0   0   0   0   0   0   3   0   0   0   0   0   0   0   4  94   0   0   0   0   190    0    0   0.278      9  0.87
  559  194 P   0   0   0   0   0   0   0  54  31   0   3   0   0   0   1   1   0   2   9   0   190    0    0   1.157     38  0.56
  560  195 P   0   0   0   0   0   0   0  88   0   0   1   0   0   0   0   1   7   0   1   3   190    0    0   0.516     17  0.78
  561  196 P   1   0   0   0   0   0   0   0   9   0   1   1   0   0   0   0   9  71   3   6   190    0    0   1.059     35  0.63
  562  197 P   7  85   4   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.587     19  0.87
  563  198 P  13  19  67   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   190    0    0   0.874     29  0.79
  564  199 P   0   1   0   0   0   0   0  72   1   0  27   0   0   0   0   0   0   0   0   0   190    0    0   0.649     21  0.71
  565  200 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   190    0    0   0.000      0  1.00
  566  201 P   0   2   0   1  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   189    0    0   0.114      3  0.98
  567  202 P  55  16  29   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   187    0    0   0.984     32  0.76
  568  203 P   0   0   0   0   0   0   0   0   9   0  31   0   2   3  49   3   1   0   2   0   187    0    0   1.330     44  0.30
  569  204 P  57  17  18   2   1   0   0   0   0   0   0   0   6   0   0   0   0   0   0   0   187    0    0   1.195     39  0.65
  570  205 P   1   0   1   0   0   0   0   1  16   0   9  72   0   0   0   0   0   0   0   1   187    0    0   0.879     29  0.63
  571  206 P   0   0   0   0   0   0   0   0   0   0   1   1   0   0   1   6   9  27   2  55   187    0    0   1.210     40  0.65
  572  207 P   1   0   0   0   0   0   1   0   0   0   0   2   0  19   1   0  58   7   1  12   187    0    0   1.273     42  0.56
  573  208 P   0  63   0   2  35   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   187    0    0   0.740     24  0.89
  574  209 P   0   0   0   0   0   0   0  50  20   0  14   3   0   0   1   0   0   0  12   1   187    0    1   1.356     45  0.50
  575  210 P   1   1   1   1   0   0   0   0   0   0   0   1   0   0   0   0   1  71   2  22   187    0    0   0.911     30  0.73
  576  211 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  43   2  55   187    0    0   0.787     26  0.79
  577  212 P   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   187    0    0   0.000      0  1.00
  578  213 P   0   1   0   0  84   0   8   0   0   0   1   3   1   0   0   0   1   1   1   1   187    1    0   0.704     23  0.75
  579  214 P   1   0   0   0   1   0   1   0  84   2   3   7   0   1   0   0   0   1   0   0   186    0    0   0.709     23  0.73
  580  215 P  38   1   0   0   0   0   0  23   3   0  17  15   0   0   0   0   0   2   1   1   186    0    0   1.571     52  0.29
  581  216 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   3   1   1  96   186    0    0   0.190      6  0.95
  582  217 P  67  31   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   186    0    0   0.712     23  0.77
  583  218 P   3   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   1  96   0   0   186    0    0   0.216      7  0.90
  584  219 P   0   0   0   1   0   0   0   4  45   0  42   2   1   0   1   1   0   0   4   0   186    0    0   1.194     39  0.48
