Complet list of 1a0r hssp fileClick here to see the 3D structure Complete list of 1a0r.hssp file
HSSP       HOMOLOGY DERIVED SECONDARY STRUCTURE OF PROTEINS , VERSION 2.0 2011
PDBID      1A0R
THRESHOLD  according to: t(L)=(290.15 * L ** -0.562) + 5
REFERENCE  Sander C., Schneider R. : Database of homology-derived protein structures. Proteins, 9:56-68 (1991).
CONTACT    Maintained at http://www.cmbi.ru.nl/ by Maarten L. Hekkelman 
DATE       file generated on 2013-08-05
HEADER     COMPLEX (TRANSDUCER/TRANSDUCTION)       05-DEC-97   1A0R
COMPND      MOLECULE: TRANSDUCIN (BETA SUBUNIT);
SOURCE      ORGANISM_SCIENTIFIC: BOS TAURUS;
AUTHOR     A.LOEW,Y.-K.HO,T.L.BLUNDELL,B.BAX
DBREF      1A0R B    2   340  UNP    P04901   GBB1_HUMAN       2    340
DBREF      1A0R G    2    66  UNP    P02698   GBG1_BOVIN       1     65
DBREF      1A0R P    1   245  UNP    P19632   PHOS_BOVIN       1    245
SEQLENGTH   592
NCHAIN        3 chain(s) in 1A0R data set
NALIGN      755
NOTATION : ID: EMBL/SWISSPROT identifier of the aligned (homologous) protein
NOTATION : STRID: if the 3-D structure of the aligned protein is known, then STRID is the Protein Data Bank identifier as taken
NOTATION : from the database reference or DR-line of the EMBL/SWISSPROT entry
NOTATION : %IDE: percentage of residue identity of the alignment
NOTATION : %SIM (%WSIM):  (weighted) similarity of the alignment
NOTATION : IFIR/ILAS: first and last residue of the alignment in the test sequence
NOTATION : JFIR/JLAS: first and last residue of the alignment in the alignend protein
NOTATION : LALI: length of the alignment excluding insertions and deletions
NOTATION : NGAP: number of insertions and deletions in the alignment
NOTATION : LGAP: total length of all insertions and deletions
NOTATION : LSEQ2: length of the entire sequence of the aligned protein
NOTATION : ACCNUM: SwissProt accession number
NOTATION : PROTEIN: one-line description of aligned protein
NOTATION : SeqNo,PDBNo,AA,STRUCTURE,BP1,BP2,ACC: sequential and PDB residue numbers, amino acid (lower case = Cys), secondary
NOTATION : structure, bridge partners, solvent exposure as in DSSP (Kabsch and Sander, Biopolymers 22, 2577-2637(1983)
NOTATION : VAR: sequence variability on a scale of 0-100 as derived from the NALIGN alignments
NOTATION : pair of lower case characters (AvaK) in the alignend sequence bracket a point of insertion in this sequence
NOTATION : dots (....) in the alignend sequence indicate points of deletion in this sequence
NOTATION : SEQUENCE PROFILE: relative frequency of an amino acid type at each position. Asx and Glx are in their
NOTATION : acid/amide form in proportion to their database frequencies
NOTATION : NOCC: number of aligned sequences spanning this position (including the test sequence)
NOTATION : NDEL: number of sequences with a deletion in the test protein at this position
NOTATION : NINS: number of sequences with an insertion in the test protein at this position
NOTATION : ENTROPY: entropy measure of sequence variability at this position
NOTATION : RELENT: relative entropy, i.e.  entropy normalized to the range 0-100
NOTATION : WEIGHT: conservation weight

## PROTEINS : identifier and alignment statistics
  NR.    ID         STRID   %IDE %WSIM IFIR ILAS JFIR JLAS LALI NGAP LGAP LSEQ2 ACCNUM     PROTEIN
    1 : A7E3V7_BOVIN        1.00  1.00    3  339    1  337  337    0    0  337  A7E3V7     Guanine nucleotide-binding protein, beta-1 subunit (Fragment) OS=Bos taurus GN=GNB1 PE=2 SV=1
    2 : F6Z808_CALJA        1.00  1.00    1  339    2  340  339    0    0  340  F6Z808     Uncharacterized protein OS=Callithrix jacchus GN=GNB1 PE=4 SV=1
    3 : G1M4Q5_AILME        1.00  1.00    1  339    2  340  339    0    0  340  G1M4Q5     Uncharacterized protein OS=Ailuropoda melanoleuca GN=GNB1 PE=4 SV=1
    4 : G1P1G1_MYOLU        1.00  1.00    1  339    2  340  339    0    0  340  G1P1G1     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
    5 : G1QGZ6_NOMLE        1.00  1.00    1  339    2  340  339    0    0  340  G1QGZ6     Uncharacterized protein OS=Nomascus leucogenys GN=GNB1 PE=4 SV=1
    6 : G3TGH1_LOXAF        1.00  1.00    1  339    2  340  339    0    0  340  G3TGH1     Uncharacterized protein OS=Loxodonta africana GN=LOC100673391 PE=4 SV=1
    7 : G7NWS9_MACFA        1.00  1.00    1  339    2  340  339    0    0  340  G7NWS9     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_00128 PE=4 SV=1
    8 : GBB1_BOVIN  1XHM    1.00  1.00    1  339    2  340  339    0    0  340  P62871     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Bos taurus GN=GNB1 PE=1 SV=3
    9 : GBB1_CANFA          1.00  1.00    1  339    2  340  339    0    0  340  P62872     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Canis familiaris GN=GNB1 PE=2 SV=3
   10 : GBB1_HUMAN  1TBG    1.00  1.00    1  339    2  340  339    0    0  340  P62873     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Homo sapiens GN=GNB1 PE=1 SV=3
   11 : GBB1_RAT    3SN6    1.00  1.00    1  339    2  340  339    0    0  340  P54311     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Rattus norvegicus GN=Gnb1 PE=1 SV=4
   12 : GBG1_BOVIN  2TRC    1.00  1.00  341  405    2   66   65    0    0   74  P02698     Guanine nucleotide-binding protein G(T) subunit gamma-T1 OS=Bos taurus GN=GNGT1 PE=1 SV=2
   13 : K7CIH8_PANTR        1.00  1.00    1  339    2  340  339    0    0  340  K7CIH8     Guanine nucleotide binding protein (G protein), beta polypeptide 1 OS=Pan troglodytes GN=GNB1 PE=2 SV=1
   14 : K9IIE8_DESRO        1.00  1.00    1  339    2  340  339    0    0  340  K9IIE8     Putative g-protein beta subunit OS=Desmodus rotundus PE=2 SV=1
   15 : L8HQH7_BOSMU        1.00  1.00  341  405    2   66   65    0    0   74  L8HQH7     Guanine nucleotide-binding protein subunit gamma OS=Bos grunniens mutus GN=M91_14199 PE=3 SV=1
   16 : M1ERZ7_MUSPF        1.00  1.00    1  338   11  348  338    0    0  348  M1ERZ7     Guanine nucleotide binding protein , beta polypeptide 1 (Fragment) OS=Mustela putorius furo PE=2 SV=1
   17 : Q3TQ70_MOUSE        1.00  1.00    1  339    2  340  339    0    0  340  Q3TQ70     Beta1 subnuit of GTP-binding protein OS=Mus musculus GN=Gnb1 PE=2 SV=1
   18 : Q95LU7_MACFA        1.00  1.00   44  339    1  296  296    0    0  296  Q95LU7     Putative uncharacterized protein OS=Macaca fascicularis PE=2 SV=1
   19 : D2HPN0_AILME        0.99  1.00   31  339    1  309  309    0    0  309  D2HPN0     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_013768 PE=4 SV=1
   20 : F6PVT7_MONDO        0.99  0.99    1  339    2  340  339    0    0  340  F6PVT7     Uncharacterized protein OS=Monodelphis domestica GN=GNB1 PE=4 SV=1
   21 : G3WGB1_SARHA        0.99  0.99    1  339    2  340  339    0    0  340  G3WGB1     Uncharacterized protein OS=Sarcophilus harrisii GN=GNB1 PE=4 SV=1
   22 : H9EMX0_MACMU        0.99  1.00    1  339    2  340  339    0    0  340  H9EMX0     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Macaca mulatta GN=GNB1 PE=2 SV=1
   23 : Q3U1B1_MOUSE        0.99  1.00    1  339    2  340  339    0    0  340  Q3U1B1     Putative uncharacterized protein OS=Mus musculus GN=Gnb1 PE=2 SV=1
   24 : Q95LT6_MACFA        0.99  1.00   32  339    2  309  308    0    0  309  Q95LT6     Putative uncharacterized protein OS=Macaca fascicularis PE=2 SV=1
   25 : A5LG10_CYPCA        0.98  0.99    1  339    2  340  339    0    0  340  A5LG10     G-protein beta subunit 1 OS=Cyprinus carpio GN=Gbeta1 PE=2 SV=1
   26 : D2H8V1_AILME        0.98  0.98  341  405    2   66   65    0    0   74  D2H8V1     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_006703 PE=3 SV=1
   27 : F7B1I8_HORSE        0.98  0.98  341  405    2   66   65    0    0   74  F7B1I8     Guanine nucleotide-binding protein subunit gamma OS=Equus caballus GN=GNGT1 PE=3 SV=1
   28 : F7CWN9_MACMU        0.98  0.98  341  405    2   66   65    0    0   89  F7CWN9     Guanine nucleotide-binding protein subunit gamma OS=Macaca mulatta GN=GNGT1 PE=2 SV=1
   29 : G1MHA4_AILME        0.98  0.98  341  405    3   67   65    0    0   75  G1MHA4     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=GNGT1 PE=3 SV=1
   30 : G1RZQ2_NOMLE        0.98  0.98  341  405    2   66   65    0    0   74  G1RZQ2     Guanine nucleotide-binding protein subunit gamma OS=Nomascus leucogenys GN=LOC100592009 PE=3 SV=1
   31 : G3PER0_GASAC        0.98  0.99    1  339    2  340  339    0    0  340  G3PER0     Uncharacterized protein OS=Gasterosteus aculeatus GN=GNB1 (2 of 2) PE=4 SV=1
   32 : G3RGF1_GORGO        0.98  0.98  341  405    4   68   65    0    0   76  G3RGF1     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Gorilla gorilla gorilla GN=GNGT1 PE=3 SV=1
   33 : G5ANK5_HETGA        0.98  0.98  341  405    2   66   65    0    0   74  G5ANK5     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_02184 PE=3 SV=1
   34 : G7MLV8_MACMU        0.98  0.98  341  405    2   66   65    0    0   74  G7MLV8     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Macaca mulatta GN=EGK_13933 PE=2 SV=1
   35 : G7P1D2_MACFA        0.98  0.98  341  405    2   66   65    0    0   74  G7P1D2     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Macaca fascicularis GN=EGM_12770 PE=3 SV=1
   36 : GBG1_CANFA          0.98  0.98  341  405    2   66   65    0    0   74  P63210     Guanine nucleotide-binding protein G(T) subunit gamma-T1 OS=Canis familiaris GN=GNGT1 PE=2 SV=2
   37 : GBG1_HUMAN          0.98  0.98  341  405    2   66   65    0    0   74  P63211     Guanine nucleotide-binding protein G(T) subunit gamma-T1 OS=Homo sapiens GN=GNGT1 PE=2 SV=2
   38 : H0YXS3_TAEGU        0.98  0.99    1  323    2  324  323    0    0  402  H0YXS3     Uncharacterized protein OS=Taeniopygia guttata GN=GNB1 PE=4 SV=1
   39 : H2PMW9_PONAB        0.98  0.98  341  405    2   66   65    0    0   74  H2PMW9     Guanine nucleotide-binding protein subunit gamma OS=Pongo abelii GN=GNGT1 PE=3 SV=1
   40 : H2QUX9_PANTR        0.98  0.98  341  405    2   66   65    0    0   74  H2QUX9     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNGT1 PE=3 SV=1
   41 : H2RNG1_TAKRU        0.98  0.99    1  339    2  340  339    0    0  340  H2RNG1     Uncharacterized protein OS=Takifugu rubripes GN=GNB1 (1 of 2) PE=4 SV=1
   42 : H2U163_TAKRU        0.98  1.00    1  339    2  340  339    0    0  340  H2U163     Uncharacterized protein OS=Takifugu rubripes GN=LOC101062348 PE=4 SV=1
   43 : I3J882_ORENI        0.98  0.99    1  339    2  340  339    0    0  340  I3J882     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100703896 PE=4 SV=1
   44 : M3WUX9_FELCA        0.98  0.98  341  405    2   66   65    0    0   74  M3WUX9     Guanine nucleotide-binding protein subunit gamma OS=Felis catus GN=GNGT1 PE=3 SV=1
   45 : M3XRD5_MUSPF        0.98  0.98  341  405    2   66   65    0    0   74  M3XRD5     Guanine nucleotide-binding protein subunit gamma OS=Mustela putorius furo GN=Gngt1 PE=3 SV=1
   46 : M7ALA8_CHEMY        0.98  0.99   19  339    1  321  321    0    0  321  M7ALA8     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 (Fragment) OS=Chelonia mydas GN=UY3_16963 PE=4 SV=1
   47 : Q803H5_DANRE        0.98  0.99    1  339    2  340  339    0    0  340  Q803H5     Gnb1l protein OS=Danio rerio GN=gnb1b PE=2 SV=1
   48 : Q805B3_ORYLA        0.98  0.99    1  339    2  340  339    0    0  340  Q805B3     Guanine nucleotide-binding protein beta subunit OS=Oryzias latipes GN=Ol-Gb1 PE=2 SV=1
   49 : B5X1F5_SALSA        0.97  0.99    1  339    2  340  339    0    0  340  B5X1F5     Guanine nucleotide-binding protein GI/GS/GT subunit beta-1 OS=Salmo salar GN=GBB1 PE=2 SV=1
   50 : D6R719_HYPMO        0.97  0.99    1  339    2  340  339    0    0  340  D6R719     Guanine nucleotide-binding protein beta polypeptide 1 OS=Hypophthalmichthys molitrix PE=2 SV=1
   51 : F1SFB0_PIG          0.97  0.98  341  405    2   66   65    0    0   74  F1SFB0     Guanine nucleotide-binding protein subunit gamma OS=Sus scrofa GN=LOC100626889 PE=3 SV=1
   52 : G1TCV6_RABIT        0.97  0.98  341  405    2   66   65    0    0   74  G1TCV6     Guanine nucleotide-binding protein subunit gamma OS=Oryctolagus cuniculus GN=LOC100342450 PE=3 SV=1
   53 : G3NPE2_GASAC        0.97  0.98    1  323    2  325  324    1    1  394  G3NPE2     Uncharacterized protein OS=Gasterosteus aculeatus GN=GNB1 (1 of 2) PE=4 SV=1
   54 : H0VCC3_CAVPO        0.97  0.98  341  405    2   66   65    0    0   74  H0VCC3     Guanine nucleotide-binding protein subunit gamma OS=Cavia porcellus GN=LOC100733904 PE=3 SV=1
   55 : H2LEX4_ORYLA        0.97  0.99    1  339    2  340  339    0    0  340  H2LEX4     Uncharacterized protein OS=Oryzias latipes GN=LOC101168199 PE=4 SV=1
   56 : H3BIP7_LATCH        0.97  0.99    1  339    2  340  339    0    0  340  H3BIP7     Uncharacterized protein OS=Latimeria chalumnae PE=4 SV=1
   57 : L5KMI1_PTEAL        0.97  0.98  341  405    2   66   65    0    0   74  L5KMI1     Guanine nucleotide-binding protein subunit gamma OS=Pteropus alecto GN=PAL_GLEAN10021738 PE=3 SV=1
   58 : M4AQL9_XIPMA        0.97  0.99    1  339    2  340  339    0    0  340  M4AQL9     Uncharacterized protein OS=Xiphophorus maculatus GN=GNB1 (2 of 2) PE=4 SV=1
   59 : M4AY93_XIPMA        0.97  0.99    1  339    2  340  339    0    0  340  M4AY93     Uncharacterized protein OS=Xiphophorus maculatus GN=GNB1 (1 of 2) PE=4 SV=1
   60 : Q4RX95_TETNG        0.97  0.99    1  339    2  340  339    0    0  340  Q4RX95     Chromosome 11 SCAF14979, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=GNB1 (2 of 2) PE=4 SV=1
   61 : Q5XH13_XENLA        0.97  0.99    1  339    2  340  339    0    0  340  Q5XH13     XGbeta1 protein OS=Xenopus laevis GN=gnb1 PE=2 SV=1
   62 : Q9DFH0_AMBTI        0.96  0.99    1  339    2  340  339    0    0  340  Q9DFH0     G-protein B1 subunit OS=Ambystoma tigrinum PE=2 SV=1
   63 : F6WMN3_CALJA        0.95  0.98  341  405    2   66   65    0    0   74  F6WMN3     Guanine nucleotide-binding protein subunit gamma OS=Callithrix jacchus GN=GNGT1 PE=3 SV=1
   64 : G3U0Q7_LOXAF        0.95  0.98  341  405    2   66   65    0    0   74  G3U0Q7     Guanine nucleotide-binding protein subunit gamma OS=Loxodonta africana GN=LOC100677258 PE=3 SV=1
   65 : GBG1_MOUSE          0.95  0.98  341  405    2   66   65    0    0   74  Q61012     Guanine nucleotide-binding protein G(T) subunit gamma-T1 OS=Mus musculus GN=Gngt1 PE=1 SV=3
   66 : H0WR88_OTOGA        0.95  0.97  341  405    2   66   65    0    0   74  H0WR88     Guanine nucleotide-binding protein subunit gamma OS=Otolemur garnettii GN=GNGT1 PE=3 SV=1
   67 : F7I491_CALJA        0.93  0.98  436  595   19  178  160    0    0  195  F7I491     Uncharacterized protein OS=Callithrix jacchus GN=PDC PE=4 SV=1
   68 : D4AAI1_RAT          0.92  0.97  341  405    2   66   65    0    0   74  D4AAI1     Guanine nucleotide-binding protein subunit gamma OS=Rattus norvegicus GN=Gngt1 PE=3 SV=1
   69 : F7AR14_MACMU        0.92  0.99  436  595   19  178  160    0    0  194  F7AR14     Uncharacterized protein OS=Macaca mulatta GN=PDC PE=2 SV=1
   70 : G3GWV7_CRIGR        0.92  0.99  437  595    1  159  159    0    0  176  G3GWV7     Phosducin OS=Cricetulus griseus GN=I79_002242 PE=4 SV=1
   71 : H9FT58_MACMU        0.92  0.97    1  339    2  340  339    0    0  340  H9FT58     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 OS=Macaca mulatta GN=GNB2 PE=2 SV=1
   72 : K9IXH4_DESRO        0.92  0.93    1  339    2  367  366    1   27  367  K9IXH4     Putative g-protein beta subunit OS=Desmodus rotundus PE=2 SV=1
   73 : L9JJ08_TUPCH        0.92  0.98  341  405    2   66   65    0    0   74  L9JJ08     Guanine nucleotide-binding protein subunit gamma OS=Tupaia chinensis GN=TREES_T100012334 PE=3 SV=1
   74 : R0JKQ1_ANAPL        0.92  0.98   32  339    1  308  308    0    0  308  R0JKQ1     Guanine nucleotide-binding protein subunit beta-4 (Fragment) OS=Anas platyrhynchos GN=Anapl_03219 PE=4 SV=1
   75 : F6S094_XENTR        0.91  0.98    1  339   47  385  339    0    0  385  F6S094     Uncharacterized protein OS=Xenopus tropicalis GN=gnb4 PE=4 SV=1
   76 : F6ZIZ9_MACMU        0.91  0.97    1  339    2  340  339    0    0  340  F6ZIZ9     Guanine nucleotide-binding protein subunit beta-4 OS=Macaca mulatta GN=GNB4 PE=2 SV=1
   77 : G1R1B0_NOMLE        0.91  0.97    1  339    2  340  339    0    0  340  G1R1B0     Uncharacterized protein OS=Nomascus leucogenys GN=GNB4 PE=4 SV=1
   78 : G1SEC9_RABIT        0.91  0.97    1  339    2  340  339    0    0  340  G1SEC9     Uncharacterized protein OS=Oryctolagus cuniculus GN=GNB4 PE=4 SV=1
   79 : G7NZ30_MACFA        0.91  0.97    1  339    2  340  339    0    0  340  G7NZ30     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_10872 PE=4 SV=1
   80 : GBB4_HUMAN          0.91  0.97    1  339    2  340  339    0    0  340  Q9HAV0     Guanine nucleotide-binding protein subunit beta-4 OS=Homo sapiens GN=GNB4 PE=1 SV=3
   81 : H0ZK99_TAEGU        0.91  0.99    1  339    2  340  339    0    0  340  H0ZK99     Uncharacterized protein OS=Taeniopygia guttata GN=GNB4 PE=4 SV=1
   82 : H2QNS5_PANTR        0.91  0.97    1  339    2  340  339    0    0  340  H2QNS5     Guanine nucleotide binding protein (G protein), beta polypeptide 4 OS=Pan troglodytes GN=GNB4 PE=2 SV=1
   83 : I3MDZ6_SPETR        0.91  0.97  341  405    2   66   65    0    0   74  I3MDZ6     Guanine nucleotide-binding protein subunit gamma OS=Spermophilus tridecemlineatus GN=GNGT1 PE=3 SV=1
   84 : Q6GM38_XENLA        0.91  0.98    1  339    2  340  339    0    0  340  Q6GM38     MGC84000 protein OS=Xenopus laevis GN=MGC84000 PE=2 SV=1
   85 : E2RD95_CANFA        0.90  0.97    1  339    2  340  339    0    0  340  E2RD95     Uncharacterized protein OS=Canis familiaris GN=GNB2 PE=4 SV=1
   86 : E9QKR0_MOUSE        0.90  0.97    1  339   44  382  339    0    0  382  E9QKR0     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 OS=Mus musculus GN=Gnb2 PE=2 SV=1
   87 : F6UCL7_HORSE        0.90  0.97    1  339    2  340  339    0    0  340  F6UCL7     Uncharacterized protein OS=Equus caballus GN=GNB4 PE=4 SV=1
   88 : F6Y3N2_MONDO        0.90  0.97    1  339    2  340  339    0    0  340  F6Y3N2     Uncharacterized protein OS=Monodelphis domestica GN=GNB2 PE=4 SV=1
   89 : F7DRF8_CALJA        0.90  0.97    1  339    2  340  339    0    0  340  F7DRF8     Uncharacterized protein OS=Callithrix jacchus GN=GNB4 PE=4 SV=1
   90 : F7GNL2_CALJA        0.90  0.97    1  339    2  340  339    0    0  340  F7GNL2     Uncharacterized protein OS=Callithrix jacchus GN=GNB2 PE=4 SV=1
   91 : G1P7S2_MYOLU        0.90  0.97    1  339    2  340  339    0    0  340  G1P7S2     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
   92 : G1SI10_RABIT        0.90  0.97    1  339   33  371  339    0    0  371  G1SI10     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus GN=GNB2 PE=4 SV=1
   93 : G3QSP3_GORGO        0.90  0.97    1  339    2  340  339    0    0  340  G3QSP3     Uncharacterized protein OS=Gorilla gorilla gorilla GN=GNB2 PE=4 SV=1
   94 : G3SB40_GORGO        0.90  0.97    1  339    2  340  339    0    0  340  G3SB40     Uncharacterized protein OS=Gorilla gorilla gorilla GN=GNB4 PE=4 SV=1
   95 : G3W3Y2_SARHA        0.90  0.97    1  339    2  340  339    0    0  340  G3W3Y2     Uncharacterized protein OS=Sarcophilus harrisii GN=GNB2 PE=4 SV=1
   96 : G3WX23_SARHA        0.90  0.98    1  339    2  340  339    0    0  340  G3WX23     Uncharacterized protein OS=Sarcophilus harrisii GN=GNB4 PE=4 SV=1
   97 : G5BBZ6_HETGA        0.90  0.97    1  339    2  340  339    0    0  340  G5BBZ6     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 OS=Heterocephalus glaber GN=GW7_08028 PE=4 SV=1
   98 : GBB2_HUMAN          0.90  0.97    1  339    2  340  339    0    0  340  P62879     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 OS=Homo sapiens GN=GNB2 PE=1 SV=3
   99 : H0V0G0_CAVPO        0.90  0.97    1  339    2  340  339    0    0  340  H0V0G0     Uncharacterized protein OS=Cavia porcellus GN=LOC100735635 PE=4 SV=1
  100 : H0XCM3_OTOGA        0.90  0.97    1  339    2  340  339    0    0  340  H0XCM3     Uncharacterized protein OS=Otolemur garnettii GN=GNB2 PE=4 SV=1
  101 : H2QV39_PANTR        0.90  0.97    1  339    2  340  339    0    0  340  H2QV39     Guanine nucleotide binding protein (G protein), beta polypeptide 2 OS=Pan troglodytes GN=GNB2 PE=2 SV=1
  102 : H9Z7W5_MACMU        0.90  0.97    1  339    2  340  339    0    0  340  H9Z7W5     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 OS=Macaca mulatta GN=GNB2 PE=2 SV=1
  103 : I3IZQ2_ORENI        0.90  0.98    1  339    2  340  339    0    0  340  I3IZQ2     Uncharacterized protein OS=Oreochromis niloticus GN=gnb4 PE=4 SV=1
  104 : I3LSK5_PIG          0.90  0.97    1  339    2  340  339    0    0  340  I3LSK5     Uncharacterized protein OS=Sus scrofa GN=LOC100620305 PE=2 SV=1
  105 : J3SEH6_CROAD        0.90  0.98    1  339    2  340  339    0    0  340  J3SEH6     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2-like OS=Crotalus adamanteus PE=2 SV=1
  106 : L8IQ29_BOSMU        0.90  0.97    1  339    2  340  339    0    0  340  L8IQ29     Guanine nucleotide-binding protein subunit beta-4 OS=Bos grunniens mutus GN=M91_09229 PE=4 SV=1
  107 : L8IRX4_BOSMU        0.90  0.97    9  339    1  331  331    0    0  331  L8IRX4     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 (Fragment) OS=Bos grunniens mutus GN=M91_01946 PE=4 SV=1
  108 : Q45QL2_RAT          0.90  0.97   12  326    1  315  315    0    0  315  Q45QL2     Guanine nucleotide binding protein beta 4 (Fragment) OS=Rattus norvegicus GN=Gnb4 PE=2 SV=1
  109 : Q52LP8_HUMAN        0.90  0.96  431  595   22  185  164    0    0  201  Q52LP8     PDC protein (Fragment) OS=Homo sapiens GN=PDC PE=2 SV=1
  110 : Q5U587_XENLA        0.90  0.98    1  339    2  340  339    0    0  340  Q5U587     LOC495335 protein OS=Xenopus laevis GN=gnb4 PE=2 SV=1
  111 : E2RRE2_CANFA        0.89  0.96    1  306    2  307  306    0    0  344  E2RRE2     Uncharacterized protein OS=Canis familiaris GN=GNB2 PE=4 SV=1
  112 : G1P9Q0_MYOLU        0.89  0.97    1  339    2  340  339    0    0  340  G1P9Q0     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  113 : G3P679_GASAC        0.89  0.98    1  339    8  346  339    0    0  346  G3P679     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus GN=GNB4 PE=4 SV=1
  114 : G3QAP3_GASAC        0.89  0.97    1  339    2  340  339    0    0  340  G3QAP3     Uncharacterized protein OS=Gasterosteus aculeatus GN=GNB2 PE=4 SV=1
  115 : G3VNJ5_SARHA        0.89  0.95  341  405    2   66   65    0    0   74  G3VNJ5     Guanine nucleotide-binding protein subunit gamma OS=Sarcophilus harrisii GN=GNGT1 PE=3 SV=1
  116 : GBB4_MOUSE          0.89  0.97    1  339    2  340  339    0    0  340  P29387     Guanine nucleotide-binding protein subunit beta-4 OS=Mus musculus GN=Gnb4 PE=2 SV=4
  117 : H2LML7_ORYLA        0.89  0.97    1  339    2  340  339    0    0  340  H2LML7     Uncharacterized protein OS=Oryzias latipes GN=LOC101157764 PE=4 SV=1
  118 : I3J8V2_ORENI        0.89  0.97    1  339    2  340  339    0    0  340  I3J8V2     Uncharacterized protein OS=Oreochromis niloticus GN=gnb2 PE=4 SV=1
  119 : L5KS54_PTEAL        0.89  0.96    1  339    2  340  339    0    0  340  L5KS54     Guanine nucleotide-binding protein subunit beta-4 OS=Pteropus alecto GN=PAL_GLEAN10012887 PE=4 SV=1
  120 : Q3THF3_MOUSE        0.89  0.97    1  339    2  340  339    0    0  340  Q3THF3     Putative uncharacterized protein OS=Mus musculus GN=Gnb4 PE=2 SV=1
  121 : Q3TY18_MOUSE        0.89  0.97    1  339    2  340  339    0    0  340  Q3TY18     Putative uncharacterized protein OS=Mus musculus GN=Gnb4 PE=2 SV=1
  122 : Q45QL6_RAT          0.89  0.97    3  321    1  319  319    0    0  319  Q45QL6     Guanine nucleotide binding protein beta 2 (Fragment) OS=Rattus norvegicus GN=Gnb2 PE=2 SV=1
  123 : Q5BJ11_DANRE        0.89  0.97    1  339    2  340  339    0    0  340  Q5BJ11     Guanine nucleotide binding protein (G protein), beta polypeptide 2 OS=Danio rerio GN=gnb2 PE=2 SV=1
  124 : B7Q3T6_IXOSC        0.88  0.95    1  339    2  340  339    0    0  340  B7Q3T6     THO complex subunit, putative OS=Ixodes scapularis GN=IscW_ISCW009711 PE=4 SV=1
  125 : C3ZSF0_BRAFL        0.88  0.96    1  339    3  341  339    0    0  341  C3ZSF0     Putative uncharacterized protein OS=Branchiostoma floridae GN=BRAFLDRAFT_220697 PE=4 SV=1
  126 : M4AC83_XIPMA        0.88  0.97    1  339    2  340  339    0    0  340  M4AC83     Uncharacterized protein OS=Xiphophorus maculatus GN=GNB2 PE=4 SV=1
  127 : M7BKJ4_CHEMY        0.88  0.94    1  339    2  327  339    1   13  327  M7BKJ4     Guanine nucleotide-binding protein subunit beta-4 OS=Chelonia mydas GN=UY3_04385 PE=4 SV=1
  128 : R7TXX3_9ANNE        0.88  0.96    1  339    3  341  339    0    0  341  R7TXX3     Uncharacterized protein OS=Capitella teleta GN=CAPTEDRAFT_124853 PE=4 SV=1
  129 : A4IH33_XENTR        0.87  0.94    1  339    2  327  339    1   13  327  A4IH33     LOC549706 protein OS=Xenopus tropicalis GN=LOC549706 PE=2 SV=1
  130 : H6BD99_OSTED        0.87  0.96    1  339    3  341  339    0    0  341  H6BD99     G protein B subunit OS=Ostrea edulis PE=2 SV=1
  131 : L7M958_9ACAR        0.87  0.95    1  339    2  340  339    0    0  340  L7M958     Putative g protein beta-subunit 13f OS=Rhipicephalus pulchellus PE=2 SV=1
  132 : M3YW85_MUSPF        0.87  0.95    1  339    2  340  339    0    0  340  M3YW85     Uncharacterized protein OS=Mustela putorius furo GN=Gnb2 PE=4 SV=1
  133 : B2LUS1_MELJA        0.86  0.95    1  339    2  340  339    0    0  340  B2LUS1     G-protein beta subunit OS=Meloidogyne javanica PE=2 SV=1
  134 : B8Q2X0_9MOLL        0.86  0.94    1  339    3  341  339    0    0  341  B8Q2X0     G protein beta subunit OS=Euprymna scolopes PE=2 SV=1
  135 : E0VYY5_PEDHC        0.86  0.94    1  339    2  344  343    1    4  344  E0VYY5     Guanine nucleotide-binding protein G, subunit beta, putative OS=Pediculus humanus subsp. corporis GN=Phum_PHUM521670 PE=4 SV=1
  136 : E2ADE6_CAMFO        0.86  0.94    1  339    2  340  339    0    0  340  E2ADE6     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Camponotus floridanus GN=EAG_07162 PE=4 SV=1
  137 : E2C0R0_HARSA        0.86  0.95   22  339   12  329  318    0    0  329  E2C0R0     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Harpegnathos saltator GN=EAI_13326 PE=4 SV=1
  138 : E3LFW0_CAERE        0.86  0.96    1  339    2  340  339    0    0  340  E3LFW0     CRE-GPB-1 protein OS=Caenorhabditis remanei GN=Cre-gpb-1 PE=4 SV=1
  139 : E5S1K6_TRISP        0.86  0.95    1  339    2  340  339    0    0  340  E5S1K6     Guanine nucleotide-binding protein subunit beta-1 OS=Trichinella spiralis GN=Tsp_02729 PE=4 SV=1
  140 : F1L292_ASCSU        0.86  0.95    1  339    2  340  339    0    0  340  F1L292     Guanine nucleotide-binding protein subunit beta-1 OS=Ascaris suum PE=2 SV=1
  141 : F1MSE1_BOVIN        0.86  0.86  407  595   13  230  218    1   30  245  F1MSE1     Phosducin OS=Bos taurus GN=PDC PE=4 SV=2
  142 : G0NT72_CAEBE        0.86  0.96    1  339    2  340  339    0    0  340  G0NT72     Putative uncharacterized protein OS=Caenorhabditis brenneri GN=CAEBREN_03128 PE=4 SV=1
  143 : GBB1_CAEBR          0.86  0.96    1  339    2  340  339    0    0  340  Q61ZF6     Guanine nucleotide-binding protein subunit beta-1 OS=Caenorhabditis briggsae GN=gpb-1 PE=3 SV=1
  144 : GBB1_CAEEL          0.86  0.96    1  339    2  340  339    0    0  340  P17343     Guanine nucleotide-binding protein subunit beta-1 OS=Caenorhabditis elegans GN=gpb-1 PE=2 SV=2
  145 : GBB_LOLFO           0.86  0.95    1  339    3  341  339    0    0  341  P23232     Guanine nucleotide-binding protein subunit beta OS=Loligo forbesi PE=2 SV=1
  146 : H3DDM6_TETNG        0.86  0.95    1  339    2  330  339    1   10  330  H3DDM6     Uncharacterized protein OS=Tetraodon nigroviridis GN=GNB4 PE=4 SV=1
  147 : H9C3G7_SCYPA        0.86  0.94    1  339    2  340  339    0    0  340  H9C3G7     G protein beta 1 OS=Scylla paramamosain PE=2 SV=1
  148 : PHOS_BOVIN  1A0R    0.86  0.86  407  595   13  230  218    1   30  245  P19632     Phosducin OS=Bos taurus GN=PDC PE=1 SV=2
  149 : Q6TQF6_DORPE        0.86  0.95    1  339    3  341  339    0    0  341  Q6TQF6     Visual G-protein beta subunit OS=Doryteuthis pealeii PE=2 SV=1
  150 : R4G8Y0_RHOPR        0.86  0.95   20  339    3  322  320    0    0  322  R4G8Y0     Putative guanine nucleotide-binding protein subunit (Fragment) OS=Rhodnius prolixus PE=2 SV=1
  151 : A4IIB5_XENTR        0.85  0.94  341  405    2   66   65    0    0   73  A4IIB5     Guanine nucleotide-binding protein subunit gamma OS=Xenopus tropicalis GN=gngt1 PE=3 SV=1
  152 : A7S5Z1_NEMVE        0.85  0.94    1  339    2  340  339    0    0  340  A7S5Z1     Predicted protein OS=Nematostella vectensis GN=v1g105798 PE=4 SV=1
  153 : B0WJZ3_CULQU        0.85  0.94    1  339    2  340  339    0    0  340  B0WJZ3     Guanine nucleotide-binding protein subunit beta 1 OS=Culex quinquefasciatus GN=CpipJ_CPIJ007402 PE=4 SV=1
  154 : B0XB73_CULQU        0.85  0.94    1  339    2  340  339    0    0  340  B0XB73     Guanine nucleotide-binding protein subunit beta 1 OS=Culex quinquefasciatus GN=CpipJ_CPIJ016403 PE=4 SV=1
  155 : B8Q2X1_9MOLL        0.85  0.94    1  339    3  341  339    0    0  341  B8Q2X1     G protein beta subunit OS=Euprymna scolopes PE=2 SV=1
  156 : D2A477_TRICA        0.85  0.94    1  339    2  340  339    0    0  340  D2A477     Putative uncharacterized protein GLEAN_14882 OS=Tribolium castaneum GN=GLEAN_14882 PE=4 SV=1
  157 : F6RKF1_XENTR        0.85  0.94  341  405   22   86   65    0    0   93  F6RKF1     Guanine nucleotide-binding protein subunit gamma OS=Xenopus tropicalis GN=gngt1 PE=3 SV=1
  158 : G4LUG8_SCHMA        0.85  0.95    1  307    2  308  307    0    0  315  G4LUG8     Putative uncharacterized protein Smp_010230 OS=Schistosoma mansoni GN=Smp_010230 PE=4 SV=1
  159 : H2ZX79_LATCH        0.85  0.94  341  405    2   66   65    0    0   73  H2ZX79     Guanine nucleotide-binding protein subunit gamma OS=Latimeria chalumnae PE=3 SV=1
  160 : J3JXS6_9CUCU        0.85  0.94    1  339    2  340  339    0    0  340  J3JXS6     Uncharacterized protein OS=Dendroctonus ponderosae GN=YQE_10132 PE=2 SV=1
  161 : L8INY5_BOSMU        0.85  0.85  407  595   16  233  218    1   30  248  L8INY5     Phosducin (Fragment) OS=Bos grunniens mutus GN=M91_16525 PE=4 SV=1
  162 : Q7Q6D3_ANOGA        0.85  0.95    1  339    2  340  339    0    0  340  Q7Q6D3     AGAP005912-PA OS=Anopheles gambiae GN=AGAP005912 PE=4 SV=3
  163 : Q7Q6D4_ANOGA        0.85  0.95    1  339    2  340  339    0    0  340  Q7Q6D4     AGAP005911-PA OS=Anopheles gambiae GN=AGAP005911 PE=4 SV=1
  164 : B0WJZ5_CULQU        0.84  0.95    1  339    2  340  339    0    0  340  B0WJZ5     Guanine nucleotide-binding protein subunit beta 1 OS=Culex quinquefasciatus GN=CpipJ_CPIJ007404 PE=4 SV=1
  165 : D3TN11_GLOMM        0.84  0.94    1  339    2  340  339    0    0  340  D3TN11     G protein beta subunit OS=Glossina morsitans morsitans PE=2 SV=1
  166 : D4A752_RAT          0.84  0.92    1  339    2  337  339    1    3  337  D4A752     Guanine nucleotide-binding protein subunit beta-4 OS=Rattus norvegicus GN=Gnb4 PE=4 SV=2
  167 : K7G6E1_PELSI        0.84  0.96    1  339    2  340  339    0    0  340  K7G6E1     Uncharacterized protein OS=Pelodiscus sinensis GN=GNB3 PE=4 SV=1
  168 : M1MER8_BEMTA        0.84  0.93    1  339    2  340  339    0    0  340  M1MER8     Heterotrimeric guanine nucleotide-binding protein beta subunit OS=Bemisia tabaci PE=2 SV=1
  169 : Q1HPN1_BOMMO        0.84  0.94    1  339    2  340  339    0    0  340  Q1HPN1     Heterotrimeric guanine nucleotide-binding protein beta subunit OS=Bombyx mori PE=2 SV=1
  170 : A4V4I0_DROME        0.83  0.94    1  339    2  340  339    0    0  340  A4V4I0     G protein beta-subunit 13F, isoform B OS=Drosophila melanogaster GN=Gbeta13F PE=4 SV=1
  171 : B4L9W3_DROMO        0.83  0.93    1  339    2  340  339    0    0  340  B4L9W3     GI14221 OS=Drosophila mojavensis GN=Dmoj\GI14221 PE=4 SV=1
  172 : B4MFV5_DROVI        0.83  0.93    1  339    2  340  339    0    0  340  B4MFV5     GJ14659 OS=Drosophila virilis GN=Dvir\GJ14659 PE=4 SV=1
  173 : B4PX84_DROYA        0.83  0.94    1  339    2  340  339    0    0  340  B4PX84     GE17230 OS=Drosophila yakuba GN=Dyak\GE17230 PE=4 SV=1
  174 : B5DSF9_DROPS        0.83  0.93    1  339    2  340  339    0    0  340  B5DSF9     GA23154 OS=Drosophila pseudoobscura pseudoobscura GN=Dpse\GA23154 PE=4 SV=1
  175 : C1C3S0_LITCT        0.83  0.89  341  405    2   66   65    0    0   73  C1C3S0     Guanine nucleotide-binding protein subunit gamma OS=Lithobates catesbeiana GN=GBG1 PE=3 SV=1
  176 : E1BB14_BOVIN        0.83  0.95    1  339    2  340  339    0    0  340  E1BB14     Uncharacterized protein OS=Bos taurus GN=GNB3 PE=4 SV=1
  177 : E3WUW4_ANODA        0.83  0.93    1  339    2  340  339    0    0  340  E3WUW4     Uncharacterized protein OS=Anopheles darlingi GN=AND_07342 PE=4 SV=1
  178 : E9PCP0_HUMAN        0.83  0.95    1  339    2  339  339    1    1  339  E9PCP0     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Homo sapiens GN=GNB3 PE=2 SV=2
  179 : F1S2Z8_PIG          0.83  0.85  407  595   14  231  218    1   30  246  F1S2Z8     Uncharacterized protein (Fragment) OS=Sus scrofa GN=LOC100518570 PE=4 SV=2
  180 : F4X163_ACREC        0.83  0.91    1  339    2  330  339    1   10  330  F4X163     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 OS=Acromyrmex echinatior GN=G5I_12021 PE=4 SV=1
  181 : F6RK03_XENTR        0.83  0.88    1  339    2  335  339    1    5  335  F6RK03     Uncharacterized protein OS=Xenopus tropicalis GN=gnb1 PE=4 SV=1
  182 : F6SJT1_HORSE        0.83  0.95    1  339    2  340  339    0    0  340  F6SJT1     Uncharacterized protein OS=Equus caballus GN=GNB3 PE=4 SV=1
  183 : F6VBL9_CALJA        0.83  0.95    1  339    2  340  339    0    0  340  F6VBL9     Uncharacterized protein OS=Callithrix jacchus GN=GNB3 PE=4 SV=1
  184 : F7CTP1_MACMU        0.83  0.95    1  339    2  340  339    0    0  340  F7CTP1     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Macaca mulatta GN=GNB3 PE=2 SV=1
  185 : F7CXD0_MONDO        0.83  0.96    1  339    2  340  339    0    0  340  F7CXD0     Uncharacterized protein OS=Monodelphis domestica GN=GNB3 PE=4 SV=1
  186 : G1P7P1_MYOLU        0.83  0.96    1  339    2  340  339    0    0  340  G1P7P1     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  187 : G3QJH3_GORGO        0.83  0.95    1  339    2  340  339    0    0  340  G3QJH3     Uncharacterized protein OS=Gorilla gorilla gorilla GN=GNB3 PE=4 SV=1
  188 : G7PJN5_MACFA        0.83  0.95    1  339    2  340  339    0    0  340  G7PJN5     Transducin beta chain 3 OS=Macaca fascicularis GN=EGM_02917 PE=4 SV=1
  189 : G9F6Y0_PIG          0.83  0.85  407  595    8  225  218    1   30  240  G9F6Y0     Phosducin (Fragment) OS=Sus scrofa PE=2 SV=1
  190 : GBB3_HUMAN          0.83  0.95    1  339    2  340  339    0    0  340  P16520     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Homo sapiens GN=GNB3 PE=1 SV=1
  191 : GBB3_MOUSE          0.83  0.95    1  339    2  340  339    0    0  340  Q61011     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Mus musculus GN=Gnb3 PE=1 SV=2
  192 : GBB3_RAT            0.83  0.95    1  339    2  340  339    0    0  340  P52287     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Rattus norvegicus GN=Gnb3 PE=1 SV=1
  193 : H0XUC3_OTOGA        0.83  0.95    1  339    2  340  339    0    0  340  H0XUC3     Uncharacterized protein OS=Otolemur garnettii GN=GNB3 PE=4 SV=1
  194 : L5KGH6_PTEAL        0.83  0.95    1  339    2  340  339    0    0  340  L5KGH6     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Pteropus alecto GN=PAL_GLEAN10015566 PE=4 SV=1
  195 : L8HU84_BOSMU        0.83  0.95    1  339    2  340  339    0    0  340  L8HU84     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Bos grunniens mutus GN=M91_17647 PE=4 SV=1
  196 : Q54AE3_MOUSE        0.83  0.95    1  339    2  340  339    0    0  340  Q54AE3     GTP-binding protein beta3 subunit OS=Mus musculus GN=Gnb3 PE=4 SV=1
  197 : Q9DFG9_AMBTI        0.83  0.94    1  339    2  340  339    0    0  340  Q9DFG9     G-protein B3 subunit OS=Ambystoma tigrinum PE=2 SV=1
  198 : A9UHL9_CANFA        0.82  0.96    1  339    2  340  339    0    0  340  A9UHL9     GTP-binding protein beta-3 subunit OS=Canis familiaris GN=GNB3 PE=2 SV=1
  199 : E0VTS4_PEDHC        0.82  0.91    1  339    2  353  352    1   13  353  E0VTS4     Guanine nucleotide-binding protein G(I)/G(S)/G(T), subunit beta, putative OS=Pediculus humanus subsp. corporis GN=Phum_PHUM437580 PE=4 SV=1
  200 : F1P8Q5_CANFA        0.82  0.95    1  339    2  340  339    0    0  340  F1P8Q5     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Canis familiaris GN=GNB3 PE=4 SV=1
  201 : Q4SC83_TETNG        0.82  0.84    1  339    2  296  339    1   44  296  Q4SC83     Chromosome undetermined SCAF14659, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00020620001 PE=4 SV=1
  202 : Q6GLQ2_XENLA        0.82  0.92  341  405    2   66   65    0    0   73  Q6GLQ2     Guanine nucleotide-binding protein subunit gamma OS=Xenopus laevis GN=gngt1 PE=3 SV=1
  203 : F6W5B8_HORSE        0.81  0.85  407  595   18  235  218    1   30  250  F6W5B8     Phosducin (Fragment) OS=Equus caballus GN=PDC PE=4 SV=1
  204 : G1QXT0_NOMLE        0.81  0.94    1  339    2  340  339    0    0  340  G1QXT0     Uncharacterized protein OS=Nomascus leucogenys GN=GNB3 PE=4 SV=1