  585  220 P   0   4   0   0  94   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   187    0    0   0.262      8  0.98
  586  221 P   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   187    0    0   0.000      0  1.00
  587  222 P   7   0  16   0   0   0   3   0   0   0   0   0   1   3   1   1  30   0  40   0   187    0    0   1.494     49  0.17
  588  223 P   0   0   0   0   0   0   0   0   2   0   7   0   0   0   0   0   1  89   0   1   187    0    0   0.445     14  0.83
  589  224 P   0   0   0   0  19   0  49   0   1   0   0   0   9  19   1   0   0   0   3   0   183    0    0   1.350     45  0.51
  590  225 P   0   0   0   0   0   0   0  94   1   0   3   0   0   0   0   0   0   0   0   3   183    0    0   0.283      9  0.92
  591  226 P   1  76  14   5   4   0   1   0   0   0   0   1   0   0   0   0   0   0   0   0   183    0    0   0.839     28  0.80
  592  227 P   0  93   7   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   178    0    0   0.261      8  0.92
  593  228 P   7   1   1   0   0   0   0   0   1  86   1   1   0   0   1   0   0   1   1   0   178    0    0   0.639     21  0.70
  594  229 P   0   0   0   0   0   0   0   0   2   0   0   1   0   0   0   0   1  73   1  24   177    0    0   0.729     24  0.80
  595  230 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0  31  66   2   0   1   0   175    0    0   0.736     24  0.74
## INSERTION LIST
 AliNo  IPOS  JPOS   Len Sequence
    79    88    89     1 nKk
    87    88    89     1 nKk
   143    67    68     1 sSr
   144    67    68     4 sNSGSr
   147   431    37    30 sEDSDSVAPSKKEILRQMSSPQSRDDKDSKEr
   155   431    37    30 sEDSDSVAHSKKEILRQMSSPQSRDDKDSKEr
   166   431    40    30 sEDSDSVAPSKKEILRQMSSPQSRDDKDSKEr
   170   196   197     1 nAk
   177   178   178     1 gGr
   189   431    38    30 sEDSDSFPPSKKDILRKMSSPQSRDDKDSKEr
   195   431    32    30 sEDSDSFPPSKKDILRKMSSPQSRDDKDSKEr
   212   431    42    30 sEDSDSIPPCKKEILKQMSSPQSRDDKDSKEr
   213   431    37    30 sEDSDSIPPSKKEILRQMSSPQSRDDKESNEr
   216   431    37    30 sEDSDSVPSSKKEILRQMSSPQSRDDKDSKEk
   218   431    37    30 sEDSDSIPPCKKEILKQMSSPQSRDDKDSKEr
   221   423    17    30 sEDGDSVPPSKKEILRQMSSPQNRDDKDAKEr
   226   431    39    30 sEDGDSVPPSKKEILRQMSSPQNRDDKDAKEr
   227   431    61    30 sEDSDSVPPSKKEILRQMSSPQSKDDKDAKDr
   228   431    37    30 sEDSNSIPPNKKEILRQMSSPQSRDDKDSKEr
   231   423    17    30 sEDRDSIPPSKKEILRQMSSPHDRNNKDLKEr
   232   431    37    30 sEDSDSVPPSKKEILRQMSSPQNRDDKDSKEr
   233   431    37    30 sEDSDSVPPSKKEILRQMSSPQSRDNKDSKEr
   235   431    37    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   236   431    45    30 sEDSDSTPPSKKEILRQMSSPQSRNSKDSKEr
   237   431    45    30 sEDTDSVPPSKKEILRQMSSPQTRDDRDPKEr
   238   431    37    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   239    67    68     1 sSd
   239    84    86    23 gLMASFPELLPVCSSLCLVSSSACl
   240   423    17    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   241   431    45    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   242   431    37    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   243   431    37    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   244   431    37    28 sEESESIPPSKKEILRQMSSPQSRNDSKEr
   246   431    42    30 sKDNDSVPPSKKEILRQMSSPQTRDDRDSKEr
   247   431    44    29 sEYSESIPPSKKEILRQMSSQSKDDKDSKEr
   248   431    37    30 sEDSESVPPSKKEILRQMSSPQSRDDKDSKDr