  205 : G4VA12_SCHMA        0.81  0.94    1  339    2  340  339    0    0  340  G4VA12     Putative g-protein, beta subunit OS=Schistosoma mansoni GN=Smp_063640 PE=4 SV=1
  206 : H0WIZ9_OTOGA        0.81  0.85  407  595   13  230  218    1   30  246  H0WIZ9     Uncharacterized protein OS=Otolemur garnettii GN=PDC PE=4 SV=1
  207 : H0ZSU7_TAEGU        0.81  0.95    1  339    2  340  339    0    0  340  H0ZSU7     Uncharacterized protein OS=Taeniopygia guttata GN=GNB3 PE=4 SV=1
  208 : H2R3A6_PANTR        0.81  0.93    1  339    2  340  339    0    0  340  H2R3A6     Uncharacterized protein OS=Pan troglodytes GN=LOC100612078 PE=4 SV=1
  209 : L5KYA3_PTEAL        0.81  0.85  407  595   13  230  218    1   30  245  L5KYA3     Phosducin OS=Pteropus alecto GN=PAL_GLEAN10017648 PE=4 SV=1
  210 : PHOS_HORSE          0.81  0.85  407  595   13  230  218    1   30  245  Q9XS39     Phosducin OS=Equus caballus GN=PDC PE=2 SV=1
  211 : D2HQU6_AILME        0.80  0.85  415  595    1  210  210    1   30  223  D2HQU6     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_014298 PE=4 SV=1
  212 : E4XGC6_OIKDI        0.80  0.94   12  339   52  379  328    0    0  379  E4XGC6     Whole genome shotgun assembly, reference scaffold set, scaffold scaffold_33 OS=Oikopleura dioica GN=GSOID_T00010535001 PE=4 SV=1
  213 : E4YGD2_OIKDI        0.80  0.94   12  339   51  378  328    0    0  378  E4YGD2     Whole genome shotgun assembly, allelic scaffold set, scaffold scaffoldA_246 OS=Oikopleura dioica GN=GSOID_T00024583001 PE=4 SV=1
  214 : E4YNW6_OIKDI        0.80  0.94   12  339   60  387  328    0    0  387  E4YNW6     Whole genome shotgun assembly, allelic scaffold set, scaffold scaffoldA_638 OS=Oikopleura dioica GN=GSOID_T00030243001 PE=4 SV=1
  215 : G1MAK0_AILME        0.80  0.85  407  595   15  232  218    1   30  247  G1MAK0     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PDC PE=4 SV=1
  216 : G3TD87_LOXAF        0.80  0.85  407  595   13  230  218    1   30  246  G3TD87     Uncharacterized protein OS=Loxodonta africana GN=LOC100666643 PE=4 SV=1
  217 : G5CAR2_HETGA        0.80  0.95    1  339    2  340  339    0    0  340  G5CAR2     Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 OS=Heterocephalus glaber GN=GW7_12121 PE=4 SV=1
  218 : H0YTE8_TAEGU        0.80  0.92  341  405    2   66   65    0    0   73  H0YTE8     Guanine nucleotide-binding protein subunit gamma OS=Taeniopygia guttata GN=GNG11 PE=3 SV=1
  219 : M3YKX8_MUSPF        0.80  0.84  415  595    1  210  210    1   30  225  M3YKX8     Uncharacterized protein (Fragment) OS=Mustela putorius furo GN=Pdc PE=4 SV=1
  220 : PHOS_CANFA          0.80  0.85  407  595   13  230  218    1   30  245  O77560     Phosducin OS=Canis familiaris GN=PDC PE=1 SV=2
  221 : PHOS_FELCA          0.80  0.84  407  595   13  230  218    1   30  245  P41686     Phosducin OS=Felis catus GN=PDC PE=2 SV=1
  222 : D3PIG9_9MAXI        0.79  0.91    1  339    3  341  339    0    0  341  D3PIG9     Guanine nucleotide-binding protein subunit beta-1 OS=Lepeophtheirus salmonis GN=GBB1 PE=2 SV=1
  223 : F7EQ61_MACMU        0.79  0.84  407  595   13  230  218    1   30  246  F7EQ61     Uncharacterized protein OS=Macaca mulatta GN=PDC PE=2 SV=1
  224 : F7I487_CALJA        0.79  0.84  407  595   21  238  218    1   30  255  F7I487     Uncharacterized protein (Fragment) OS=Callithrix jacchus GN=PDC PE=4 SV=1
  225 : G1PM46_MYOLU        0.79  0.84  407  595   21  238  218    1   30  253  G1PM46     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  226 : G1S8S6_NOMLE        0.79  0.84  407  595   13  230  218    1   30  246  G1S8S6     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100590520 PE=4 SV=1
  227 : G1SRP6_RABIT        0.79  0.85  407  595   21  239  219    2   31  254  G1SRP6     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus GN=LOC100350772 PE=4 SV=1
  228 : G3I1D1_CRIGR        0.79  0.86    1  339    2  364  363    2   24  364  G3I1D1     Guanine nucleotide-binding protein subunit beta-4 OS=Cricetulus griseus GN=I79_017184 PE=4 SV=1
  229 : G3QIK9_GORGO        0.79  0.83  415  595    1  210  210    1   30  226  G3QIK9     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla PE=4 SV=1
  230 : G3SAB6_GORGO        0.79  0.84  407  595   21  238  218    1   30  254  G3SAB6     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla PE=4 SV=1
  231 : G7NXE9_MACFA        0.79  0.84  407  595   13  230  218    1   30  246  G7NXE9     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_01583 PE=4 SV=1
  232 : H2Q0S8_PANTR        0.79  0.84  407  595   13  230  218    1   30  246  H2Q0S8     Uncharacterized protein OS=Pan troglodytes GN=PDC PE=4 SV=1
  233 : I3N2Z0_SPETR        0.79  0.85  407  595   13  228  216    1   28  244  I3N2Z0     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=PDC PE=4 SV=1
  234 : K9LLF7_MNELE        0.79  0.93    1  339    2  340  339    0    0  340  K9LLF7     Visual G beta OS=Mnemiopsis leidyi GN=ML02234a PE=4 SV=1
  235 : G5C6C0_HETGA        0.78  0.85  407  595   20  236  217    1   29  251  G5C6C0     Phosducin (Fragment) OS=Heterocephalus glaber GN=GW7_07101 PE=4 SV=1
  236 : H0UT17_CAVPO        0.78  0.83  407  595   13  230  218    1   30  243  H0UT17     Uncharacterized protein OS=Cavia porcellus GN=LOC100718138 PE=4 SV=1
  237 : K7G6N0_PELSI        0.78  0.92  341  405    2   66   65    0    0   73  K7G6N0     Guanine nucleotide-binding protein subunit gamma OS=Pelodiscus sinensis GN=GNG11 PE=3 SV=1
  238 : L5LBP8_MYODS        0.78  0.84  407  595   13  230  218    1   30  245  L5LBP8     Phosducin OS=Myotis davidii GN=MDA_GLEAN10017474 PE=4 SV=1
  239 : PHOS_HUMAN          0.78  0.83  407  595   13  230  218    1   30  246  P20941     Phosducin OS=Homo sapiens GN=PDC PE=1 SV=1
  240 : PHOS_MOUSE          0.78  0.85  407  595   13  228  216    1   28  244  Q9QW08     Phosducin OS=Mus musculus GN=Pdc PE=2 SV=1
  241 : Q4S8Y3_TETNG        0.78  0.85    1  339    2  378  377    3   38  378  Q4S8Y3     Chromosome 7 SCAF14703, whole genome shotgun sequence OS=Tetraodon nigroviridis GN=GSTENG00022138001 PE=4 SV=1
  242 : Q9UP23_HUMAN        0.78  0.83  407  595   50  267  218    1   30  283  Q9UP23     PhLP1 OS=Homo sapiens PE=2 SV=1
  243 : G1PXJ8_MYOLU        0.77  0.92  342  405    3   66   64    0    0   73  G1PXJ8     Guanine nucleotide-binding protein subunit gamma OS=Myotis lucifugus PE=3 SV=1
  244 : H9G9Z9_ANOCA        0.77  0.83    1  339    2  333  339    2    7  333  H9G9Z9     Uncharacterized protein OS=Anolis carolinensis PE=4 SV=1
  245 : PHOS_RAT    2TRC    0.77  0.84  407  595   13  230  218    1   30  246  P20942     Phosducin OS=Rattus norvegicus GN=Pdc PE=1 SV=1
  246 : Q4RU65_TETNG        0.77  0.85    1  339    2  332  358    2   46  332  Q4RU65     Chromosome 1 SCAF14995, whole genome shotgun sequence OS=Tetraodon nigroviridis GN=GSTENG00028934001 PE=4 SV=1
  247 : F6YE86_MONDO        0.76  0.84  407  595   20  237  218    1   30  253  F6YE86     Uncharacterized protein OS=Monodelphis domestica GN=PDC PE=4 SV=2
  248 : G3WSQ3_SARHA        0.76  0.84  407  595   21  237  217    1   29  253  G3WSQ3     Uncharacterized protein (Fragment) OS=Sarcophilus harrisii GN=PDC PE=4 SV=1
  249 : B6V716_SHEEP        0.75  0.91  341  405    2   66   65    0    0   73  B6V716     Guanine nucleotide-binding protein subunit gamma OS=Ovis aries GN=GNG11 PE=3 SV=1
  250 : D2H8V0_AILME        0.75  0.91  341  405    2   66   65    0    0   73  D2H8V0     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=GNG11 PE=3 SV=1
  251 : E0VAY2_PEDHC        0.75  0.85    1  339    2  317  343    2   31  317  E0VAY2     Guanine nucleotide-binding protein subunit beta 1, putative OS=Pediculus humanus subsp. corporis GN=Phum_PHUM046980 PE=4 SV=1
  252 : E2RBE7_CANFA        0.75  0.91  341  405    2   66   65    0    0   73  E2RBE7     Guanine nucleotide-binding protein subunit gamma OS=Canis familiaris GN=GNG11 PE=3 SV=1
  253 : F1SFA9_PIG          0.75  0.91  341  405    3   67   65    0    0   74  F1SFA9     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Sus scrofa GN=LOC100522202 PE=3 SV=2
  254 : F6X563_HORSE        0.75  0.91  341  405    2   66   65    0    0   73  F6X563     Guanine nucleotide-binding protein subunit gamma OS=Equus caballus GN=GNG11 PE=3 SV=1
  255 : F6X977_CALJA        0.75  0.91  341  405    2   66   65    0    0   73  F6X977     Guanine nucleotide-binding protein subunit gamma OS=Callithrix jacchus GN=GNG11 PE=3 SV=1
  256 : G1KNH3_ANOCA        0.75  0.92  341  405    2   66   65    0    0   73  G1KNH3     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis GN=LOC100568050 PE=3 SV=1
  257 : G1QDU0_MYOLU        0.75  0.91  341  405    2   66   65    0    0   73  G1QDU0     Guanine nucleotide-binding protein subunit gamma OS=Myotis lucifugus PE=3 SV=1
  258 : G1RZQ5_NOMLE        0.75  0.91  341  405    2   66   65    0    0   73  G1RZQ5     Guanine nucleotide-binding protein subunit gamma OS=Nomascus leucogenys GN=LOC100593358 PE=3 SV=1
  259 : G1TCV2_RABIT        0.75  0.91  341  405    2   66   65    0    0   73  G1TCV2     Guanine nucleotide-binding protein subunit gamma OS=Oryctolagus cuniculus GN=LOC100342201 PE=3 SV=1
  260 : G3RG22_GORGO        0.75  0.91  341  405    2   66   65    0    0   73  G3RG22     Guanine nucleotide-binding protein subunit gamma OS=Gorilla gorilla gorilla GN=GNG11 PE=3 SV=1
  261 : G5ANK6_HETGA        0.75  0.91  341  405    2   66   65    0    0   73  G5ANK6     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_02185 PE=3 SV=1
  262 : G7MLV7_MACMU        0.75  0.91  341  405    2   66   65    0    0   73  G7MLV7     Guanine nucleotide-binding protein subunit gamma OS=Macaca mulatta GN=GNG11 PE=3 SV=1
  263 : G7P1D1_MACFA        0.75  0.91  341  405    2   66   65    0    0   73  G7P1D1     Guanine nucleotide-binding protein subunit gamma OS=Macaca fascicularis GN=EGM_12769 PE=3 SV=1
  264 : GBG11_HUMAN         0.75  0.91  341  405    2   66   65    0    0   73  P61952     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11 OS=Homo sapiens GN=GNG11 PE=1 SV=1
  265 : GBG11_MOUSE         0.75  0.91  341  405    2   66   65    0    0   73  P61953     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11 OS=Mus musculus GN=Gng11 PE=1 SV=1
  266 : GBG11_RAT           0.75  0.91  341  405    2   66   65    0    0   73  P61954     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11 OS=Rattus norvegicus GN=Gng11 PE=3 SV=1
  267 : H0VCC2_CAVPO        0.75  0.91  341  405    2   66   65    0    0   73  H0VCC2     Guanine nucleotide-binding protein subunit gamma OS=Cavia porcellus GN=LOC100734182 PE=3 SV=1
  268 : H0WR89_OTOGA        0.75  0.91  341  405    2   66   65    0    0   73  H0WR89     Guanine nucleotide-binding protein subunit gamma OS=Otolemur garnettii GN=GNG11 PE=3 SV=1
  269 : H2PMW8_PONAB        0.75  0.91  341  405    2   66   65    0    0   73  H2PMW8     Guanine nucleotide-binding protein subunit gamma OS=Pongo abelii GN=GNG11 PE=3 SV=1
  270 : H2QUY0_PANTR        0.75  0.91  341  405    2   66   65    0    0   73  H2QUY0     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNG11 PE=3 SV=1
  271 : I1FGQ2_AMPQE        0.75  0.93    1  339   64  402  339    0    0  402  I1FGQ2     Uncharacterized protein OS=Amphimedon queenslandica GN=LOC100633901 PE=4 SV=1
  272 : I3MDZ8_SPETR        0.75  0.91  341  405    2   66   65    0    0   73  I3MDZ8     Guanine nucleotide-binding protein subunit gamma OS=Spermophilus tridecemlineatus GN=GNG11 PE=3 SV=1
  273 : K9J4E7_DESRO        0.75  0.91  341  405   12   76   65    0    0   83  K9J4E7     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Desmodus rotundus PE=2 SV=1
  274 : L5KPE7_PTEAL        0.75  0.91  341  405    2   66   65    0    0   73  L5KPE7     Guanine nucleotide-binding protein subunit gamma OS=Pteropus alecto GN=PAL_GLEAN10021739 PE=3 SV=1
  275 : L9JFK2_TUPCH        0.75  0.91  341  405    2   66   65    0    0   73  L9JFK2     Guanine nucleotide-binding protein subunit gamma OS=Tupaia chinensis GN=TREES_T100012335 PE=3 SV=1
  276 : M1ESH5_MUSPF        0.75  0.91  341  405    1   65   65    0    0   72  M1ESH5     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Mustela putorius furo PE=2 SV=1
  277 : M3W6F0_FELCA        0.75  0.91  341  405    2   66   65    0    0   73  M3W6F0     Guanine nucleotide-binding protein subunit gamma OS=Felis catus GN=GNG11 PE=3 SV=1
  278 : M3XRC8_MUSPF        0.75  0.91  341  405    2   66   65    0    0   73  M3XRC8     Guanine nucleotide-binding protein subunit gamma OS=Mustela putorius furo GN=Gng11 PE=3 SV=1
  279 : Q53Y01_HUMAN        0.75  0.91  341  405    2   66   65    0    0   73  Q53Y01     Guanine nucleotide-binding protein subunit gamma OS=Homo sapiens GN=GNG11 PE=2 SV=1
  280 : G3TKW0_LOXAF        0.74  0.91  341  405    2   66   65    0    0   73  G3TKW0     Guanine nucleotide-binding protein subunit gamma OS=Loxodonta africana GN=LOC100676970 PE=3 SV=1
  281 : GBG11_BOVIN         0.74  0.89  341  405    2   66   65    0    0   73  Q5E9F0     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11 OS=Bos taurus GN=GNG11 PE=3 SV=1
  282 : M4A9K6_XIPMA        0.74  0.87    1  339    2  340  339    0    0  340  M4A9K6     Uncharacterized protein OS=Xiphophorus maculatus GN=GNB3 (1 of 2) PE=4 SV=1
  283 : H2MBG0_ORYLA        0.73  0.88    1  339    2  340  339    0    0  340  H2MBG0     Uncharacterized protein OS=Oryzias latipes GN=GNB3 (1 of 2) PE=4 SV=1
  284 : I3K5F4_ORENI        0.73  0.88    1  339    2  340  339    0    0  340  I3K5F4     Uncharacterized protein OS=Oreochromis niloticus GN=GNB3 (1 of 2) PE=4 SV=1
  285 : Q6DH55_DANRE        0.73  0.88    1  339    2  340  339    0    0  340  Q6DH55     Guanine nucleotide binding protein (G protein), beta polypeptide 3, like OS=Danio rerio GN=gnb3a PE=2 SV=1
  286 : G3GXI4_CRIGR        0.72  0.92  341  405    2   66   65    0    0   73  G3GXI4     Guanine nucleotide-binding protein subunit gamma OS=Cricetulus griseus GN=I79_002476 PE=3 SV=1
  287 : K7AVV5_PANTR        0.72  0.89  341  405    2   66   65    0    0   73  K7AVV5     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNG11 PE=3 SV=1
  288 : Q4RKG1_TETNG        0.72  0.85  341  405    2   66   65    0    0   73  Q4RKG1     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00032971001 PE=3 SV=1
  289 : Q4SNF7_TETNG        0.72  0.87    1  339    2  346  345    1    6  346  Q4SNF7     Chromosome 8 SCAF14543, whole genome shotgun sequence OS=Tetraodon nigroviridis GN=GSTENG00015314001 PE=4 SV=1
  290 : A8N364_COPC7        0.71  0.87    7  338   16  347  333    2    2  348  A8N364     Guanine nucleotide binding protein beta subunit OS=Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003) GN=CC1G_00488 PE=4 SV=2
  291 : B8PE06_POSPM        0.71  0.88    7  338   17  349  334    3    3  350  B8PE06     Candidate G-protein beta subunit OS=Postia placenta (strain ATCC 44394 / Madison 698-R) GN=POSPLDRAFT_117050 PE=4 SV=1
  292 : D8PMM6_SCHCM        0.71  0.88    7  338   16  348  334    3    3  349  D8PMM6     Guanine nucleotide binding protein beta subunit 2 OS=Schizophyllum commune (strain H4-8 / FGSC 9210) GN=SCHCODRAFT_72736 PE=4 SV=1
  293 : E3K0E6_PUCGT        0.71  0.87    1  338    7  344  339    2    2  345  E3K0E6     Guanine nucleotide-binding protein subunit beta OS=Puccinia graminis f. sp. tritici (strain CRL 75-36-700-3 / race SCCL) GN=PGTG_03727 PE=4 SV=1
  294 : J3PP66_PUCT1        0.71  0.87    1  338    7  344  339    2    2  345  J3PP66     Uncharacterized protein OS=Puccinia triticina (isolate 1-1 / race 1 (BBBD)) GN=PTTG_00932 PE=4 SV=1
  295 : Q96B71_HUMAN        0.71  0.81    1  339    2  297  339    1   43  297  Q96B71     GNB3 protein OS=Homo sapiens PE=2 SV=1
  296 : R9AC26_WALIC        0.71  0.88    2  338   11  347  338    2    2  348  R9AC26     Guanine nucleotide-binding protein subunit beta OS=Wallemia ichthyophaga EXF-994 GN=J056_001585 PE=4 SV=1
  297 : E9BVY1_CAPO3        0.70  0.86    1  339    3  343  344    3    8  343  E9BVY1     Heterotrimeric G protein beta subunit 1 OS=Capsaspora owczarzaki (strain ATCC 30864) GN=CAOG_00482 PE=4 SV=1
  298 : F5HC42_USTMA        0.70  0.88    7  338   16  348  334    3    3  349  F5HC42     Putative uncharacterized protein OS=Ustilago maydis (strain 521 / FGSC 9021) GN=UM00703.1 PE=4 SV=1
  299 : I2FWA1_USTH4        0.70  0.88    7  338   16  348  334    3    3  349  I2FWA1     Probable G-protein beta subunit Bpp1 OS=Ustilago hordei (strain Uh4875-4) GN=UHOR_01085 PE=4 SV=1
  300 : M9LPD3_9BASI        0.70  0.88    7  338   16  348  334    3    3  349  M9LPD3     G-protein beta subunit OS=Pseudozyma antarctica T-34 GN=PANT_9d00351 PE=4 SV=1
  301 : Q6DLY8_LENED        0.70  0.88    7  338   16  348  334    3    3  349  Q6DLY8     Guanine nucleotide binding protein beta subunit 2 OS=Lentinula edodes GN=Gbeta2 PE=2 SV=1
  302 : Q8J258_USTMD        0.70  0.88    7  338   16  348  334    3    3  349  Q8J258     G-protein beta subunit Bpp1 OS=Ustilago maydis GN=bpp1 PE=4 SV=1
  303 : A2RA66_ASPNC        0.69  0.86    1  338   11  350  341    4    4  352  A2RA66     Complex: sfaD of A. nidulans is the beta-subunit of the heterotrimeric G-protein OS=Aspergillus niger (strain CBS 513.88 / FGSC A1513) GN=An18g02090 PE=4 SV=1
  304 : A5LG07_CYPCA        0.69  0.85  341  405    2   66   65    0    0   73  A5LG07     Guanine nucleotide-binding protein subunit gamma OS=Cyprinus carpio GN=Ggamma1 PE=3 SV=1
  305 : A9QVE2_9HOMO        0.69  0.87    3  338   11  347  338    3    3  348  A9QVE2     G-protein beta subunit OS=Rhizoctonia solani PE=4 SV=1
  306 : B4HCF9_DROPE        0.69  0.77    1  339    2  278  339    3   62  278  B4HCF9     GL18448 OS=Drosophila persimilis GN=Dper\GL18448 PE=4 SV=1
  307 : B8M352_TALSN        0.69  0.86    1  338   12  353  343    5    6  361  B8M352     G protein complex beta subunit SfaD OS=Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006) GN=TSTA_092740 PE=4 SV=1
  308 : C0SBA6_PARBP        0.69  0.86    1  338    3  342  341    4    4  344  C0SBA6     Guanine nucleotide-binding protein subunit beta OS=Paracoccidioides brasiliensis (strain Pb03) GN=PABG_04961 PE=4 SV=1
  309 : C1GED5_PARBD        0.69  0.86    1  338   12  351  341    4    4  353  C1GED5     Guanine nucleotide-binding protein subunit beta OS=Paracoccidioides brasiliensis (strain Pb18) GN=PADG_05621 PE=4 SV=1
  310 : C1KIY8_ASPFM        0.69  0.86    1  338   12  351  341    4    4  353  C1KIY8     G protein beta subunit SfaD OS=Neosartorya fumigata GN=sfaD PE=2 SV=1
  311 : D5GLA9_TUBMM        0.69  0.86    3  338    8  345  339    4    4  347  D5GLA9     Whole genome shotgun sequence assembly, scaffold_67, strain Mel28 OS=Tuber melanosporum (strain Mel28) GN=GSTUM_00010108001 PE=4 SV=1
  312 : E1BZB1_CHICK        0.69  0.80  407  595   13  233  221    1   33  249  E1BZB1     Uncharacterized protein OS=Gallus gallus GN=PDC PE=4 SV=1
  313 : E6ZLC3_SPORE        0.69  0.87    3  338   12  348  338    3    3  349  E6ZLC3     G-protein beta subunit Bpp1 OS=Sporisorium reilianum (strain SRZ2) GN=Bpp1 PE=4 SV=1
  314 : E9D2J6_COCPS        0.69  0.85    1  338    8  347  341    4    4  349  E9D2J6     Guanine nucleotide-binding protein beta subunit OS=Coccidioides posadasii (strain RMSCC 757 / Silveira) GN=CPSG_03794 PE=4 SV=1
  315 : F8NEW0_SERL9        0.69  0.88    3  338   12  348  337    1    1  349  F8NEW0     Putative uncharacterized protein OS=Serpula lacrymans var. lacrymans (strain S7.9) GN=SERLADRAFT_455788 PE=4 SV=1
  316 : F8PF62_SERL3        0.69  0.88    3  338   12  348  337    1    1  349  F8PF62     Putative uncharacterized protein OS=Serpula lacrymans var. lacrymans (strain S7.3) GN=SERLA73DRAFT_174318 PE=4 SV=1
  317 : G3NSF5_GASAC        0.69  0.83  341  405    2   66   65    0    0   73  G3NSF5     Guanine nucleotide-binding protein subunit gamma OS=Gasterosteus aculeatus GN=GNGT1 PE=3 SV=1
  318 : G3VP15_SARHA        0.69  0.85  341  405    2   66   65    0    0   73  G3VP15     Guanine nucleotide-binding protein subunit gamma OS=Sarcophilus harrisii GN=GNG11 PE=3 SV=1
  319 : G3YDM4_ASPNA        0.69  0.86    1  338   11  350  341    4    4  352  G3YDM4     Guanine nucleotide-binding protein beta subunit OS=Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7) GN=gpb-1 PE=4 SV=1
  320 : H2LGY1_ORYLA        0.69  0.85  341  405    2   66   65    0    0   73  H2LGY1     Guanine nucleotide-binding protein subunit gamma OS=Oryzias latipes GN=LOC101175174 PE=3 SV=1
  321 : H6BKL5_EXODN        0.69  0.87    1  338   12  351  341    4    4  353  H6BKL5     Guanine nucleotide-binding protein subunit beta OS=Exophiala dermatitidis (strain ATCC 34100 / CBS 525.76 / NIH/UT8656) GN=HMPREF1120_00858 PE=4 SV=1
  322 : I9XMD5_COCIM        0.69  0.85    1  338    8  347  341    4    4  349  I9XMD5     Guanine nucleotide-binding protein subunit beta OS=Coccidioides immitis (strain RS) GN=CIMG_09237 PE=4 SV=1
  323 : K5WAS4_AGABU        0.69  0.86    3  338   18  356  340    5    5  357  K5WAS4     Uncharacterized protein OS=Agaricus bisporus var. burnettii (strain JB137-S8 / ATCC MYA-4627 / FGSC 10392) GN=AGABI1DRAFT_81726 PE=4 SV=1
  324 : K9HV97_AGABB        0.69  0.86    3  338   18  356  340    5    5  357  K9HV97     Guanine nucleotide binding protein beta subunit 2 OS=Agaricus bisporus var. bisporus (strain H97 / ATCC MYA-4626 / FGSC 10389) GN=AGABI2DRAFT_132917 PE=4 SV=1
  325 : K9J9M6_9EURO        0.69  0.86    1  338   12  351  341    4    4  353  K9J9M6     Heterotrimeric G-protein beta subunit OS=Monascus ruber GN=mgb1 PE=4 SV=1
  326 : M2PAK0_CERSU        0.69  0.86    1  338   11  349  340    3    3  350  M2PAK0     Heterotrimeric G-protein beta subunit OS=Ceriporiopsis subvermispora B GN=CERSUDRAFT_87872 PE=4 SV=1
  327 : O74214_EMEND        0.69  0.86    1  338   11  350  341    4    4  352  O74214     G-protein beta subunit OS=Emericella nidulans GN=sfaD PE=4 SV=1
  328 : Q0MR00_PENMA        0.69  0.86    1  338   12  351  341    4    4  353  Q0MR00     STE4-like protein OS=Penicillium marneffei PE=4 SV=1
  329 : Q2U686_ASPOR        0.69  0.86    1  338   12  351  341    4    4  353  Q2U686     G-protein beta subunit OS=Aspergillus oryzae (strain ATCC 42149 / RIB 40) GN=AO090120000339 PE=4 SV=1
  330 : Q5DPY7_PARBR        0.69  0.86    1  338   12  351  341    4    4  353  Q5DPY7     Small G-beta protein GPB OS=Paracoccidioides brasiliensis GN=gpb PE=4 SV=1
  331 : A1DDX2_NEOFI        0.68  0.85    1  337   12  351  341    5    5  386  A1DDX2     G protein complex beta subunit SfaD OS=Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / FGSC A1164 / NRRL 181) GN=NFIA_075080 PE=4 SV=1
  332 : A7IT75_MYCGR        0.68  0.86    3  338   12  349  339    4    4  350  A7IT75     G-protein beta subunit OS=Mycosphaerella graminicola GN=Gpb1 PE=4 SV=1
  333 : C5GLE5_AJEDR        0.68  0.86    1  335   12  348  338    4    4  352  C5GLE5     Small G-beta protein GPB OS=Ajellomyces dermatitidis (strain ER-3 / ATCC MYA-2586) GN=BDCG_05179 PE=4 SV=1
  334 : C5JZ36_AJEDS        0.68  0.86    1  336   12  349  339    4    4  353  C5JZ36     Small G-beta protein GPB OS=Ajellomyces dermatitidis (strain SLH14081) GN=BDBG_07809 PE=4 SV=1
  335 : C5PD88_COCP7        0.68  0.85    1  335    8  344  338    4    4  372  C5PD88     Guanine nucleotide-binding protein beta subunit, putative OS=Coccidioides posadasii (strain C735) GN=CPC735_016500 PE=4 SV=1
  336 : F0UDV1_AJEC8        0.68  0.86    1  338   12  351  341    4    4  353  F0UDV1     Small G-beta protein GPB OS=Ajellomyces capsulata (strain H88) GN=HCEG_03739 PE=4 SV=1
  337 : F2TKC5_AJEDA        0.68  0.86    1  335   12  348  338    4    4  352  F2TKC5     Guanine nucleotide-binding protein subunit beta OS=Ajellomyces dermatitidis (strain ATCC 18188 / CBS 674.68) GN=BDDG_06633 PE=4 SV=1
  338 : F6QEC0_ORNAN        0.68  0.82  407  595   16  232  217    1   29  248  F6QEC0     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus GN=PDC PE=4 SV=1
  339 : G1MR26_MELGA        0.68  0.79  415  595    1  213  213    1   33  229  G1MR26     Uncharacterized protein (Fragment) OS=Meleagris gallopavo GN=LOC100549937 PE=4 SV=2
  340 : G1WYS7_ARTOA        0.68  0.86    3  338    9  346  339    4    4  348  G1WYS7     Uncharacterized protein OS=Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491) GN=AOL_s00004g438 PE=4 SV=1
  341 : I3JXJ7_ORENI        0.68  0.83  341  405    4   68   65    0    0   75  I3JXJ7     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Oreochromis niloticus GN=LOC100711075 PE=3 SV=1
  342 : K5WPR8_PHACS        0.68  0.87    3  338   12  348  338    3    3  349  K5WPR8     Uncharacterized protein OS=Phanerochaete carnosa (strain HHB-10118-sp) GN=PHACADRAFT_248083 PE=4 SV=1
  343 : K9FN71_PEND1        0.68  0.86    1  339   11  351  342    4    4  352  K9FN71     G protein complex beta subunit SfaD OS=Penicillium digitatum (strain Pd1 / CECT 20795) GN=PDIP_59440 PE=4 SV=1
  344 : K9GR59_PEND2        0.68  0.87    1  338   11  350  341    4    4  352  K9GR59     G protein complex beta subunit SfaD OS=Penicillium digitatum (strain PHI26 / CECT 20796) GN=PDIG_24960 PE=4 SV=1
  345 : M2LTE1_9PEZI        0.68  0.86    2  338   12  350  340    4    4  351  M2LTE1     Uncharacterized protein OS=Baudoinia compniacensis UAMH 10762 GN=BAUCODRAFT_404084 PE=4 SV=1
  346 : M3XK01_LATCH        0.68  0.85  346  405    3   62   60    0    0   69  M3XK01     Guanine nucleotide-binding protein subunit gamma OS=Latimeria chalumnae GN=GNGT2 PE=3 SV=1
  347 : M3ZEP0_XIPMA        0.68  0.83  341  405    2   66   65    0    0   73  M3ZEP0     Guanine nucleotide-binding protein subunit gamma OS=Xiphophorus maculatus GN=GNGT1 PE=3 SV=1
  348 : M5G2F5_DACSP        0.68  0.87    3  338   12  349  339    4    4  350  M5G2F5     Guanine nucleotide binding protein beta subunit 2 OS=Dacryopinax sp. (strain DJM 731) GN=DACRYDRAFT_23568 PE=4 SV=1
  349 : M7BLM1_CHEMY        0.68  0.80  407  595   13  233  221    1   33  249  M7BLM1     Phosducin OS=Chelonia mydas GN=UY3_04105 PE=4 SV=1
  350 : Q4WVI4_ASPFU        0.68  0.86    1  337   12  351  341    5    5  387  Q4WVI4     G protein complex beta subunit SfaD OS=Neosartorya fumigata (strain ATCC MYA-4609 / Af293 / CBS 101355 / FGSC A1100) GN=AFUA_5G12210 PE=4 SV=1
  351 : R0L2Y6_ANAPL        0.68  0.80  414  595    1  214  214    1   33  230  R0L2Y6     Phosducin (Fragment) OS=Anas platyrhynchos GN=Anapl_16299 PE=4 SV=1
  352 : D5KX72_9PEZI        0.67  0.84    1  339   16  358  344    6    6  359  D5KX72     Heterotrimeric G-protein beta subunit OS=Colletotrichum hanaui GN=gb PE=4 SV=1
  353 : F6Z6E3_MONDO        0.67  0.86  348  405    9   66   58    0    0   73  F6Z6E3     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Monodelphis domestica GN=GNGT2 PE=3 SV=1
  354 : G2Y017_BOTF4        0.67  0.85    1  339   15  357  344    6    6  358  G2Y017     BcGB1, heterotrimeric Gbeta subunit OS=Botryotinia fuckeliana (strain T4) GN=BofuT4_P043580.1 PE=4 SV=1
  355 : G4T932_PIRID        0.67  0.86    3  338   10  348  340    4    5  349  G4T932     Related to G-protein beta subunit Bpp1 OS=Piriformospora indica (strain DSM 11827) GN=PIIN_01639 PE=4 SV=1
  356 : H1V5H0_COLHI        0.67  0.84    1  339   16  358  344    6    6  359  H1V5H0     Guanine nucleotide-binding protein subunit beta OS=Colletotrichum higginsianum (strain IMI 349063) GN=CH063_07252 PE=4 SV=1
  357 : I2DB61_VERDA        0.67  0.84    1  339   16  358  344    6    6  359  I2DB61     G protein beta subunit OS=Verticillium dahliae PE=4 SV=1
  358 : K7G053_PELSI        0.67  0.80  407  595   13  233  221    1   33  249  K7G053     Uncharacterized protein OS=Pelodiscus sinensis GN=PDC PE=4 SV=1
  359 : L5JRT2_PTEAL        0.67  0.83  346  405    3   62   60    0    0   69  L5JRT2     Guanine nucleotide-binding protein subunit gamma OS=Pteropus alecto GN=PAL_GLEAN10019697 PE=3 SV=1
  360 : M3ANL2_9PEZI        0.67  0.86    2  339   12  351  341    4    4  351  M3ANL2     G-protein beta subunit-like protein OS=Pseudocercospora fijiensis CIRAD86 GN=MYCFIDRAFT_88295 PE=4 SV=1
  361 : M3B5Z1_9PEZI        0.67  0.86    1  338   10  349  341    4    4  350  M3B5Z1     G-protein beta subunit OS=Mycosphaerella populorum SO2202 GN=SEPMUDRAFT_147166 PE=4 SV=1
  362 : Q589C5_BOTFU        0.67  0.85    1  339   15  357  344    6    6  358  Q589C5     G protein beta subunit OS=Botryotinia fuckeliana GN=bcgb1 PE=4 SV=1
  363 : R0JH78_ANAPL        0.67  0.85  346  405    3   62   60    0    0   69  R0JH78     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2 (Fragment) OS=Anas platyrhynchos GN=Anapl_09417 PE=4 SV=1
  364 : B2AWB2_PODAN        0.66  0.83    1  339   16  358  344    6    6  359  B2AWB2     Predicted CDS Pa_7_6570 OS=Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383) PE=4 SV=1
  365 : C7BUC6_ACRCH        0.66  0.85    1  339   16  358  344    6    6  359  C7BUC6     G protein beta subunit (Fragment) OS=Acremonium chrysogenum GN=ste4 PE=2 SV=1
  366 : C7Z9G2_NECH7        0.66  0.84    1  339   16  358  344    6    6  359  C7Z9G2     Predicted protein OS=Nectria haematococca (strain 77-13-4 / ATCC MYA-4622 / FGSC 9596 / MPVI) GN=NECHADRAFT_104764 PE=4 SV=1
  367 : D2X9U9_9HYPO        0.66  0.85    1  339   16  358  344    6    6  359  D2X9U9     GTP binding protein beta subunit OS=Villosiclava virens PE=2 SV=1
  368 : E2DI35_9HYPO        0.66  0.85    1  339   16  358  344    6    6  359  E2DI35     GTP binding protein beta subunit OS=Villosiclava virens GN=UVGbeta-1 PE=4 SV=1
  369 : E3S4F0_PYRTT        0.66  0.86    2  339    9  348  341    4    4  348  E3S4F0     Putative uncharacterized protein OS=Pyrenophora teres f. teres (strain 0-1) GN=PTT_17426 PE=4 SV=1
  370 : E4ZZ68_LEPMJ        0.66  0.85    2  339   12  351  341    4    4  351  E4ZZ68     Similar to guanine nucleotide-binding protein subunit beta 1 OS=Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8) GN=LEMA_P109280.1 PE=4 SV=1
  371 : F4Q875_DICFS        0.66  0.84    1  339    7  347  341    2    2  347  F4Q875     G protein b-subunit OS=Dictyostelium fasciculatum (strain SH3) GN=gpbA PE=4 SV=1
  372 : F9G7T7_FUSOF        0.66  0.84    1  339   16  358  344    6    6  359  F9G7T7     Uncharacterized protein OS=Fusarium oxysporum (strain Fo5176) GN=FOXB_14719 PE=4 SV=1
  373 : G9N0B3_HYPVG        0.66  0.85    1  339   15  357  344    6    6  358  G9N0B3     Heterotrimeric G-protein beta subunit OS=Hypocrea virens (strain Gv29-8 / FGSC 10586) GN=TRIVIDRAFT_89725 PE=4 SV=1
  374 : GBB_DICDI           0.66  0.84    1  339    7  347  341    2    2  347  P36408     Guanine nucleotide-binding protein subunit beta OS=Dictyostelium discoideum GN=gpbA PE=1 SV=1
  375 : H9G510_ANOCA        0.66  0.80  410  595   17  235  219    1   34  251  H9G510     Uncharacterized protein OS=Anolis carolinensis GN=LOC100560523 PE=4 SV=1
  376 : I1RJS2_GIBZE        0.66  0.84    1  339   16  358  344    6    6  359  I1RJS2     Uncharacterized protein OS=Gibberella zeae (strain PH-1 / ATCC MYA-4620 / FGSC 9075 / NRRL 31084) GN=FGSG_04104 PE=4 SV=1
  377 : I3W950_COCLU        0.66  0.85    2  339   12  351  341    4    4  351  I3W950     G-protein beta subunit Clgb1 OS=Cochliobolus lunatus GN=gb1 PE=2 SV=1
  378 : J3NID2_GAGT3        0.66  0.84    1  339   16  358  344    6    6  359  J3NID2     Guanine nucleotide-binding protein subunit beta OS=Gaeumannomyces graminis var. tritici (strain R3-111a-1) GN=GGTG_01014 PE=4 SV=1
  379 : J4KPB5_BEAB2        0.66  0.85    1  339   16  358  344    6    6  359  J4KPB5     Heterotrimeric G protein beta subunit OS=Beauveria bassiana (strain ARSEF 2860) GN=BBA_03738 PE=4 SV=1
  380 : J9N8L9_FUSO4        0.66  0.84    1  339   16  358  344    6    6  359  J9N8L9     Uncharacterized protein OS=Fusarium oxysporum f. sp. lycopersici (strain 4287 / CBS 123668 / FGSC 9935 / NRRL 34936) GN=FOXG_11532 PE=4 SV=1
  381 : K3W3M7_FUSPC        0.66  0.84    1  339   16  358  344    6    6  359  K3W3M7     Uncharacterized protein OS=Fusarium pseudograminearum (strain CS3096) GN=FPSE_00124 PE=4 SV=1
  382 : L7JET8_MAGOR        0.66  0.84    1  339   16  358  344    6    6  359  L7JET8     Guanine nucleotide-binding protein subunit beta OS=Magnaporthe oryzae P131 GN=OOW_P131scaffold00432g10 PE=4 SV=1
  383 : L8HRZ8_BOSMU        0.66  0.82  341  405    2   62   65    1    4   69  L8HRZ8     Guanine nucleotide-binding protein subunit gamma OS=Bos grunniens mutus GN=M91_14200 PE=3 SV=1
  384 : M2SCA6_COCSA        0.66  0.85    2  339   12  351  341    4    4  351  M2SCA6     Uncharacterized protein OS=Bipolaris sorokiniana ND90Pr GN=COCSADRAFT_316295 PE=4 SV=1
  385 : M4G613_MAGP6        0.66  0.84    1  339   61  403  344    6    6  404  M4G613     Uncharacterized protein OS=Magnaporthe poae (strain ATCC 64411 / 73-15) PE=4 SV=1
  386 : M7S9Y1_9PEZI        0.66  0.84    1  339   16  358  344    6    6  359  M7S9Y1     Putative guanine nucleotide-binding protein subunit beta protein OS=Eutypa lata UCREL1 GN=UCREL1_10090 PE=4 SV=1
  387 : N1J5P9_ERYGR        0.66  0.84    1  337   12  354  344    7    8  361  N1J5P9     G-protein beta subunit OS=Blumeria graminis f. sp. hordei DH14 GN=BGHDH14_bgh01001 PE=4 SV=1
  388 : N4VER5_COLOR        0.66  0.84    1  339   16  358  344    6    6  359  N4VER5     Guanine nucleotide-binding protein beta subunit OS=Colletotrichum orbiculare (strain 104-T / ATCC 96160 / CBS 514.97 / LARS 414 / MAFF 240422) GN=Cob_05358 PE=4 SV=1
  389 : N4XAZ2_COCHE        0.66  0.85    2  339   12  351  341    4    4  351  N4XAZ2     Uncharacterized protein OS=Bipolaris maydis ATCC 48331 GN=COCC4DRAFT_26104 PE=4 SV=1
  390 : O93887_CRYNE        0.66  0.86    1  339    6  352  347    1    8  352  O93887     G-protein beta subunit GPB1 OS=Cryptococcus neoformans var. neoformans GN=gpb1 PE=4 SV=1
  391 : Q1JUK2_GIBSA        0.66  0.84    1  339   16  358  344    6    6  359  Q1JUK2     G-protein beta-subunit OS=Gibberella sacchari GN=gpb1 PE=4 SV=1
  392 : Q1PBD2_GIBMO        0.66  0.84    1  339   16  358  344    6    6  359  Q1PBD2     Heterotrimeric G protein beta subunit OS=Gibberella moniliformis GN=GBB1 PE=4 SV=1
  393 : Q6XSF5_COCHE        0.66  0.85    2  339   12  351  341    4    4  351  Q6XSF5     G-protein beta subunit Cgb1 OS=Cochliobolus heterostrophus PE=4 SV=1
  394 : Q8NK86_MAGGR        0.66  0.84    1  339   16  358  344    6    6  359  Q8NK86     Heterotrimeric G-protein beta subunit OS=Magnaporthe grisea GN=Mgb1 PE=4 SV=1
  395 : Q8TFC0_SPOSC        0.66  0.84    1  339   16  358  344    6    6  359  Q8TFC0     G-protein beta subunit OS=Sporothrix schenckii GN=gb-1 PE=2 SV=1
  396 : Q96VA6_FUSOX        0.66  0.84    1  339   16  358  344    6    6  359  Q96VA6     Guanine nucleotide-binding protein beta subunit (Fragment) OS=Fusarium oxysporum GN=fgb1 PE=4 SV=1
  397 : R0KDM4_SETTU        0.66  0.85    2  339   12  351  341    4    4  351  R0KDM4     Uncharacterized protein OS=Setosphaeria turcica Et28A GN=SETTUDRAFT_154137 PE=4 SV=1
  398 : R4GL61_CHICK        0.66  0.85  347  405    6   64   59    0    0   71  R4GL61     Uncharacterized protein (Fragment) OS=Gallus gallus GN=LOC100859179 PE=4 SV=1
  399 : R8BCT8_9PEZI        0.66  0.84    1  339   19  361  344    6    6  362  R8BCT8     Putative guanine nucleotide-binding protein subunit beta protein OS=Togninia minima UCRPA7 GN=UCRPA7_7393 PE=4 SV=1
  400 : A2A614_MOUSE        0.65  0.83  346  405    3   62   60    0    0   69  A2A614     Guanine nucleotide-binding protein subunit gamma OS=Mus musculus GN=Gngt2 PE=3 SV=1
  401 : D3ZLD6_RAT          0.65  0.82  346  405    3   62   60    0    0   69  D3ZLD6     Guanine nucleotide-binding protein subunit gamma OS=Rattus norvegicus GN=Gngt2 PE=3 SV=1
  402 : F5HH30_NEUCR        0.65  0.84    1  339   15  357  344    6    6  358  F5HH30     Guanine nucleotide-binding protein beta subunit OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=NCU00440 PE=4 SV=1
  403 : F6UVS8_CALJA        0.65  0.85  346  405    3   62   60    0    0   69  F6UVS8     Guanine nucleotide-binding protein subunit gamma OS=Callithrix jacchus GN=GNGT2 PE=3 SV=1
  404 : F6W0I2_XENTR        0.65  0.85  346  405    3   62   60    0    0   69  F6W0I2     Guanine nucleotide-binding protein subunit gamma OS=Xenopus tropicalis GN=gngt2.1 PE=3 SV=1
  405 : F7VS43_SORMK        0.65  0.84    1  339   15  357  344    6    6  358  F7VS43     WGS project CABT00000000 data, contig 2.5 OS=Sordaria macrospora (strain ATCC MYA-333 / DSM 997 / K(L3346) / K-hell) GN=SMAC_01876 PE=4 SV=1
  406 : F8MJW5_NEUT8        0.65  0.84    1  339   15  357  344    6    6  358  F8MJW5     Putative uncharacterized protein OS=Neurospora tetrasperma (strain FGSC 2508 / ATCC MYA-4615 / P0657) GN=NEUTE1DRAFT_117080 PE=4 SV=1
  407 : G0S6L1_CHATD        0.65  0.84    1  339   16  358  344    6    6  359  G0S6L1     G protein beta subunit-like protein OS=Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719) GN=CTHT_0026600 PE=4 SV=1
  408 : G1KY89_ANOCA        0.65  0.83  346  405    3   62   60    0    0   69  G1KY89     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis GN=LOC100563737 PE=3 SV=1
  409 : G2R9Y7_THITE        0.65  0.83    1  339   16  358  344    6    6  359  G2R9Y7     Putative uncharacterized protein OS=Thielavia terrestris (strain ATCC 38088 / NRRL 8126) GN=THITE_2118396 PE=4 SV=1
  410 : G4N528_MAGO7        0.65  0.84    1  339    3  345  344    6    6  346  G4N528     Guanine nucleotide-binding protein subunit beta OS=Magnaporthe oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) GN=MGG_05201 PE=4 SV=1
  411 : GBGT2_BOVIN         0.65  0.83  346  405    3   62   60    0    0   69  P50154     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2 OS=Bos taurus GN=GNGT2 PE=3 SV=1