   250   431    37    30 sEDNDSVPPSKKEILRQMSSPQSRDDRDSKEr
   251   431    37    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   252   431    37    28 sEDGDSIPPSKKEILRQMSSPQSRDDSKEr
   253   431    74    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   255   431    37    30 sEDGDSIPPSKKEILRQMSSPQSRDDKDSKEr
   256   144   145    19 gRHRFRGAEEDQRTDTGAKGy
   257   431    44    30 sEDNDSVPPNKKEILRQMSSPQCRDDKDTKEr
   258   431    45    29 sEDSDSIPSSKKEILRQMSSPQYRDDNTKQk
   294    67    68     4 sNGESr
   301    67    68     2 sNTr
   301   144   147     3 gGPGy
   304   125   141     1 gNn
   305   125   140     1 gNs
   306   196   198     2 aNPn
   307     7    24     1 qLm
   307    91   109     1 qQr
   307   159   178     1 nSn
   310   129   139     1 gGg
   312   131   141     1 gNn
   313   131   139     2 gGSs
   314   129   140     1 gTn
   315   129   141     1 gNn
   318   129   139     1 gGg
   319   431    37    33 sEDKDSLPLSKKEILRQMSSPHRSFSKDDKDTREr
   320   129   140     1 aNg
   324   129   140     1 pNn
   325   129   146     2 gGTn
   325   194   213     1 nNn
   326   129   140     1 aTg
   327   129   146     2 gGTn
   327   194   213     1 nNn
   328    36    46     1 nQt
   328   196   207     1 nQn
   329   129   140     1 pNn
   330   431    41    33 sEDRDSLPLSKKEILRQMSSPHRSFSKDDKDTRDr
   331   129   140     1 nTs
   332    36    47     1 nNt
   332   196   208     1 nQn
   332   337   350     2 rCYi
   333    36    47     1 nQt
   333   196   208     1 nQn
   334    36    38     1 nNt
   334   196   199     1 nNn
   335    36    47     1 nNt
   335   196   208     1 nNn
   336    36    43     1 nNt
   336   196   204     1 nNn
   337    36    45     1 nNt
   337   196   206     1 sNd
   338    36    43     1 nNt
   338   196   204     1 nNn
   339    36    47     1 nNt
   339   196   208     1 nNn
   340   431    40    29 sEDSDSVPSKKEILRQLSSPHRRDNKDSREr
   341   423    17    33 sEDKDSLPLSKKEILRQMSSPHRSFSKDDKDTREr
   342    34    42     1 eQv
   342   194   203     1 nSn
   343    36    46     1 nQt
   343   196   207     1 nQn
   345    36    47     1 sQt
   345   196   208     1 nQn
   348   431    37    33 sEDRDSLPLSKKEILRQMSSPHRSLSKDDKDTREr
   349    36    47     1 nNt
   349   196   208     1 nNn
   350   424    18    33 sEDRDSLPLSKKEILRQMSSPHRSFSKDDKDTRDr
   351    34    42     1 dQv
   351   194   203     1 nSn
   352    53    93   114 gTSGLEHRRVVPSICPRRQKGPGGWLPLAGIRAHGALPASRDMWHAGLAAVPTGLDSSAFVSEGSRLRLLSADTQYLAVNLMTHELSHSPTMFSIGETPE
     +                   RGLLAGAVIWVCFPGy
   353    36    47     1 nNt
   353   196   208     1 nNn
   354    34    41     1 eTl
   354   194   202     1 nQn
   355    34    45     1 qRt
   355   194   206     1 dNn
   357   126   135     1 sKe
   357   129   139     2 gIGs
   358   128   133     8 gAGPGAPGAp
   359    36    47     1 sQq
   359    43    55     1 nTm
   359   128   141     1 sNr
   359   196   210     1 nQn
   360   431    37    33 sEDRDSLPLSKKEILRQMSSPHRSFSKEDKDTREr
   362    35    46     1 qRt
   362   195   207     1 dNn
   363    35    46     1 qRt
   363   195   207     1 dNn
   364    36    50     1 aQq
   364    44    59     1 qMm
   364   128   144     1 sNr
   364   196   213     1 nQn
   366    36    47     1 sSt
   366   196   208     1 nAn
   367   431    41    33 sEDGDALPPSKKEILRQMSSPHRSFSRDDKDTREr