  412 : GBGT2_CANFA         0.65  0.83  346  405    3   62   60    0    0   69  O97564     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2 OS=Canis familiaris GN=GNGT2 PE=3 SV=1
  413 : GBGT2_MOUSE         0.65  0.83  346  405    3   62   60    0    0   69  Q61017     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2 OS=Mus musculus GN=Gngt2 PE=2 SV=2
  414 : L8IWF0_BOSMU        0.65  0.83  346  405    3   62   60    0    0   69  L8IWF0     Guanine nucleotide-binding protein subunit gamma OS=Bos grunniens mutus GN=M91_15619 PE=3 SV=1
  415 : Q1LXL0_DANRE        0.65  0.85  341  405    5   69   65    0    0   76  Q1LXL0     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=gngt1 PE=2 SV=1
  416 : Q2H9J0_CHAGB        0.65  0.83    1  339    3  345  344    6    6  346  Q2H9J0     Guanine nucleotide-binding protein beta subunit OS=Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970) GN=CHGG_03114 PE=4 SV=1
  417 : Q6PBN9_DANRE        0.65  0.85  341  405    2   66   65    0    0   73  Q6PBN9     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=gngt1 PE=3 SV=1
  418 : Q8NJW7_NEUCS        0.65  0.84    1  339   15  357  344    6    6  358  Q8NJW7     G-protein beta subunit OS=Neurospora crassa GN=gnb-1 PE=4 SV=1
  419 : H0YZ54_TAEGU        0.64  0.78  407  595   13  238  226    2   38  253  H0YZ54     Uncharacterized protein OS=Taeniopygia guttata GN=PDC PE=4 SV=1
  420 : D6RDH5_HUMAN        0.63  0.85  346  405    3   62   60    0    0   88  D6RDH5     Guanine nucleotide-binding protein subunit gamma OS=Homo sapiens GN=GNGT2 PE=2 SV=1
  421 : F6PKY3_MACMU        0.63  0.85  346  405    3   62   60    0    0   69  F6PKY3     Guanine nucleotide-binding protein subunit gamma OS=Macaca mulatta GN=GNGT2 PE=3 SV=1
  422 : F6SAR2_XENTR        0.63  0.77  413  595    1  214  215    2   34  229  F6SAR2     Uncharacterized protein (Fragment) OS=Xenopus tropicalis GN=pdc PE=4 SV=1
  423 : G1QRI6_NOMLE        0.63  0.85  346  405    3   62   60    0    0   69  G1QRI6     Guanine nucleotide-binding protein subunit gamma OS=Nomascus leucogenys GN=LOC100585001 PE=3 SV=1
  424 : G3QHT5_GORGO        0.63  0.85  346  405    3   62   60    0    0   69  G3QHT5     Guanine nucleotide-binding protein subunit gamma OS=Gorilla gorilla gorilla GN=GNGT2 PE=3 SV=1
  425 : G3U3B8_LOXAF        0.63  0.83  346  405    3   62   60    0    0   69  G3U3B8     Guanine nucleotide-binding protein subunit gamma OS=Loxodonta africana GN=LOC100674922 PE=3 SV=1
  426 : G8F5B1_MACFA        0.63  0.85  346  405    3   62   60    0    0   69  G8F5B1     Guanine nucleotide-binding protein subunit gamma OS=Macaca fascicularis GN=EGM_20808 PE=3 SV=1
  427 : GBGT2_HUMAN         0.63  0.85  346  405    3   62   60    0    0   69  O14610     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2 OS=Homo sapiens GN=GNGT2 PE=2 SV=1
  428 : H2NVK3_PONAB        0.63  0.85  346  405    3   62   60    0    0   69  H2NVK3     Guanine nucleotide-binding protein subunit gamma OS=Pongo abelii GN=GNGT2 PE=3 SV=1
  429 : H2QDC9_PANTR        0.63  0.85  346  405    3   62   60    0    0   69  H2QDC9     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNGT2 PE=3 SV=1
  430 : H2RGV2_PANTR        0.63  0.85  346  405    3   62   60    0    0   88  H2RGV2     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNGT2 PE=3 SV=1
  431 : H2ZC26_CIOSA        0.63  0.77    2  339    3  293  341    6   53  293  H2ZC26     Uncharacterized protein (Fragment) OS=Ciona savignyi GN=Csa.10536 PE=4 SV=1
  432 : H3B8F3_LATCH        0.63  0.76  407  595   22  241  221    2   34  258  H3B8F3     Uncharacterized protein (Fragment) OS=Latimeria chalumnae PE=4 SV=1
  433 : K7FAR0_PELSI        0.63  0.85  346  405    3   62   60    0    0   69  K7FAR0     Guanine nucleotide-binding protein subunit gamma OS=Pelodiscus sinensis GN=GNGT2 PE=3 SV=1
  434 : Q6P025_DANRE        0.63  0.83    1  339    2  338  340    2    4  338  Q6P025     Gnb3 protein OS=Danio rerio GN=gnb3b PE=2 SV=1
  435 : Q6P8Y9_MOUSE        0.63  0.83  346  405    3   62   60    0    0   69  Q6P8Y9     Guanine nucleotide-binding protein subunit gamma OS=Mus musculus GN=Gngt2 PE=3 SV=1
  436 : D2H579_AILME        0.62  0.82  346  405    3   62   60    0    0   69  D2H579     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=GNGT2 PE=3 SV=1
  437 : F6UD42_HORSE        0.62  0.83  346  405    3   62   60    0    0   69  F6UD42     Guanine nucleotide-binding protein subunit gamma OS=Equus caballus GN=GNGT2 PE=3 SV=1
  438 : I1BGL2_RHIO9        0.62  0.86    1  339    9  348  342    5    5  348  I1BGL2     Uncharacterized protein OS=Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880) GN=RO3G_00046 PE=4 SV=1
  439 : I3JIV6_ORENI        0.62  0.83    1  339    6  342  340    3    4  342  I3JIV6     Uncharacterized protein OS=Oreochromis niloticus GN=GNB3 (2 of 2) PE=4 SV=1
  440 : Q800J3_9SAUR        0.62  0.76  410  594   17  232  218    2   36  249  Q800J3     Phosducin OS=Phelsuma sundbergi longinsulae GN=PmlPD PE=2 SV=1
  441 : C7E3P4_RHIST        0.61  0.85    1  339    9  348  342    5    5  348  C7E3P4     G-protein beta subunit OS=Rhizopus stolonifer GN=GPB1 PE=2 SV=1
  442 : F1R9S7_DANRE        0.61  0.78  410  595   20  230  213    2   30  245  F1R9S7     Uncharacterized protein (Fragment) OS=Danio rerio GN=pdca PE=2 SV=1
  443 : F8W512_DANRE        0.61  0.78  411  595   12  221  212    2   30  236  F8W512     Uncharacterized protein OS=Danio rerio GN=pdca PE=2 SV=1
  444 : G1TBE3_RABIT        0.61  0.83  347  405    8   66   59    0    0   73  G1TBE3     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Oryctolagus cuniculus GN=LOC100349601 PE=3 SV=1
  445 : H2RK05_TAKRU        0.61  0.84    1  339    6  342  340    3    4  342  H2RK05     Uncharacterized protein OS=Takifugu rubripes GN=GNB3 (2 of 2) PE=4 SV=1
  446 : M3ZG63_XIPMA        0.61  0.84    1  339    6  342  340    3    4  342  M3ZG63     Uncharacterized protein OS=Xiphophorus maculatus GN=GNB3 (2 of 2) PE=4 SV=1
  447 : Q8QGW8_ORYLA        0.61  0.84    1  339    6  342  340    3    4  342  Q8QGW8     Guanine nucleotide-binding protein beta subunit OS=Oryzias latipes GN=Ol-Gb PE=2 SV=1
  448 : R1DNM9_EMIHU        0.61  0.79    8  339    7  344  341    7   12  344  R1DNM9     GPB1, beta subunit of a heterotrimeric G-protein OS=Emiliania huxleyi CCMP1516 GN=GPB1-1 PE=4 SV=1
  449 : G3HJN8_CRIGR        0.60  0.82  346  405    3   62   60    0    0   69  G3HJN8     Guanine nucleotide-binding protein subunit gamma OS=Cricetulus griseus GN=I79_010887 PE=3 SV=1
  450 : H3CEN7_TETNG        0.60  0.82    1  339    6  338  340    4    8  338  H3CEN7     Uncharacterized protein OS=Tetraodon nigroviridis GN=GNB3 (2 of 2) PE=4 SV=1
  451 : I3JY64_ORENI        0.60  0.77  408  595   16  225  212    2   27  241  I3JY64     Uncharacterized protein (Fragment) OS=Oreochromis niloticus GN=PDC (1 of 2) PE=4 SV=1
  452 : I3MA43_SPETR        0.60  0.85  346  405    3   62   60    0    0   69  I3MA43     Guanine nucleotide-binding protein subunit gamma OS=Spermophilus tridecemlineatus GN=GNGT2 PE=3 SV=1
  453 : L8YBJ9_TUPCH        0.60  0.83  346  405    3   62   60    0    0   69  L8YBJ9     Guanine nucleotide-binding protein subunit gamma OS=Tupaia chinensis GN=TREES_T100015363 PE=3 SV=1
  454 : M3VU45_FELCA        0.60  0.83  346  405    3   62   60    0    0   69  M3VU45     Guanine nucleotide-binding protein subunit gamma OS=Felis catus GN=GNGT2 PE=3 SV=1
  455 : Q90WW8_DANRE        0.60  0.78  346  405    3   62   60    0    0   69  Q90WW8     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Danio rerio GN=gngt2a PE=2 SV=1
  456 : A5LG08_CYPCA        0.59  0.76  347  405    4   62   59    0    0   69  A5LG08     Guanine nucleotide-binding protein subunit gamma OS=Cyprinus carpio GN=Ggamma8 PE=3 SV=1
  457 : A9V8R6_MONBE        0.59  0.80    3  339    1  338  343    4   11  339  A9V8R6     Predicted protein OS=Monosiga brevicollis GN=38561 PE=4 SV=1
  458 : E7F1F5_DANRE        0.59  0.75  347  405    4   62   59    0    0   69  E7F1F5     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=gngt2b PE=3 SV=1
  459 : G1PLP0_MYOLU        0.59  0.80  350  405    1   56   56    0    0   63  G1PLP0     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Myotis lucifugus PE=3 SV=1
  460 : H2LPQ8_ORYLA        0.59  0.81    1  339    6  349  347    4   11  349  H2LPQ8     Uncharacterized protein OS=Oryzias latipes GN=ol-gb PE=4 SV=1
  461 : H2M0A9_ORYLA        0.59  0.74  407  595   14  228  217    2   31  242  H2M0A9     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC100422798 PE=4 SV=1
  462 : Q6PBR4_DANRE        0.59  0.78  347  405    4   62   59    0    0   69  Q6PBR4     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=gngt2a PE=3 SV=1
  463 : Q9W613_ORYLA        0.59  0.74  407  595    8  222  217    2   31  236  Q9W613     Cone type phosducin OS=Oryzias latipes GN=OlPD-C PE=2 SV=1
  464 : A4IHM2_XENTR        0.58  0.78  346  405    3   62   60    0    0   69  A4IHM2     Guanine nucleotide-binding protein subunit gamma OS=Xenopus tropicalis GN=gngt2 PE=3 SV=1
  465 : H2MFP6_ORYLA        0.58  0.77  408  595   34  243  212    2   27  259  H2MFP6     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC100422797 PE=4 SV=1
  466 : I3JUQ9_ORENI        0.58  0.74  407  595    8  222  217    2   31  236  I3JUQ9     Uncharacterized protein OS=Oreochromis niloticus GN=PDC (2 of 2) PE=4 SV=1
  467 : I3JUR0_ORENI        0.58  0.74  407  595   32  246  217    2   31  260  I3JUR0     Uncharacterized protein (Fragment) OS=Oreochromis niloticus GN=PDC (2 of 2) PE=4 SV=1
  468 : M4AWG6_XIPMA        0.58  0.77  408  595    9  218  212    2   27  234  M4AWG6     Uncharacterized protein OS=Xiphophorus maculatus GN=PDC (1 of 2) PE=4 SV=1
  469 : Q3B734_DANRE        0.58  0.74  408  595    8  222  218    5   34  236  Q3B734     Pdc2 protein OS=Danio rerio GN=pdcb PE=2 SV=1
  470 : Q9W612_ORYLA        0.58  0.77  408  595   10  219  212    2   27  235  Q9W612     Rod type phosducin OS=Oryzias latipes GN=OlPD-R PE=2 SV=1
  471 : G3NX02_GASAC        0.57  0.72  407  595    8  222  217    2   31  236  G3NX02     Uncharacterized protein OS=Gasterosteus aculeatus GN=PDC (2 of 2) PE=4 SV=1
  472 : G3NX13_GASAC        0.57  0.72  407  595   26  240  217    2   31  254  G3NX13     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus GN=PDC (2 of 2) PE=4 SV=1
  473 : H2SBF8_TAKRU        0.57  0.74  415  595   22  228  209    2   31  241  H2SBF8     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101064599 PE=4 SV=1
  474 : H3DL91_TETNG        0.57  0.74  407  595   12  226  217    2   31  239  H3DL91     Uncharacterized protein (Fragment) OS=Tetraodon nigroviridis GN=PDC PE=4 SV=1
  475 : M3ZJP6_XIPMA        0.57  0.73  407  595    8  222  217    2   31  236  M3ZJP6     Uncharacterized protein OS=Xiphophorus maculatus GN=PDC (2 of 2) PE=4 SV=1
  476 : Q4RJ15_TETNG        0.57  0.74  407  595    8  222  217    2   31  235  Q4RJ15     Chromosome 1 SCAF15039, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00033630001 PE=4 SV=1
  477 : G3PP72_GASAC        0.56  0.75  408  595   14  223  212    2   27  238  G3PP72     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus GN=PDC (1 of 2) PE=4 SV=1
  478 : G3PP75_GASAC        0.56  0.75  408  595   16  225  212    2   27  240  G3PP75     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus GN=PDC (1 of 2) PE=4 SV=1
  479 : G4ZLJ4_PHYSP        0.56  0.76    1  339    2  344  346    8   10  344  G4ZLJ4     G-protein beta subunit OS=Phytophthora sojae (strain P6497) GN=PHYSODRAFT_301543 PE=4 SV=1
  480 : H2SBF7_TAKRU        0.56  0.74  407  595   31  245  217    2   31  258  H2SBF7     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101064599 PE=4 SV=1
  481 : M4BG03_HYAAE        0.56  0.73   11  339   12  344  344    9   26  344  M4BG03     Uncharacterized protein OS=Hyaloperonospora arabidopsidis (strain Emoy2) PE=4 SV=1
  482 : Q6P968_DANRE        0.56  0.71  410  595   21  231  219    2   42  246  Q6P968     Pdc1 protein (Fragment) OS=Danio rerio GN=pdca PE=2 SV=1
  483 : Q8RYB2_PHYIN        0.56  0.77    1  339    2  344  345    6    8  344  Q8RYB2     G-protein beta subunit 1 OS=Phytophthora infestans GN=gpb1 PE=2 SV=1
  484 : C4LZ87_ENTHI        0.55  0.76    1  339    7  350  345    4    7  351  C4LZ87     Guanine nucleotide-binding protein subunit beta, putative OS=Entamoeba histolytica GN=EHI_000240 PE=4 SV=1
  485 : D7G2C0_ECTSI        0.55  0.76    1  339    6  349  350   10   17  349  D7G2C0     Putative uncharacterized protein OS=Ectocarpus siliculosus GN=Esi_0047_0112 PE=4 SV=1
  486 : J3Q3K4_PUCT1        0.55  0.70    1  339    7  309  346    4   50  309  J3Q3K4     Uncharacterized protein OS=Puccinia triticina (isolate 1-1 / race 1 (BBBD)) GN=PTTG_05970 PE=4 SV=1
  487 : M3TH24_ENTHI        0.55  0.76    1  339    7  350  345    4    7  351  M3TH24     Guanine nucleotide-binding protein subunit beta-1, putative OS=Entamoeba histolytica HM-1:IMSS-B GN=EHI8A_208630 PE=4 SV=1
  488 : M7WEX2_ENTHI        0.55  0.76    1  339    7  350  345    4    7  351  M7WEX2     Guanine nucleotide-binding protein subunit beta, putative OS=Entamoeba histolytica HM-3:IMSS GN=KM1_259140 PE=4 SV=1
  489 : N9TLZ3_ENTHI        0.55  0.76    1  339    7  350  345    4    7  351  N9TLZ3     Guanine nucleotide-binding protein subunit beta, putative OS=Entamoeba histolytica HM-1:IMSS-A GN=EHI7A_180300 PE=4 SV=1
  490 : F0WM30_9STRA        0.54  0.75    1  339    2  344  354    9   26  344  F0WM30     G protein beta subunit 1 putative OS=Albugo laibachii Nc14 GN=AlNc14C151G7541 PE=4 SV=1
  491 : G5C4N7_HETGA        0.53  0.80  346  405    3   62   60    0    0   69  G5C4N7     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_21755 PE=3 SV=1
  492 : H0WB58_CAVPO        0.53  0.82  346  405    3   62   60    0    0   69  H0WB58     Guanine nucleotide-binding protein subunit gamma OS=Cavia porcellus GN=LOC100714012 PE=3 SV=1
  493 : H2SZY7_TAKRU        0.53  0.74  347  404    4   61   58    0    0   70  H2SZY7     Guanine nucleotide-binding protein subunit gamma OS=Takifugu rubripes GN=LOC101062666 PE=3 SV=1
  494 : Q4RYG1_TETNG        0.53  0.78  347  404    4   61   58    0    0   70  Q4RYG1     Guanine nucleotide-binding protein subunit gamma OS=Tetraodon nigroviridis GN=GNGT2 PE=3 SV=1
  495 : Q568T1_DANRE        0.53  0.68  408  595   31  246  223    3   43  260  Q568T1     Pdc2 protein (Fragment) OS=Danio rerio GN=pdcb PE=2 SV=1
  496 : Q5RI07_DANRE        0.53  0.68  408  595    8  223  223    3   43  237  Q5RI07     Uncharacterized protein OS=Danio rerio GN=pdcb PE=2 SV=1
  497 : Q6DH10_DANRE        0.53  0.68  408  595   32  247  223    3   43  261  Q6DH10     Pdc2 protein (Fragment) OS=Danio rerio GN=pdcb PE=2 SV=1
  498 : K7BUT9_PANTR        0.52  0.72    1  339   10  353  345    6    7  353  K7BUT9     Guanine nucleotide binding protein (G protein), beta 5 OS=Pan troglodytes GN=GNB5 PE=2 SV=1
  499 : M4AT17_XIPMA        0.52  0.74  347  404    4   61   58    0    0   70  M4AT17     Guanine nucleotide-binding protein subunit gamma OS=Xiphophorus maculatus GN=GNGT2 PE=3 SV=1
  500 : F1RZC0_PIG          0.51  0.72    1  339   52  396  346    6    8  396  F1RZC0     Uncharacterized protein OS=Sus scrofa GN=LOC100157949 PE=2 SV=2
  501 : D2VSA6_NAEGR        0.50  0.72    3  339   10  356  349    7   14  356  D2VSA6     WD-40 repeat-containing protein OS=Naegleria gruberi GN=NAEGRDRAFT_81051 PE=4 SV=1
  502 : F0YMF2_AURAN        0.50  0.71    1  338    5  347  357   10   33  348  F0YMF2     Putative uncharacterized protein OS=Aureococcus anophagefferens GN=AURANDRAFT_55469 PE=4 SV=1
  503 : F0YL34_AURAN        0.48  0.71    2  339    6  346  355    9   31  346  F0YL34     Putative uncharacterized protein OS=Aureococcus anophagefferens GN=AURANDRAFT_70408 PE=4 SV=1
  504 : G3NGK1_GASAC        0.48  0.72  347  404    4   61   58    0    0   70  G3NGK1     Guanine nucleotide-binding protein subunit gamma OS=Gasterosteus aculeatus GN=GNGT2 PE=3 SV=1
  505 : H3CXB8_TETNG        0.48  0.68  356  405   17   66   50    0    0   74  H3CXB8     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Tetraodon nigroviridis GN=GNG8 PE=3 SV=1
  506 : J9NXA2_CANFA        0.48  0.70  408  595   51  277  227    3   40  301  J9NXA2     Uncharacterized protein OS=Canis familiaris GN=PDCL PE=4 SV=1
  507 : L5K9I4_PTEAL        0.48  0.70  408  595   51  277  227    3   40  301  L5K9I4     Phosducin-like protein OS=Pteropus alecto GN=PAL_GLEAN10012397 PE=4 SV=1
  508 : M3X7C8_FELCA        0.48  0.70  408  595   51  277  227    3   40  301  M3X7C8     Uncharacterized protein OS=Felis catus GN=PDCL PE=4 SV=1
  509 : B5XA04_SALSA        0.47  0.72  347  404    4   61   58    0    0   70  B5XA04     Guanine nucleotide-binding protein subunit gamma OS=Salmo salar GN=GBGT2 PE=3 SV=1
  510 : F6TFS0_HORSE        0.47  0.70  408  595   12  238  227    3   40  262  F6TFS0     Uncharacterized protein (Fragment) OS=Equus caballus GN=PDCL PE=4 SV=1
  511 : F7BIF8_CALJA        0.47  0.70  408  595   51  277  227    3   40  301  F7BIF8     Uncharacterized protein OS=Callithrix jacchus GN=PDCL PE=4 SV=1
  512 : G3T8F8_LOXAF        0.47  0.70  408  595   51  277  227    3   40  301  G3T8F8     Uncharacterized protein OS=Loxodonta africana GN=LOC100669933 PE=4 SV=1
  513 : G5B6X7_HETGA        0.47  0.70  408  595   51  277  227    3   40  301  G5B6X7     Phosducin-like protein OS=Heterocephalus glaber GN=GW7_01156 PE=4 SV=1
  514 : H0X5R0_OTOGA        0.47  0.70  408  595   51  277  227    3   40  301  H0X5R0     Uncharacterized protein OS=Otolemur garnettii GN=PDCL PE=4 SV=1
  515 : H2V2V0_TAKRU        0.47  0.69  355  405   14   64   51    0    0   72  H2V2V0     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Takifugu rubripes GN=LOC101073162 PE=3 SV=1
  516 : H3AJE3_LATCH        0.47  0.65  355  405   16   66   51    0    0   74  H3AJE3     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Latimeria chalumnae PE=3 SV=1
  517 : K9IIZ7_DESRO        0.47  0.70  408  595   51  277  227    3   40  301  K9IIZ7     Putative conserved phosducin-like protein OS=Desmodus rotundus PE=2 SV=1
  518 : M3YRT2_MUSPF        0.47  0.70  408  595   51  277  227    3   40  301  M3YRT2     Uncharacterized protein OS=Mustela putorius furo GN=PDCL PE=4 SV=1
  519 : D2I6X7_AILME        0.46  0.70  408  595   51  277  227    3   40  301  D2I6X7     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PDCL PE=4 SV=1
  520 : E1BQM7_CHICK        0.46  0.70  408  595   50  276  227    3   40  300  E1BQM7     Uncharacterized protein OS=Gallus gallus GN=PDCL PE=4 SV=1
  521 : F7F3M0_MACMU        0.46  0.70  408  595   51  277  227    3   40  301  F7F3M0     Phosducin-like protein OS=Macaca mulatta GN=PDCL PE=2 SV=1
  522 : G1N7F4_MELGA        0.46  0.70  408  595   50  276  227    3   40  300  G1N7F4     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100547852 PE=4 SV=1
  523 : G1S5V1_NOMLE        0.46  0.70  408  595   51  277  227    3   40  301  G1S5V1     Uncharacterized protein OS=Nomascus leucogenys GN=LOC100588830 PE=4 SV=1
  524 : G3HLG7_CRIGR        0.46  0.70  408  595   51  277  227    3   40  301  G3HLG7     Phosducin-like protein OS=Cricetulus griseus GN=I79_011555 PE=4 SV=1
  525 : G3RC41_GORGO        0.46  0.70  408  595   51  277  227    3   40  301  G3RC41     Uncharacterized protein OS=Gorilla gorilla gorilla GN=PDCL PE=4 SV=1
  526 : G7PRH7_MACFA        0.46  0.70  408  595   51  277  227    3   40  301  G7PRH7     Phosducin-like protein OS=Macaca fascicularis GN=EGM_06661 PE=4 SV=1
  527 : H0VES7_CAVPO        0.46  0.70  408  595   51  277  227    3   40  301  H0VES7     Uncharacterized protein OS=Cavia porcellus GN=LOC100714122 PE=4 SV=1
  528 : H0Z927_TAEGU        0.46  0.70  408  595   50  276  227    3   40  300  H0Z927     Uncharacterized protein OS=Taeniopygia guttata GN=PDCL PE=4 SV=1
  529 : H2QXU6_PANTR        0.46  0.70  408  595   51  277  227    3   40  301  H2QXU6     Phosducin-like OS=Pan troglodytes GN=PDCL PE=2 SV=1
  530 : I3MFW8_SPETR        0.46  0.70  408  595   51  277  227    3   40  301  I3MFW8     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=PDCL PE=4 SV=1
  531 : PHLP_HUMAN          0.46  0.70  408  595   51  277  227    3   40  301  Q13371     Phosducin-like protein OS=Homo sapiens GN=PDCL PE=1 SV=3
  532 : PHLP_RAT            0.46  0.69  408  595   51  277  227    3   40  301  Q63737     Phosducin-like protein OS=Rattus norvegicus GN=Pdcl PE=1 SV=1
  533 : Q5R9T4_PONAB        0.46  0.70  408  595   51  277  227    3   40  301  Q5R9T4     Putative uncharacterized protein DKFZp468I225 OS=Pongo abelii GN=DKFZp468I225 PE=2 SV=1
  534 : R0JBI8_ANAPL        0.46  0.70  408  595   50  276  227    3   40  300  R0JBI8     Phosducin-like protein (Fragment) OS=Anas platyrhynchos GN=Anapl_11320 PE=4 SV=1
  535 : F1SKW2_PIG          0.45  0.70  408  595   51  277  227    3   40  301  F1SKW2     Uncharacterized protein OS=Sus scrofa GN=LOC100153625 PE=4 SV=1
  536 : F6X4V6_MONDO        0.45  0.70  408  595 1173 1400  228    4   41 1424  F6X4V6     Uncharacterized protein OS=Monodelphis domestica GN=RC3H2 PE=4 SV=2
  537 : G1SVX0_RABIT        0.45  0.69  408  595   51  277  227    3   40  301  G1SVX0     Uncharacterized protein OS=Oryctolagus cuniculus GN=LOC100354893 PE=4 SV=1
  538 : G3VYC4_SARHA        0.45  0.69  408  595   49  276  228    4   41  300  G3VYC4     Uncharacterized protein OS=Sarcophilus harrisii GN=PDCL PE=4 SV=1
  539 : K7FCM1_PELSI        0.45  0.70  408  595   49  275  227    3   40  299  K7FCM1     Uncharacterized protein OS=Pelodiscus sinensis GN=PDCL PE=4 SV=1
  540 : K9IXT4_DESRO        0.45  0.67  358  405   18   66   49    1    1   73  K9IXT4     Guanine nucleotide-binding protein subunit gamma OS=Desmodus rotundus PE=3 SV=1
  541 : L8HKN3_BOSMU        0.45  0.69  408  595   51  278  228    4   41  302  L8HKN3     Phosducin-like protein OS=Bos grunniens mutus GN=M91_20743 PE=4 SV=1
  542 : M7C2F6_CHEMY        0.45  0.70  408  595   49  275  227    3   40  276  M7C2F6     Phosducin-like protein (Fragment) OS=Chelonia mydas GN=UY3_08173 PE=4 SV=1
  543 : PHLP_BOVIN          0.45  0.70  408  595   51  277  227    3   40  301  Q2HJA9     Phosducin-like protein OS=Bos taurus GN=PDCL PE=2 SV=1
  544 : PHLP_MOUSE          0.45  0.69  408  595   51  277  227    3   40  301  Q9DBX2     Phosducin-like protein OS=Mus musculus GN=Pdcl PE=1 SV=1
  545 : Q3UZN6_MOUSE        0.45  0.69  408  595   51  277  227    3   40  301  Q3UZN6     Putative uncharacterized protein OS=Mus musculus GN=Pdcl PE=2 SV=1
  546 : Q923E8_MOUSE        0.45  0.69  408  595   51  277  227    3   40  301  Q923E8     Phosducin-like OS=Mus musculus GN=Pdcl PE=2 SV=1
  547 : B9H0Q0_POPTR        0.44  0.69   13  339   20  369  359   10   41  377  B9H0Q0     Predicted protein OS=Populus trichocarpa GN=POPTRDRAFT_712950 PE=4 SV=1
  548 : B9HRN9_POPTR        0.44  0.69   13  339   20  369  359   10   41  377  B9HRN9     Predicted protein OS=Populus trichocarpa GN=POPTRDRAFT_722050 PE=4 SV=1
  549 : D7MF11_ARALL        0.44  0.67   13  339   20  369  357   12   37  377  D7MF11     Putative uncharacterized protein OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_491213 PE=4 SV=1
  550 : D7TQ08_VITVI        0.44  0.69   13  339   20  369  359   10   41  377  D7TQ08     Putative uncharacterized protein OS=Vitis vinifera GN=VIT_03s0063g02480 PE=2 SV=1
  551 : E9G283_DAPPU        0.44  0.69  354  405    1   52   52    0    0   59  E9G283     Guanine nucleotide-binding protein subunit gamma OS=Daphnia pulex GN=Gng2 PE=3 SV=1
  552 : F6QJ91_ORNAN        0.44  0.70  408  595   49  275  227    3   40  299  F6QJ91     Uncharacterized protein OS=Ornithorhynchus anatinus GN=PDCL PE=4 SV=1
  553 : G5C9D3_HETGA        0.44  0.61    1  336   52  443  393    8   58  488  G5C9D3     Guanine nucleotide-binding protein subunit beta-5 OS=Heterocephalus glaber GN=GW7_04217 PE=4 SV=1
  554 : GBB_ARATH           0.44  0.67   13  339   20  369  357   12   37  377  P49177     Guanine nucleotide-binding protein subunit beta OS=Arabidopsis thaliana GN=GB1 PE=1 SV=1
  555 : H2XZV4_CIOIN        0.44  0.70    1  339   11  376  366    6   27  376  H2XZV4     Uncharacterized protein OS=Ciona intestinalis GN=LOC100185742 PE=4 SV=1
  556 : H3A709_LATCH        0.44  0.66  408  595   49  272  227    4   43  298  H3A709     Uncharacterized protein OS=Latimeria chalumnae PE=4 SV=1
  557 : I1LJE1_SOYBN        0.44  0.69   13  339   20  369  359   10   41  377  I1LJE1     Uncharacterized protein OS=Glycine max PE=4 SV=1
  558 : K4ABA4_SETIT        0.44  0.68   13  339   21  372  360   12   41  380  K4ABA4     Uncharacterized protein OS=Setaria italica GN=Si036161m.g PE=4 SV=1
  559 : M3ZSK3_XIPMA        0.44  0.67  408  595   52  278  227    3   40  306  M3ZSK3     Uncharacterized protein OS=Xiphophorus maculatus GN=PDCL PE=4 SV=1
  560 : Q5PNT1_ARATH        0.44  0.67   13  339   20  369  357   12   37  375  Q5PNT1     At4g34460 OS=Arabidopsis thaliana PE=2 SV=1
  561 : Q8GU43_9BRYO        0.44  0.70    7  339   15  371  358   14   26  377  Q8GU43     Putative heterotrimeric G protein beta subunit OS=Physcomitrella patens GN=gb1 PE=2 SV=1
  562 : B8AP31_ORYSI        0.43  0.69   13  339   21  372  361   11   43  380  B8AP31     Putative uncharacterized protein OS=Oryza sativa subsp. indica GN=OsI_12941 PE=2 SV=1
  563 : B9RBE4_RICCO        0.43  0.68   13  339   20  369  360   12   43  377  B9RBE4     Guanine nucleotide-binding protein beta, putative OS=Ricinus communis GN=RCOM_1674940 PE=4 SV=1
  564 : C5MTW2_NICBE        0.43  0.68   11  339   22  369  359   13   41  377  C5MTW2     Heterotrimeric G protein beta 2 subunit OS=Nicotiana benthamiana PE=2 SV=1
  565 : C6THC3_SOYBN        0.43  0.68   13  339   20  369  359   10   41  377  C6THC3     Uncharacterized protein OS=Glycine max PE=2 SV=1
  566 : E0AEC9_ORYSI        0.43  0.68   13  339   21  372  361   12   43  380  E0AEC9     G protein beta subunit OS=Oryza sativa subsp. indica PE=2 SV=1
  567 : G1PI75_MYOLU        0.43  0.69  408  595   48  274  227    3   40  298  G1PI75     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  568 : G7J6K3_MEDTR        0.43  0.69   13  339   20  370  360   10   42  378  G7J6K3     Guanine nucleotide-binding protein subunit beta-1 OS=Medicago truncatula GN=MTR_3g116500 PE=4 SV=1
  569 : GBB2_TOBAC          0.43  0.68   12  339   19  369  362   13   45  377  P93398     Guanine nucleotide-binding protein subunit beta-2 OS=Nicotiana tabacum PE=2 SV=1
  570 : H2ZSM5_LATCH        0.43  0.67  355  405   11   61   51    0    0   68  H2ZSM5     Guanine nucleotide-binding protein subunit gamma OS=Latimeria chalumnae PE=3 SV=1
  571 : I1GPP8_BRADI        0.43  0.68   13  339   21  372  360   11   41  380  I1GPP8     Uncharacterized protein OS=Brachypodium distachyon GN=BRADI1G12820 PE=4 SV=1
  572 : I1PE80_ORYGL        0.43  0.69   13  339   21  372  361   11   43  380  I1PE80     Uncharacterized protein OS=Oryza glaberrima PE=4 SV=1
  573 : I3LIP5_PIG          0.43  0.65  408  595   51  262  227    6   55  286  I3LIP5     Uncharacterized protein OS=Sus scrofa PE=4 SV=1
  574 : I3S0B5_LOTJA        0.43  0.68   13  339   20  369  359   10   41  377  I3S0B5     Uncharacterized protein OS=Lotus japonicus PE=2 SV=1
  575 : K4B3G9_SOLLC        0.43  0.68   12  339   19  369  362   13   45  377  K4B3G9     Uncharacterized protein OS=Solanum lycopersicum GN=Solyc01g109560.2 PE=4 SV=1
  576 : L5LKR1_MYODS        0.43  0.69  408  595 1168 1394  227    3   40 1418  L5LKR1     RING finger and CCCH-type zinc finger domain-containing protein 2 OS=Myotis davidii GN=MDA_GLEAN10019370 PE=4 SV=1
  577 : M5VM49_PRUPE        0.43  0.68   13  339   20  369  360   12   43  377  M5VM49     Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa007241mg PE=4 SV=1
  578 : O35359_RAT          0.43  0.65  355  403    7   55   49    0    0   55  O35359     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Rattus norvegicus GN=Gng12 PE=2 SV=1
  579 : Q10FF8_ORYSJ        0.43  0.69   13  339   21  372  361   11   43  380  Q10FF8     Guanine nucleotide-binding protein beta subunit, putative, expressed OS=Oryza sativa subsp. japonica GN=LOC_Os03g46650 PE=2 SV=1
  580 : Q8LNY6_WHEAT3IZ6    0.43  0.67   13  339   21  372  360   12   41  380  Q8LNY6     G protein beta subunit OS=Triticum aestivum GN=TaGB1 PE=1 SV=1
  581 : Q945H7_SOLTU        0.43  0.67   12  339   19  369  362   13   45  377  Q945H7     G protein beta subunit 2 OS=Solanum tuberosum GN=GB2 PE=2 SV=1
  582 : Q9FV61_TOBAC        0.43  0.67   12  339   19  369  362   13   45  377  Q9FV61     Heterotrimeric GTP-binding protein subunit beta 1 OS=Nicotiana tabacum PE=2 SV=1
  583 : Q9XFK0_PEA          0.43  0.68   13  339   20  369  359   10   41  377  Q9XFK0     G protein beta subunit OS=Pisum sativum PE=2 SV=1
  584 : C3KHI1_ANOFI        0.42  0.67  408  595   52  278  227    3   40  306  C3KHI1     Phosducin-like protein OS=Anoplopoma fimbria GN=PHLP PE=2 SV=1
  585 : D0ENG8_BRANA        0.42  0.66    1  339   15  369  368   12   42  377  D0ENG8     GTP binding protein beta subunit OS=Brassica napus GN=GB1 PE=2 SV=1
  586 : G3PUE7_GASAC        0.42  0.68  408  595   52  278  227    3   40  306  G3PUE7     Uncharacterized protein OS=Gasterosteus aculeatus GN=PDCL PE=4 SV=1
  587 : G8E9N3_SALMI        0.42  0.67   13  339   20  369  361   13   45  377  G8E9N3     GTP-binding protein beta subunit OS=Salvia miltiorrhiza PE=2 SV=1
  588 : GBB_MAIZE           0.42  0.68   13  339   21  372  361   12   43  380  P49178     Guanine nucleotide-binding protein subunit beta OS=Zea mays GN=GB1 PE=2 SV=1
  589 : H2LK82_ORYLA        0.42  0.67  408  595   50  276  227    3   40  304  H2LK82     Uncharacterized protein OS=Oryzias latipes GN=LOC101170283 PE=4 SV=1
  590 : I1K777_SOYBN        0.42  0.68   13  339   20  369  359   10   41  377  I1K777     Uncharacterized protein OS=Glycine max PE=4 SV=1
  591 : I3JBR2_ORENI        0.42  0.63  346  405    3   62   60    0    0   70  I3JBR2     Guanine nucleotide-binding protein subunit gamma OS=Oreochromis niloticus GN=LOC100707451 PE=3 SV=1
  592 : I3JKQ8_ORENI        0.42  0.68  408  595   52  278  227    3   40  306  I3JKQ8     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100704540 PE=4 SV=1
  593 : M0TBW1_MUSAM        0.42  0.67   13  339   20  371  361   11   43  379  M0TBW1     Uncharacterized protein OS=Musa acuminata subsp. malaccensis PE=4 SV=1
  594 : M4F0N3_BRARP        0.42  0.66    1  339   15  370  369   13   43  378  M4F0N3     Uncharacterized protein OS=Brassica rapa subsp. pekinensis GN=Bra034628 PE=4 SV=1
  595 : E1BS32_CHICK        0.41  0.63  355  405   16   66   51    0    0   74  E1BS32     Guanine nucleotide-binding protein subunit gamma OS=Gallus gallus GN=GNG4 PE=3 SV=1
  596 : F6YZA3_MONDO        0.41  0.59  348  405   10   67   58    0    0   75  F6YZA3     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Monodelphis domestica GN=GNG8 PE=3 SV=1
  597 : G1NH37_MELGA        0.41  0.63  355  405   16   66   51    0    0   74  G1NH37     Guanine nucleotide-binding protein subunit gamma OS=Meleagris gallopavo GN=LOC100551249 PE=3 SV=1
  598 : G3VG64_SARHA        0.41  0.59  348  405    7   64   58    0    0   72  G3VG64     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Sarcophilus harrisii GN=GNG8 PE=3 SV=1
  599 : H2VAR1_TAKRU        0.41  0.67  408  595   52  278  227    3   40  306  H2VAR1     Uncharacterized protein OS=Takifugu rubripes GN=LOC101062086 PE=4 SV=1
  600 : I3ISJ0_DANRE        0.41  0.67  355  405   15   65   51    0    0   72  I3ISJ0     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=si:dkey-44g17.6 PE=3 SV=1
  601 : R0JLF0_ANAPL        0.41  0.63  355  405   16   66   51    0    0   74  R0JLF0     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-4 (Fragment) OS=Anas platyrhynchos GN=Anapl_11040 PE=4 SV=1
  602 : J3S0H6_CROAD        0.40  0.67  408  595   50  270  227    4   46  294  J3S0H6     Phosducin-like protein-like OS=Crotalus adamanteus PE=2 SV=1
  603 : Q4SFP0_TETNG        0.40  0.65  346  405    3   62   60    0    0   70  Q4SFP0     Guanine nucleotide-binding protein subunit gamma OS=Tetraodon nigroviridis GN=GSTENG00019011001 PE=3 SV=1
  604 : Q503Q6_DANRE        0.40  0.63  346  405    3   62   60    0    0   70  Q503Q6     Guanine nucleotide-binding protein subunit gamma OS=Danio rerio GN=gng8 PE=3 SV=1
  605 : A3LVU6_PICST        0.39  0.59    1  339   13  398  390   10   55  399  A3LVU6     Predicted protein OS=Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545) GN=PICST_60945 PE=4 SV=2
  606 : B7G4U5_PHATC        0.39  0.63    4  339    9  351  357   15   35  351  B7G4U5     G protein beta subunit OS=Phaeodactylum tricornutum (strain CCAP 1055/1) GN=PHATRDRAFT_21897 PE=4 SV=1
  607 : C5DXM8_ZYGRC        0.39  0.57    2  339   43  427  391   12   59  431  C5DXM8     ZYRO0F06314p OS=Zygosaccharomyces rouxii (strain ATCC 2623 / CBS 732 / NBRC 1130 / NCYC 568 / NRRL Y-229) GN=ZYRO0F06314g PE=4 SV=1
  608 : D2A574_TRICA        0.39  0.67  351  401   11   60   51    1    1   72  D2A574     Guanine nucleotide-binding protein subunit gamma OS=Tribolium castaneum GN=GLEAN_15232 PE=3 SV=1
  609 : D3PHE7_9MAXI        0.39  0.71  356  405   13   63   51    1    1   71  D3PHE7     Guanine nucleotide-binding protein subunit gamma OS=Lepeophtheirus salmonis GN=GBG1 PE=3 SV=1
  610 : E2AH25_CAMFO        0.39  0.67  351  401   11   60   51    1    1   72  E2AH25     Guanine nucleotide-binding protein subunit gamma OS=Camponotus floridanus GN=EAG_02185 PE=3 SV=1
  611 : E2B3W4_HARSA        0.39  0.67  351  401   11   60   51    1    1   72  E2B3W4     Guanine nucleotide-binding protein subunit gamma OS=Harpegnathos saltator GN=EAI_09343 PE=3 SV=1
  612 : E3TD01_9TELE        0.39  0.63  355  405   15   65   51    0    0   72  E3TD01     Guanine nucleotide-binding protein subunit gamma OS=Ictalurus furcatus GN=GBG12 PE=3 SV=1
  613 : F6T6I4_HORSE        0.39  0.61  355  405   17   67   51    0    0   75  F6T6I4     Guanine nucleotide-binding protein subunit gamma OS=Equus caballus GN=GNG4 PE=3 SV=1
  614 : G3X9Q2_MOUSE        0.39  0.69  355  405   12   62   51    0    0   69  G3X9Q2     Guanine nucleotide-binding protein subunit gamma OS=Mus musculus GN=Gng7 PE=3 SV=1
  615 : G5AYI7_HETGA        0.39  0.63  355  405  239  289   51    0    0  297  G5AYI7     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_01781 PE=3 SV=1
  616 : G5BYX7_HETGA        0.39  0.65  355  405   15   65   51    0    0   72  G5BYX7     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_16097 PE=3 SV=1
  617 : GBG7_MOUSE          0.39  0.69  355  405   11   61   51    0    0   68  Q61016     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-7 OS=Mus musculus GN=Gng7 PE=2 SV=2
  618 : H0VXZ6_CAVPO        0.39  0.65  355  405   15   65   51    0    0   72  H0VXZ6     Guanine nucleotide-binding protein subunit gamma OS=Cavia porcellus GN=LOC100717644 PE=3 SV=1
  619 : H0ZJ41_TAEGU        0.39  0.63  355  405   16   66   51    0    0   74  H0ZJ41     Guanine nucleotide-binding protein subunit gamma OS=Taeniopygia guttata GN=GNG4 PE=3 SV=1
  620 : H9JYM1_APIME        0.39  0.65  351  401   11   60   51    1    1   72  H9JYM1     Guanine nucleotide-binding protein subunit gamma OS=Apis mellifera GN=LOC725453 PE=3 SV=1
  621 : M3X5V2_FELCA        0.39  0.65  355  405   15   65   51    0    0   72  M3X5V2     Guanine nucleotide-binding protein subunit gamma OS=Felis catus GN=LOC101084346 PE=3 SV=1
  622 : M3Y070_MUSPF        0.39  0.65  355  405   15   65   51    0    0   72  M3Y070     Guanine nucleotide-binding protein subunit gamma OS=Mustela putorius furo GN=Gm5741 PE=3 SV=1
  623 : B7ZSW5_XENTR        0.38  0.63  408  595   44  269  227    4   41  293  B7ZSW5     Uncharacterized protein OS=Xenopus tropicalis GN=pdcl PE=2 SV=1
  624 : C1BZE9_ESOLU        0.38  0.71  354  405   10   61   52    0    0   89  C1BZE9     Guanine nucleotide-binding protein subunit gamma OS=Esox lucius GN=GBG10 PE=3 SV=1
  625 : D3DQV2_HUMAN        0.38  0.69  354  405   10   61   52    0    0   68  D3DQV2     Guanine nucleotide-binding protein subunit gamma OS=Homo sapiens GN=hCG_1992840 PE=3 SV=1
  626 : E2R9G5_CANFA        0.38  0.67  354  405   10   61   52    0    0   68  E2R9G5     Guanine nucleotide-binding protein subunit gamma OS=Canis familiaris GN=GNG10 PE=3 SV=1
  627 : F1SNC2_PIG          0.38  0.63  354  405   10   61   52    0    0   68  F1SNC2     Guanine nucleotide-binding protein subunit gamma OS=Sus scrofa GN=LOC100515992 PE=3 SV=1
  628 : F7ESA3_CALJA        0.38  0.69  354  405   10   61   52    0    0   68  F7ESA3     Guanine nucleotide-binding protein subunit gamma OS=Callithrix jacchus GN=GNG10 PE=3 SV=1
  629 : F7FAQ9_MACMU        0.38  0.67  354  405   10   61   52    0    0   68  F7FAQ9     Guanine nucleotide-binding protein subunit gamma OS=Macaca mulatta GN=GNG10 PE=2 SV=1
  630 : G1MMQ9_AILME        0.38  0.67  354  405    6   57   52    0    0   63  G1MMQ9     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=LOC100469103 PE=3 SV=1
  631 : G1TIG0_RABIT        0.38  0.67  354  405   10   61   52    0    0   68  G1TIG0     Guanine nucleotide-binding protein subunit gamma OS=Oryctolagus cuniculus GN=LOC100338205 PE=3 SV=1
  632 : G3UN41_LOXAF        0.38  0.67  354  405   10   61   52    0    0   68  G3UN41     Guanine nucleotide-binding protein subunit gamma OS=Loxodonta africana GN=LOC100662559 PE=3 SV=1
  633 : GBG10_HUMAN         0.38  0.67  354  405   10   61   52    0    0   68  P50151     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-10 OS=Homo sapiens GN=GNG10 PE=1 SV=1