   368    41    48     1 lDn
   368    42    50     1 nKi
   369    35    43     1 dRv
   369   195   204     1 dHn
   370    35    46     1 dRv
   370   195   207     1 dNn
   371    43    49     1 mDg
   371    44    51     1 gKi
   372    43    49     1 mEg
   372    44    51     1 gKi
   373   428    38    34 aKDRDALPLSKKEILIRQMSSPHRAHSKDDKDTREr
   374   128   136     4 gAGPGq
   374   131   143     1 gGq
   374   196   209     1 dPn
   376    35    46     1 dRv
   376   195   207     1 dHn
   377    35    46     1 dRv
   377   195   207     1 dHn
   378    35    46     1 dRv
   378   195   207     1 dHn
   379    35    46     1 dRv
   379   195   207     1 dHn
   380   117   117     1 sGh
   380   140   141     3 nDEEg
   381   129   134     1 gGq
   382    35    46     1 dRv
   382   195   207     1 dHn
   389    36    38     1 qAh
   389    43    46     1 nQl
   389   128   132     1 qNr
   389   196   201     1 nQn
   397    87    91     1 nKv
   399   416    22     5 gKETNWp
   399   431    42    33 sEDSDSLPLSKKEMLRQMSSPHRSFSRDDKDTREr
   402   425    19    33 sEDQESIPPNKKEILRQMSSPYKPPIKDEKDTKEk
   411   431    46    33 sEDHETVPSGKRELLRQMSSPYRSQSRDEKDTREr
   416   428    38    34 sEDRNTLPVSKKEILIRQMSSPHRSNSKCSTRDRLi
   417   428    41    28 sEDHESIPSNKRELLRQMSNPKSSDDPREk
   418   427    32    28 sEDHESIPSNKRELLRQMSNPKSSDDPREk
   421   430    39    25 sVDQTVPQNKRELLRQMSSPRDDDKEr
   425   425    33    26 sMDQEALPPNKREPLRQMSSPQKPKDSc
   425   428    62     3 gGLNr
   430   431    38    29 sMDRENLPSAKKELLRQMSSPNKSKDDSRAn
   432   431    32    29 sMDRENLPSAKKELLRQMSSPNKSKDDSRAn
   434   430    57    25 sVDQNVPQRKRELLRQMSNPRDDDKEr
   435   431    32    29 sMDQENLNPAKRELLRQMSSPSRAKDTSRAn
   436   431    56    29 sMDQENLNPAKRELLRQMSSPSRAKDTSRAn
   437   430    32    25 sVDQTVPQKKRELLRQMSNPRDDDKEr
   438   430    33    25 sVDQNVPQRKRELLRQMSNPRDDDKEr
   439   431    32    29 sMDQESLPAAKRELLRQMSSPSRPKDDARAn
   440   431    50    29 sMDQESLPAAKRELLRQMSSPSRPKDDARAn
   441   422    38    29 sMDQENLPTAKKELLRQMSSPNKSKDDSRGn
   442   431    36    29 sMDQENLPSAKKELLRQMSSPNKSKDDSRGs
   443   431    32    29 sMDQENLPSAKKELLRQMSSPNKSKDDSRGs
   445   430    37    25 sMDQTVPQSKRELLRQMSSPREDDKEr
   446   430    39    25 sMDQTVPQSKRELLRQMSSPREDDKEr
   447   431    55    29 sMDQENLPTAKKELLRQMSSPNKSKDDSRGn
   448   428    42    34 sEDHESIPSNKRELLRQMSNPKSSDDPREKVNRKMs
   449   426    56    34 sMDQEALPPNKRELLRQMSSPQKPKDSCVGGLNRKm
   450   425    33    34 sMDQEALPPNKRELLRQMSSPQKPKDSCVGGLNRKm
   451   426    57    34 sMDQEALPPNKRELLRQMSSPQKPKDSCVGGLNRKm
   457   431    32    34 sMDRENLPPAKKELLRQMSSPNKSKDDSRANLNRKm
   462   427    71     1 kQl
   462   430    75    34 tEQREEQCQEMERLVKKLSMTCRSHLDEEEDQHRQk
   462   431   110     5 kDLQEKi
   463   427    71     1 kQl
   463   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   463   431   110     5 kDLQEKi
   464   427    71     1 kQl
   464   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQRQQk
   464   431   110     5 kELQEKi
   465   427    71     1 kQl
   465   430    75    34 tEQREEQCREMERLIQKLSLSCRSHLDEEVDQQKQk
   465   431   110     5 kDLQEKi
   467   427    32     1 kQl
   467   430    36    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   467   431    71     5 kDLQEKi
   468   427    71     1 kQl
   468   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   468   431   110     5 kDLQEKi