  634 : GBG10_MOUSE         0.38  0.67  354  405   10   61   52    0    0   68  Q9CXP8     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-10 OS=Mus musculus GN=Gng10 PE=3 SV=1
  635 : H2UJI4_TAKRU        0.38  0.71  354  405   10   61   52    0    0   68  H2UJI4     Guanine nucleotide-binding protein subunit gamma OS=Takifugu rubripes GN=LOC101078912 PE=3 SV=1
  636 : H9GE21_ANOCA        0.38  0.62  346  405    3   62   60    0    0   70  H9GE21     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis GN=LOC100564350 PE=3 SV=1
  637 : H9GIN9_ANOCA        0.38  0.61  408  595   90  323  234    6   47  344  H9GIN9     Uncharacterized protein OS=Anolis carolinensis GN=LOC100558387 PE=4 SV=2
  638 : I1G1L1_AMPQE        0.38  0.61  348  403    1   54   56    1    2   63  I1G1L1     Guanine nucleotide-binding protein subunit gamma OS=Amphimedon queenslandica PE=3 SV=1
  639 : I3JL46_ORENI        0.38  0.71  354  405   10   61   52    0    0   68  I3JL46     Guanine nucleotide-binding protein subunit gamma OS=Oreochromis niloticus GN=LOC100709453 PE=3 SV=1
  640 : I3NFK1_SPETR        0.38  0.71  354  405   10   61   52    0    0   68  I3NFK1     Guanine nucleotide-binding protein subunit gamma OS=Spermophilus tridecemlineatus PE=3 SV=1
  641 : K7AE17_PANTR        0.38  0.67  354  405   10   61   52    0    0   68  K7AE17     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNG10 PE=3 SV=1
  642 : K9IG77_DESRO        0.38  0.69  354  405   10   61   52    0    0   68  K9IG77     Guanine nucleotide-binding protein subunit gamma OS=Desmodus rotundus PE=3 SV=1
  643 : L9KP22_TUPCH        0.38  0.67  354  405   10   61   52    0    0   75  L9KP22     Guanine nucleotide-binding protein subunit gamma OS=Tupaia chinensis GN=TREES_T100013205 PE=3 SV=1
  644 : M4AGS3_XIPMA        0.38  0.71  354  405   10   61   52    0    0   68  M4AGS3     Guanine nucleotide-binding protein subunit gamma OS=Xiphophorus maculatus GN=GNG10 PE=3 SV=1
  645 : M7B4L2_CHEMY        0.38  0.62  346  405    3   62   60    0    0   70  M7B4L2     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-8 OS=Chelonia mydas GN=UY3_15843 PE=4 SV=1
  646 : Q3KRE3_RAT          0.38  0.67  354  405   10   61   52    0    0   68  Q3KRE3     Guanine nucleotide-binding protein subunit gamma OS=Rattus norvegicus GN=Gng10 PE=3 SV=1
  647 : Q3SZ98_BOVIN        0.38  0.67  354  405   10   61   52    0    0   68  Q3SZ98     Guanine nucleotide-binding protein subunit gamma OS=Bos taurus GN=GNG10 PE=3 SV=1
  648 : A4IFL6_BOVIN        0.37  0.61  355  405   17   67   51    0    0   75  A4IFL6     Guanine nucleotide-binding protein subunit gamma OS=Bos taurus GN=GNG4 PE=3 SV=1
  649 : B0W030_CULQU        0.37  0.67  351  401   11   60   51    1    1   72  B0W030     Guanine nucleotide-binding protein subunit gamma OS=Culex quinquefasciatus GN=CpipJ_CPIJ000394 PE=3 SV=1
  650 : B1APZ0_HUMAN        0.37  0.61  355  405   17   67   51    0    0   75  B1APZ0     Guanine nucleotide-binding protein subunit gamma OS=Homo sapiens GN=GNG4 PE=2 SV=1
  651 : B5X6R3_SALSA        0.37  0.63  346  405    3   62   60    0    0   70  B5X6R3     Guanine nucleotide-binding protein subunit gamma OS=Salmo salar GN=GBG8 PE=3 SV=1
  652 : C1C4N2_LITCT        0.37  0.69  354  405   10   61   52    0    0   68  C1C4N2     Guanine nucleotide-binding protein subunit gamma OS=Lithobates catesbeiana GN=GBG10 PE=3 SV=1
  653 : D2HG04_AILME        0.37  0.65  355  405   15   65   51    0    0   72  D2HG04     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Ailuropoda melanoleuca GN=LOC100477221 PE=3 SV=1
  654 : D3ZVY9_RAT          0.37  0.63  355  405   15   65   51    0    0   72  D3ZVY9     Guanine nucleotide-binding protein subunit gamma OS=Rattus norvegicus GN=LOC685513 PE=3 SV=1
  655 : E1BE27_BOVIN        0.37  0.65  355  405   15   65   51    0    0   72  E1BE27     Guanine nucleotide-binding protein subunit gamma OS=Bos taurus GN=LOC529425 PE=3 SV=1
  656 : E2A4E0_CAMFO        0.37  0.65  355  405   95  146   52    1    1  153  E2A4E0     Guanine nucleotide-binding protein subunit gamma OS=Camponotus floridanus GN=EAG_14270 PE=3 SV=1
  657 : E9H697_DAPPU        0.37  0.67  350  401    2   52   52    1    1   64  E9H697     Guanine nucleotide-binding protein subunit gamma OS=Daphnia pulex GN=Gng3 PE=3 SV=1
  658 : F1SEX7_PIG          0.37  0.65  355  405   15   65   51    0    0   72  F1SEX7     Guanine nucleotide-binding protein subunit gamma OS=Sus scrofa GN=LOC100520008 PE=3 SV=1
  659 : F6QSV4_CALJA        0.37  0.61  355  405   17   67   51    0    0   75  F6QSV4     Guanine nucleotide-binding protein subunit gamma OS=Callithrix jacchus GN=GNG4 PE=3 SV=1
  660 : F6S600_HORSE        0.37  0.65  355  405   15   65   51    0    0   72  F6S600     Guanine nucleotide-binding protein subunit gamma OS=Equus caballus GN=LOC100063518 PE=3 SV=1
  661 : F6TFY2_MACMU        0.37  0.61  355  405   17   67   51    0    0   75  F6TFY2     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Macaca mulatta GN=GNG4 PE=3 SV=1
  662 : F7CFG8_MONDO        0.37  0.67  354  405   10   61   52    0    0   68  F7CFG8     Guanine nucleotide-binding protein subunit gamma OS=Monodelphis domestica GN=GNG10 PE=3 SV=1
  663 : G1QAT7_MYOLU        0.37  0.67  354  405   10   61   52    0    0   68  G1QAT7     Guanine nucleotide-binding protein subunit gamma OS=Myotis lucifugus PE=3 SV=1
  664 : G1QRN5_NOMLE        0.37  0.61  355  405   13   63   51    0    0   71  G1QRN5     Guanine nucleotide-binding protein subunit gamma OS=Nomascus leucogenys GN=LOC100591313 PE=3 SV=2
  665 : G1RSZ8_NOMLE        0.37  0.67  354  405   10   61   52    0    0   68  G1RSZ8     Guanine nucleotide-binding protein subunit gamma OS=Nomascus leucogenys GN=LOC100590570 PE=3 SV=1
  666 : G3I3U2_CRIGR        0.37  0.61  355  405   17   67   51    0    0   75  G3I3U2     Guanine nucleotide-binding protein subunit gamma OS=Cricetulus griseus GN=I79_018110 PE=3 SV=1
  667 : G3NJ54_GASAC        0.37  0.63  355  405   15   65   51    0    0   72  G3NJ54     Guanine nucleotide-binding protein subunit gamma OS=Gasterosteus aculeatus GN=GNG12 (2 of 2) PE=3 SV=1
  668 : G3PV62_GASAC        0.37  0.71  354  405   10   61   52    0    0   68  G3PV62     Guanine nucleotide-binding protein subunit gamma OS=Gasterosteus aculeatus GN=GNG10 PE=3 SV=1
  669 : G3UJY6_LOXAF        0.37  0.61  355  405   17   67   51    0    0   75  G3UJY6     Guanine nucleotide-binding protein subunit gamma OS=Loxodonta africana GN=LOC100664179 PE=3 SV=1
  670 : G5BTJ6_HETGA        0.37  0.61  355  405   17   67   51    0    0   75  G5BTJ6     Guanine nucleotide-binding protein subunit gamma OS=Heterocephalus glaber GN=GW7_02989 PE=3 SV=1
  671 : G6CPX2_DANPL        0.37  0.67  351  401   11   60   51    1    1   72  G6CPX2     Guanine nucleotide-binding protein subunit gamma OS=Danaus plexippus GN=KGM_06280 PE=3 SV=1
  672 : GBG4_HUMAN          0.37  0.61  355  405   17   67   51    0    0   75  P50150     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-4 OS=Homo sapiens GN=GNG4 PE=1 SV=1
  673 : GBG4_MOUSE          0.37  0.61  355  405   17   67   51    0    0   75  P50153     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-4 OS=Mus musculus GN=Gng4 PE=2 SV=1
  674 : GBG4_PONAB          0.37  0.61  355  405   17   67   51    0    0   75  Q5R639     Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-4 OS=Pongo abelii GN=GNG4 PE=3 SV=1
  675 : H0VQH2_CAVPO        0.37  0.61  355  405   17   67   51    0    0   75  H0VQH2     Guanine nucleotide-binding protein subunit gamma OS=Cavia porcellus GN=LOC100728440 PE=3 SV=1
  676 : H0WWA0_OTOGA        0.37  0.61  355  405   17   67   51    0    0   75  H0WWA0     Guanine nucleotide-binding protein subunit gamma OS=Otolemur garnettii GN=GNG4 PE=3 SV=1
  677 : H2NND1_PONAB        0.37  0.65  354  405   10   61   52    0    0   61  H2NND1     Guanine nucleotide-binding protein subunit gamma OS=Pongo abelii GN=GNG10 PE=3 SV=1
  678 : H2Q1D9_PANTR        0.37  0.61  355  405   17   67   51    0    0   75  H2Q1D9     Guanine nucleotide-binding protein subunit gamma OS=Pan troglodytes GN=GNG4 PE=3 SV=1
  679 : H9GJ33_ANOCA        0.37  0.69  354  405   10   61   52    0    0   68  H9GJ33     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis PE=3 SV=1
  680 : I3N418_SPETR        0.37  0.69  354  405    6   57   52    0    0   64  I3N418     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Spermophilus tridecemlineatus PE=3 SV=1
  681 : K4FSL1_CALMI        0.37  0.67  354  405   10   61   52    0    0   68  K4FSL1     Guanine nucleotide-binding protein subunit gamma OS=Callorhynchus milii PE=3 SV=1
  682 : K7E376_MONDO        0.37  0.61  355  405   17   67   51    0    0   75  K7E376     Guanine nucleotide-binding protein subunit gamma OS=Monodelphis domestica GN=GNG4 PE=3 SV=1
  683 : K7G463_PELSI        0.37  0.62  346  405    7   66   60    0    0   74  K7G463     Guanine nucleotide-binding protein subunit gamma OS=Pelodiscus sinensis GN=GNG4 PE=3 SV=1
  684 : L8HY24_BOSMU        0.37  0.61  355  405   17   67   51    0    0   75  L8HY24     Guanine nucleotide-binding protein subunit gamma OS=Bos grunniens mutus GN=M91_17221 PE=3 SV=1
  685 : L8I9N0_BOSMU        0.37  0.65  355  405   15   65   51    0    0   72  L8I9N0     Guanine nucleotide-binding protein subunit gamma OS=Bos grunniens mutus GN=M91_12609 PE=3 SV=1
  686 : M0R809_RAT          0.37  0.61  355  405   17   67   51    0    0   75  M0R809     Guanine nucleotide-binding protein subunit gamma OS=Rattus norvegicus GN=Gng4 PE=3 SV=1
  687 : M3W570_FELCA        0.37  0.61  355  405   17   67   51    0    0   75  M3W570     Guanine nucleotide-binding protein subunit gamma OS=Felis catus GN=GNG4 PE=3 SV=1
  688 : M3ZWJ1_XIPMA        0.37  0.63  355  405   17   67   51    0    0   75  M3ZWJ1     Guanine nucleotide-binding protein subunit gamma OS=Xiphophorus maculatus GN=GNG4 PE=3 SV=1
  689 : N6T8G5_9CUCU        0.37  0.62  354  405   14   65   52    0    0   72  N6T8G5     Uncharacterized protein (Fragment) OS=Dendroctonus ponderosae GN=YQE_06970 PE=4 SV=1
  690 : Q0VFL5_XENTR        0.37  0.61  355  405   17   67   51    0    0   75  Q0VFL5     Guanine nucleotide-binding protein subunit gamma OS=Xenopus tropicalis GN=gng4 PE=3 SV=1
  691 : Q175F3_AEDAE        0.37  0.67  351  401   11   60   51    1    1   72  Q175F3     Guanine nucleotide-binding protein subunit gamma OS=Aedes aegypti GN=AAEL006685 PE=3 SV=1
  692 : Q6AZS8_XENLA        0.37  0.61  355  405   17   67   51    0    0   75  Q6AZS8     Guanine nucleotide-binding protein subunit gamma OS=Xenopus laevis GN=gng4 PE=3 SV=1
  693 : Q7PMD1_ANOGA        0.37  0.67  351  401   11   60   51    1    1   72  Q7PMD1     Guanine nucleotide-binding protein subunit gamma OS=Anopheles gambiae GN=AGAP009953 PE=3 SV=2
  694 : C3ZWK3_BRAFL        0.36  0.61  408  588   43  245  216    5   49  245  C3ZWK3     Putative uncharacterized protein OS=Branchiostoma floridae GN=BRAFLDRAFT_102980 PE=4 SV=1
  695 : E2BJE5_HARSA        0.36  0.58  408  595   55  265  222    4   46  283  E2BJE5     Phosducin-like protein OS=Harpegnathos saltator GN=EAI_10084 PE=4 SV=1
  696 : E3MVK7_CAERE        0.36  0.55  351  405    1   56   56    1    1   63  E3MVK7     Guanine nucleotide-binding protein subunit gamma OS=Caenorhabditis remanei GN=Cre-gpc-1 PE=3 SV=1
  697 : F1QTL0_DANRE        0.36  0.61  408  566   52  249  198    3   40  272  F1QTL0     Uncharacterized protein OS=Danio rerio GN=pdcl PE=4 SV=1
  698 : F2Z6D4_KLULA        0.36  0.55    1  339   33  432  407    9   75  436  F2Z6D4     KLLA0D06787p OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=KLLA0D06787g PE=4 SV=1
  699 : F4W4B3_ACREC        0.36  0.59  408  595   56  265  222    4   47  283  F4W4B3     Phosducin-like protein OS=Acromyrmex echinatior GN=G5I_00229 PE=4 SV=1
  700 : G1K9Q7_ANOCA        0.36  0.59  342  405    4   67   64    0    0   75  G1K9Q7     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis GN=LOC100564764 PE=3 SV=1
  701 : G8Y9E0_PICSO        0.36  0.56    5  339   17  403  396   13   70  404  G8Y9E0     Piso0_004656 protein OS=Pichia sorbitophila (strain ATCC MYA-4447 / BCRC 22081 / CBS 7064 / NBRC 10061 / NRRL Y-12695) GN=Piso0_004656 PE=4 SV=1
  702 : H0VIQ6_CAVPO        0.36  0.61  347  405    8   66   59    0    0   74  H0VIQ6     Guanine nucleotide-binding protein subunit gamma (Fragment) OS=Cavia porcellus GN=LOC100725986 PE=3 SV=1
  703 : H9JR79_BOMMO        0.36  0.62  408  595   56  268  222    3   44  268  H9JR79     Uncharacterized protein OS=Bombyx mori PE=4 SV=1
  704 : K0KT94_WICCF        0.36  0.58    1  339   17  412  397   10   59  416  K0KT94     Vegetative incompatibility protein OS=Wickerhamomyces ciferrii (strain F-60-10 / ATCC 14091 / CBS 111 / JCM 3599 / NBRC 0793 / NRRL Y-1031) GN=BN7_5969 PE=4 SV=1
  705 : K7IM20_NASVI        0.36  0.58  408  595   56  266  222    4   46  284  K7IM20     Uncharacterized protein OS=Nasonia vitripennis PE=4 SV=1
  706 : Q6PBT0_DANRE        0.36  0.61  408  566   52  249  198    3   40  282  Q6PBT0     Zgc:73264 OS=Danio rerio GN=pdcl PE=2 SV=1
  707 : Q9Y7B8_KLULC        0.36  0.55    1  339   33  432  407    9   75  436  Q9Y7B8     Heterotrimeric G protein beta subunit OS=Kluyveromyces lactis GN=gpa1 PE=4 SV=1
  708 : C4YIA5_CANAW        0.35  0.55    1  339   30  456  432   13   98  457  C4YIA5     Putative uncharacterized protein OS=Candida albicans (strain WO-1) GN=CAWG_04177 PE=4 SV=1
  709 : E9IXK4_SOLIN        0.35  0.59  408  595   60  270  222    4   46  288  E9IXK4     Putative uncharacterized protein (Fragment) OS=Solenopsis invicta GN=SINV_04410 PE=4 SV=1
  710 : F1PJE5_CANFA        0.35  0.62  346  405    3   62   60    0    0   70  F1PJE5     Guanine nucleotide-binding protein subunit gamma OS=Canis familiaris GN=GNG8 PE=3 SV=2
  711 : G3MLG6_9ACAR        0.35  0.61  408  595   47  258  222    3   45  278  G3MLG6     Putative uncharacterized protein OS=Amblyomma maculatum PE=2 SV=1
  712 : L7M7M0_9ACAR        0.35  0.59  408  595   52  261  222    3   47  282  L7M7M0     Putative phosducin-like protein OS=Rhipicephalus pulchellus PE=2 SV=1
  713 : Q5AHX2_CANAL        0.35  0.55    1  339   30  456  432   13   98  457  Q5AHX2     Potential pheromone response pathway G protein subunit OS=Candida albicans (strain SC5314 / ATCC MYA-2876) GN=STE4 PE=4 SV=1
  714 : Q6BTS0_DEBHA        0.35  0.58    2  339   16  407  398   14   66  408  Q6BTS0     DEHA2C16368p OS=Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / JCM 1990 / NBRC 0083 / IGC 2968) GN=DEHA2C16368g PE=4 SV=1
  715 : R7VBP5_9ANNE        0.35  0.63  407  595   53  269  223    4   41  294  R7VBP5     Uncharacterized protein OS=Capitella teleta GN=CAPTEDRAFT_171124 PE=4 SV=1
  716 : A5DKQ1_PICGU        0.34  0.57    6  339    7  401  398   13   67  402  A5DKQ1     Putative uncharacterized protein OS=Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324) GN=PGUG_03852 PE=4 SV=2
  717 : B4LII7_DROVI        0.34  0.57  407  595   62  276  228    5   53  280  B4LII7     GJ13966 OS=Drosophila virilis GN=Dvir\GJ13966 PE=4 SV=1
  718 : B7PIY5_IXOSC        0.34  0.60  408  595   56  268  224    4   48  292  B7PIY5     Putative uncharacterized protein OS=Ixodes scapularis GN=IscW_ISCW017884 PE=4 SV=1
  719 : D1MLP0_MAYDE        0.34  0.58  408  595   66  281  224    5   45  305  D1MLP0     Phosducin-like protein OS=Mayetiola destructor PE=4 SV=1
  720 : D6WGP8_TRICA        0.34  0.57  408  595   50  261  222    3   45  278  D6WGP8     Putative uncharacterized protein OS=Tribolium castaneum GN=TcasGA2_TC002130 PE=4 SV=1
  721 : E3X228_ANODA        0.34  0.57  409  595   78  289  222    5   46  302  E3X228     Uncharacterized protein OS=Anopheles darlingi GN=AND_11707 PE=4 SV=1
  722 : G3AM97_SPAPN        0.34  0.53   13  339    7  403  406   16   88  404  G3AM97     Putative uncharacterized protein OS=Spathaspora passalidarum (strain NRRL Y-27907 / 11-Y1) GN=SPAPADRAFT_151428 PE=4 SV=1
  723 : G6DPP4_DANPL        0.34  0.59  408  595   57  269  226    4   52  269  G6DPP4     Uncharacterized protein OS=Danaus plexippus GN=KGM_08388 PE=4 SV=1
  724 : H2Z465_CIOSA        0.34  0.62  415  593   49  243  195    6   17  247  H2Z465     Uncharacterized protein OS=Ciona savignyi PE=4 SV=1
  725 : K1RA44_CRAGI        0.34  0.62  407  588   50  255  216    4   45  409  K1RA44     Phosducin-like protein OS=Crassostrea gigas GN=CGI_10023679 PE=4 SV=1
  726 : B4JZZ8_DROGR        0.33  0.57  407  595   62  277  225    4   46  281  B4JZZ8     GH23318 OS=Drosophila grimshawi GN=Dgri\GH23318 PE=4 SV=1
  727 : B4L0I5_DROMO        0.33  0.56  407  595   64  278  228    5   53  282  B4L0I5     GI13629 OS=Drosophila mojavensis GN=Dmoj\GI13629 PE=4 SV=1
  728 : B4MX70_DROWI        0.33  0.56  407  595   61  277  230    5   55  281  B4MX70     GK14696 OS=Drosophila willistoni GN=Dwil\GK14696 PE=4 SV=1
  729 : C4WUW2_ACYPI        0.33  0.63  408  595   40  236  203    4   22  253  C4WUW2     ACYPI007649 protein OS=Acyrthosiphon pisum GN=ACYPI007649 PE=2 SV=1
  730 : D3TNR9_GLOMM        0.33  0.58  407  595   65  277  223    4   45  281  D3TNR9     Conserved phosducin-like protein OS=Glossina morsitans morsitans PE=2 SV=1
  731 : E2A8X8_CAMFO        0.33  0.56  422  595    1  197  208    5   46  214  E2A8X8     Phosducin-like protein (Fragment) OS=Camponotus floridanus GN=EAG_07472 PE=4 SV=1
  732 : E5S4G4_TRISP        0.33  0.57  408  588   57  256  200    5   20  256  E5S4G4     Putative phosducin OS=Trichinella spiralis GN=Tsp_05791 PE=4 SV=1
  733 : F1L8F7_ASCSU        0.33  0.61  415  591   62  240  189    6   23  250  F1L8F7     Phosducin-like protein OS=Ascaris suum PE=2 SV=1
  734 : F1L9L2_ASCSU        0.33  0.61  415  591   49  227  189    6   23  237  F1L9L2     Phosducin-like protein OS=Ascaris suum PE=2 SV=1
  735 : F1LDU4_ASCSU        0.33  0.61  415  591   61  239  189    6   23  249  F1LDU4     Phosducin-like protein OS=Ascaris suum PE=2 SV=1
  736 : F1LFA7_ASCSU        0.33  0.62  415  591   48  226  188    6   21  236  F1LFA7     Phosducin-like protein (Fragment) OS=Ascaris suum PE=2 SV=1
  737 : H2LYA5_ORYLA        0.33  0.59  343  405    1   63   63    0    0   71  H2LYA5     Guanine nucleotide-binding protein subunit gamma OS=Oryzias latipes GN=LOC101157742 PE=3 SV=1
  738 : H3IFT5_STRPU        0.33  0.60  415  595   66  272  216    5   45  293  H3IFT5     Uncharacterized protein OS=Strongylocentrotus purpuratus PE=4 SV=1
  739 : H8WXC1_CANO9        0.33  0.52    2  339   44  471  429   10   92  472  H8WXC1     Ste4 Beta subunit of heterotrimeric G protein OS=Candida orthopsilosis (strain 90-125) GN=CORT_0A10410 PE=4 SV=1
  740 : H9GPV0_ANOCA        0.33  0.59  343  405    1   63   63    0    0   71  H9GPV0     Guanine nucleotide-binding protein subunit gamma OS=Anolis carolinensis PE=3 SV=1
  741 : M3HT93_CANMA        0.33  0.55    2  339   23  447  428   12   93  448  M3HT93     Guanine nucleotide-binding protein subunit beta, putative OS=Candida maltosa Xu316 GN=G210_0547 PE=4 SV=1
  742 : N6TH14_9CUCU        0.33  0.58  408  595   52  263  222    3   45  281  N6TH14     Uncharacterized protein (Fragment) OS=Dendroctonus ponderosae GN=YQE_03775 PE=4 SV=1
  743 : Q7QA23_ANOGA        0.33  0.57  409  595   72  283  222    5   46  293  Q7QA23     AGAP004468-PA OS=Anopheles gambiae GN=AGAP004468 PE=4 SV=4
  744 : B3MAC6_DROAN        0.32  0.58  407  595   57  271  224    4   45  275  B3MAC6     GF10390 OS=Drosophila ananassae GN=Dana\GF10390 PE=4 SV=1
  745 : B3NI49_DROER        0.32  0.56  407  595   58  272  228    5   53  276  B3NI49     GG13535 OS=Drosophila erecta GN=Dere\GG13535 PE=4 SV=1
  746 : B4HIH3_DROSE        0.32  0.56  407  595   58  272  228    5   53  276  B4HIH3     GM24478 OS=Drosophila sechellia GN=Dsec\GM24478 PE=4 SV=1
  747 : B4PCH8_DROYA        0.32  0.56  407  595   58  272  228    5   53  276  B4PCH8     GE19829 OS=Drosophila yakuba GN=Dyak\GE22253 PE=4 SV=1
  748 : B4QL45_DROSI        0.32  0.56  407  595   58  272  228    5   53  276  B4QL45     GD12551 OS=Drosophila simulans GN=Dsim\GD12551 PE=4 SV=1
  749 : PHLP_DROME          0.32  0.56  407  595   58  272  228    5   53  276  Q9VUR7     Phosducin-like protein OS=Drosophila melanogaster GN=CG7650 PE=1 SV=2
  750 : Q2M1D7_DROPS        0.32  0.57  407  595   58  272  224    4   45  276  Q2M1D7     GA20503 OS=Drosophila pseudoobscura pseudoobscura GN=Dpse\GA20503 PE=4 SV=1
  751 : E0VIS2_PEDHC        0.31  0.56  408  595   52  258  222    3   50  275  E0VIS2     Phosducin, putative OS=Pediculus humanus subsp. corporis GN=Phum_PHUM232110 PE=4 SV=1
  752 : F6PYG2_CIOIN        0.31  0.52  413  593   52  248  217    5   57  257  F6PYG2     Uncharacterized protein OS=Ciona intestinalis GN=LOC100179946 PE=4 SV=2
  753 : G4VHU3_SCHMA        0.31  0.55  415  595   55  259  216    6   47  278  G4VHU3     Phosducin-like protein (Phlp) OS=Schistosoma mansoni GN=Smp_036130 PE=4 SV=1
  754 : H2KPJ9_CLOSI        0.31  0.59  415  595   59  261  205    7   27  279  H2KPJ9     Phosducin-like protein OS=Clonorchis sinensis GN=CLF_102126 PE=4 SV=1
  755 : Q16R22_AEDAE        0.31  0.57  408  595   59  271  226    4   52  286  Q16R22     AAEL011096-PA OS=Aedes aegypti GN=AAEL011096 PE=4 SV=1
## ALIGNMENTS    1 -   70
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1    2 B S              0   0  117  267   60   SSSSSSSSSS SS SS  SSSS S     S      S  SSS   SSSS  S SS SSSSS        
     2    3 B E     >  -     0   0  107  283   60   EEEEEEEEEE EE EE  EEEE E     E      E  EEE   EEEE  E EE EEEEE        
     3    4 B L  H  > S+     0   0   52  299   33  LLLLLLLLLLL LL LL  LLLL L     L      L  LLL   LLLL  L LL LLLLL        
     4    5 B D  H  > S+     0   0  104  300   57  DDDDDDDDDDD DD DD  DDDD D     D      D  DDD   DDDD  D ED DDDDE        
     5    6 B Q  H  > S+     0   0  131  301   62  QQQQQQQQQQQ QQ QQ  QQQQ Q     Q      Q  QQQ   QQQQ  Q QQ QQQQQ        
     6    7 B L  H  X S+     0   0   27  302   65  LLLLLLLLLLL LL LL  LLLL L     L      L  LLL   LLLL  L LL LLLLL        
     7    8 B R  H  X S+     0   0  110  311   10  RRRRRRRRRRR RR RR  RRRR R     R      R  RRR   RRRR  R RR RRRRR        
     8    9 B Q  H  X S+     0   0  117  312   60  QQQQQQQQQQQ QQ QQ  QQQQ Q     Q      Q  QQQ   QQQQ  Q QQ QQQQQ        
     9   10 B E  H  X S+     0   0   78  313   13  EEEEEEEEEEE EE EE  EEEE E     E      E  EEE   EEEE  E EE EEEEE        
    10   11 B A  H  X S+     0   0    1  313   25  AAAAAAAAAAA AA AA  AAAA A     A      A  AAA   AAAA  A AA AAAAA        
    11   12 B E  H  X S+     0   0  121  315   21  EEEEEEEEEEE EE EE  EEEE E     E      E  EEE   EEEE  E EE EEEEE        
    12   13 B Q  H  X S+     0   0  111  323   73  QQQQQQQQQQQ QQ QQ  QQQQ Q     Q      Q  QQQ   QQQQ  Q QQ QQQQQ        
    13   14 B L  H  X S+     0   0   14  348    5  LLLLLLLLLLL LL LL  LLLL L     L      L  LLL   LLLL  L LL LLLLL        
    14   15 B K  H  X S+     0   0   99  348   37  KKKKKKKKKKK KK KK  KKKK K     K      K  KKK   KKKK  K KK KKKKK        
    15   16 B N  H  X S+     0   0   33  348   56  NNNNNNNNNNN NN NN  NNNN N     N      N  NNN   NNNN  N NN NNNNN        
    16   17 B Q  H  X S+     0   0   82  348   60  QQQQQQQQQQQ QQ QQ  QQQQ Q     Q      Q  QQQ   QQQQ  Q QQ QQQQQ        
    17   18 B I  H  X S+     0   0    7  348   18  IIIIIIIIIII II II  IIII I     I      I  III   IIII  I II IIIII        
    18   19 B R  H  X S+     0   0  135  348   59  RRRRRRRRRRR RR RR  RRRR R     R      R  RRR   RRRR  R RR RRRRR        
    19   20 B D  H  X S+     0   0   85  349   72  DDDDDDDDDDD DD DD  DDDD D     D      D  DDD  DDDDD  D DD DDDDD        
    20   21 B A  H  X S+     0   0   36  249   44  AAAAAAAAAAA AA AA  AAAA A     A      A  AAA  AAAAA  A AA AAAAA        
    21   22 B R  H >X S+     0   0   22  349   28  RRRRRRRRRRR RR RR  RRRR R     R      R  RRR  RRRRR  R RR RRRRR        
    22   23 B K  H 3< S+     0   0  136  350   43  KKKKKKKKKKK KK KK  KKKK K     K      K  KKK  KKKKK  K KK KKKKK        
    23   24 B A  H 3< S+     0   0   79  350   64  AAAAAAAAAAA AA AA  AAAA A     A      A  AAA  AAAAA  A AA AAAAV        
    24   25 B C  H << S+     0   0   19  306   94  CCCCCCCCCCC CC CC  CCCC C     C      C  CCC  CCCCC  C CC CCCCC        
    25   26 B A     <  +     0   0   46  309   60  AAAAAAAAAAA AA AA  AAAA A     A      A  AAA  AAAAA  A AA AAAAA        
    26   27 B D        +     0   0   88  312    3  DDDDDDDDDDD DD DD  DDDD D     D      D  DDD  DDDDD  D DD DDDDD        
    27   28 B A        -     0   0   17  315   51  AAAAAAAAAAA AA AA  AAAA A     A      A  AAA  AAAAA  A AA AAAAA        
    28   29 B T    >>  -     0   0   59  315   41  TTTTTTTTTTT TT TT  TTTT T     T      T  TTT  TTTTT  T TT TTTTT        
    29   30 B L  H 3> S+     0   0    0  317    9  LLLLLLLLLLL LL LL  LLLL L     L      L  LLL  LLLLL  L LL LLLLL        
    30   31 B S  H 34 S+     0   0   38  323   90  SSSSSSSSSSS SS SS  SSSS S     S      A  SSS  ASSSS  S SA SSSAA        
    31   32 B Q  H X4 S+     0   0  119  330   65  QQQQQQQQQQQ QQ QQ KQQQQ Q     Q      Q  QQQ  QQQQQ  Q QQ QQQQQ        
    32   33 B I  H 3< S+     0   0   28  332   58  IIIIIIIIIII II II IIIIIII     I      I  III  IIIII  I II IIIII        
    33   34 B T  T >< S+     0   0    0  343   62  TTTTTTTTTTT TT TT TTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
    34   35 B N  T <  S+     0   0  129  351   77  NNNNNNNNNNN NN NN NAANNNA     A      A  AAA  AAAAA  A AA AAAAA        
    35   36 B N  T 3  S+     0   0  111  351   67  NNNNNNNNNNN NN NN NNNNNNN     S      N  NNN  NNNNN  S NN NNNNN        
    36   37 B I  S <  S-     0   0   21  338   72  IIIIIIIIIII II II IIIIIII     I      I  III  IIIII  I II VIIII        
    37   38 B D        -     0   0  138  345   57  DDDDDDDDDDD DD DD DDDDDDE     D      D  DDD  DDDDD  D DD EDDDD        
    38   39 B P        -     0   0   89  348   62  PPPPPPPPPPP PP PP PPPPPPP     P      P  PPP  PPPPP  P PP APPPP        
    39   40 B V        -     0   0   23  350   41  VVVVVVVVVVV VV VV VVVVVVV     V      V  VVV  VVVIV  V VV VVVVV        
    40   41 B G        -     0   0   54  353   52  GGGGGGGGGGG GG GG GGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
    41   42 B R        -     0   0  115  354   44  RRRRRRRRRRR RR RR RRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
    42   43 B I        +     0   0    8  354   63  IIIIIIIIIII II II IIIIIII     I      I  III  IIIII  I II IIIII        
    43   44 B Q        -     0   0   54  340   61  QQQQQQQQQQQ QQ QQ QQQQQQQ     Q      Q  QQQ  QQQQQ  Q QQ QQQQQ        
    44   45 B M        -     0   0   11  345   12  MMMMMMMMMMM MM MMMMMMMMMM     M      M  MMM  MMMMM  M MM MMMMM        
    45   46 B R        -     0   0   49  346   51  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
    46   47 B T  E     +A  338   0A  12  350   67  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
    47   48 B R  E     +     0   0A  56  355   56  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
    48   49 B R  E     -A  337   0A  60  355   15  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
    49   50 B T  E     -A  336   0A  30  355   27  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
    50   51 B L  E     -A  335   0A   0  355    2  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
    51   52 B R        +     0   0  159  355   41  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
    52   53 B G        +     0   0   20  355    0  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
    53   54 B H        -     0   0    4  355    0  HHHHHHHHHHH HH HHHHHHHHHH     H      H  HHH  HHHHH  H HH HHHHH        
    54   55 B L  S    S+     0   0  116  355   50  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
    55   56 B A  S    S-     0   0    0  355   30  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
    56   57 B K        -     0   0   15  355    0  KKKKKKKKKKK KK KKKKKKKKKK     K      K  KKK  KKKKK  K KK KKKKK        
    57   58 B I  E     -D   73   0B   0  355    9  IIIIIIIIIII II IIIIIIIIII     I      I  III  IIIII  I II IIIII        
    58   59 B Y  E     -     0   0B   6  355   20  YYYYYYYYYYY YY YYYYYYYYYY     Y      Y  YYY  YYYYY  Y YY YYYYY        
    59   60 B A  E     -D   72   0B  13  355   32  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
    60   61 B M  E     -D   71   0B  15  355   10  MMMMMMMMMMM MM MMMMMMMMMM     M      M  MMM  MMMMM  M MM MMMMM        
    61   62 B H  E     -D   70   0B  44  355   33  HHHHHHHHHHH HH HHHHHHHHHH     H      H  HHH  HHHHH  H HH HHHHH        
    62   63 B W  E     -D   69   0B  11  355    0  WWWWWWWWWWW WW WWWWWWWWWW     W      W  WWW  WWWWW  W WW WWWWW        
    63   64 B G    >   -     0   0    3  355   54  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  g GG GGGGG        
    64   65 B T  T 3  S+     0   0   75  355   66  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TST  TTTTT  d ST TTSTT        
    65   66 B D  T 3  S-     0   0   80  355   12  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  S DD DDDDD        
    66   67 B S  S <  S+     0   0    3  355   57  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
    67   68 B R  S    S+     0   0   94  355   47  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
    68   69 B L  E     + E   0  82B  31  355   87  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
    69   70 B L  E     -DE  62  81B   0  355   23  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
    70   71 B L  E     -DE  61  80B   0  355    7  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
    71   72 B S  E     -DE  60  79B   0  354    2  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
    72   73 B A  E     -DE  59  78B   0  354    5  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
    73   74 B S  E >>  -DE  57  77B   0  354    2  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
    74   75 B Q  T 34 S+     0   0    1  355    1  QQQQQQQQQQQ QQ QQQQQQQQQQ     Q      Q  QQQ  QQQQQ  Q QQ QQQQQ        
    75   76 B D  T 34 S-     0   0    9  355    0  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
    76   77 B G  T <4 S+     0   0    7  355    1  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
    77   78 B K  E  <  -EF  73  93B  52  355   34  KKKKKKKKKKK KK KKKKKKKKKK     K      K  KKK  KKKKK  K KK KKKKK        
    78   79 B L  E     -EF  72  92B   0  355    4  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
    79   80 B I  E     -EF  71  91B   0  355    7  IIIIIIIIIII II IIIIIIIIII     I      I  III  IIIII  I II IIIII        
    80   81 B I  E     -EF  70  90B   0  355   18  IIIIIIIIIII II IIIIIIIIII     I      I  III  IIIII  I II IIIII        
    81   82 B W  E     -EF  69  88B   0  355    0  WWWWWWWWWWW WW WWWWWWWWWW     W      W  WWW  WWWWW  W WW WWWWW        
    82   83 B D  E >>> -EF  68  87B  21  355   18  DDDDDDDDDDD DD DDDDDDVDDD     D      D  DDD  DDDDD  D DD DDDDD        
    83   84 B S  T 345S+     0   0    0  355   52  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
    84   85 B Y  T 345S+     0   0   57  354   48  YYYYYYYYYYY YY YYYYYYYYYY     Y      Y  YYY  YYYYY  Y YY YYYYY        
    85   86 B T  T <45S-     0   0   56  354    8  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
    86   87 B T  T  <5 +     0   0   43  354   36  TTTTTTTTTTT TT TTTTTTTTAT     T      T  TTT  TTTTT  T TT TTTTT        
    87   88 B N  E   < -F   82   0B  99  354   38  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NNNNN  N NN NNNNN        
    88   89 B K  E     +F   81   0B  95  354    0  KKKKKKKKKKK KK KKKKKKKKKK     K      K  KKK  KKKKK  K KK KKKKK        
    89   90 B V  E    S+     0   0B  66  353   49  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
    90   91 B H  E     -F   80   0B  57  353   18  HHHHHHHHHHH HH HHHHHHHHHH     H      H  HHH  HHHHH  H HH HHHHH        
    91   92 B A  E     -F   79   0B  43  353    8  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
    92   93 B I  E     -F   78   0B   0  353    3  IIIIIIIIIII II IIIIIIIIII     I      I  III  IIIII  I II IIIII        
    93   94 B P  E     -F   77   0B  80  353   37  PPPPPPPPPPP PP PPPPPPPPPP     P      P  PPP  PPPPP  P PP PPPPP        
    94   95 B L        -     0   0   26  354    2  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
    95   96 B R  S    S+     0   0  190  354   40  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
    96   97 B S        -     0   0   17  354   24  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
    97   98 B S  S    S+     0   0    6  354   36  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
    98   99 B W        +     0   0    2  354    3  WWWWWWWWWWW WW WWWWWWWWWW     W      W  WWW  WWWWW  W WW WWWWW        
    99  100 B V  E     -G  115   0C   4  354    1  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
   100  101 B M  E     +     0   0C   5  353    4  MMMMMMMMMMM MM MMMMMMMMMM     M      M  MMM  MMMMM  M MM MMMMM        
   101  102 B T  E     -G  114   0C   8  353   13  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   102  103 B C  E     -G  113   0C   0  353    9  CCCCCCCCCCC CC CCCCCCCCCC     C      C  CCC  CCCCC  C CC CCCCC        
   103  104 B A  E     -G  112   0C   0  353    8  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   104  105 B Y  E     -G  111   0C   9  353   10  YYYYYYYYYYY YY YYYYYYYYYY     Y      Y  YYY  YYYYY  Y YY YYYYY        
   105  106 B A    >   -     0   0    0  353   33  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   106  107 B P  T 3  S+     0   0   64  353    8  PPPPPPPPPPP PP PPPPPPPPPP     P      P  PPP  PPPPP  P PP PPPPP        
   107  108 B S  T 3  S-     0   0   47  353   31  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   108  109 B G  S <  S+     0   0    8  353   14  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   109  110 B N  S    S+     0   0   50  353   43  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NNNNN  N NN NNNNN        
   110  111 B Y  E     - H   0 124C  50  353   55  YYYYYYYYYYY YY YYYYYYYYYY     Y      Y  YYY  YYYYY  Y YY YYYYY        
   111  112 B V  E     -GH 104 123C   0  353    5  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
   112  113 B A  E     +GH 103 122C   0  353    4  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   113  114 B C  E     +GH 102 121C   5  353   10  CCCCCCCCCCC CC CCCCCCCCCC     C      C  CCC  CCCCC  C CC CCCCC        
   114  115 B G  E     +GH 101 120C   1  353    6  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   115  116 B G  E >  S-G   99   0C   0  353    0  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   116  117 B L  T 3  S+     0   0    1  353    1  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   117  118 B D  T 3  S-     0   0   50  353    3  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   118  119 B N  S <  S+     0   0   30  353   21  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NNNNN  N NN NNNNN        
   119  120 B I  E     - I   0 139C  39  353   43  IIIIIIIIIII II IIIIIIIIII     I      I  III  IIIII  I II IIIII        
   120  121 B C  E     -HI 114 138C   0  353    7  CCCCCCCCCCC CC CCCCCCCCCC     C      C  CCC  CCCCC  C CC CCCCC        
   121  122 B S  E     -HI 113 137C   9  353   14  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   122  123 B I  E     -HI 112 136C   0  353    6  IIIIIIIIIII II IIIIIIIIII     I      I  III  IIIII  I II IIIII        
   123  124 B Y  E     -H  111   0C   3  353    4  YYYYYYYYYYY YY YYYYYYYYYY     Y      Y  YYY  YYYYY  Y YY YYYYY        
   124  125 B N  E     +H  110   0C  24  353   45  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NSNNS  N NN NNNNN        
   125  126 B L        +     0   0   11  353   12  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   126  127 B K  S    S+     0   0  109  353   60  KKKKKKKKKKK KK KKKKKKKKKK     K      K  KKK  KKKKK  K KK KKKKK        
   127  128 B T  S    S-     0   0   64  353   71  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   128  129 B R  S    S+     0   0  267  336   26  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
   129  130 B E  S    S-     0   0  173  340   28  EEEEEEEEEEE EE EEEEEEEEEE     E      E  EEE  EEEEE  E EE EEEEE        
   130  131 B G        -     0   0   50  351   25  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   131  132 B N        +     0   0   30  349   59  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NNNNN  N NN NNNNN        
   132  133 B V  S    S+     0   0   58  329   58  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
   133  134 B R  S    S-     0   0  213  347   44  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
   134  135 B V        -     0   0   29  352   27  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
   135  136 B S  S    S-     0   0   43  352   59  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   136  137 B R  E     -I  122   0C 105  344   18  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
   137  138 B E  E     -I  121   0C  75  346   40  EEEEEEEEEEE EE EEEEEEEEEE     E      E  EEE  EEEEE  E EE EEEEE        
   138  139 B L  E     +I  120   0C   1  349    5  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   139  140 B A  E     +I  119   0C  61  351   61  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   140  141 B G        +     0   0   50  351   27  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   141  142 B H        -     0   0    9  352    8  HHHHHHHHHHH HH HHHHHHHHHH     H      H  HHH  HHHHH  H HH HHHHH        
   142  143 B T  S    S+     0   0   64  352   62  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   143  144 B G  S    S-     0   0    0  352    8  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   144  145 B Y        -     0   0    0  352    1  YYYYYYYYYYY YY YYYYYYYYYY     Y      Y  YYY  YYYYY  Y YY YYYYY        
   145  146 B L  E     +J  160   0D   0  352   18  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   146  147 B S  E     -     0   0D   3  352    1  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   147  148 B C  E     -J  159   0D   9  353   29  CCCCCCCCCCC CC CCCCCCCCCC     C      C  CCC  CCCCC  C CC CCCCC        
   148  149 B C  E     -J  158   0D   0  353    6  CCCCCCCCCCC CC CCCCCCCCCC     C      C  CCC  CCCCC  C CC CCCCC        
   149  150 B R  E     -J  157   0D  53  353   33  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
   150  151 B F  E     -J  156   0D  10  353    2  FFFFFFFFFFF FF FFFFFFFFFF     F      F  FFF  FFFFF  F FF FFFFF        
   151  152 B L  S    S-     0   0   26  353   35  LLLLLLLLLLL LL LLLLLLLLLL     V      L  LLL  LLLVL  L LL LLLLI        
   152  153 B D  S    S-     0   0   60  353   56  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   153  154 B D  S    S+     0   0   60  353   13  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   154  155 B N  S    S+     0   0   44  353   76  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NNNSN  N NN NNNNN        
   155  156 B Q  E     + K   0 169D  60  353   66  QQQQQQQQQQQ QQ QQQQQQQQQQ     Q      Q  QQQ  QQQQQ  Q QQ QQQQQ        
   156  157 B I  E     -JK 150 168D   0  354   13  IIIIIIIIIII II IIIIIIIIII     I      I  III  IIIII  I II IIIII        
   157  158 B V  E     -JK 149 167D   0  354   27  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVII        
   158  159 B T  E     -JK 148 166D   0  353    0  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   159  160 B S  E     -JK 147 165D   0  352   19  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSR  S SS SSSSS        
   160  161 B S  E >   -J  145   0D   0  352    0  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   161  162 B G  T 3  S+     0   0    0  352    0  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   162  163 B D  T 3  S-     0   0    5  352    0  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   163  164 B T  S <  S+     0   0    8  353   76  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   164  165 B T        -     0   0    2  353   17  TTTTTTTTTTT TT TTTTTTTTTS     T      T  TTT  TTSTT  T TT TTTTT        
   165  166 B C  E     -KL 159 179D   0  352    1  CCCCCCCCCCC CC CCCCCCCCCC     C      C  CCC  CCCCC  C CC CCCCC        
   166  167 B A  E     -KL 158 178D   0  353   70  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   167  168 B L  E     -KL 157 177D   6  353   29  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   168  169 B W  E     -KL 156 175D   2  353    0  WWWWWWWWWWW WW WWWWWWWWWW     W      W  WWW  WWWWW  W WW WWCWW        
   169  170 B D  E >>> -KL 155 174D  37  353    1  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDYDD        
   170  171 B I  T 345S+     0   0    7  353   13  IIIIIIIIIII II IIIIIIIIII     I      I  III  IIIII  I II IIIII        
   171  172 B E  T 345S+     0   0  144  353   32  EEEEEEEEEEE EE EEEEEEEEEE     E      E  EEE  EEEEE  E EE EEEEE        
   172  173 B T  T <45S-     0   0   78  353   40  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   173  174 B G  T  <5 +     0   0   16  353   12  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   174  175 B Q  E   < -L  169   0D 135  353   74  QQQQQQQQQQQ QQ QQQQQQQQQQ     Q      Q  QQQ  QQQQQ  Q QQ QQQQQ        
   175  176 B Q  E     -L  168   0D  30  353   58  QQQQQQQQQQQ QQ QQQQQQQQQQ     Q      Q  QQQ  QQQQQ  Q QQ QQQQQ        
   176  177 B T  E     +     0   0D  64  353   70  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   177  178 B T  E     -L  167   0D  20  353   63  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   178  179 B T  E     -L  166   0D   5  354   78  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   179  180 B F  E     +L  165   0D   1  354    0  FFFFFFFFFFF FF FFFFFFFFFF     F      F  FFF  FFFFF  F FF FFFFF        
   180  181 B T        +     0   0   34  354   73  TTTTTTTTTTT TT TTTTTTTTTA     A      T  AAA  TAAAA  A AT AAATA        
   181  182 B G        +     0   0   37  354   33  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   182  183 B H        -     0   0    7  354    0  HHHHHHHHHHH HH HHHHHHHHHH     H      H  HHH  HHHHH  H HH HHHHH        
   183  184 B T  S    S+     0   0   99  354   69  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   184  185 B G  S    S-     0   0    0  354   17  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   185  186 B D        -     0   0    1  354    0  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   186  187 B V  E     -M  202   0E   0  354   18  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
   187  188 B M  E     +     0   0E   3  354   11  MMMMMMMMMMM MM MMMMMMMMMM     M      M  MMM  MMMMM  M MM MMMMM        
   188  189 B S  E     -M  201   0E  16  354   17  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   189  190 B L  E     -M  200   0E   3  354   28  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   190  191 B S  E     -M  199   0E  21  354   23  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   191  192 B L  E     -M  198   0E  29  354   32  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   192  193 B A    >   -     0   0    4  354   63  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA SSAAA        
   193  194 B P  T 3  S+     0   0   85  354   30  PPPPPPPPPPP PP PPPPPPPPPP     P      P  PPP  PPPPP  P PP PPPPP        
   194  195 B D  T 3  S-     0   0   87  354   71  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   195  196 B T  S <  S+     0   0   62  354   89  TTTTTTTTTTT TT TTTTTTTTTT     T      A  TSS  ATTTT  T SS TSSSS        
   196  197 B R  S    S+     0   0  142  355   76  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
   197  198 B L  E     - N   0 211E  37  351   70  LLLLLLLLLLL LL LLLLLLLLLL     L      C  MLL  CLLLL  L LC SLLCC        
   198  199 B F  E     -MN 191 210E   0  351    0  FFFFFFFFFFF FF FFFFFFFFFF     F      F  FFF  FFFFF  F FF FFFFF        
   199  200 B V  E     -MN 190 209E   0  352   12  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
   200  201 B S  E     -MN 189 208E   0  353    3  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   201  202 B G  E     +MN 188 207E   0  355    3  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   202  203 B A  E >   -M  186   0E   0  354   31  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   203  204 B C  T 3  S+     0   0    5  354    7  CCCCCCCCCCC CC CCCCCCCCCC     C      C  CCC  CCCCC  C CC CCCCC        
   204  205 B D  T 3  S-     0   0   31  354    0  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   205  206 B A  S <  S+     0   0   20  354   39  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   206  207 B S  E     - O   0 222E   6  354   82  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   207  208 B A  E     -NO 201 221E   0  354   28  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   208  209 B K  E     -NO 200 220E  18  354   20  KKKKKKKKKKK KK KKKKKKKKKK     K      K  KKK  KKKKK  K KK KKKKK        
   209  210 B L  E     -NO 199 219E   2  354   11  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   210  211 B W  E     -NO 198 217E   1  354    0  WWWWWWWWWWW WW WWWWWWWWWW     W      W  WWW  WWWWW  W WW WWWWW        
   211  212 B D  E >>> -NO 197 216E  11  354    0  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   212  213 B V  T 345S+     0   0   12  354   39  VVVVVVVVVVV VV VVVVVVVVVV     V      V  IIV  VIIVI  I II VIIVV        
   213  214 B R  T 345S+     0   0  194  354    0  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
   214  215 B E  T <45S-     0   0  111  353   69  EEEEEEEEEEE EE EEEEEEEEEE     E      E  EEE  EEEEE  E EE EEEEE        
   215  216 B G  T  <5 +     0   0    8  354   39  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   216  217 B M  E      -     0   0    1  353    5  FFFFFFFFFFF FF FFFFFFFFFF     F      F  FFF  FFFFF  F FF FFFFF        
   235  236 B P  T 3  S+     0   0   45  353    4  PPPPPPPPPPP PP PPPPPPPPPP     P      P  PPP  PPPPP  P PP PPPPP        
   236  237 B N  T 3  S-     0   0   42  353   42  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NNNNN  N NN NNNNN        
   237  238 B G  S <  S+     0   0   12  353    5  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   238  239 B N  S    S+     0   0   56  353   67  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NNNNN  N NN NNNNN        
   239  240 B A  E     - Q   0 253F   0  353   48  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   240  241 B F  E     -PQ 233 252F   0  353   14  FFFFFFFFFFF FF FFFFFFFFFF     F      F  FFF  FFFFF  F FF FFFFF        
   241  242 B A  E     -PQ 232 251F   0  353   59  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   242  243 B T  E     -PQ 231 250F   0  353    6  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   243  244 B G  E     +PQ 230 249F   0  353    0  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   244  245 B S  E >   -P  228   0F   0  353    0  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   245  246 B D  T 3  S+     0   0   13  353    2  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   246  247 B D  T 3  S-     0   0   28  353    0  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   247  248 B A  S <  S+     0   0    6  353   38  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   248  249 B T        -     0   0   16  353   41  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   249  250 B C  E     -QR 243 263F   0  353   12  CCCCCCCCCCC CC CCCCCCCCCC     C      C  CCC  CCCCC  C CC CCCCC        
   250  251 B R  E     -QR 242 262F  23  353    7  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
   251  252 B L  E     -QR 241 261F   0  353    1  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   252  253 B F  E     -QR 240 259F   1  352    1  FFFFFFFFFFF FF FFFFFFFFFF     F      F  FFF  FFFFF  F FF FFFFF        
   253  254 B D  E  >> -QR 239 258F   1  352    0  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   254  255 B L  T >45S+     0   0   15  352   28  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   255  256 B R  T 345S+     0   0   57  352    1  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
   256  257 B A  T 345S-     0   0    0  352   29  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   257  258 B D  T <<5 +     0   0    0  352   23  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   258  259 B Q  E      -     0   0  119  354   72  HHHHHHHHHHH HH HHHHHHHHHH     H      H  HHH  HHHHH  H HH HHHHH        
   266  267 B D  T 3  S+     0   0  161  354   42  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   267  268 B N  T 3  S+     0   0   66  354   66  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NNNNN  N NN NNNNN        
   268  269 B I    <   +     0   0   23  354   48  IIIIIIIIIII II IIIIIIIIII     I      I  III  IIIII  I II IIIII        
   269  270 B I        +     0   0   97  354   54  IIIIIIIIIII II IIIIIIIIII     I      I  III  IIIII  I II IIIII        
   270  271 B C  S    S-     0   0   10  354   48  CCCCCCCCCCC CC CCCCCCCCCC     C      C  CCC  CCCCC  C CC CCCCC        
   271  272 B G        -     0   0    1  355   28  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   272  273 B I  E     +S  288   0G   0  355   15  IIIIIIIIIII II IIIIIIIIII     I      I  III  IIIII  I II IIIII        
   273  274 B T  E     +     0   0G  13  355   15  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   274  275 B S  E     +S  287   0G  18  355    1  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   275  276 B V  E     +S  286   0G  10  355   16  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
   276  277 B S  E     -S  285   0G  15  354   25  SSSSSSSSSSS SS SSSSSSSSSA     A      A  AAA  AAAAA  A AA AAAAA        
   277  278 B F  E     -S  284   0G  12  354   30  FFFFFFFFFFF FF FFFFFFFFFF     F      F  FFF  FFFFF  F FF FFFFF        
   278  279 B S        -     0   0    3  354    4  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   279  280 B K  S    S+     0   0  104  354   81  KKKKKKKKKKK KK KKKKKKKKKK     K      K  KKK  KKKKK  K KK KKKKK        
   280  281 B S  S    S-     0   0    2  354    3  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   281  282 B G  S    S+     0   0    0  354    1  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   282  283 B R        +     0   0    8  354    0  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
   283  284 B L  E     - T   0 297G   0  354   11  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   284  285 B L  E     -ST 277 296G   0  354    5  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   285  286 B L  E     -ST 276 295G   0  354   15  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   286  287 B A  E     -ST 275 294G   0  355   18  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   287  288 B G  E     -ST 274 293G   2  355   11  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   288  289 B Y  E >   -S  272   0G   4  355    1  YYYYYYYYYYY YY YYYYYYYYYY     Y      Y  YYY  YYYYY  Y YY YYYYY        
   289  290 B D  T 3  S+     0   0    3  355   34  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   290  291 B D  T 3  S-     0   0   37  355   17  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   291  292 B F  S <  S+     0   0    3  355   44  FFFFFFFFFFF FF FFFFFFFFFF     F      F  FFF  FFFFF  F FF FFFFF        
   292  293 B N        -     0   0   15  355   49  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NNNNN  N NN NNNNN        
   293  294 B C  E     -TU 287 307G   0  355   10  CCCCCCCCCCC CC CCCCCCCCCC     C      C  CCC  CCCCC  C CC CCCCC        
   294  295 B N  E     -TU 286 306G   5  355   74  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NNNNN  N NN NNNNN        
   295  296 B V  E     -TU 285 305G   0  355   16  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
   296  297 B W  E     -TU 284 303G   6  355    0  WWWWWWWWWWW WW WWWWWWWWWW     W      W  WWW  WWWWW  W WW WWWWW        
   297  298 B D  E  >  -T  283   0G   4  355    0  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   298  299 B A  T  4 S+     0   0    0  355   65  AAAAAAAAAAA AA AAAAAAAAAA     T      T  TTT  TTTST  T TT TTTTT        
   299  300 B L  T  4 S+     0   0    0  355   27  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   300  301 B K  T  4 S-     0   0   29  355   53  KKKKKKKKKKK KK KKKKKKKKKK     K      K  KKK  KKKKK  K KK KKKKK        
   301  302 B A  S  < S+     0   0   17  355   52  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AGAAA        
   302  303 B D  S    S-     0   0   95  355   52  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   303  304 B R  E     -U  296   0G  69  354   61  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
   304  305 B A  E     -     0   0G  14  355   63  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   305  306 B G  E     -U  295   0G   4  355   27  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   306  307 B V  E >   -U  294   0G   7  355   69  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
   307  308 B L  E >  S+U  293   0G   2  350   36  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   308  309 B A  G >  S-     0   0    4  351   70  AAAAAAAAAAA AA AAAAAAAAAA     A      A  AAA  AAAAA  A AA AAAAA        
   309  310 B G  G <   -     0   0    4  353   21  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   310  311 B H  G <  S+     0   0    8  353    0  HHHHHHHHHHH HH HHHHHHHHHH     H      H  HHH  HHHHH  H HH HHHHH        
   311  312 B D    <   -     0   0   26  353   32  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   312  313 B N  S    S+     0   0   31  353   16  NNNNNNNNNNN NN NNNNNNNNNN     N      N  NNN  NNNNN  N NN NNNNN        
   313  314 B R        +     0   0   40  353    5  RRRRRRRRRRR RR RRRRRRRRRR     R      R  RRR  RRRRR  R RR RRRRR        
   314  315 B V        +     0   0    2  353   10  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
   315  316 B S  S    S-     0   0    2  353   10  SSSSSSSSSSS SS SSSSSSSSSS     S      S  SSS  SSSSS  S SS SSSSS        
   316  317 B C  E     -B  329   0A  10  353   17  CCCCCCCCCCC CC CCCCCCCCCC     C      C  CCC  CCCCC  C CC CCCCC        
   317  318 B L  E     -B  328   0A  15  353   13  LLLLLLLLLLL LL LLLLLLLLLL     L      L  LLL  LLLLL  L LL LLLLL        
   318  319 B G  E     -B  327   0A  10  353   13  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   319  320 B V  E     -B  326   0A  25  353   19  VVVVVVVVVVV VV VVVVVVVVVV     V      V  VVV  VVVVV  V VV VVVVV        
   320  321 B T    >   -     0   0    3  353   52  TTTTTTTTTTT TT TTTTTTTTTT     T      T  TTT  TTTTT  T TT TTTTT        
   321  322 B D  T 3  S+     0   0   98  353   70  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   322  323 B D  T 3  S-     0   0   51  352    9  DDDDDDDDDDD DD DDDDDDDDDD     D      D  DDD  DDDDD  D DD DDDDD        
   323  324 B G  S <  S+     0   0    0  352    4  GGGGGGGGGGG GG GGGGGGGGGG     G      G  GGG  GGGGG  G GG GGGGG        
   324  325 B M  S    S+     0   0   36  350   62  MMMMMMMMMMM MM MMMMMMMMMM     M         MMM  MMMMM    MM MMMMM        
   325  326 B A        -     0   0    0  350   30  AAAAAAAAAAA AA AAAAAAAAAA     A         AAA  AAAAA    AA AAAAA        
   326  327 B V  E     -BC 319 338A   0  350   33  VVVVVVVVVVV VV VVVVVVVVVV     V         VVV  VVVVV    VV VVVVV        
   327  328 B A  E     -BC 318 337A   0  349   47  AAAAAAAAAAA AA AAAAAAAAAA     A         AAA  AAAAA    AA AAAAA        
   328  329 B T  E     -BC 317 336A   7  349    4  TTTTTTTTTTT TT TTTTTTTKTT     T         TTT  TTTTT    TT TTTTT        
   329  330 B G  E     -BC 316 335A   1  349    4  GGGGGGGGGGG GG GGGGGGGGGG     G         GGG  GGGGG    GG GGGGG        
   330  331 B S    >   -     0   0    6  349    0  SSSSSSSSSSS SS SSSSSSSSSS     S         SSS  SSSSS    SS SSSSS        
   331  332 B W  T 3  S+     0   0    6  349    0  WWWWWWWWWWW WW WWWWWWWWWW     W         WWW  WWWWW    WW WWWWW        
   332  333 B D  T 3  S-     0   0   17  349    0  DDDDDDDDDDD DD DDDDDDDDDD     D         DDD  DDDDD    DD DDDDD        
   333  334 B S  S <  S+     0   0   12  349   35  SSSSSSSSSSS SS SSSSSSSSSS     S         SSS  SSSSS    SS SSSSS        
   334  335 B F        -     0   0   78  349   71  FFFFFFFFFFF FF FFFFFFFFFF     F         FFF  FFFFF    FF FFFFF        
   335  336 B L  E     -AC  50 329A   1  349    8  LLLLLLLLLLL LL LLLLLLLLLL     L         LLL  LLLLL    LL LLLLL        
   336  337 B K  E     -AC  49 328A  60  346   23  KKKKKKKKKKK KK KKKKKKKKKK     K         KKK  KKKKK    KK KKKKK        
   337  338 B I  E     -AC  48 327A   0  344   13  IIIIIIIIIII II IIIIIIIIII     I         III  IIIII    II IIIII        
   338  339 B W  E      AC  46 326A   2  341    0  WWWWWWWWWWW WW WWWWWWWWWW     W         WWW  WWWWW    WW WWWWW        
   339  340 B N              0   0   10  297   57  NNNNNNNNNNN NN  NNNNNNNNN     N         NNN  NNNNN    NN NNNNN        
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   80    0             P  P          PPPPP PPPPPP PP   PP     PP P  P     PPPP P  
   342    3 G V        +     0   0   96   82   63             V  V          VVVVV VVVVVV VV   VV     VV V  V     VVVV V  
   343    4 G I        -     0   0   38   84   34             I  I          IIIII IIIIII II   II     II I  I     IIII I  
   344    5 G N    >   -     0   0  109   84   59             N  N          NNNNN NNNNNN NN   NN     NN N  N     NNNN N  
   345    6 G I  G >  S+     0   0   25   84   30             I  I          IIIII IIIIII II   II     II I  I     IIII I  
   346    7 G E  G 3  S+     0   0  122  126   44             E  E          EEEEE EEEEEE EE   EE     EE E  E     EEEE E  
   347    8 G D  G <  S+     0   0  133  137   21             D  D          DDDDD DDDDDD DD   DD     DD D  D     DDDD D  
   348    9 G L    <   -     0   0   35  141   15             L  L          LLLLL LLLLLL LL   LL     LL L  L     LLLL L  
   349   10 G T     >  -     0   0   69  141   62             T  T          TTTTT TTTTTT TT   TT     TT T  T     TTTT T  
   350   11 G E  H  > S+     0   0  116  143   33             E  E          EEEEE EEEEEE EE   EE     EE E  E     EEEE E  
   351   12 G K  H >> S+     0   0   66  152   41             K  K          KKKKK KKKKKK KK   KK     KK K  K     KKKK K  
   352   13 G D  H 3> S+     0   0   39  152   35             D  D          DDDDD DDDDDD DD   DD     DD D  D     DDDD D  
   353   14 G K  H 3X S+     0   0   83  152   84             K  K          KKKKK KKKKKK KK   KK     KK K  K     KKKK K  
   354   15 G L  H < S+     0   0    7  233    6             E  E          EEEEE EEEEEE EE   EE     EE E  E     EEEE E  
   365   26 G V  H 3< S+     0   0   43  233   53             V  V          VVVVV VVVVVV VV   VV     VV V  V     VVVV V  
   366   27 G T  T 3< S+     0   0  116  233   82             T  T          TTTTT TTTTTT TT   TT     TT T  T     TTTT T  
   367   28 G L    <   -     0   0   49  233   61             L  L          LLLLL LLLLLL LL   LL     LL L  L     LLLL L  
   368   29 G E        -     0   0  191  233   49             E  E          EEEEE EEEEEE EE   EE     EE E  E     EEEE E  
   369   30 G R        -     0   0   32  233    1             R  R          RRRRR RRRRRR RR   RR     RR R  R     RRRR R  
   370   31 G M        -     0   0   53  233   85             M  M          MMMMM MMMMMM MM   MM     MM M  M     MMMM V  
   371   32 G L     >  -     0   0   75  232   81             L  L          LLLLL LLLLLL LL   LL     LL L  L     LLML M  
   372   33 G V  H  > S+     0   0    4  232   15             V  V          VVVVV VVVVVV VV   VV     VV V  V     VVVV V  
   373   34 G S  H  > S+     0   0   14  232    1             S  S          SSSSS SSSSSS SS   SS     SS S  S     SSSS S  
   374   35 G K  H  > S+     0   0   93  232   38             K  K          KKKKK KKKKKK KK   KK     KK K  K     KKKK K  
   375   36 G C  H  X S+     0   0    0  233   62             C  C          CCCCC CCCCCC CC   CC     CC C  C     CCCA C  
   376   37 G C  H  X S+     0   0    0  233   63             C  C          CCCCC CCCCCC CC   CC     CC C  C     CCCC C  
   377   38 G E  H  X S+     0   0   75  233   68             E  E          EEEEE EEEEEE EE   EE     EE E  E     EEEE E  
   378   39 G E  H  X S+     0   0   60  233   26             E  E          EEEEE EEEEEE EE   EE     EE E  E     EEEE E  
   379   40 G F  H  X S+     0   0    3  233   36             F  F          VVVVV VVVVVV VV   VV     VV V  V     VVVV V  
   380   41 G R  H  X S+     0   0   53  233   79             R  R          RRRRR RRRRRR RR   RR     KR R  R     RRRR R  
   381   42 G D  H  X S+     0   0   67  233   65             D  D          DDDDD DDDDDD DD   DD     DD D  D     DDDD D  
   382   43 G Y  H  X S+     0   0   43  233    2             Y  Y          YYYYY YYYYYY YY   YY     YY Y  Y     YYYY Y  
   383   44 G V  H >X S+     0   0    0  233   58             V  V          VVVVV VVVVVV VV   VV     VV V  V     VVIV I  
   384   45 G E  H 3X S+     0   0   71  233   47             E  E          EEEEE EEEEEE EE   EE     EE E  E     EEEE E  
   385   46 G E  H 3< S+     0   0  125  233   57             E  E          EEEEE EEEEEE EE   EE     EE E  E     EEEE E  
   386   47 G R  H XX S+     0   0   94  233   69             R  R          RRRRR RRRRRR RR   RR     RR R  R     RRRR R  
   387   48 G S  H >< S+     0   0   12  233   67             S  S          SSSSS SSSSSS SS   SS     SS S  S     SSSS S  
   388   49 G G  T 3< S+     0   0   38  233   80             G  G          GGGGG GGGGGG GG   GG     GG G  G     GGGG R  
   389   50 G E  T <4 S+     0   0  138  232   54             E  E          EEEEE EEEEEE EE   EE     EE E  E     EDEE E  
   390   51 G D    XX> -     0   0    1  232    0             D  D          DDDDD DDDDDD DD   DD     DD D  D     DDDD D  
   391   52 G P  H 3>5S+     0   0   17  233   25             P  P          PPPPP PPPPPP PP   PP     PP P  P     PPPP P  
   392   53 G L  H 345S+     0   0    6  233    3             L  L          LLLLL LLLLLL LL   LL     LL L  L     LLLL L  
   393   54 G V  H <45S+     0   0   24  233   29             V  V          VVVVV VVVVVV VV   VV     VV I  V     VVVV V  
   394   55 G K  H  <5S-     0   0  149  233   80             K  K          KKKKK KKKKKK KK   KK     KK K  K     KKKK K  
   395   56 G G     << -     0   0   38  233   34             G  G          GGGGG GGGGGG GG   GG     GG G  G     GGGG G  
   396   57 G I        -     0   0   21  224   20             I  I          IIIII IIIIII II   II     IV I  V     VIIV I  
   397   58 G P    >>  -     0   0   80  233   11             P  P          PPPPP PPPPPP PP   PP     PP P  P     PPPP P  
   398   59 G E  T 34 S+     0   0   75  233   58             E  E          EEEEE EEEEEE EE   EE     EE E  E     EEEE E  
   399   60 G D  T 34 S+     0   0  151  233   61             D  D          DDDDD DDDDDD DD   DD     DD D  D     EDDD D  
   400   61 G K  T <4 S+     0   0  163  233   62             K  K          KKKKK KKKKKK KK   KK     KK K  K     KKKK K  
   401   62 G N     <  -     0   0    1  233    0             N  N          NNNNN NNNNNN NN   NN     NN N  N     NNNN N  
   402   63 G P  S    S+     0   0   36  224    0             P  P          PPPPP PPPPPP PP   PP     PP P  P     PPPP P  
   403   64 G F  S    S-     0   0    3  224    0             F  F          FFFFF FFFFFF FF   FF     FF F  F     FFFF F  
   404   65 G K              0   0  108  222   29             K  K          KKKKK KKKKKK KK   KK     KK K  K     KKKK K  
   405   66 G E              0   0  201  217    3             E  E          EEEEE EEEEEE EE   EE     EE E  E     EEEE E  
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   62   10                                                                        
   408   14 P E        +     0   0  153  142   39                                                                        
   409   15 P G  S    S+     0   0   38  144   37                                                                        
   410   16 P Q  S    S-     0   0   94  148   90                                                                        
   411   17 P A        +     0   0    1  149   53                                                                        
   412   18 P S        +     0   0   28  149   71                                                                        
   413   19 P H  S    S+     0   0   42  151   57                                                                        
   414   20 P T  S  > S-     0   0    2  152   17                                                                        
   415   21 P G  H  > S-     0   0   10  164    2                                                                        
   416   22 P P  H  > S+     0   0   14  165    0                                                                        
   417   23 P K  H  > S+     0   0    6  165    0                                                                        
   418   24 P G  H  X S+     0   0    0  165    1                                                                        
   419   25 P V  H  X S+     0   0    0  165    0                                                                        
   420   26 P I  H  X S+     0   0    4  165   14                                                                        
   421   27 P N  H  X S+     0   0   48  165   42                                                                        
   422   28 P D  H  X S+     0   0   14  166    0                                                                        
   423   29 P W  H  X S+     0   0    6  166    0                                                                        
   424   30 P R  H  < S+     0   0   67  166   26                                                                        
   425   31 P K  H >X S+     0   0   67  166   36                                                                        
   426   32 P F  H >X>S+     0   0    1  166    1                                                                        
   427   33 P K  H 3<5S+     0   0   30  166    7                                                                        
   428   34 P L  H <45S+     0   0  139  161    1                                                                        
   429   35 P E  H <<5S+     0   0   86  161    9                                                                        
   430   36 P S  T  <5       0   0   57  162   66                                                                        
   431   37 P E      <       0   0  118  167   66                                                                        
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  143   42                                                                        
   434   69 P S        +     0   0   52  144   64                                                                        
   435   70 P R        -     0   0  103  120   85                                                                        
   436   71 P K        +     0   0   22  123   12                                                                    K K 
   437   72 P M  S    S-     0   0   12  124   13                                                                    M MM
   438   73 P S     >  -     0   0   52  131   65                                                                    S SS
   439   74 P V  H  > S+     0   0  107  130   53                                                                    I II
   440   75 P Q  H  > S+     0   0  133  130   52                                                                    Q QQ
   441   76 P E  H  > S+     0   0   38  134   26                                                                    E EE
   442   77 P Y  H  X S+     0   0   36  146   56                                                                    Y YY
   443   78 P E  H  < S+     0   0  111  154   61                                                                    E EE
   444   79 P L  H >X S+     0   0   45  155   57                                                                    L LL
   445   80 P I  H 3< S+     0   0   37  157   72                                                                    I II
   446   81 P H  T 3< S+     0   0  178  158   80                                                                    H HH
   447   82 P K  T <4 S+     0   0  140  157   65                                                                    K KQ
   448   83 P D     <  -     0   0   58  169   39                                                                    E ED
   449   84 P K        -     0   0  205  149   80                                                                    K KK
   450   85 P E        -     0   0   45  150   68                                                                    E EE
   451   86 P D    >>  -     0   0   87  169   31                                                                    D DD
   452   87 P E  H 3> S+     0   0  113  168   12                                                                    E EE
   453   88 P N  H 3> S+     0   0   73  169   59                                                                    N NN
   454   89 P C  H <> S+     0   0   32  170   72                                                                    C CC
   455   90 P L  H  X S+     0   0    4  170    2                                                                    L LL
   456   91 P R  H  X S+     0   0  131  170   63                                                                    R RR
   457   92 P K  H  X S+     0   0  112  170   59                                                                    K KK
   458   93 P Y  H  X S+     0   0    7  170    5                                                                    Y YY
   459   94 P R  H  X S+     0   0   31  170   31                                                                    R RR
   460   95 P R  H  X S+     0   0  130  170   43                                                                    R RR
   461   96 P Q  H  X S+     0   0   96  170   30                                                                    Q QQ
   462   97 P C  H  X S+     0   0   22  170   72                                                                    C CC
   463   98 P M  H  X S+     0   0   33  170   11                                                                    M MM
   464   99 P Q  H  X S+     0   0  115  170   54                                                                    Q QQ
   465  100 P D  H  X S+     0   0   46  170   21                                                                    D DD
   466  101 P M  H  X S+     0   0   23  170    2                                                                    M MM
   467  102 P H  H  X S+     0   0   64  170   74                                                                    H HH
   468  103 P Q  H  < S+     0   0  143  170   59                                                                    Q QQ
   469  104 P K  H  < S+     0   0  140  170   55                                                                    K KK
   470  105 P L  H  < S+     0   0   35  170   43                                                                    L LL
   471  106 P S     <  -     0   0   75  170   79                                                                    S SS
   472  107 P F        -     0   0   71  168   99                                                                    F FF
   473  108 P G        -     0   0   36  168   51                                                                    G GG
   474  109 P P        +     0   0   92  160   41                                                                    P PP
   475  110 P R        +     0   0  177  165   61                                                                    R RR
   476  111 P Y        +     0   0   51  166    5                                                                    Y YY
   477  112 P G        +     0   0   12  170   61                                                                    G GG
   478  113 P F  S    S-     0   0  151  170  103                                                                    F FF
   479  114 P V  E     -v  532   0H  28  170   13                                                                    V VV
   480  115 P Y  E     -v  533   0H  71  165   68                                                                    Y YY
   481  116 P E  E     -v  534   0H 108  170   41                                                                    E EE
   482  117 P L        -     0   0   12  170   32                                                                    L LL
   483  118 P E        +     0   0  134  170   74                                                                    E EE
   484  119 P S  S >> S-     0   0   57  170   53                                                                    T TT
   485  120 P G  H 3> S+     0   0   15  169   40                                                                    G GG
   486  121 P E  H 3> S+     0   0  127  170   23                                                                    E EE
   487  122 P Q  H <> S+     0   0   72  170   61                                                                    Q QQ
   488  123 P F  H  X S+     0   0   26  170    1                                                                    F FF
   489  124 P L  H  X S+     0   0   90  170    6                                                                    L LL
   490  125 P E  H  X S+     0   0  103  170   41                                                                    E EE
   491  126 P T  H  < S+     0   0   10  170   76                                                                    T TT
   492  127 P I  H  < S+     0   0   17  170   12                                                                    I II
   493  128 P E  H  < S+     0   0  139  170   20                                                                    E EE
   494  129 P K  S  < S+     0   0  172  170   35                                                                    K KK
   495  130 P E  S    S-     0   0   38  166    5                                                                    E EE
   496  131 P Q    >   -     0   0  116  170   66                                                                    Q QQ
   497  132 P K  T 3  S+     0   0  156  170   34                                                                    K KK
   498  133 P I  T 3  S+     0   0   68  170   87                                                                    I IV
   499  134 P T    <   -     0   0   10  170   35                                                                    T TT
   500  135 P T  E     -W  558   0H   7  169   62                                                                    T TT
   501  136 P I  E     -Wx 557 531H   3  170   15                                                                    I II
   502  137 P V  E     -Wx 556 532H   0  170   35                                                                    V VV