   469   427    71     1 kQl
   469   430    75    34 tEQKEEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   469   431   110     5 kDLQEKi
   470   427    71     1 kQl
   470   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   470   431   110     5 kDLQEKi
   471   427    71     1 kQl
   471   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQq
   471   431   110     5 qDLQEKi
   474   427    71     1 kQl
   474   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   474   431   110     5 kDLQEKi
   475   427    71     1 kQl
   475   430    75    34 tEQREEQCREMERLVKKLSMTCRSHLDEEEERHKQe
   475   431   110     5 eALQEKl
   476   427    71     1 kQl
   476   430    75    34 tEQREEQCREMERLVKKLSMTCRSHLDEEEERHKQe
   476   431   110     5 eALQEKl
   477   427    71     1 kQl
   477   430    75    34 tEQREEQCREMERLVRKLSMTCRSHLDEEEGQRKQk
   477   431   110     5 kDLQEKi
   478   427    70     1 kQl
   478   430    74    34 tEQRQEQRREMERLIKKLSMTCRSHLDEETDKQKQk
   478   431   109     5 kELQEKi
   479   427    71     1 kQl
   479   430    75    34 tEQKEEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   479   431   110     5 kDLQEKi
   480   427    70     1 kQl
   480   430    74    34 tEQRQEQRREMERLIKKLSMTCRSHLDEETDKQKQk
   480   431   109     5 kELQEKi
   481   427    71     1 kQl
   481   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   481   431   110     5 kDLQEKi
   482   427    71     1 kQl
   482   430    75    34 tEQREEQCREMERLIKKLSMTCRSNLDEEEEQKKQk
   482   431   110     5 kDLQEKi
   483   427    71     1 kQl
   483   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   483   431   110     5 kDLQEKi
   484   427    71     1 kQl
   484   430    75    34 tEQKEEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   484   431   110     5 kDLQEKi
   485   427    71     1 kQl
   485   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   485   431   110     5 kDLQEKi
   486   427    70     1 kQl
   486   430    74    34 tEQRQEQRREMERLIKKLSMTCRSHLDDEADQQKQk
   486   431   109     5 kELQEKi
   487   427    71     1 kQl
   487   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   487   431   110     5 kDLQEKi
   488   427    71     1 kQl
   488   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   488   431   110     5 kDLQEKi
   489   427    71     1 kQl
   489   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   489   431   110     5 kDLQEKi
   490   427    71     1 kQl
   490   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   490   431   110     5 kDLQEKi
   491   427    71     1 kQl
   491   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   491   431   110     5 kDIQEKi
   492   427    70     1 kQl
   492   430    74    34 tEQRQEQRREMERLIKKLSMTCRSHLDEESEKQKQk
   492   431   109     5 kEIQEKi
   493   427    70     1 kQl
   493   430    74    34 tEQRQEQRREMERLIKKLSMTCRSHLDEEADKQKQk
   493   431   109     5 kELQEKi
   494   427    71     1 kQl
   494   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   494   431   110     5 kDLQEKi
   495   427  1193     1 kQl
   495   430  1197    34 tEQREEQCREMERLIKKLSVTCRSHLDEEDDKQKQk
   495   431  1232     5 kELQDKi
   495   472  1278     1 gHh
   496   427    71     1 kQl
   496   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEERQREk
   496   431   110     5 kDLQEKm
   497   427    69     1 kQl
   497   430    73    34 tEQREEQCREMERLIKKLSMTCRSHLDEEDDKQKQk
   497   431   108     5 kELQDKi
   497   472   154     1 gHh
   498   427    69     1 kQl
   498   430    73    34 tEQRDEQCREMERLIKKLSMTCRSHLDEEKDKQKQk
   498   431   108     5 kELQEKi
   499   427    71     1 kQl
   499   430    75    34 tEQREEQCREMERLIKKLSLSCRSHLDEEEEQRKQk
   499   431   110     5 kDLQEKi
   499   547   231     1 rKn
   500   427    69     1 kQl
   500   430    73    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEDKQKQk
   500   431   108     5 kELQEKi
   501   427    71     1 kQl
   501   430    75    34 tEQREEQCREMERLIKKLSLSCRSHLDEEEEQRKQk
   501   431   110     5 kDLQEKi
   502   427    71     1 kQl
   502   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   502   431   110     5 kDLQEKi
   503   427    71     1 kQl
   503   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   503   431   110     5 kDLQEKi
   504   427    71     1 kQl
   504   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   504   431   110     5 kDLQEKi
   506   427    69     1 kQl
   506   430    73    34 tEQREEQCREMERLIKKLSMTCRSHFDEEDDKQKQk
   506   431   108     5 kELQEKi
   507   427    69     1 kQl
   507   430    73    34 tENREEQRREMERLIKKLSMTCKSSLDEEKDKQKQk
   507   431   108     5 kDLQEKi
   508   427    72     1 kQl
   508   430    76    34 vEQKQEQKKEMERLIKKLSMTCRSDLDLKKDKEEEk
   508   431   111     5 kKLQDKi
   509   427    70     1 kQl
   509   430    74    34 tEQRQEQRREMERLIKKLSMTCRSHLDEESEKQKQk
   509   431   109     5 kEIQEKi
   510   427    68     1 kQl
   510   430    72    34 tEQREEQCREVEKLIKKLSMTCRSHLDEEKEQQKQk
   510   431   107     5 kDLQEKi
   513   427    71     1 kQl
   513   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   513   431   110     5 kDLQEKi
   514   427  1188     1 kQl
   514   430  1192    34 tEQREEQCREVEKLIKKLSMTCRSHLDEEKEQQKQk
   514   431  1227     5 kDLQEKi
   516   427    91     1 kQl
   516   430    95    34 tEQREEQCREVEKLIKKLSMTCRSHLDEEKEQQKQk
   516   431   130     5 kDLQEKi
   517   427    72     1 kQl
   517   430    76    34 vEQKQEQKKEMERLIKKLSMSCRSDLDLEKDKQKQk
   517   431   111     5 kELQDKi
   518   427    72     1 kQl
   518   430    76    34 vEQKQEQKQEMERLIKKLSMTCRSDLDLEKDKDKQk
   518   431   111     5 kELKEKi
   519   427    70     1 kQl
   519   430    74    34 vEQKQEQKREMERLIKKLSMTCRSDLDQEKDKEKQk
   519   431   109     5 kELQNKi
   521   427    72     1 kQl
   521   430    76    34 vEQKQEQKKEMERLIKKLSMTCRSNLDQEKDQEKQk
   521   431   111     5 kALQEKi
   524   427    72     1 kQl
   524   430    76    34 vEQKQEQKREMERLIKKLSMTCRSDLDLEKDKEQEa
   524   431   111     5 aQLQNKl
   529   427    70     1 kQl
   529   430    74    34 tEQREEQCREMERLIKKLSMTCQSHLDEEKDKQKQk
   529   431   109     5 kELQEKl
   532   427    71     1 kQl
   532   430    75    34 tEQREEQCREMERLIKKLSMTCQSHLDEEKDKQKQk
   532   431   110     5 kELQEKl
   534   383    55     1 aSe
   546   427    64     1 kQl
   546   430    68    34 tEQNEDQKREMEQLIKRLSMTCKSHLDEEKDKQKEk
   546   431   103     5 kELEERl
   559   427   110     1 kQl
   559   430   114    34 tERREDQAREMKRLVQRLSLSCRSHLDEEEDRRRQa
   559   431   149     5 aELREKl
   559   433   156     4 gSKLTl
   559   471   198     1 gAg
   559   472   200     2 gAPq
   571   387    48     1 pKp
   579   384   138     1 sSq
   593    39    55     1 gSi