   503  138 P V  E     -Wx 555 533H   0  170   12                                                                    V VV
   504  139 P H  E     -Wx 554 534H   0  170    6                                                                    H HN
   505  140 P I  E     +Wx 553 535H   2  170    1                                                                    I II
   506  141 P Y  E     - x   0 536H   4  170    2                                                                    Y YY
   507  142 P E    >   -     0   0   45  170   26                                                                    E EE
   508  143 P D  T 3  S+     0   0   95  170   51                                                                    D DD
   509  144 P G  T 3  S+     0   0   66  170   48                                                                    G GG
   510  145 P I  S X> S-     0   0   36  170   33                                                                    I IV
   511  146 P K  T 34 S+     0   0  191  170   71                                                                    K KK
   512  147 P G  T 3> S+     0   0   13  170   22                                                                    G GG
   513  148 P C  H <> S+     0   0    0  170   35                                                                    C CC
   514  149 P D  H  X S+     0   0   78  170   47                                                                    D DD
   515  150 P A  H  > S+     0   0   44  170   50                                                                    A AA
   516  151 P L  H  X S+     0   0    0  170   11                                                                    L LL
   517  152 P N  H  X S+     0   0   19  170   16                                                                    N NN
   518  153 P S  H  X S+     0   0   78  170   56                                                                    D SS
   519  154 P S  H  X S+     0   0    6  170   35                                                                    S SS
   520  155 P L  H  X S+     0   0    1  170   10                                                                    L LL
   521  156 P I  H  X S+     0   0  105  170   85                                                                    T TA
   522  157 P C  H  X S+     0   0   63  170   38                                                                    C CC
   523  158 P L  H  X S+     0   0    0  170    4                                                                    L LL
   524  159 P A  H  < S+     0   0    1  170    9                                                                    A AA
   525  160 P A  H  < S+     0   0   61  170   67                                                                    A AV
   526  161 P E  H  < S+     0   0   72  170   23                                                                    E EE
   527  162 P Y    ><  +     0   0    5  170    2                                                                    Y YY
   528  163 P P  T 3  S+     0   0   28  170   29                                                                    P PP
   529  164 P M  T 3  S+     0   0   26  170   86                                                                    I IM
   530  165 P V  S <  S-     0   0    1  170    8                                                                    V VV
   531  166 P K  E     - x   0 501H  37  170    2                                                                    K KK
   532  167 P F  E     +vx 479 502H   0  170    1                                                                    F FF
   533  168 P C  E     -vx 480 503H   0  170   18                                                                    C CC
   534  169 P K  E     +vx 481 504H  51  170   37                                                                    K KK
   535  170 P I  E     - x   0 505H   1  170   21                                                                    I II
   536  171 P K  E >>  - x   0 506H  52  170   72                                                                    K KK
   537  172 P A  H >> S+     0   0   13  170   46                                                                    A AA
   538  173 P S  H 34 S+     0   0   88  170   30                                                                    S SS
   539  174 P N  H <4 S+     0   0   67  170   86                                                                    N NN
   540  175 P T  H << S-     0   0   25  170   73                                                                    T TT
   541  176 P G     <  +     0   0   66  169   22                                                                    G GG
   542  177 P A    >   -     0   0   39  170   55                                                                    A AA
   543  178 P G  T 3  S-     0   0   70  169   43                                                                    G GG
   544  179 P D  T 3  S+     0   0  151  169   78                                                                    D DD
   545  180 P R  S <  S+     0   0  167  169   58                                                                    R RR
   546  181 P F  S    S+     0   0   35  169    0                                                                    F FF
   547  182 P S    >>  -     0   0   34  169   70                                                                    S SS
   548  183 P S  T 34 S+     0   0   86  169   84                                                                    L LS
   549  184 P D  T 34 S+     0   0  126  169   66                                                                    D DD
   550  185 P V  T <4 S+     0   0   20  169   65                                                                    V VV
   551  186 P L     <  +     0   0    8  170   13                                                                    L LL
   552  187 P P  S    S+     0   0    1  170    0                                                                    P PP
   553  188 P T  E     -W  505   0H   1  170   42                                                                    T TT
   554  189 P L  E     -WY 504 566H   0  170    2                                                                    L LL
   555  190 P L  E     -WY 503 565H   4  170    9                                                                    L LL
   556  191 P V  E     +WY 502 564H   0  170   19                                                                    V IV
   557  192 P Y  E     +WY 501 562H  31  170    0                                                                    Y YY
   558  193 P K  E >  S-WY 500 561H  25  170   12                                                                    K KK
   559  194 P G  T 3  S-     0   0   25  170   41                                                                    G GG
   560  195 P G  T 3  S+     0   0   48  170   21                                                                    G GG
   561  196 P E  E <   -Y  558   0H  38  170   36                                                                    E EE
   562  197 P L  E     +Y  557   0H  34  170   12                                                                    L LL
   563  198 P L  E     -     0   0H   2  170   20                                                                    I II
   564  199 P S  E     -Y  556   0H   4  170   30                                                                    S SS
   565  200 P N  E     -Y  555   0H  41  170    0                                                                    N NN
   566  201 P F  E >   -Y  554   0H   3  170    1                                                                    F FF
   567  202 P I  T 3  S-     0   0   87  168   25                                                                    I II
   568  203 P S  T >  S-     0   0   11  168   71                                                                    S SS
   569  204 P V  G X  S+     0   0    0  168   35                                                                    V VV
   570  205 P T  G >  S+     0   0   17  168   36                                                                    A AA
   571  206 P E  G <  S+     0   0  156  168   35                                                                    E DE
   572  207 P Q  G <  S+     0   0   84  168   43                                                                    Q QQ
   573  208 P L  S <  S-     0   0   31  168   11                                                                    F FF
   574  209 P A    >   -     0   0   49  168   51                                                                    A AA
   575  210 P E  T 3  S+     0   0  201  168   27                                                                    E EE
   576  211 P E  T 3  S+     0   0  166  168   21                                                                    E EE
   577  212 P F    <   -     0   0   17  168    0                                                                    F FF
   578  213 P F    >>  -     0   0  146  168   24                                                                    F FF
   579  214 P T  H 3> S+     0   0   24  167   24                                                                    A AA
   580  215 P G  H 3> S+     0   0   32  167   71                                                                    G GG
   581  216 P D  H <> S+     0   0   57  167    4                                                                    D DD
   582  217 P V  H  X S+     0   0    0  167   23                                                                    V VV
   583  218 P E  H  X S+     0   0   32  167    8                                                                    E EE
   584  219 P S  H  X S+     0   0   58  167   52                                                                    S SS
   585  220 P F  H  < S+     0   0    2  168    2                                                                    F FF
   586  221 P L  H ><>S+     0   0    0  168    0                                                                    L LL
   587  222 P N  H ><5S+     0   0   61  168   82                                                                    N NN
   588  223 P E  T 3<5S+     0   0   70  168   18                                                                    E EE
   589  224 P Y  T < 5S-     0   0   20  165   47                                                                    Y YY
   590  225 P G  T < 5S+     0   0    6  165    6                                                                    G GG
   591  226 P L      < +     0   0    2  165   18                                                                    L LL
   592  227 P L  S    S-     0   0   10  161    8                                                                    L LL
   593  228 P P        -     0   0   40  161   31                                                                    P PP
   594  229 P E              0   0   94  159   17                                                                    E EE
   595  230 P K              0   0  161  158   24                                                                    R RK
## ALIGNMENTS   71 -  140
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....8....:....9....:....0....:....1....:....2....:....3....:....4
     1    2 B S              0   0  117  267   60  SS  SSSSSSSS SSSSSSSSSSSSSSSSSSSSSSS   SSSSS SSSSSS SNASSSSSNSSSNN SSS
     2    3 B E     >  -     0   0  107  283   60  EE  EEEEEEEE EEEEEEEEEEEEEEEEEEEEEEE   EEEEE EEEEEE EEEEEEEEEEEEEE EEE
     3    4 B L  H  > S+     0   0   52  299   33  LL  LLLLLLLL LLLLLLLLLLLLLLLLLLLLLLL   LLLLL LLLLLLLLLLLLLLLVLLLLL LLL
     4    5 B D  H  > S+     0   0  104  300   57  DD  EEEEEEEE EEEEEEEEEEEEEEEEEEEEEEE   EEEEE EEEEEEEEDEEEEEEEEDEDD DED
     5    6 B Q  H  > S+     0   0  131  301   62  QQ  QQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQ   QQQQQ QQQQQQQQSQQQQQASQQASS QAQ
     6    7 B L  H  X S+     0   0   27  302   65  LL  LLLLLLLL LLLLLLLLLLLLLLLLLLLLLLL   LLLLL LLLLLLLLLLLLLLLLLLLLL LLL
     7    8 B R  H  X S+     0   0  110  311   10  RR  RRRRRRRR RRRRRRRRRRRRRRRRRRRRRKR   RRRRR RRRRRRRRRRRRRRRRRRRRR RRR
     8    9 B Q  H  X S+     0   0  117  312   60  QQ  QQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQ   QQQQQ QLQQQQQQQQQQVQQQQQQQQ QQQ
     9   10 B E  H  X S+     0   0   78  313   13  EE  EEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEE  EEEEE EEEEEEEEEEEEEEEEEEEEE EEE
    10   11 B A  H  X S+     0   0    1  313   25  AA  AAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAA  AAAAA AAAAAAAAACAATATAAATAA AAA
    11   12 B E  H  X S+     0   0  121  315   21  EE  EEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEE  EEEEE EEEEEEEEEEEDEEEEEEEEE EEE
    12   13 B Q  H  X S+     0   0  111  323   73  QQ  QQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQ QQQQQQQQTAQQQQQAQQQTT QQQ
    13   14 B L  H  X S+     0   0   14  348    5  LL  LLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLL LLL
    14   15 B K  H  X S+     0   0   99  348   37  KK  RRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRKKRRKRKKRKKKK KKK
    15   16 B N  H  X S+     0   0   33  348   56  NN  NNNNNNNN NNNNNNNNNNNNGNNNNNNNNNNNN NNNNN NNNNNNNNNNNNNNNNNSNNN SSS
    16   17 B Q  H  X S+     0   0   82  348   60  QQ  QQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQ QQQQQQQQTHQQQQQTQQQCA QQQ
    17   18 B I  H  X S+     0   0    7  348   18  II  IIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIII III
    18   19 B R  H  X S+     0   0  135  348   59  RR  RQQQQQRQ RRRQRQRRRRQRKRRQRRRRRRQRQ RRQRR QRRQQQRRRRRRRRRRRRRRR RRR
    19   20 B D  H  X S+     0   0   85  349   72  DD  DDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDIEIEDSEEDD EEE
    20   21 B A  H  X S+     0   0   36  249   44  AA  AAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAA.ATAAPAAAA AAA
    21   22 B R  H >X S+     0   0   22  349   28  RR  RRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRR.RARRARRRR RRR
    22   23 B K  H 3< S+     0   0  136  350   43  KK  KKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKK KKKKK KKKKKKKKKKK.KSKKSKKKKKKKK
    23   24 B A  H 3< S+     0   0   79  350   64  AA  AAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAA.ALAASQAAAASAA
    24   25 B C  H << S+     0   0   19  306   94  CC  CCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC CCCCC CCCCCCCCACC.ADAASAAAAAAAA
    25   26 B A     <  +     0   0   46  309   60  AA  SNNNNNSN SGGNGNGGGGNGGGGNGGGSGGNGN SGNSG NCGNNNGGCQG.ASACPNACCCNNN
    26   27 B D        +     0   0   88  312    3  DD  DDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDD.D.DDSDDDDDDDD
    27   28 B A        -     0   0   17  315   51  AA  TAAAAATA TSSASASSSSASTSSASSSSSSASA ASTSS ASSAAASSTTS.T.TTSTTTTTTTT
    28   29 B T    >>  -     0   0   59  315   41  TT  TTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTT.T.TTPTTTTTTTT
    29   30 B L  H 3> S+     0   0    0  317    9  LL  LLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLL.L.LLALLLLLLLL
    30   31 B S  H 34 S+     0   0   38  323   90  SS  VVVVVVAV VTTITVTTTTVTSTTVTTTSTTVTV VTVST VSTVVVTTVIT.T.AVSAAVAVAAA
    31   32 B Q  H X4 S+     0   0  119  330   65  QQ  QQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQ QQQQQQQQQQQ.Q.SQESMQQQTAS
    32   33 B I  H 3< S+     0   0   28  332   58  II IIIIIIIII IIIIIIIIIIIIMIIIIIIIIIIII IIIII IIIIIIIIAVM.A.AAIVAAAAVVV
    33   34 B T  T >< S+     0   0    0  343   62  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTATA.TTTATTTTAAA
    34   35 B N  T <  S+     0   0  129  351   77  NN TASSSSSTS AAASASAAAASATAASAAAAAASAS AASAA SAASSSAAAAATA.AAAAAASSSAA
    35   36 B N  T 3  S+     0   0  111  351   67  NN SSNNNNNSN SGGNGNGGGGNGSGGNGGGGGGNGN SGNGG NGGNNNGGNNSSH.NNGNNNGGNSN
    36   37 B I  S <  S-     0   0   21  338   72  II LLMMMMMLM LLLMLMLLLLMLLLLMLLLLLLMLM LLMLL MLLMMMLLMMLLV.VMLLVMMMLML
    37   38 B D        -     0   0  138  345   57  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDEEDDE.EEDEEEEEEEE
    38   39 B P        -     0   0   89  348   62  PP SSSSSSSSS SPPSPSPPPPSPSPPSPPPSPPSPS SPSSP SSPSSSPPPAPSP.PPPPPPPPPPP
    39   40 B V        -     0   0   23  350   41  VV VVVVVVVVV VVVVVVVVVVMVVVVVVVVVVVVVV VVVVV VVVVVVVVVVVVVVIVVIVIIIIII
    40   41 B G        -     0   0   54  353   52  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
    41   42 B R        -     0   0  115  354   44  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
    42   43 B I        +     0   0    8  354   63  II IIIIVIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIIIIIII
    43   44 B Q        -     0   0   54  340   61  QQ QQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQHQQQ QQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQ
    44   45 B M        -     0   0   11  345   12  MM MMMMMMMMM MMMMMMMMMMMMMMMMMMMMMMMMM MMMMM MMMMIMMMMMMMMMMMMMMMMMMMM
    45   46 B R        -     0   0   49  346   51  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
    46   47 B T  E     +A  338   0A  12  350   67  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTT
    47   48 B R  E     +     0   0A  56  355   56  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
    48   49 B R  E     -A  337   0A  60  355   15  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
    49   50 B T  E     -A  336   0A  30  355   27  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTT
    50   51 B L  E     -A  335   0A   0  355    2  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
    51   52 B R        +     0   0  159  355   41  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
    52   53 B G        +     0   0   20  355    0  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
    53   54 B H        -     0   0    4  355    0  HH HHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHH HHHHH HHHHHHHHHHHHHHHHHHHHHHHHH
    54   55 B L  S    S+     0   0  116  355   50  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
    55   56 B A  S    S-     0   0    0  355   30  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
    56   57 B K        -     0   0   15  355    0  KK KKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKK KKKKK KKKKKKKKKKKKKKKKKKKKKKKKK
    57   58 B I  E     -D   73   0B   0  355    9  II IIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIIIIIII
    58   59 B Y  E     -     0   0B   6  355   20  YY YYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYY YYYYY YYYYYYYYYYYYYYYYYYYYYYYYY
    59   60 B A  E     -D   72   0B  13  355   32  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
    60   61 B M  E     -D   71   0B  15  355   10  MM MMMMMMMMM MMMMMMMMMMMMMMMMMMMMMMMMM MMMMM MMMMMMMMMMMMMMMMMMMMMMMMM
    61   62 B H  E     -D   70   0B  44  355   33  HH HHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHH HHHHH HHHHHHHHHHHHHHHHHHHHHHHHH
    62   63 B W  E     -D   69   0B  11  355    0  WW WWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWW WWWWW WWWWWWWWWWWWWWWWWWWWWWWWW
    63   64 B G    >   -     0   0    3  355   54  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGAGAGAGGAAgGGAAA
    64   65 B T  T 3  S+     0   0   75  355   66  TT SSYYYYYSY STTYTYTTTTYTYTTYTTTSTTYTY TTYST YSTYYYTTSSTSSSSSTSSsSSSTS
    65   66 B D  T 3  S-     0   0   80  355   12  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDGDDDDD
    66   67 B S  S <  S+     0   0    3  355   57  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
    67   68 B R  S    S+     0   0   94  355   47  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRK RRRRRRRRRRKRRRRRRRRRRRRRR
    68   69 B L  E     + E   0  82B  31  355   87  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLYNLLNLNYLNNNNNNNN
    69   70 B L  E     -DE  62  81B   0  355   23  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
    70   71 B L  E     -DE  61  80B   0  355    7  VV VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV VVVVV VVVVVVVVVVVVVVVVVVVVVVVVV
    71   72 B S  E     -DE  60  79B   0  354    2  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
    72   73 B A  E     -DE  59  78B   0  354    5  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
    73   74 B S  E >>  -DE  57  77B   0  354    2  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
    74   75 B Q  T 34 S+     0   0    1  355    1  QQ QQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQ QQQQQRQQQQQQQQQQQQQQQQQQQ
    75   76 B D  T 34 S-     0   0    9  355    0  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
    76   77 B G  T <4 S+     0   0    7  355    1  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
    77   78 B K  E  <  -EF  73  93B  52  355   34  KK KKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKK KKKKK KKKKKKKKKKKKKKKKKKKKKKKKK
    78   79 B L  E     -EF  72  92B   0  355    4  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
    79   80 B I  E     -EF  71  91B   0  355    7  II IIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIIIIIII
    80   81 B I  E     -EF  70  90B   0  355   18  II IIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIVIIIIIVVVIVIVVIVVVVVVVV
    81   82 B W  E     -EF  69  88B   0  355    0  WW WWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWW WWWWW WWWWWWWWWWWWWWWWWWWWWWWWW
    82   83 B D  E >>> -EF  68  87B  21  355   18  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
    83   84 B S  T 345S+     0   0    0  355   52  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSASSSSSGASSGSSSSSS
    84   85 B Y  T 345S+     0   0   57  354   48  YY YYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYY YYYYY YYYYYYYYYYYYFYYYYYYYYYYYY
    85   86 B T  T <45S-     0   0   56  354    8  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTT
    86   87 B T  T  <5 +     0   0   43  354   36  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTT
    87   88 B N  E   < -F   82   0B  99  354   38  NN NNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNN NNNNN NNNNNNNNNNNNNNNNNNNNNNNNN
    88   89 B K  E     +F   81   0B  95  354    0  KK KKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKK KKKKK KKKKKKKKKKKKKKKKKKKKKKKKK
    89   90 B V  E    S+     0   0B  66  353   49  VV MMMMMMMMM MVVMVMVVVVMVMVVMVVVMVVMVM MVMMM MMIMMMVIVVIMVMVVVVVVVVVVV
    90   91 B H  E     -F   80   0B  57  353   18  HH HHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHH HHHHH HHHHHHHHHHHHHHHHHHHHHHHHH
    91   92 B A  E     -F   79   0B  43  353    8  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
    92   93 B I  E     -F   78   0B   0  353    3  II IIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIIIIIII
    93   94 B P  E     -F   77   0B  80  353   37  PP PPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPP PPPPP PPPPPPPPPPPPPPPPPPPPPPPPP
    94   95 B L        -     0   0   26  354    2  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
    95   96 B R  S    S+     0   0  190  354   40  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
    96   97 B S        -     0   0   17  354   24  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
    97   98 B S  S    S+     0   0    6  354   36  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
    98   99 B W        +     0   0    2  354    3  WW WWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWW WWWWW WWWWWWWWWWWWWWWWWWWWWWWWW
    99  100 B V  E     -G  115   0C   4  354    1  VV VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV VVVVV VVVVVVVVVVVVVVVVVVVVVVVVV
   100  101 B M  E     +     0   0C   5  353    4  MM MMMMMMMMM MMMMMMMMMMMMMMMMMMMMMMMMM MMMMM MMMMMMMMMMMMMMMMMMMMMMMMM
   101  102 B T  E     -G  114   0C   8  353   13  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTT
   102  103 B C  E     -G  113   0C   0  353    9  CC CCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC CCCCC CCCCCCCCCCCCCCCCCCCCCCCCC
   103  104 B A  E     -G  112   0C   0  353    8  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
   104  105 B Y  E     -G  111   0C   9  353   10  YY YYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYY YYYYY YYYYYYYYYYYYYYYYYYYYYYYYY
   105  106 B A    >   -     0   0    0  353   33  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
   106  107 B P  T 3  S+     0   0   64  353    8  PP PPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPP PPPPP PPPPPPPPPPPPPPPPPPPPPPPPP
   107  108 B S  T 3  S-     0   0   47  353   31  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSTSSSSSSSSSSSSSSSS
   108  109 B G  S <  S+     0   0    8  353   14  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   109  110 B N  S    S+     0   0   50  353   43  NN NNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNN NNNNN NNNNNNNNSSNNSNSSNSNSSSSNS
   110  111 B Y  E     - H   0 124C  50  353   55  FY YYYYYYYYY YFFYFFFFFFYFYFFYFFFYFYYFY YFYYY YYYYYYFFYYYYYYYYFFYFYYFYY
   111  112 B V  E     -GH 104 123C   0  353    5  VV VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV VVVVV VVVVVVVVVVVVVVVVVVVVVVVVV
   112  113 B A  E     +GH 103 122C   0  353    4  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
   113  114 B C  E     +GH 102 121C   5  353   10  CC CCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC CCCCC CCCCCCCCCCCCCCCCCCCCCCCCC
   114  115 B G  E     +GH 101 120C   1  353    6  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   115  116 B G  E >  S-G   99   0C   0  353    0  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   116  117 B L  T 3  S+     0   0    1  353    1  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
   117  118 B D  T 3  S-     0   0   50  353    3  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   118  119 B N  S <  S+     0   0   30  353   21  NN NNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNN NNNNN NNNNNNNNNNNNNNNNNNNNNNNNN
   119  120 B I  E     - I   0 139C  39  353   43  II IIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIIIIIII
   120  121 B C  E     -HI 114 138C   0  353    7  CC CCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC CCCCC CCCCCCCCCCCCCCCCCCCCCCCCC
   121  122 B S  E     -HI 113 137C   9  353   14  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
   122  123 B I  E     -HI 112 136C   0  353    6  II IIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIIIIIII
   123  124 B Y  E     -H  111   0C   3  353    4  YY YYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYY YYYYY YYYYYYYYYYYYYYYYYYYYYYYYY
   124  125 B N  E     +H  110   0C  24  353   45  SN NNNNNNNNN NSSNSNSSSSNSNSSNSSSSSSNSN NSNSC NSCNNNSSSSCNSNSSSSSSSSSSS
   125  126 B L        +     0   0   11  353   12  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
   126  127 B K  S    S+     0   0  109  353   60  KK KKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKK KKKKK KKKKKKKKKKKKKKKKKKKKKKKKK
   127  128 B T  S    S-     0   0   64  353   71  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTT
   128  129 B R  S    S+     0   0  267  336   26  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
   129  130 B E  S    S-     0   0  173  340   28  EE EEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEE EEEEE EEEEEEEEEEEEEEEEEEEEEEEEE
   130  131 B G        -     0   0   50  351   25  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   131  132 B N        +     0   0   30  349   59  NN NNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNN NNNNN NNNNNNNNNNNNNNNNNNNNNNNNN
   132  133 B V  S    S+     0   0   58  329   58  VV VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV VVVVV VVVVVVVVVVVVVVVVVVVVVVVVV
   133  134 B R  S    S-     0   0  213  347   44  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
   134  135 B V        -     0   0   29  352   27  VV VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV VVVVV VVVVVVVVVVVVVVVVVVVVVVVVV
   135  136 B S  S    S-     0   0   43  352   59  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSTSSSSS SSSTS STSSSSSSSSSSSSSSSSSSSSSSS
   136  137 B R  E     -I  122   0C 105  344   18  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
   137  138 B E  E     -I  121   0C  75  346   40  EE EEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEE KEEEE EEEEEEEEEEEEEEEEEEEEEEEEE
   138  139 B L  E     +I  120   0C   1  349    5  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
   139  140 B A  E     +I  119   0C  61  351   61  PA PPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPP PPPPP PPPPPPPPPPPPPPPPPPPPPPPPP
   140  141 B G        +     0   0   50  351   27  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   141  142 B H        -     0   0    9  352    8  HH HHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHH HHHHH HHHHHHHHHHHHHHHHHHHHHHHHH
   142  143 B T  S    S+     0   0   64  352   62  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTITT TTTITTTTTTTTTTTTTTTTTTTTT
   143  144 B G  S    S-     0   0    0  352    8  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   144  145 B Y        -     0   0    0  352    1  YY YYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYY YYYYY YYYYYYYYYYYYYYYYYYYYYYYYY
   145  146 B L  E     +J  160   0D   0  352   18  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
   146  147 B S  E     -     0   0D   3  352    1  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
   147  148 B C  E     -J  159   0D   9  353   29  CC CCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC CCCCC CCCCCCCCCCCCCCCCCCCCCCCCC
   148  149 B C  E     -J  158   0D   0  353    6  CC CCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC CCCCC CCCCCCCCCCCCCCCCCCCCCCCCC
   149  150 B R  E     -J  157   0D  53  353   33  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
   150  151 B F  E     -J  156   0D  10  353    2  FF FFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFF FFFFF FFFFFFFFFFFFFFFFFFFFFFFFF
   151  152 B L  S    S-     0   0   26  353   35  LL LLLLLLLLL ILLLLLLLLLLLLLLLLLLLLLLLL ILLLI LLILLLLIVLILLLLVLLILYYLLL
   152  153 B D  S    S-     0   0   60  353   56  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDTDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   153  154 B D  S    S+     0   0   60  353   13  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   154  155 B N  S    S+     0   0   44  353   76  NN NNSSSSSNS NNNSNSNNNNSNNNNSNNNNNNSNG NNSNN GSNRGGNNNNNNNNNSNNNNNSNNN
   155  156 B Q  E     + K   0 169D  60  353   66  QQ QEQQQQQQQ EQQQQQQQQQQQQQQQQQQQQQQQQ EQQQQ QQQQQQQQQQQQQEQQQQQQQQQQQ
   156  157 B I  E     -JK 150 168D   0  354   13  II IIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIIIIIII
   157  158 B V  E     -JK 149 167D   0  354   27  IV VVVVVVVVV VIIVIVIIIIVIVIIVIIILIIVII VIVLI ILIVIIIIVVIVVVVVIVVVVVVVV
   158  159 B T  E     -JK 148 166D   0  353    0  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTT
   159  160 B S  E     -JK 147 165D   0  352   19  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
   160  161 B S  E >   -J  145   0D   0  352    0  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
   161  162 B G  T 3  S+     0   0    0  352    0  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   162  163 B D  T 3  S-     0   0    5  352    0  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   163  164 B T  S <  S+     0   0    8  353   76  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTMMTTMTMMTMMMMMMMM
   164  165 B T        -     0   0    2  353   17  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTNTT TTTNTTTTTTTTTTTTTTTTSSTTT
   165  166 B C  E     -KL 159 179D   0  352    1  CC CCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC CCCCC CCCCCCCCCCCCCCCCCCCCCCCCC
   166  167 B A  E     -KL 158 178D   0  353   70  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
   167  168 B L  E     -KL 157 177D   6  353   29  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
   168  169 B W  E     -KL 156 175D   2  353    0  WW WWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWW WWWWW WWWWWWWWWWWWWWWWWWWWWWWWW
   169  170 B D  E >>> -KL 155 174D  37  353    1  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDNDDDDDD
   170  171 B I  T 345S+     0   0    7  353   13  II IIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIIIIIII
   171  172 B E  T 345S+     0   0  144  353   32  EE EEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEE EEEEE EEEEEEEEEEEEEEEEEEEEEEEEE
   172  173 B T  T <45S-     0   0   78  353   40  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTT
   173  174 B G  T  <5 +     0   0   16  353   12  GG GGAAGAAGA GGGAGAGGGGAGGGGAGGGGGGAGG GGAGS GGSAGGGGGGSGGGGGGGGGGGGGG
   174  175 B Q  E   < -L  169   0D 135  353   74  QQ QQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQ QQQQQQQQQQQQQQQQQQXQQQQQQ
   175  176 B Q  E     -L  168   0D  30  353   58  QQ QQQQQQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQ QQQQQ QQQQQQQQQQQQQQQQQQQQQQQQQ
   176  177 B T  E     +     0   0D  64  353   70  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTAT TSTTTTTTCMTTTTTCTLICCCCCC
   177  178 B T  E     -L  167   0D  20  353   63  VT TTTTTTTTT TVVTVTVVVVTVTVVTVVVTVTTVT TVTTT TTTTTTVTTTTTTTTTVTTTTTTTT
   178  179 B T  E     -L  166   0D   5  354   78  GT TTTTTTTTT TGGMGTGAGGTGTGGTGGGTGTAGT TGTSV TSVTTTGLSSVTSTASGTSSSSAAA
   179  180 B F  E     +L  165   0D   1  354    0  FF FFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFF FFFFF FFFFFFFFFFFFFFFFFFFFFFFFF
   180  181 B T        +     0   0   34  354   73  AT TTTTTTTTT TAATATAAAATATAATAAASATTAT TATTS TTSTTTASTTSTATTTATGTIITTT
   181  182 B G        +     0   0   37  354   33  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   182  183 B H        -     0   0    7  354    0  HH HHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHH HHHHH HHHHHHHHHHHHHHHHHHHHHHHHH
   183  184 B T  S    S+     0   0   99  354   69  ST TTSSSSSTS TSSSSSSSSSSSTSSSSSSTSSSSS TSSTS STTSSSSSTTTTTTTTSTTTTTTTT
   184  185 B G  S    S-     0   0    0  354   17  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   185  186 B D        -     0   0    1  354    0  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   186  187 B V  E     -M  202   0E   0  354   18  VV VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV VVVVV VVVVVVVVVVVVVVVVVVVVVVVVV
   187  188 B M  E     +     0   0E   3  354   11  MM MMMMMMMMM MMMMMMMMMMMMMMMMMMMMMMMMM MMMMM MMMMMMMMMMMMMMMMMMMMMMMMM
   188  189 B S  E     -M  201   0E  16  354   17  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
   189  190 B L  E     -M  200   0E   3  354   28  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
   190  191 B S  E     -M  199   0E  21  354   23  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
   191  192 B L  E     -M  198   0E  29  354   32  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL VLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
   192  193 B A    >   -     0   0    4  354   63  AA SSSSSSSSS SAASASAAAASASAASAAASASSAS SASSS SSSSSSAASSSSASSSASASAASSS
   193  194 B P  T 3  S+     0   0   85  354   30  PP PPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPP PPPPP PPPPPPPPPEPPPPPPPPPPPPPPP
   194  195 B D  T 3  S-     0   0   87  354   71  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   195  196 B T  S <  S+     0   0   62  354   89  GT MMMMMMMMM MGGMGMGGGGMGMGGLGGGYGMMGL MGMFL LFQMLLGSFHLMMMMMGMMMTTFMM
   196  197 B R  S    S+     0   0  142  355   76  RR RRRRRRRRR RRRRRRRRRRRRKRRRRRRKRRRRK RRRKR KRRRKKRRRRRRRRRRRRRRRRRRR
   197  198 B L  E     - N   0 211E  37  351   70  TL TTTTTTTTT TTTTSTTTTTTSTTTTTTTTTSTTT TTTTT TTTTTTTTTTTTSTTTTTTTTTTTT
   198  199 B F  E     -MN 191 210E   0  351    0  FF FFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFF FFFFF FFFFFFFFFFFFFFFFFFFFFFFFF
   199  200 B V  E     -MN 190 209E   0  352   12  VV VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV VVVVV VVVVVVVIVVVVVVVVVIVVVVIVI
   200  201 B S  E     -MN 189 208E   0  353    3  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
   201  202 B G  E     +MN 188 207E   0  355    3  Gg GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   202  203 B A  E >   -M  186   0E   0  354   31  Aa AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
   203  204 B C  T 3  S+     0   0    5  354    7  CC CCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC CCCCC CCCCCCCCCCCCCCCCCCCCCCCCC
   204  205 B D  T 3  S-     0   0   31  354    0  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   205  206 B A  S <  S+     0   0   20  354   39  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
   206  207 B S  E     - O   0 222E   6  354   82  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSTSSSSS SSSTS STSSSSSSSSSSSSSSSSSSSSSSS
   207  208 B A  E     -NO 201 221E   0  354   28  IA SSSSSSSSS SIISISIIIISISIISIIISIVSIS SISSV SSISSSIIAAASASAAIAAAAAAAA
   208  209 B K  E     -NO 200 220E  18  354   20  KK KKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKK KKKKK KKKKKKKKKKKKKKKKKKKKKKKKK
   209  210 B L  E     -NO 199 219E   2  354   11  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
   210  211 B W  E     -NO 198 217E   1  354    0  WW WWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWW WWWWW WWWWWWWWWWWWWWWWWWFWWWWWW
   211  212 B D  E >>> -NO 197 216E  11  354    0  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   212  213 B V  T 345S+     0   0   12  354   39  VV IIIIIIIII IVVIVIVVVVIVIVVIVVVIVIIVI IVIII IVIIIIVIVIIIIIIVVIIIIIIII
   213  214 B R  T 345S+     0   0  194  354    0  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
   214  215 B E  T <45S-     0   0  111  353   69  DE DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDEDEEEDDD
   215  216 B G  T  <5 +     0   0    8  354   39  SG GGGGGGGGG GSSGSGSSSSGSGSSGSSSGSSGSG GSGGS GGSGGGSSGGSGGGGGSGGGGGGGG
   216  217 B M  E      -     0   0    1  353    5  FF FFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFF FFFFF FFFFFFFFFFFFFFFFFFFFFFFFF
   235  236 B P  T 3  S+     0   0   45  353    4  PP PPPPPPPPP PPPPPPPPPPPPPPPPPPPPPPPPP PPPPP PPPPPPPPPPPPPPPPPPPPPPPPP
   236  237 B N  T 3  S-     0   0   42  353   42  NN NNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNS NNNNN SNNSSSNSNNNNNNNNNNNNNNSNS
   237  238 B G  S <  S+     0   0   12  353    5  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   238  239 B N  S    S+     0   0   56  353   67  YN HHYYYYYHY HYYYYYYYYYYYHYYYYYYNYNYYY HYYNS YNSYYYYSYNSHFHYYYHFQYYNFY
   239  240 B A  E     - Q   0 253F   0  353   48  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
   240  241 B F  E     -PQ 233 252F   0  353   14  FF FFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFF FFFFF FFFFFFFFFFFFFFFFFFFFFFFFF
   241  242 B A  E     -PQ 232 251F   0  353   59  TA AAAAAAAAA ATTATATTTTATATTATTTGTTATA ATAGA AGAAAATAAAAAAAAATAAAAAAAA
   242  243 B T  E     -PQ 231 250F   0  353    6  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTT
   243  244 B G  E     +PQ 230 249F   0  353    0  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   244  245 B S  E >   -P  228   0F   0  353    0  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
   245  246 B D  T 3  S+     0   0   13  353    2  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   246  247 B D  T 3  S-     0   0   28  353    0  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   247  248 B A  S <  S+     0   0    6  353   38  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
   248  249 B T        -     0   0   16  353   41  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTT
   249  250 B C  E     -QR 243 263F   0  353   12  CC CCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC CCCCC CCCCCCCCCCCCCCCCCCCCCCCCC
   250  251 B R  E     -QR 242 262F  23  353    7  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
   251  252 B L  E     -QR 241 261F   0  353    1  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
   252  253 B F  E     -QR 240 259F   1  352    1  FF FFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFF FFFFF FFFFFFFFFFFFFFFFFFFFFFFFF
   253  254 B D  E  >> -QR 239 258F   1  352    0  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   254  255 B L  T >45S+     0   0   15  352   28  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLMILLLLIILIIIIIIII
   255  256 B R  T 345S+     0   0   57  352    1  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
   256  257 B A  T 345S-     0   0    0  352   29  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
   257  258 B D  T <<5 +     0   0    0  352   23  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   258  259 B Q  E      -     0   0  119  354   72  HH HHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHH HHHHH HHHHHHHHHHHHHHHHHCHHHHHHH
   266  267 B D  T 3  S+     0   0  161  354   42  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   267  268 B N  T 3  S+     0   0   66  354   66  NN NNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNN NNNNN NNNNNNNNNNNNNNNNNNNNNNNNN
   268  269 B I    <   +     0   0   23  354   48  II IIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIIIIIII
   269  270 B I        +     0   0   97  354   54  II IIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIIIIIII
   270  271 B C  S    S-     0   0   10  354   48  CC CCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC CCCCC CCCCCCCCCCCCCCCCCCCCCCCCC
   271  272 B G        -     0   0    1  355   28  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   272  273 B I  E     +S  288   0G   0  355   15  II IIIIIIIII IIIIIIIIIIIIIIIIIIIIIIIII IIIII IIIIIIIIIIIIIIIIIIIIIIIII
   273  274 B T  E     +     0   0G  13  355   15  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTT
   274  275 B S  E     +S  287   0G  18  355    1  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
   275  276 B V  E     +S  286   0G  10  355   16  VV VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV VVVVV VVVVVVVVVVVVVVVVVVVVVVVVV
   276  277 B S  E     -S  285   0G  15  354   25  AS AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAASA AAAAAAAAAAAAAAAAAAAAAAAAA
   277  278 B F  E     -S  284   0G  12  354   30  FF FFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFF FFFFF FFFFFFFFFFFFFFFFFFFFFFFFF
   278  279 B S        -     0   0    3  354    4  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
   279  280 B K  S    S+     0   0  104  354   81  RK KKKKKKKKK KRRKRKRRRRKRKRRKRRRKRRKRK KRKKR KKRKKKRRKKRKKKKKRKKKKKKKK
   280  281 B S  S    S-     0   0    2  354    3  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS SSSSS SSSSSSSSSSSSSSSSSSSSSSSSS
   281  282 B G  S    S+     0   0    0  354    1  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   282  283 B R        +     0   0    8  354    0  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
   283  284 B L  E     - T   0 297G   0  354   11  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
   284  285 B L  E     -ST 277 296G   0  354    5  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLLLLLLLLL
   285  286 B L  E     -ST 276 295G   0  354   15  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLL LLLLLLLLLLLLLLLLLFLLLLFFF
   286  287 B A  E     -ST 275 294G   0  355   18  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA AAAAAAAAAAAAGAGAAAGAAAAAA
   287  288 B G  E     -ST 274 293G   2  355   11  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   288  289 B Y  E >   -S  272   0G   4  355    1  YY YYYYYYYYY YYYYYYYYYYYYYYYYYYYYYYYYY YYYYY YYYYYYYYYYYYYYYYYYYYYYYYY
   289  290 B D  T 3  S+     0   0    3  355   34  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   290  291 B D  T 3  S-     0   0   37  355   17  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   291  292 B F  S <  S+     0   0    3  355   44  FF FFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFFF FFFFF FFFFFFFFFFFFFFFFFFFFFFFFF
   292  293 B N        -     0   0   15  355   49  NN NNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNN NNNNN NNNNNNNNNNNNNNNNNNNNNNNNN
   293  294 B C  E     -TU 287 307G   0  355   10  CC CCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC CCCCC CCCCCCCCCCCCCCCCCCCCCCCCC
   294  295 B N  E     -TU 286 306G   5  355   74  NN NNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNS NNNNN SNNNSSNNNNNNNNNNNNNNNNNNN
   295  296 B V  E     -TU 285 305G   0  355   16  IV VVVVVVVVV VIIVIVIIIIVIVIIVIIIVIIVIV VIVVI VVIVVVIIVVIVVVVVIVVVVVVVV
   296  297 B W  E     -TU 284 303G   6  355    0  WW WWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWW WWWWW WWWWWWWWWWWWWWWWWWWWWWWWW
   297  298 B D  E  >  -T  283   0G   4  355    0  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD DDDDD DDDDDDDDDDDDDDDDDDDDDDDDD
   298  299 B A  T  4 S+     0   0    0  355   65  AA TTTTTTTTT TAATATAAAATATAATAAATASTAA TATTA ATATAAAASSATTTVSASVSSSSSS
   299  300 B L  T  4 S+     0   0    0  355   27  ML LLLLLLLLL LMMLMLMMMMLMLMMLMMMLMMLML LMLLM LLMLLLMMMMMLLLLMMMLIMMMMM
   300  301 B K  T  4 S-     0   0   29  355   53  KK KKKKKKKKK KKKKKKKKKKKKKKKKKKKKKKKKK KKKKK KKKKKKKKKKKKKKKKKRKKKKRQR
   301  302 B A  S  < S+     0   0   17  355   52  GA GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGAGGGQGQAGQQSTTQQQ
   302  303 B D  S    S-     0   0   95  355   52  DD EEDDDDDED EDDDDDDDDDDDEDDDDDDEDDDDG EDDED GDDDGGDEEEDEDEDEDEEEEEEEE
   303  304 B R  E     -U  296   0G  69  354   61  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR RRRRR RRRRRRRRRRRRRRRRRRRRRRRRR
   304  305 B A  E     -     0   0G  14  355   63  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA AAAAA SAAASSAAAAAAAAAAAAAAAAASA
   305  306 B G  E     -U  295   0G   4  355   27  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG GGGGG GGGGGGGGGGGGGGGGGGGGGGGGG
   306  307 B V  E >   -U  294   0G   7  355   69  VV VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV VVVVV VVVVVVVVVVVVVVVVVVVIIIVVV
   307  308 B L  E >  S+U  293   0G   2  350   36  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL L LLL LLLLLLLLLLLLLLLLLLLLLLLLL
   308  309 B A  G >  S-     0   0    4  351   70  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA A AAA AAAAAAAAAAAAAAAAAAAAAAAAA
   309  310 B G  G <   -     0   0    4  353   21  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG G GGG GGGGGGGGGGGGGGGGGGGGGGGGG
   310  311 B H  G <  S+     0   0    8  353    0  HH HHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHH H HHH HHHHHHHHHHHHHHHHHHHHHHHHH
   311  312 B D    <   -     0   0   26  353   32  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD D DDD DDDDDDDDDDDDDDDDDDDDDDDDD
   312  313 B N  S    S+     0   0   31  353   16  NN NNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNN N NNN NNNNNNNNNNNNNNNNNNNNNNNNN
   313  314 B R        +     0   0   40  353    5  RR RRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRR R RRR RRRRRRRRRRRRRRRRRRRRRRRRR
   314  315 B V        +     0   0    2  353   10  VV VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV V VVV VVVVVVVVVVVVVVVVVVVVVVVVV
   315  316 B S  S    S-     0   0    2  353   10  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSS S SSS SSSSSSSSSSSSSSSSSSSSSSSSS
   316  317 B C  E     -B  329   0A  10  353   17  CC CCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCC C CCC CCCCCCCCCCCCCCCCCCCCCCCCC
   317  318 B L  E     -B  328   0A  15  353   13  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL L LLL LLLLLLLLLLLLLLLLLLLLLLLLL
   318  319 B G  E     -B  327   0A  10  353   13  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG G GGG GGGGGGGGGGGGGGGGGGGGGGGGG
   319  320 B V  E     -B  326   0A  25  353   19  VV VVVVVVVVV VVVVVVVVVVVVVVVIVVVVVVVVV V VVV VVVVVVVVVVVVVVVVVVVVVVVVV
   320  321 B T    >   -     0   0    3  353   52  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT A TTT TTTTTTTTTTTTTTTTTTTTTTTTT
   321  322 B D  T 3  S+     0   0   98  353   70  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDGDDDDD D DED DSDDDDDDEDDDEDEEDDEDEEEEE
   322  323 B D  T 3  S-     0   0   51  352    9  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDDD D DDD DDDDDD DDDDDDDDDDDDDDDDDD
   323  324 B G  S <  S+     0   0    0  352    4  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGG G GGG GGGGGG GGGGGGGGGGGGGGGGGG
   324  325 B M  S    S+     0   0   36  350   62  MM MMMMMMMMM MMMMMMMMMMMMMMMMMMMMMMMMM M MMM MMMMMM MMMMMMMMMMMMMMMMMM
   325  326 B A        -     0   0    0  350   30  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA A AAA AAAAAA AAAAAAAAAAAAAAAAAA
   326  327 B V  E     -BC 319 338A   0  350   33  VV VVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVV V VVV VVVVVV VVVAVVVVVVVVVVVVVV
   327  328 B A  E     -BC 318 337A   0  349   47  AA AAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAA  A AAS AACAAA CAACAAAAAACAAAACCC
   328  329 B T  E     -BC 317 336A   7  349    4  TT TTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTT  T TTT TTTTTT TTTTTTTTTTTTTTTTTT
   329  330 B G  E     -BC 316 335A   1  349    4  GG GGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGG  G GGG GGGGGG GGGGGGGGGGGGGGGGGG
   330  331 B S    >   -     0   0    6  349    0  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSS  S SSS SSSSSS SSSSSSSSSSSSSSSSSS
   331  332 B W  T 3  S+     0   0    6  349    0  WW WWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWW  W WWW WWWWWW WWWWWWWWWWWWWWWWWW
   332  333 B D  T 3  S-     0   0   17  349    0  DD DDDDDDDDD DDDDDDDDDDDDDDDDDDDDDDDD  D DDD DDDDDD DDDDDDDDDDDDDDDDDD
   333  334 B S  S <  S+     0   0   12  349   35  SS SSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSS  S SSS SSSSSS SSSSSSSSSSSSSSSSSS
   334  335 B F        -     0   0   78  349   71  FF FFFFFFFFF FFFFFFFFFFFFFFFFFFFFFFFF  F FFF FFFFFF FFFFFFFFFFFFFFFFFF
   335  336 B L  E     -AC  50 329A   1  349    8  LL LLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLL  L LLL LLLLLL LLLLLLLLLLLLLLLLLL
   336  337 B K  E     -AC  49 328A  60  346   23  KK RRRRRRRRR RKKRKRKKKKRKRKKRKKKRKKRK  R RRK RRKRRR KKKKRKRKKKKKRRRKKK
   337  338 B I  E     -AC  48 327A   0  344   13  II IIIIIIIII IIIIIIIIIIIIIIIVIIIIIVII  I III IIIIII IIIIIIIIIIIIIIIIII
   338  339 B W  E      AC  46 326A   2  341    0  WW WWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWW  W WWW WWWWWW WWWWWWWWWWWWWWWWWW
   339  340 B N              0   0   10  297   57  NN NNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNN  N NNN NNNNNN NNNNNNNNNNNNNNNNNN
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   80    0    P         P                               P                         
   342    3 G V        +     0   0   96   82   63    V         V                               V                         
   343    4 G I        -     0   0   38   84   34    I         I                               I                         
   344    5 G N    >   -     0   0  109   84   59    N         N                               N                         
   345    6 G I  G >  S+     0   0   25   84   30    I         I                               I                         
   346    7 G E  G 3  S+     0   0  122  126   44    E         E                               E                         
   347    8 G D  G <  S+     0   0  133  137   21    D         D                               D                         
   348    9 G L    <   -     0   0   35  141   15    L         L                               L                         
   349   10 G T     >  -     0   0   69  141   62    T         S                               T                         
   350   11 G E  H  > S+     0   0  116  143   33    E         E                               E                         
   351   12 G K  H >> S+     0   0   66  152   41    K         K                               K                         
   352   13 G D  H 3> S+     0   0   39  152   35    D         D                               D                         
   353   14 G K  H 3X S+     0   0   83  152   84    K         K                               K                         
   354   15 G L  H < S+     0   0    7  233    6    E         E                               E                         
   365   26 G V  H 3< S+     0   0   43  233   53    L         L                               L                         
   366   27 G T  T 3< S+     0   0  116  233   82    A         T                               T                         
   367   28 G L    <   -     0   0   49  233   61    L         L                               L                         
   368   29 G E        -     0   0  191  233   49    E         E                               E                         
   369   30 G R        -     0   0   32  233    1    R         R                               R                         
   370   31 G M        -     0   0   53  233   85    M         V                               Q                         
   371   32 G L     >  -     0   0   75  232   81    L         L                               V                         
   372   33 G V  H  > S+     0   0    4  232   15    V         V                               V                         
   373   34 G S  H  > S+     0   0   14  232    1    S         S                               S                         
   374   35 G K  H  > S+     0   0   93  232   38    K         K                               K                         
   375   36 G C  H  X S+     0   0    0  233   62    C         C                               S                         
   376   37 G C  H  X S+     0   0    0  233   63    C         C                               C                         
   377   38 G E  H  X S+     0   0   75  233   68    E         E                               E                         
   378   39 G E  H  X S+     0   0   60  233   26    E         A                               E                         
   379   40 G F  H  X S+     0   0    3  233   36    V         V                               V                         
   380   41 G R  H  X S+     0   0   53  233   79    R         R                               R                         
   381   42 G D  H  X S+     0   0   67  233   65    D         D                               D                         
   382   43 G Y  H  X S+     0   0   43  233    2    Y         Y                               Y                         
   383   44 G V  H >X S+     0   0    0  233   58    V         V                               I                         
   384   45 G E  H 3X S+     0   0   71  233   47    E         E                               E                         
   385   46 G E  H 3< S+     0   0  125  233   57    E         D                               E                         
   386   47 G R  H XX S+     0   0   94  233   69    R         R                               R                         
   387   48 G S  H >< S+     0   0   12  233   67    S         S                               S                         
   388   49 G G  T 3< S+     0   0   38  233   80    G         G                               G                         
   389   50 G E  T <4 S+     0   0  138  232   54    E         E                               E                         
   390   51 G D    XX> -     0   0    1  232    0    D         D                               D                         
   391   52 G P  H 3>5S+     0   0   17  233   25    P         P                               P                         
   392   53 G L  H 345S+     0   0    6  233    3    L         L                               L                         
   393   54 G V  H <45S+     0   0   24  233   29    V         V                               V                         
   394   55 G K  H  <5S-     0   0  149  233   80    K         K                               K                         
   395   56 G G     << -     0   0   38  233   34    G         G                               G                         
   396   57 G I        -     0   0   21  224   20    I         I                               I                         
   397   58 G P    >>  -     0   0   80  233   11    P         P                               P                         
   398   59 G E  T 34 S+     0   0   75  233   58    E         E                               E                         
   399   60 G D  T 34 S+     0   0  151  233   61    E         D                               D                         
   400   61 G K  T <4 S+     0   0  163  233   62    Q         K                               K                         
   401   62 G N     <  -     0   0    1  233    0    N         N                               N                         
   402   63 G P  S    S+     0   0   36  224    0    P         P                               P                         
   403   64 G F  S    S-     0   0    3  224    0    F         F                               F                         
   404   65 G K              0   0  108  222   29    K         K                               K                         
   405   66 G E              0   0  201  217    3    E         E                               E                         
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   62   10                                                                        
   408   14 P E        +     0   0  153  142   39                                                                        
   409   15 P G  S    S+     0   0   38  144   37                                                                        
   410   16 P Q  S    S-     0   0   94  148   90                                                                        
   411   17 P A        +     0   0    1  149   53                                                                        
   412   18 P S        +     0   0   28  149   71                                                                        
   413   19 P H  S    S+     0   0   42  151   57                                                                        
   414   20 P T  S  > S-     0   0    2  152   17                                                                        
   415   21 P G  H  > S-     0   0   10  164    2                                                                        
   416   22 P P  H  > S+     0   0   14  165    0                                                                        
   417   23 P K  H  > S+     0   0    6  165    0                                                                        
   418   24 P G  H  X S+     0   0    0  165    1                                                                        
   419   25 P V  H  X S+     0   0    0  165    0                                                                        
   420   26 P I  H  X S+     0   0    4  165   14                                                                        
   421   27 P N  H  X S+     0   0   48  165   42                                                                        
   422   28 P D  H  X S+     0   0   14  166    0                                                                        
   423   29 P W  H  X S+     0   0    6  166    0                                                                        
   424   30 P R  H  < S+     0   0   67  166   26                                                                        
   425   31 P K  H >X S+     0   0   67  166   36                                                                        
   426   32 P F  H >X>S+     0   0    1  166    1                                                                        
   427   33 P K  H 3<5S+     0   0   30  166    7                                                                        
   428   34 P L  H <45S+     0   0  139  161    1                                                                        
   429   35 P E  H <<5S+     0   0   86  161    9                                                                        
   430   36 P S  T  <5       0   0   57  162   66                                                                        
   431   37 P E      <       0   0  118  167   66                                        R                               
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  143   42                                        V                               
   434   69 P S        +     0   0   52  144   64                                        S                               
   435   70 P R        -     0   0  103  120   85                                        R                               
   436   71 P K        +     0   0   22  123   12                                        K                               
   437   72 P M  S    S-     0   0   12  124   13                                        M                               
   438   73 P S     >  -     0   0   52  131   65                                        S                               
   439   74 P V  H  > S+     0   0  107  130   53                                        I                               
   440   75 P Q  H  > S+     0   0  133  130   52                                        Q                               
   441   76 P E  H  > S+     0   0   38  134   26                                        E                               
   442   77 P Y  H  X S+     0   0   36  146   56                                        Y                               
   443   78 P E  H  < S+     0   0  111  154   61                                        E                               
   444   79 P L  H >X S+     0   0   45  155   57                                        L                               
   445   80 P I  H 3< S+     0   0   37  157   72                                        I                               
   446   81 P H  T 3< S+     0   0  178  158   80                                        H                               
   447   82 P K  T <4 S+     0   0  140  157   65                                        K                               
   448   83 P D     <  -     0   0   58  169   39                                        E                               
   449   84 P K        -     0   0  205  149   80                                        K                               
   450   85 P E        -     0   0   45  150   68                                        E                               
   451   86 P D    >>  -     0   0   87  169   31                                        D                               
   452   87 P E  H 3> S+     0   0  113  168   12                                        E                               
   453   88 P N  H 3> S+     0   0   73  169   59                                        N                               
   454   89 P C  H <> S+     0   0   32  170   72                                        C                               
   455   90 P L  H  X S+     0   0    4  170    2                                        L                               
   456   91 P R  H  X S+     0   0  131  170   63                                        R                               
   457   92 P K  H  X S+     0   0  112  170   59                                        K                               
   458   93 P Y  H  X S+     0   0    7  170    5                                        Y                               
   459   94 P R  H  X S+     0   0   31  170   31                                        R                               
   460   95 P R  H  X S+     0   0  130  170   43                                        R                               
   461   96 P Q  H  X S+     0   0   96  170   30                                        Q                               
   462   97 P C  H  X S+     0   0   22  170   72                                        C                               
   463   98 P M  H  X S+     0   0   33  170   11                                        M                               
   464   99 P Q  H  X S+     0   0  115  170   54                                        Q                               
   465  100 P D  H  X S+     0   0   46  170   21                                        D                               
   466  101 P M  H  X S+     0   0   23  170    2                                        M                               
   467  102 P H  H  X S+     0   0   64  170   74                                        H                               
   468  103 P Q  H  < S+     0   0  143  170   59                                        Q                               
   469  104 P K  H  < S+     0   0  140  170   55                                        K                               
   470  105 P L  H  < S+     0   0   35  170   43                                        L                               
   471  106 P S     <  -     0   0   75  170   79                                        S                               
   472  107 P F        -     0   0   71  168   99                                        F                               
   473  108 P G        -     0   0   36  168   51                                        G                               
   474  109 P P        +     0   0   92  160   41                                        P                               
   475  110 P R        +     0   0  177  165   61                                        R                               
   476  111 P Y        +     0   0   51  166    5                                        Y                               
   477  112 P G        +     0   0   12  170   61                                        G                               
   478  113 P F  S    S-     0   0  151  170  103                                        F                               
   479  114 P V  E     -v  532   0H  28  170   13                                        V                               
   480  115 P Y  E     -v  533   0H  71  165   68                                        Y                               
   481  116 P E  E     -v  534   0H 108  170   41                                        E                               
   482  117 P L        -     0   0   12  170   32                                        L                               
   483  118 P E        +     0   0  134  170   74                                        E                               
   484  119 P S  S >> S-     0   0   57  170   53                                        T                               
   485  120 P G  H 3> S+     0   0   15  169   40                                        G                               
   486  121 P E  H 3> S+     0   0  127  170   23                                        K                               
   487  122 P Q  H <> S+     0   0   72  170   61                                        Q                               
   488  123 P F  H  X S+     0   0   26  170    1                                        F                               
   489  124 P L  H  X S+     0   0   90  170    6                                        L                               
   490  125 P E  H  X S+     0   0  103  170   41                                        E                               
   491  126 P T  H  < S+     0   0   10  170   76                                        T                               
   492  127 P I  H  < S+     0   0   17  170   12                                        I                               
   493  128 P E  H  < S+     0   0  139  170   20                                        E                               
   494  129 P K  S  < S+     0   0  172  170   35                                        K                               
   495  130 P E  S    S-     0   0   38  166    5                                        E                               
   496  131 P Q    >   -     0   0  116  170   66                                        L                               
   497  132 P K  T 3  S+     0   0  156  170   34                                        K                               
   498  133 P I  T 3  S+     0   0   68  170   87                                        I                               
   499  134 P T    <   -     0   0   10  170   35                                        T                               
   500  135 P T  E     -W  558   0H   7  169   62                                        T                               
   501  136 P I  E     -Wx 557 531H   3  170   15                                        I                               
   502  137 P V  E     -Wx 556 532H   0  170   35                                        V                               
   503  138 P V  E     -Wx 555 533H   0  170   12                                        V                               
   504  139 P H  E     -Wx 554 534H   0  170    6                                        H                               
   505  140 P I  E     +Wx 553 535H   2  170    1                                        I                               
   506  141 P Y  E     - x   0 536H   4  170    2                                        Y                               
   507  142 P E    >   -     0   0   45  170   26                                        E                               
   508  143 P D  T 3  S+     0   0   95  170   51                                        D                               
   509  144 P G  T 3  S+     0   0   66  170   48                                        G                               
   510  145 P I  S X> S-     0   0   36  170   33                                        I                               
   511  146 P K  T 34 S+     0   0  191  170   71                                        K                               
   512  147 P G  T 3> S+     0   0   13  170   22                                        G                               
   513  148 P C  H <> S+     0   0    0  170   35                                        C                               
   514  149 P D  H  X S+     0   0   78  170   47                                        D                               
   515  150 P A  H  > S+     0   0   44  170   50                                        A                               
   516  151 P L  H  X S+     0   0    0  170   11                                        L                               
   517  152 P N  H  X S+     0   0   19  170   16                                        N                               
   518  153 P S  H  X S+     0   0   78  170   56                                        S                               
   519  154 P S  H  X S+     0   0    6  170   35                                        S                               
   520  155 P L  H  X S+     0   0    1  170   10                                        L                               
   521  156 P I  H  X S+     0   0  105  170   85                                        T                               
   522  157 P C  H  X S+     0   0   63  170   38                                        C                               
   523  158 P L  H  X S+     0   0    0  170    4                                        L                               
   524  159 P A  H  < S+     0   0    1  170    9                                        A                               
   525  160 P A  H  < S+     0   0   61  170   67                                        A                               
   526  161 P E  H  < S+     0   0   72  170   23                                        E                               
   527  162 P Y    ><  +     0   0    5  170    2                                        Y                               
   528  163 P P  T 3  S+     0   0   28  170   29                                        P                               
   529  164 P M  T 3  S+     0   0   26  170   86                                        I                               
   530  165 P V  S <  S-     0   0    1  170    8                                        V                               
   531  166 P K  E     - x   0 501H  37  170    2                                        K                               
   532  167 P F  E     +vx 479 502H   0  170    1                                        F                               
   533  168 P C  E     -vx 480 503H   0  170   18                                        C                               
   534  169 P K  E     +vx 481 504H  51  170   37                                        K                               
   535  170 P I  E     - x   0 505H   1  170   21                                        I                               
   536  171 P K  E >>  - x   0 506H  52  170   72                                        K                               
   537  172 P A  H >> S+     0   0   13  170   46                                        A                               
   538  173 P S  H 34 S+     0   0   88  170   30                                        S                               
   539  174 P N  H <4 S+     0   0   67  170   86                                        N                               
   540  175 P T  H << S-     0   0   25  170   73                                        T                               
   541  176 P G     <  +     0   0   66  169   22                                        G                               
   542  177 P A    >   -     0   0   39  170   55                                        A                               
   543  178 P G  T 3  S-     0   0   70  169   43                                        G                               
   544  179 P D  T 3  S+     0   0  151  169   78                                        D                               
   545  180 P R  S <  S+     0   0  167  169   58                                        R                               
   546  181 P F  S    S+     0   0   35  169    0                                        F                               
   547  182 P S    >>  -     0   0   34  169   70                                        S                               
   548  183 P S  T 34 S+     0   0   86  169   84                                        L                               
   549  184 P D  T 34 S+     0   0  126  169   66                                        D                               
   550  185 P V  T <4 S+     0   0   20  169   65                                        V                               
   551  186 P L     <  +     0   0    8  170   13                                        L                               
   552  187 P P  S    S+     0   0    1  170    0                                        P                               
   553  188 P T  E     -W  505   0H   1  170   42                                        T                               
   554  189 P L  E     -WY 504 566H   0  170    2                                        L                               
   555  190 P L  E     -WY 503 565H   4  170    9                                        L                               
   556  191 P V  E     +WY 502 564H   0  170   19                                        I                               