   593    40    57     1 iSl
   593    80    98     3 iVTGf
   593   121   142     7 sKQPGLSEy
   593   124   152     1 qFy
   593   184   213     4 sKFNHi
   593   189   222     2 sDRp
   593   258   293    34 sLASTLTSHDNQGFRSNGNISPTSVDRSSKAESIDs
   593   302   371     2 gFAg
   616   410    48    34 tEQREEQCREMQRLIKKLSMTCQSHLDEEKDKQKQk
   616   411    83     5 kELQEKl
   617   424    64     1 kQl
   617   427    68    34 tERRAEQQAEKVALVKKLALTCRSELDDDDQTEGRe
   621   427    75     1 kQl
   621   430    79    34 aEKRELQEKERLQLIKKLSLTCRSALDEEKEKLNEt
   622   388    48     1 tNe
   624   427    72     1 kQl
   624   430    76    34 nEQRIEQQKEMEKLIKKLSMTCKSHLEEEADKQKQk
   624   431   111     5 kELQDKl
   625   427    76     1 kQl
   625   430    80    34 aEKRESQEKERLQLINKLSLTCRSALDEEKEKLNEt
   629   427    76     1 kQl
   629   430    80    34 aENRAELEKERIALSKKLTLSVKTEREEAQDKKIEe
   631   427    76     1 kQi
   631   430    80    34 nEKRAEQEKERIELMKKLTLTCRSTLDDEREKMLEt
   632   427    72     1 kQl
   632   430    76    34 nEQRIEQQKEMEKLIKKLSMTCKSHLEEEADKQKQk
   632   431   111     5 kELQDKl
   636   427    76     1 kQl
   636   430    80    34 sEKREQQEKERLQLIKKLSLTCKSDLDTEKRQKEKe
   638   427    80     1 kQl
   638   430    84    34 aEKRESQEKERLQLINKLSLTCRSALDEEKEKLNEt
   641   427    67     1 qQl
   641   430    71    34 nEKREEQERERLQLIQKLSLTCKSELEQPQAGAAEq
   642   427    72     1 rQl
   642   430    76    34 sERREEQERERLQLIKKLSLTCRSELEAEKKSKEEe
   643   428    74     1 kQl
   643   431    78    34 tEKREEQEIERMELAKKLSVSCRSQSDEQREKDKDq
   644   422    82     1 kQl
   644   425    86    34 aERREESDRQRIELAKKLTMTTATAQEEEERKKQEe
   644   426   121     4 eLEAEf
   645   426    89     1 kQl
   645   429    93    34 tEKRNEQERERLELMKKLSIKTRTKAEDEEAKKQEe
   645   430   128     4 eLDAEl
   646   427    76     1 kQl
   646   430    80    34 sEKREQQEKERLQLIKKLSLTCKSDLDTEKRQKEKe
   647   427    85     1 kQl
   647   430    89    34 nERRDETERQRIALAKKLSMTTATAAEDEERKRQEe
   647   431   124     4 eLDAEf
   648   427    86     1 kQl
   648   430    90    34 iERDMGKENERLGLMKKLCITAKTVAEDRKQIEQDe
   648   464   158     1 qQk
   648   565   260     1 gGd
   649   421    85     1 kKl
   649   424    89    34 aEKREENERQRIELAKKLTMTTATAQEEEERKRQEe
   650   427    70     1 kQl
   650   430    74    34 nEKRAEDESEKIALMKKLTLTVQSALDEEREKAALe
   651   426    97     1 kQl
   651   429   101    34 aERREQDDAEKLRLLKKLSITAQTKEEDEKAAAMSe
   651   430   136     4 eLDAEf
   651   457   167     1 rKg
   652   427    77     1 kEl
   652   430    81    34 aQNREELAKERIALAKKLTMTVKTVQEEDKEKEIDe
   652   431   116     4 eLEDEl
   653   422    62     1 kKl
   653   425    66    10 fEKKEEAETKRk
   653   426    77     2 kEIl
   653   428    81     2 qKHs
   653   467   122     1 kWa
   653   473   129     1 gKv
   654   428    71     1 kRl
   654   431    75    34 tERRAEQEKEKQALAKKLSMTCRSHLDDEREKENDd
   655   423    79     1 kQl
   655   426    83    34 aERRDETERQRLALAKKLSMTTSTAAEDEERKRQEe
   656   427    85     1 kQl
   656   430    89    34 aERREETERQRLDMAKKLTMTTTTSAEDEERKRQEe
   656   431   124     4 eLDAEf
   657   423    86     1 kQl
   657   426    90    34 aERREETERQRLALAKKLSMTTTTSAEDEERKRQEe
   657   427   125     4 eLDAEf
   658   427    84     1 kQl
   658   430    88    34 aERREETERQRLALAKKLSMTTATAAEDEERKRQEe
   658   431   123     4 eLDAEf
   659   427    60    11 kRQQSAQRIQREk
   659   428    72     5 kDVLKQi
   660   413     7     1 kQl
   660   416    11    34 aEKRELQEREKLQLIKKLSLTCRSALDEEKEKLNEt
   661   427    77     1 kQm
   661   430    81    13 cKEDLERDKKLVEAa
   661   431    95     2 aKRl
   661   433    99     2 cIIq
   661   472   140     2 qNSa
   662   420    62     8 nEQKQQQKAk
   662   421    71     4 kFQEMi
   664   421    79     1 kQl
   664   424    83    34 tEKRGDQDREKRLLAEKLSMTCRSYLDDEKAKEDEe
   664   458   151     1 nSp
   666    42    64     1 nSc
   666    43    66     1 cNl
   666    86   110     1 gMk
   666   128   153     1 tSn
   666   141   167    19 pMQGINFYQSIQSIFKGHTAy
   666   188   233     2 tTFp
   666   193   240     2 lSNn
   666   262   311    61 sLSQELKNGQSLPELAVQDESESRSHKLFHQKSPLLHRRNNSSGNWNGNASYDQYSIISNTNs
   666   306   416     1 gSe
   667   427    72     1 kQl
   667   430    76    34 sAKRTESGKEMVELAKKLTMTVRTTLEDEREQAALe
   668   426    91     1 kQl
   668   429    95    34 aERREQDEMEKVRLLKKLSITARTKEEDKAAEAMNe
   668   430   130     4 eLDAEf
   668   457   161     1 kKg
   669   427    75     1 kQl
   669   430    79    34 tEKRQEEELERIELAKKLCLTCAPDSEQPKTDDNLs
   670   398    66     1 kSi
   671   427    80     1 kQl
   671   430    84    34 aERRDETERQRLALAKKLTITTTTSAEDEERKRQEe
   671   431   119     4 eLDAEl
   672   427    80     1 kQl
   672   430    84    34 aERRDETERQRLALAKKLTITTTTSAEDEERKRQEe
   672   431   119     4 eLDAEl
   673   427    80     1 kQl
   673   430    84    34 aERRDETERQRLALAKKLTITTATSAEDEERKRQEe
   673   431   119     4 eLDAEl
   674   427    80     1 kQl
   674   430    84    34 aERRDETERQRLALAKKLTITATTSAEDEERKRQEe
   674   431   119     4 eLDAEl
   675   419    75     9 hNEQKQQQKAk
   675   420    85     4 kFQEMi
   676   419    62     9 hNEQKQQQKAk
   676   420    72     4 kFQEMi
   677   419    74     9 hNEQKQQQKAk
   677   420    84     4 kFQEMi
   678   427    80     1 kQl
   678   430    84    34 aERRDETERQRLALAKKLTITATTSAEDEERKRQEe
   678   431   119     4 eLDAEl
   679   421    70     1 kQl
   679   424    74    34 tERRDENEKERLALAKKLSTTCRTIAKDLEYLEEIe
   679   425   109     2 eDHl
   679   451   137     1 kCp
   680   427    68     1 kQl
   680   430    72    34 tERREEQEAEKLNLMKKLSLNCRSQIEDEEAKKEEe
   681   419    80     9 hNEQKQQQKAk
   681   420    90     4 kFQEMi
   681   457   131     1 sKg
   682   428    67     1 kRl
   682   431    71    34 tEKRENQEKERQALAKKLTLTCRSHLDDEAEKEKDe
   683   427    72     1 kQi
   683   430    76    34 sEQRMEREREKLELIERLAFTCRSDLDQEKEEDPEl
   684   422    67     1 kRl
   684   425    71    34 yEKREEEEKKRDEILKKLSLTCDPNAGEDGVDNEDk
   684   447   127     1 kWv
   684   453   134     1 gKv
   685   421    68     1 kKl
   685   424    72    34 sRRNAEKERKVVEYAKQHSLSCRPYSEDVKEDEHTh
   685   456   138     1 sLp
   686   420    72     1 kAl
   686   423    76    17 rLKEAQKEQELIEAAKKNt
   686   424    94     4 tLTSQt
   686   426   100     2 hVCf
   686   464   140     1 rLp
   687   427    79     1 kQl
   687   430    83    34 tEKKESQEREKLDLIKKLSITSRTVAEDEKAKEQEq
   687   431   118     4 qLDEEl
   688   427    80     1 kQl
   688   430    84    34 aERRDETERQRLALAKKLSMTTATTAEDEERKRQEe
   688   431   119     4 eLDDEl
   689   427    76     1 qEl
   689   430    80    34 qERKRSEEIDKLKLMEKLSMSCKTYIEEMEEKKRQe
   689   466   150     1 lNr
   689   467   152     2 rSGr
//