   557  192 P Y  E     +WY 501 562H  31  170    0                                        Y                               
   558  193 P K  E >  S-WY 500 561H  25  170   12                                        K                               
   559  194 P G  T 3  S-     0   0   25  170   41                                        G                               
   560  195 P G  T 3  S+     0   0   48  170   21                                        G                               
   561  196 P E  E <   -Y  558   0H  38  170   36                                        E                               
   562  197 P L  E     +Y  557   0H  34  170   12                                        L                               
   563  198 P L  E     -     0   0H   2  170   20                                        I                               
   564  199 P S  E     -Y  556   0H   4  170   30                                        S                               
   565  200 P N  E     -Y  555   0H  41  170    0                                        N                               
   566  201 P F  E >   -Y  554   0H   3  170    1                                        F                               
   567  202 P I  T 3  S-     0   0   87  168   25                                        I                               
   568  203 P S  T >  S-     0   0   11  168   71                                        S                               
   569  204 P V  G X  S+     0   0    0  168   35                                        V                               
   570  205 P T  G >  S+     0   0   17  168   36                                        A                               
   571  206 P E  G <  S+     0   0  156  168   35                                        E                               
   572  207 P Q  G <  S+     0   0   84  168   43                                        Q                               
   573  208 P L  S <  S-     0   0   31  168   11                                        F                               
   574  209 P A    >   -     0   0   49  168   51                                        A                               
   575  210 P E  T 3  S+     0   0  201  168   27                                        E                               
   576  211 P E  T 3  S+     0   0  166  168   21                                        E                               
   577  212 P F    <   -     0   0   17  168    0                                        F                               
   578  213 P F    >>  -     0   0  146  168   24                                        F                               
   579  214 P T  H 3> S+     0   0   24  167   24                                        A                               
   580  215 P G  H 3> S+     0   0   32  167   71                                        G                               
   581  216 P D  H <> S+     0   0   57  167    4                                        D                               
   582  217 P V  H  X S+     0   0    0  167   23                                        V                               
   583  218 P E  H  X S+     0   0   32  167    8                                        E                               
   584  219 P S  H  X S+     0   0   58  167   52                                        S                               
   585  220 P F  H  < S+     0   0    2  168    2                                        F                               
   586  221 P L  H ><>S+     0   0    0  168    0                                        L                               
   587  222 P N  H ><5S+     0   0   61  168   82                                        N                               
   588  223 P E  T 3<5S+     0   0   70  168   18                                        E                               
   589  224 P Y  T < 5S-     0   0   20  165   47                                        Y                               
   590  225 P G  T < 5S+     0   0    6  165    6                                        G                               
   591  226 P L      < +     0   0    2  165   18                                        L                               
   592  227 P L  S    S-     0   0   10  161    8                                        L                               
   593  228 P P        -     0   0   40  161   31                                        P                               
   594  229 P E              0   0   94  159   17                                        E                               
   595  230 P K              0   0  161  158   24                                        R                               
## ALIGNMENTS  141 -  210
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....5....:....6....:....7....:....8....:....9....:....0....:....1
     1    2 B S              0   0  117  267   60   SSSSSN S  SNNSN S N NNNNSGNNNNNNN GNG NSGGGGGGG GGGGGGGGGNGS  GG GG  
     2    3 B E     >  -     0   0  107  283   60   EEEEED E  EEEEE E E EEEEEEEEEEEEE EEE EEEEEEEEE EEEEEEEGEEEE  EE EE  
     3    4 B L  H  > S+     0   0   52  299   33   LLLLLL L  LLLLL L L LLILLMLLLLLLL MIM LLMMMMMMM MMMMMMMMMLML  ML MM  
     4    5 B D  H  > S+     0   0  104  300   57   DDDEED E  EEEED D D EEDDEEDDDDDDD EEE DDEEEEEEE EEEEEEEEEDED  ED EE  
     5    6 B Q  H  > S+     0   0  131  301   62   QQQAQS A  QAAAS Q S AAASQQSSSSSSS QAQ SQQQQQQQQ QQQQQQQQQSQQ  QQ QQ  
     6    7 B L  H  X S+     0   0   27  302   65   LLLLLL L  LLLLL L L LLLLLMLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL ML  
     7    8 B R  H  X S+     0   0  110  311   10   RRRRRR R  RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRKRRRRRRRRR  RR KR  
     8    9 B Q  H  X S+     0   0  117  312   60   QQQQQQ Q  QQQQQ Q Q QQQQQQTQQQQQQ QTQ QQQQQQQQQ QQQQQQQQQQQQ  QQ QQ  
     9   10 B E  H  X S+     0   0   78  313   13   EEEEEE E  EEEEE E E EEEEEEEEEEEEE EEE EEEEEEEEE EEEEEEEEEEEE  EE EE  
    10   11 B A  H  X S+     0   0    1  313   25   AAATAA T  SAATA S A AAAAAAAAAAAAA AAA SAAAAAAAA AAAAAAAAAAAA  AT AA  
    11   12 B E  H  X S+     0   0  121  315   21   EEEEEE E  EEEEE E E EEEEEEEEEEEEE EEE EEEEEEEEE EEEEEEEEEEEE  EE EE  
    12   13 B Q  H  X S+     0   0  111  323   73   QQQQQR Q  AATQT Q T TTQSQQTTSSSSS QTQ TQQQQQQQQ QQQQQQQQQTQQ  QQ QQ  
    13   14 B L  H  X S+     0   0   14  348    5   LLLLLL L  LLLLL L L LLLLLLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL LL  
    14   15 B K  H  X S+     0   0   99  348   37   KKKKRK K  KKKKK K K KKKKRKKKKKKKK KKK KKKKKKKKK KKKKKKKKKKKK  KK KK  
    15   16 B N  H  X S+     0   0   33  348   56   SSSNNN N  CNNNN N N NNNNNKNNNNNNN KNK NNKKKKKKK KKKKKKKKKNKN  KS KK  
    16   17 B Q  H  X S+     0   0   82  348   60   QQQQQT Q  QAAQA M A AAAAQQAAAAAAA QAQ AQQQQHQQQ QQQQQQQQQAQQ  QQ QQ  
    17   18 B I  H  X S+     0   0    7  348   18   IIIIII V  IIIII I I IIIIIIIIIIIII III IIIIIIIII IIIIIIIIIIII  II II  
    18   19 B R  H  X S+     0   0  135  348   59   RRRRRR R  RRRRR R R RRRRQARRRRRRR ARA RRAAAAAAA AAAAAAAAARAR  AR AA  
    19   20 B D  H  X S+     0   0   85  349   72   EEEEDD E  DDDED E D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDEDnDD  IE DD  
    20   21 B A  H  X S+     0   0   36  249   44   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA AAAAAAAAA AAAAAAAAAlAA  LA AA  
    21   22 B R  H >X S+     0   0   22  349   28   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRFRR  WR RR  
    22   23 B K  H 3< S+     0   0  136  350   43   KKKKKK KK KKKKK K K KKKKKKKKKKKKK KKK KKKKKKKKK KKKKKKKKKNKK  KR KK  
    23   24 B A  H 3< S+     0   0   79  350   64   SSSAAN AA IAAAA A A AAAAAAAAAAAAA AAA AAAAAAAAA AAAAAAAVAAAA  AV AA  
    24   25 B C  H << S+     0   0   19  306   94   AAAACA AA AAAAA A A AAAACCAAAAAAA CAC ACCCCCCCC CCCCCCCCCACC  CA CC  
    25   26 B A     <  +     0   0   46  309   60   NNNASL AC ACCAC A A CCCCNACCCCCCC ACA CAAAAAAAA AAAAAAAAACAA  AA AA  
    26   27 B D        +     0   0   88  312    3   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
    27   28 B A        -     0   0   17  315   51   TTTTST TT TTTTT T T TTTTATTTTTTTT TTV TAIVVTTVV VIIMITITTTIA  VT TV  
    28   29 B T    >>  -     0   0   59  315   41   TTTTTT TS TSSTS T N SSSSTTSSSSSSS TST TTTTTTTTT TTTTTTTTTTTT  TT TT  
    29   30 B L  H 3> S+     0   0    0  317    9   LLLLLL LL LLLLL L L LLILLLLLLLLLL LIL LLLLLLLLL LLLLLLLLLLLL  LL LL  
    30   31 B S  H 34 S+     0   0   38  323   90   AAAASA AV AIVAV L A VVLVVAVALLLLL ALA AAAAAAAAA AAAAAAAAAAAS  AQ AA  
    31   32 B Q  H X4 S+     0   0  119  330   65   TTTMQQ MQ QQQMQ Q A QQQQQQTQQQQQQ EQE QQEEEEEEE EEEEEEEQEQEQ  EQ QE  
    32   33 B I  H 3< S+     0   0   28  332   58   VVVAIA AA VAAAA A A AAAAIIAAAAAAA LAL AILLLLLLL LLLLLLLILALI  LA IL  
    33   34 B T  T >< S+     0   0    0  343   62   AAATTT TT STTTT S T TTTATVTTAAAAA VTV TTVVVTAVV VVVVVVVTVTVT  VT VV  
    34   35 B N  T <  S+     0   0  129  351   77   SSSAAS AS ANNAA S A NNNASSGSTAATA SAS SASSSSSSS SSSSSSSASSSA  SV SS  
    35   36 B N  T 3  S+     0   0  111  351   67   NNNNGG NN NNNNS N T NNHSNGNNSLLSS GQG GNGGGGGGG GGGGGGGGGNGN  GN GG  
    36   37 B I  S <  S-     0   0   21  338   72   LLLVLM VM ILLVL V L LLLLMVMLLLLLL LLL MILLLLLLL LLLLLLLMLMLI  LV ML  
    37   38 B D        -     0   0  138  345   57   EEEEDE EE DEEEE E E EEEEDEEEEEEEE EEE EDEEEEEEE EEEEEEEEEEED  EE EE  
    38   39 B P        -     0   0   89  348   62   PPPPSP PP QPPPP P P PPAPSLPPPPPPP VAV SPVVVLVVV VVVVVVVVVPVP  VY VV  
    39   40 B V        -     0   0   23  350   41   IIIVVI VI VIIVI V I IIVIVVIIIIIII VVV IVVVVVVVV VVVVVVVVVIVV  VI VV  
    40   41 B G        -     0   0   54  353   52   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GS GG  
    41   42 B R        -     0   0  115  354   44   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRRRR  RR RR  
    42   43 B I        +     0   0    8  354   63   IIIIII II IIIIV I V IIIIIIIIIIIII VIV IIVVVIVVV VVVVVVVIVIVI  VT IV  
    43   44 B Q        -     0   0   54  340   61   QQQQQQ QQ QQQQQ Q Q QQQQQQQQQQQQQ QQQ QQQQQQQQQ QQQQQQQQQQQQ  QQ QQ  
    44   45 B M        -     0   0   11  345   12   MMMMMM MM MMMMM L M MMLMMMMMMMMMM MLM MMMMMMMMM MMMMMMMMMMMM  ML MM  
    45   46 B R        -     0   0   49  346   51   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRRRR  RR RR  
    46   47 B T  E     +A  338   0A  12  350   67   TTTTTT TT TTTTT T T TTTTTTTTTTTTT TTT TTTTTTTTT TTTTTTTTTTTT  TS TT  
    47   48 B R  E     +     0   0A  56  355   56   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRRRR  RR RR  
    48   49 B R  E     -A  337   0A  60  355   15   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRRRR  RR RR  
    49   50 B T  E     -A  336   0A  30  355   27   TTTTTT TT TTTTT T T TTTTTTTTTTTTT TTT TTTTTTTTT TTTTTTTTTTTT  TT TT  
    50   51 B L  E     -A  335   0A   0  355    2   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL LL  
    51   52 B R        +     0   0  159  355   41   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRRRR  RR RR  
    52   53 B G        +     0   0   20  355    0   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
    53   54 B H        -     0   0    4  355    0   HHHHHH HH HHHHH H H HHHHHHHHHHHHH HHH HHHHHHHHH HHHHHHHHHHHH  HH HH  
    54   55 B L  S    S+     0   0  116  355   50   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL LL  
    55   56 B A  S    S-     0   0    0  355   30   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA AAAAAAAAA AAAAAAAAAAAA  AA AA  
    56   57 B K        -     0   0   15  355    0   KKKKKK KK KKKKK K K KKKKKKKKKKKKK KKK KKKKKKKKK KKKKKKKKKKKK  KK KK  
    57   58 B I  E     -D   73   0B   0  355    9   IIIIII II IIIII I I IIIIIIIIIIIII III IIIIIIIII IIIIIIIIIIII  II II  
    58   59 B Y  E     -     0   0B   6  355   20   YYYYYY YY YYYYY Y Y YYYYYYYYYYYYY YYY YYYYYYYYY YYYYYYYYYYYY  YY YY  
    59   60 B A  E     -D   72   0B  13  355   32   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA AAAAAAAAA AAAAAAAAAAAA  AA AA  
    60   61 B M  E     -D   71   0B  15  355   10   MMMMMM MM MMMMM M M MMMMMMMMMMMMM MMM MMMMMMMMM MMMMMMMMMMMM  MM LM  
    61   62 B H  E     -D   70   0B  44  355   33   HHHHHH HH HHHHH H H HHHHHHHHHHHHH HHH HHHHHHHHH HHHHHHHHHHHH  HH HH  
    62   63 B W  E     -D   69   0B  11  355    0   WWWWWW WW WWWWW W W WWWWWWWWWWWWW WWW WWWWWWWWW WWWWWWWWWWWW  WW WW  
    63   64 B G    >   -     0   0    3  355   54   AAAAGG AG GGGAG S G GGGGGSGGGGGGG AGA GGAAASAAA AAAAAAASAGAG  AC SA  
    64   65 B T  T 3  S+     0   0   75  355   66   SSSSSS SS SCCSS T S SSSNYTSSNNNNN TST STTTTTTTT TTTTTTTNTCTT  TS TT  
    65   66 B D  T 3  S-     0   0   80  355   12   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
    66   67 B S  S <  S+     0   0    3  355   57   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  SS SS  
    67   68 B R  S    S+     0   0   94  355   47   RRRRRR RR RRRRR R R RRRRRKRRRRRRR KRK RRKKKKKKK KKKKKKKRKKKR  KR KK  
    68   69 B L  E     + E   0  82B  31  355   87   NNNNLN NN NNNNN N N NNYNSLNNNNNNN LYL NLLLLLLLL LLLLLLLLLNLL  LN LL  
    69   70 B L  E     -DE  62  81B   0  355   23   LLLLLL LL LLLLL L L LLLLVLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL ML  
    70   71 B L  E     -DE  61  80B   0  355    7   VVVVVV VV VVVVV V V VVVVAVVVVVVVV VVV VVVVVVVVV VVVVVVVVVVVV  VV VV  
    71   72 B S  E     -DE  60  79B   0  354    2   SSSSSS SS SSSSS S S SSSS.SSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  SS SS  
    72   73 B A  E     -DE  59  78B   0  354    5   AAAAAA AA AAAAA A A AAAA.AAAAAAAA AAA AAAAAAAAA AAAAAAAAAAAA  AA AA  
    73   74 B S  E >>  -DE  57  77B   0  354    2   SSSSSS SS SSSSS S S SSSS.SSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  SS SS  
    74   75 B Q  T 34 S+     0   0    1  355    1   QQQQQQ QQ QQQQQ Q Q QQQQVQQQQQQQQ QQQ QQQQQQQQQ QQQQQQQQQQQQ  QQ QQ  
    75   76 B D  T 34 S-     0   0    9  355    0   DDDDDD DD DDDDD D D DDDDTDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
    76   77 B G  T <4 S+     0   0    7  355    1   GGGGGG GG GGGGG G G GGGGAGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
    77   78 B K  E  <  -EF  73  93B  52  355   34   KKKKKK KK KKKKK K K KKKKEKKKKKKKK KKK KKKKKKKKK KKKKKKKKKKKK  KK KK  
    78   79 B L  E     -EF  72  92B   0  355    4   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL LL  
    79   80 B I  E     -EF  71  91B   0  355    7   IIIIII II IIIII I I IIIIPIIIIIIII III IIIIIIIII IIIIIIIIIIII  II II  
    80   81 B I  E     -EF  70  90B   0  355   18   VVVVIV VV VVVVV V V VVVVRVVVVVVVV VVV VIVVVVVVV VVVVVVVVVVVI  VV VV  
    81   82 B W  E     -EF  69  88B   0  355    0   WWWWWW WW WWWXW W W WWWWEWWWWWWWW WWW WWWWWWWWW WWWWWWWWWWWW  WW WW  
    82   83 B D  E >>> -EF  68  87B  21  355   18   DDDDDD DD DDDDD D D DDDDVDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
    83   84 B S  T 345S+     0   0    0  355   52   SSSGSS GS SSSGS G S SSSSSTSSSSSSS TSS SSTSSTTSS STTTTTTTTSTS  SG TS  
    84   85 B Y  T 345S+     0   0   57  354   48   YYYYYY YY YHHYH Y H HHHHSYYHHHHHH YHY YYYYYYYYY YYYYYYYYYYYY  YY YY  
    85   86 B T  T <45S-     0   0   56  354    8   TTTTTT TT TTTTT T T TTTTLTTTTTTTT TTT TTTTTTTTT TTTTTTTSTTTT  TT TT  
    86   87 B T  T  <5 +     0   0   43  354   36   TTTTTT TT TTTTT T T TTTTRTTTTTTTT TTT TTTTTTTTT TTTTTTTTTTTT  TT TT  
    87   88 B N  E   < -F   82   0B  99  354   38   NNNNNN NN NNNNN N N NNNNTNNNNNNNN NNN NNNNNNNNN NNNNNNNNNNNN  NN NN  
    88   89 B K  E     +F   81   0B  95  354    0   KKKKKK KK KKKKK K K KKKKIKKKKKKKK KKK KKKKKKKKK KKKKKKKKKKKK  KK KK  
    89   90 B V  E    S+     0   0B  66  353   49   VVVVMV VV VVVVV V V VVVVMVVVVVVVV VVV V.VVVVVVV VVVVVVVVVVVM  VV VV  
    90   91 B H  E     -F   80   0B  57  353   18   HHHHHH HH HHHHH H H HHHHHHHHHHHHH HHH H.HHHHHHH HHHHHHHHHHHT  HH HH  
    91   92 B A  E     -F   79   0B  43  353    8   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA A.AAAAAAA AAAAAAAAAAAA  AA AA  
    92   93 B I  E     -F   78   0B   0  353    3   IIIIII II IIIII I I IIIIIIIIIIIII III I.IIIIIII IIIIIIIIIIIT  II II  
    93   94 B P  E     -F   77   0B  80  353   37   PPPPPP PP PPPPP P P PPPPPPPPPPPPP PPP P.PPPPPPP PPPPPPPPPPPH  PP PP  
    94   95 B L        -     0   0   26  354    2   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL LALLLLLLL LLLLLLLLLLLW  LL LL  
    95   96 B R  S    S+     0   0  190  354   40   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RKRRRRRRR RRRRRRRRRRRQ  RR RR  
    96   97 B S        -     0   0   17  354   24   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS SKSSSSSSS SSSSSSSSSSSD  SS SS  
    97   98 B S  S    S+     0   0    6  354   36   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSL  SS SS  
    98   99 B W        +     0   0    2  354    3   WWWWWW WW WWWWW W W WWWWWWWWWWWWW WWW WTWWWWWWW WWWWWWWWWWWF  WW WW  
    99  100 B V  E     -G  115   0C   4  354    1   VVVVVV VV VVVVV V V VVVVVVVVVVVVV VVV VLVVVVVVV VVVVVVVVVVVG  VV VV  
   100  101 B M  E     +     0   0C   5  353    4   MMMMMM MM MMMMM M M MMMMMMMMMMMMM MMM MGMMMMMMM MMMMMMMMMMM.  MM MM  
   101  102 B T  E     -G  114   0C   8  353   13   TTTTTT TT TTTTT T T TTTTTTTTTTTTT TTT TNTTTTTTT TTTTTTTTTTT.  TT TT  
   102  103 B C  E     -G  113   0C   0  353    9   CCCCCC CC CCCCC C C CCCCCCCCCCCCC CCC CDCCCCCCC CCCCCCCCCCC.  CC CC  
   103  104 B A  E     -G  112   0C   0  353    8   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA AAAAAAAAA AAAAAAASAAA.  AA AA  
   104  105 B Y  E     -G  111   0C   9  353   10   YYYYYY YY YYYYY Y Y YYYYYYYYYYYYY YYY YMYYYYYYY YYYYYYYYYYY.  YY YY  
   105  106 B A    >   -     0   0    0  353   33   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA ASAAAAAAA AAAAAAAAAAA.  AS AA  
   106  107 B P  T 3  S+     0   0   64  353    8   PPPPPP PP PPPPP P P PPPPPPPPPPPPP PPP PHPPPPPPP PPPPPPPPPPP.  PP PP  
   107  108 B S  T 3  S-     0   0   47  353   31   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS SGSSSSSSS SSSSSSSSSSS.  SS SS  
   108  109 B G  S <  S+     0   0    8  353   14   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGG.  GG GG  
   109  110 B N  S    S+     0   0   50  353   43   SSSNNS NS SNNNS N S NNNSNNSSSSSSS NNN SENNNNNNN NNNNNNNNNSN.  NN NN  
   110  111 B Y  E     - H   0 124C  50  353   55   FFFYYY YY FFFYY Y Y FFYYYFYYYYYYY FFF YLFFFFFFF FFFFFFFFFFF.  FY FF  
   111  112 B V  E     -GH 104 123C   0  353    5   VVVVVV VV VVVXV V V VVVVVVVVVVVVV VVV VSVVVVVVV VVVVVVVVVVV.  VV VV  
   112  113 B A  E     +GH 103 122C   0  353    4   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA ALAAAAAAA AAAAAAAAAAA.  AA AA  
   113  114 B C  E     +GH 102 121C   5  353   10   CCCCCC CC CCCCC C C CCCCCCCCCCCCC CCC CCCCCCCCC CCCCCCCCCCC.  CC CC  
   114  115 B G  E     +GH 101 120C   1  353    6   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GYGGGGGGG GGGGGGGGGGG.  GG GG  
   115  116 B G  E >  S-G   99   0C   0  353    0   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GKGGGGGGG GGGGGGGGGGG.  GG GG  
   116  117 B L  T 3  S+     0   0    1  353    1   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL LILLLLLLL LLLLLLLLLLL.  LL LL  
   117  118 B D  T 3  S-     0   0   50  353    3   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DSDDDDDDD DDDDDDDDDDD.  DD DD  
   118  119 B N  S <  S+     0   0   30  353   21   NNNNNN NN NNNNN N N NNNNNNNNNNNNN NNN NPNNNNNNN NNNNNNNNNNN.  NN NN  
   119  120 B I  E     - I   0 139C  39  353   43   IIIIII II IIIII I I IIIMIMIIMMMMM MIM ITMMMMMMM MMMMMMMMMIM.  MI MM  
   120  121 B C  E     -HI 114 138C   0  353    7   CCCCCC CC CCCCC C C CCCCCCCCCCCCC CCC CMCCCCCCC CCCCCCCCCCC.  CC CC  
   121  122 B S  E     -HI 113 137C   9  353   14   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSS.  SS SS  
   122  123 B I  E     -HI 112 136C   0  353    6   IIIIII II IIIII I I IIIIIIIIIIIII III ICIIIIIII IIIIIIIIIII.  II II  
   123  124 B Y  E     -H  111   0C   3  353    4   YYYYYY YY YYYYY Y Y YYYYYYYYYYYYY YYY YSYYYYYYY YYYYYYYYYYY.  YY YY  
   124  125 B N  E     +H  110   0C  24  353   45   SSSSSS SS SNNSS N S NNNNNNSSNNNNN SNN SLSSNSSNN NNSSSSNNSSS.  NS SN  
   125  126 B L        +     0   0   11  353   12   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLL.  LL LL  
   126  127 B K  S    S+     0   0  109  353   60   KKKKKK KK KKKKK K K KKKKKKKKKKKKK KKK KTKKKKKKK KKKKKKKKKKK.  KK KK  
   127  128 B T  S    S-     0   0   64  353   71   TTTTTT TT TTTTT T T TTTTTTTTTTTTT STS TLSSSSSSS SSSSSSSTSTS.  ST SS  
   128  129 B R  S    S+     0   0  267  336   26   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RERRRRRRR RRRRRRRRRRR.  RR RR  
   129  130 B E  S    S-     0   0  173  340   28   EEEEEE EE EEEEE E E EEEEEEEEEEEEE EEE ESEEEEEEE EEEEEEEEEEE.  EE EE  
   130  131 B G        -     0   0   50  351   25   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GLGGGGGGG GGGGGGGGGGG.  GG GG  
   131  132 B N        +     0   0   30  349   59   NNNNNN NN NNNNN N N NNNNNNTNNNNNN NNN NHNNNNNNN NNNNNNNNNNN.  NN NN  
   132  133 B V  S    S+     0   0   58  329   58   VVVVVV VV VVVVV V V VVVVVVVVVVVVV VVV VKVVVVVVV VVVVVVVVVVV.  VV VV  
   133  134 B R  S    S-     0   0  213  347   44   RRRRRR RR RRRRR R R RRRRRKRRRRRRR KRK RNKKKKKKK KKKKKKKKKRK.  KR KK  
   134  135 B V        -     0   0   29  352   27   VVVVVV VV VVVVV V V VVIVVVVVVVVVV VVV VSVVVVVVV VVVVVVVVVVV.  VV VV  
   135  136 B S  S    S-     0   0   43  352   59   SSSSTS SS SSSSS S S SSASSSSSSSSSS SSS SVSSSSSSS SSSSSSSSSSS.  SS SS  
   136  137 B R  E     -I  122   0C 105  344   18   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RLRRRRRRR RRRRRRRRRRR.  RR RR  
   137  138 B E  E     -I  121   0C  75  346   40   EEEEEE EE EEEEE E E EEEEEEEEEEEEE EEE EIEEEEEEE EEEEEEEEEEE.  EE EE  
   138  139 B L  E     +I  120   0C   1  349    5   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL LILLLLLLL LLLLLLLLLLL.  LL LL  
   139  140 B A  E     +I  119   0C  61  351   61   PPPPPP PP PPPPP P P PPGPPSPPPPPPP SPS PRSSSSSSS SSSSSSSASPS.  SP SS  
   140  141 B G        +     0   0   50  351   27   GGGGGG GG GGGGG G G GGGGGAGGGGGGG AGA GFAAAAGAA AAAAAAAAAGA.  AG AA  
   141  142 B H        -     0   0    9  352    8   HHHHHH HH HHHHH H H HHHHHHHHHHHHH HHH HSHHHHHHH HHHHHHHHHHH.  HH HH  
   142  143 B T  S    S+     0   0   64  352   62   TTTTTT TT TTTTT T T TTTGTTTSGGGGG TTT TTTTTTTTT TTTTTTTTTTT.  TT TT  
   143  144 B G  S    S-     0   0    0  352    8   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGG.  GG GG  
   144  145 B Y        -     0   0    0  352    1   YYYYYY YY YYYYY Y Y YYYYYYYYYYYYY YYY YYYYYYYYY YYYYYYYYYYYY  YY YY  
   145  146 B L  E     +J  160   0D   0  352   18   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL LL  
   146  147 B S  E     -     0   0D   3  352    1   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  SS SS  
   147  148 B C  E     -J  159   0D   9  353   29   CCCCCC CC CCCCC C C CCCCCCCCCCCCC CCC CCCCCCCCC CCCCCCCCCCCC  CC CC  
   148  149 B C  E     -J  158   0D   0  353    6   CCCCCC CC CCCCC C C CCCCCCCCCCCCC CCC CCCCCCCCC CCCCCCCCCCCC  CC CC  
   149  150 B R  E     -J  157   0D  53  353   33   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRRRR  RR RR  
   150  151 B F  E     -J  156   0D  10  353    2   FFFFFF FF FFFFF F F FFFFFFFFFFFFF FFF FFFFFFFFF FFFFFFFFFFFF  FF FF  
   151  152 B L  S    S-     0   0   26  353   35   LLLILV IL ILLIL L L LLLLLLLLLLLLL LLL YLLLLLLLL LLLLLLLLLLLL  LV LL  
   152  153 B D  S    S-     0   0   60  353   56   DDDDDD DD DDDDD D D DDDDDDNDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DN DD  
   153  154 B D  S    S+     0   0   60  353   13   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   154  155 B N  S    S+     0   0   44  353   76   NNNNNN NN CNNNN S N NNNNGNDNNNNNN NNN NNNNNNNNN NNNNNNNNNNNN  NS NN  
   155  156 B Q  E     + K   0 169D  60  353   66   QQQQQQ QQ QQQQQ Q Q QQQQQSQQQQQQQ NQN QQNNNNNNN NNNNNNNQNQNQ  NQ NN  
   156  157 B I  E     -JK 150 168D   0  354   13   IIIIII II IIIII I I IIIIIIIIIIIII III IIIIIIIII IIIIIIIIIIII  II II  
   157  158 B V  E     -JK 149 167D   0  354   27   VVVVLV VV IVVVV V V VVVVIVVLVVVVV VVV VIVVVVVVV VVVVVVVVVIVV  VV VV  
   158  159 B T  E     -JK 148 166D   0  353    0   TTTTTT TT TTTTT T T TTTTTTTTTTTTT TTT TTTTTTTTT TTTTTTTTTTTT  TT TT  
   159  160 B S  E     -JK 147 165D   0  352   19   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  ST SS  
   160  161 B S  E >   -J  145   0D   0  352    0   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  SS SS  
   161  162 B G  T 3  S+     0   0    0  352    0   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   162  163 B D  T 3  S-     0   0    5  352    0   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   163  164 B T  S <  S+     0   0    8  353   76   MMMMTM MM MMMMM V M MMMMTTMMMMMMM TMT MTTTTTTTT TTTTTTTTTMTT  TG TT  
   164  165 B T        -     0   0    2  353   17   TTTTTT TS TSSTS T S SSSTTTSTSSSSS TST STTTTTTTT TTTTTTTTTTTT  TT TT  
   165  166 B C  E     -KL 159 179D   0  352    1   CCCCCC CC CCCCC C C CCCCCCCCCCCCC CC. CCCCCCCCC CCCCCCCCCCCC  WC CC  
   166  167 B A  E     -KL 158 178D   0  353   70   AAAAAA AA AGGAA G A GGAGAAAAGGGGG AGA AAAAAATAA AAAAAAAAAAAA  CA AA  
   167  168 B L  E     -KL 157 177D   6  353   29   LLLLLL LL LLLLL L L LLLLLLLLLLLLP LLL LLLLLLLLL LLLLLLLLLLLL  LL LL  
   168  169 B W  E     -KL 156 175D   2  353    0   WWWWWW WW WWWWW W W WWWWWWWWWWWWW WWW WWWWWWWWW WWWWWWWWWWWW  WW WW  
   169  170 B D  E >>> -KL 155 174D  37  353    1   DDDNDD ND DDDND D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   170  171 B I  T 345S+     0   0    7  353   13   IIIIII II IIIII I I IIIIIIIIIIIII III IIIIIIIII IIIIIIIIIIII  II II  
   171  172 B E  T 345S+     0   0  144  353   32   EEEEEE EE EEEEE E E EEEEEEEEEEEEE EEE EEEEEEEEE EEEEEEEEEEEE  EE EE  
   172  173 B T  T <45S-     0   0   78  353   40   TTTTTT TT TTTTT T T TTTTTTTTTTTTT TTT TTTTTTTTT TTTTTTTTTTTT  TT TT  
   173  174 B G  T  <5 +     0   0   16  353   12   GGGGGG GG AGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GW  
   174  175 B Q  E   < -L  169   0D 135  353   74   QQQNQQ NQ QQQNQ Q Q QQQQQQQQLLLLL QQQ QQQQQQQQQ QQQQQQQTQQQQ  QQ QQ  
   175  176 B Q  E     -L  168   0D  30  353   58   QQQQQQ QQ TQQQQ Q Q QQQQQQQQQQQQQ QQQ QQQQQQQQQ QQQQQQQQQQQQ  QQ QQ  
   176  177 B T  E     +     0   0D  64  353   70   CCCIAC IC ICCIV V V CCAVTKCCVVVVV KCK CTKKKKKKK KKKKKKKKKCKT  KI KK  
   177  178 B T  E     -L  167   0D  20  353   63   TTTTTT TT STTTT A T TTTTTTTGTTTTT TTT TTTTTMTTT TTTTTTTTTTTT  TA TT  
   178  179 B T  E     -L  166   0D   5  354   78   AAASAQ SS TSSSS T S SSSSTVSQSSSSS VSV STVVVVVVV VVVVVVVVVSVT  VS VV  
   179  180 B F  E     +L  165   0D   1  354    0   FFFFFF FF YFFFF F F FFFFFFFFFFFFF FFF FFFFFFFFF FFFFFFFFFFFF  FF FF  
   180  181 B T        +     0   0   34  354   73   TTTGTT GI SLLGL T L LLQLTLITLLLLL VLV ITVVVLVVV VVVVVVVMVIVA  VT IV  
   181  182 B G        +     0   0   37  354   33   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   182  183 B H        -     0   0    7  354    0   HHHHHH HH HHHHH H H HHHHHHHHHHHHH HHH HHHHHHHHH HHHHHHHHHHHH  HH HH  
   183  184 B T  S    S+     0   0   99  354   69   TTTTTT TT TTTTT T T TTTTSTTTTTTTT TTT TTTTTTTTT TTTTTTTTTTTT  TT TT  
   184  185 B G  S    S-     0   0    0  354   17   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   185  186 B D        -     0   0    1  354    0   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DE  
   186  187 B V  E     -M  202   0E   0  354   18   VVVVVV VV VVVVV V V VVVVVCVVVVVVV CVC VVCCCCCCC CCCCCCCCCVCV  CV CC  
   187  188 B M  E     +     0   0E   3  354   11   MMMMMM MM MMMMM M M MMMMMMMMMMMMM MMM MMMMMMMMM MMMMMMMMMMMM  MM MT  
   188  189 B S  E     -M  201   0E  16  354   17   SSSSSS SS SAASS S S AAAASSSSAAAAA SAS SSSSSSSSS SSSSSSSSSSSS  SS SR  
   189  190 B L  E     -M  200   0E   3  354   28   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL LP  
   190  191 B S  E     -M  199   0E  21  354   23   SSSSSS SS SSSSS S S SSSSSASSSSSSS ASA SSAAAAAAA AAAAAAAAASAS  AS AA  
   191  192 B L  E     -M  198   0E  29  354   32   LLLLLL LL LVLLL L L LLLLLVLLLLLLL VLV LLVVVVVVV VVVVVVVVVLVL  VL VV  
   192  193 B A    >   -     0   0    4  354   63   SSSASS AS NSSAS A A SSAASSAAAAAAA SSS AASSSSSSS SSSSSSSSSSSA  SA SS  
   193  194 B P  T 3  S+     0   0   85  354   30   PPPPPP PP PPPPP P P PPAPPPPPPPPPP PPP PPPPPPPPP PPPPPPPPPPPP  PP PP  
   194  195 B D  T 3  S-     0   0   87  354   71   DDDDDS DD NQQDD D D QQQGDDDDQQQQQ DQD DDDDDDDDD DDDDDDDDDDDD  DN DD  
   195  196 B T  S <  S+     0   0   62  354   89   FFFMYM MM NFFMM L M CCSCLFMQCCCCC FGF TSFFFFFFF FYYFFFYFFMFT  FL FF  
   196  197 B R  S    S+     0   0  142  355   76   RRRRKR RR QRRRR R R RRKQKKHRKKKKK RKN RRKNNKKNN NKKKKRKRKRKR  NQ KN  
   197  198 B L  E     - N   0 211E  37  351   70   TTTTTT TT SVVTT T T VVTTTLTTTTTTT LTL TCLLLLLLL LLLLLLLILTLM  LT LL  
   198  199 B F  E     -MN 191 210E   0  351    0   FFFFFF FF FFFFF F F FFFFFFFFFFFFF FFF FFFFFFFFF FFFFFFFFFFFF  FF FF  
   199  200 B V  E     -MN 190 209E   0  352   12   IIIVVT VV VVVVV V V VVVVVIVVVVVVV IVI VVIIIIIII IIIIIIIVIVIV  II II  
   200  201 B S  E     -MN 189 208E   0  353    3   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  SS SK  
   201  202 B G  E     +MN 188 207E   0  355    3   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GR  
   202  203 B A  E >   -M  186   0E   0  354   31   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA AAAAAAAAA AAAAAAAAAAAA  AA AT  
   203  204 B C  T 3  S+     0   0    5  354    7   CCCCCC CC CCCCC C C CCCCCCCCCCCCC CCC CCCCCCCCC CCCCCCCCCCCC  CC CC  
   204  205 B D  T 3  S-     0   0   31  354    0   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   205  206 B A  S <  S+     0   0   20  354   39   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA AAAAAAAAA AAAAAAAAAAAA  AA AA  
   206  207 B S  E     - O   0 222E   6  354   82   SSSSTS SS SSSSS S S SSTSSTSSSSSSS SKS SSSSSSSSS SSSSSSSTSSSS  SS TS  
   207  208 B A  E     -NO 201 221E   0  354   28   AAAASA AA AAAAA A A AAAASAAAAAAAA AAA AAAAAAAAA AAAAAAAAAAAA  AA AA  
   208  209 B K  E     -NO 200 220E  18  354   20   KKKKKK KK KKKKK K K KKKKKKKKKKKKK KKK KKKKKKKKK KKKKKKKKKKKK  KK KK  
   209  210 B L  E     -NO 199 219E   2  354   11   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL LL  
   210  211 B W  E     -NO 198 217E   1  354    0   WWWFWW FW WWWFW W W WWWWWWWWWWWWW WWW WWWWWWWWW WWWWWWWWWWWW  WW WW  
   211  212 B D  E >>> -NO 197 216E  11  354    0   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   212  213 B V  T 345S+     0   0   12  354   39   IIIIII II IIIII I I IIIIIVIVIIIII VIV IIVVVVVVV VVVVVVVIVIVI  VL VV  
   213  214 B R  T 345S+     0   0  194  354    0   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRRRR  RR RR  
   214  215 B E  T <45S-     0   0  111  353   69   DDDDDD DE GEEDE D E EEEEDEEDEEEEE EEE EEEEEEEEE EEEEEEEEEEEE  ED EE  
   215  216 B G  T  <5 +     0   0    8  354   39   GGGGGG GG GGGGG G G GGGGGGGCGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   216  217 B M  E      -     0   0    1  353    5   FFFFFF FF FFFFF F F FFFFFFFFFFFFF FFF FFFFFFFFF FFFFFFFFFFFF  FF FF  
   235  236 B P  T 3  S+     0   0   45  353    4   PPPPPP PP PPPPP P P PPPPPPPPPPPPP PPP PPPPPPPPP PPPPPPPPPPPP  PP PP  
   236  237 B N  T 3  S-     0   0   42  353   42   SSSNNN NN SNNNN S N NNNNSNNSNNNNN NNN NNNNNNSNN NNNNNNNNNNNN  NN NN  
   237  238 B G  S <  S+     0   0   12  353    5   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   238  239 B N  S    S+     0   0   56  353   67   NNNFNH FF FHHFF L F HHHQYEWFQQQQQ EFE YNEEEEEEE EEEEEEEEEQEN  EM EE  
   239  240 B A  E     - Q   0 253F   0  353   48   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA AAAAAAAAA AAAAAAAAAAAA  AS AA  
   240  241 B F  E     -PQ 233 252F   0  353   14   FFFFFF FF FFFFF F F FFFFFIFFFFFFF IFI FFIIIIIII IIIIIIIVIFIF  IF II  
   241  242 B A  E     -PQ 232 251F   0  353   59   AAAAGA AA GAAAA A A AAAAACAAAAAAA CAC AACCCCCCC CCCCCCCCCACA  CA CC  
   242  243 B T  E     -PQ 231 250F   0  353    6   TTTTTT TT TTTTT T T TTTTTTTTTTTTT TTT TTTTTTTTT TTTTTTTTTTTT  TT TT  
   243  244 B G  E     +PQ 230 249F   0  353    0   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   244  245 B S  E >   -P  228   0F   0  353    0   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  SS SS  
   245  246 B D  T 3  S+     0   0   13  353    2   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   246  247 B D  T 3  S-     0   0   28  353    0   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   247  248 B A  S <  S+     0   0    6  353   38   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA AAAAAAAAA AAAAAAAAAAAA  AA AA  
   248  249 B T        -     0   0   16  353   41   TTTTTT TT TTTTT T T TTTTTTTTTTTTT STS TTSSSTSSS SSSSSSSTSTST  ST TS  
   249  250 B C  E     -QR 243 263F   0  353   12   CCCCCC CC CCCCC C C CCCCCCCCCCCCC CCC CCCCCCCCC CCCCCCCCCCCC  CC CC  
   250  251 B R  E     -QR 242 262F  23  353    7   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRRRR  RR RR  
   251  252 B L  E     -QR 241 261F   0  353    1   LLLLLL LL LLLLL F L LLLLLLLMLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL LL  
   252  253 B F  E     -QR 240 259F   1  352    1   FFFF.F FF FFFFF F F FFFFFFFFFFFFF FFF FFFFFFFFF FFFFFFFFFFFF  FF FF  
   253  254 B D  E  >> -QR 239 258F   1  352    0   DDDD.D DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   254  255 B L  T >45S+     0   0   15  352   28   IIII.I II IIIII I I IIIILLIIIIIII LIL ILLLLLLLL LLLLLLLLLILL  LI LL  
   255  256 B R  T 345S+     0   0   57  352    1   RRRR.R RR RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRRRR  RR RR  
   256  257 B A  T 345S-     0   0    0  352   29   AAAA.A AS AAAAA A A AAAAAASAAAAAA AAA AAAAAAAAA AAAAAAAAAAAA  AS AA  
   257  258 B D  T <<5 +     0   0    0  352   23   DDDD.D DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   258  259 B Q  E      -     0   0  119  354   72   HHHHHH HH HHHHH H H HHHHHHHHHHHHH HHH HHHHHHHHH HQHHHHQHDHDH  HH HH  
   266  267 B D  T 3  S+     0   0  161  354   42   DDDDDD DD DDDDD D D DDDDDEDDDDDDD EDE DDEEEEEEE EEEEEEEEEDED  ED EE  
   267  268 B N  T 3  S+     0   0   66  354   66   NNNNNN NN NNNNN N N NNNNNSNNNNNNN SNS NNSSSSSSS SSSSSSSSSNSN  SN TS  
   268  269 B I    <   +     0   0   23  354   48   IIIIII II IIIII I I IIIIIIIIIIIII III IIIIIIIII IIIIIIIIIIII  II II  
   269  270 B I        +     0   0   97  354   54   IIIIII II IIIII I I IIIIIIIIIIIII III IIIIIIIII IIIIIIIIIIII  II II  
   270  271 B C  S    S-     0   0   10  354   48   CCCCCC CC CCCCC C C CCCCCCCCCCCCC CCC CCCCCCCCC CCCCCCCCCCCC  CC CC  
   271  272 B G        -     0   0    1  355   28   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   272  273 B I  E     +S  288   0G   0  355   15   IIIIII II IIIII I I IIIIIIIIIIIII III IIIIIIIII IIIIIIIIIIII  II II  
   273  274 B T  E     +     0   0G  13  355   15   TTTTTT TT TTTTT T T TTTTTTTTTTTTT TTT TTTTTTTTT TTTTTTTTTTTT  TT TT  
   274  275 B S  E     +S  287   0G  18  355    1   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  SS SS  
   275  276 B V  E     +S  286   0G  10  355   16   VVVVVV VV VVVVV V V VVVVVVVVVVVVV VVV VVVVVVVVV VVVVVVVVVVVV  VV IV  
   276  277 B S  E     -S  285   0G  15  354   25   AAAAAA AA AAAAA A A AAAAAAAAAAAAA AAA .AAAAGAAA AAAAAAAAAAAA  AA AA  
   277  278 B F  E     -S  284   0G  12  354   30   FFFFFF FF FFFFF F F FFFFFFFFFFFFF FFF .FFFFFFFF FFFFFFFFFFFF  FF LF  
   278  279 B S        -     0   0    3  354    4   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS .SSSSSSSS SSSSSSSSSSSS  SS SS  
   279  280 B K  S    S+     0   0  104  354   81   KKKKKK KK KKKKK K K KKKKKRKKKKKKK LKL .KLLLRLLL LLLLLLLRLKLK  LK RL  
   280  281 B S  S    S-     0   0    2  354    3   SSSSSS SS SSSSS S S SSSSSSSSSSSSS SSS .SSSSSSSS SSSSSSSSSSSS  SS SS  
   281  282 B G  S    S+     0   0    0  354    1   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG .GGGGGGGG GGGGGGGGGGGG  GG GG  
   282  283 B R        +     0   0    8  354    0   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR .RRRRRRRR RRRRRRRRRRRR  RR RR  
   283  284 B L  E     - T   0 297G   0  354   11   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL .LLLLLLLL LLLLLLLLLLLL  LL LL  
   284  285 B L  E     -ST 277 296G   0  354    5   LLLLLL LL LLLLL L L LLLLLMLLLLLLL LLL .LLLLLLLL LLLLLLLLLLLL  LL LL  
   285  286 B L  E     -ST 276 295G   0  354   15   FFFLLL LL LLLLL L L LLLLLLLLLLLLL FLF .LFFFLFFF FFFFFFFLFLFL  FL FF  
   286  287 B A  E     -ST 275 294G   0  355   18   AAAGAA GA AAAGA G A AAAAAAAAAAAAA AAA SAAAAAAAA AAAAAAAAAAAA  AG AA  
   287  288 B G  E     -ST 274 293G   2  355   11   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   288  289 B Y  E >   -S  272   0G   4  355    1   YYYYYY YY YYYYY Y Y YYYYYYYYYYYYY YYY YYYYYYYYY YYYYYYYYYYYY  YY YY  
   289  290 B D  T 3  S+     0   0    3  355   34   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   290  291 B D  T 3  S-     0   0   37  355   17   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   291  292 B F  S <  S+     0   0    3  355   44   FFFFFF FF FFFXF F F FFFFFFFFFFFFF FFF FFFFFFFFF FFFFFFFFFFFF  FF FF  
   292  293 B N        -     0   0   15  355   49   NNNNNN NN NNNNN N N NNNNNNNNNNNNN NNN NNNNNNNNN NNNNNNNNNNNN  NN NN  
   293  294 B C  E     -TU 287 307G   0  355   10   CCCCCC CC CCCCC C C CCCCCCCCCCCCC CCC CCCCCCCCC CCCCCCCCCCCC  CC CC  
   294  295 B N  E     -TU 286 306G   5  355   74   NNNNNN NN NNNNN N N NNNNSNNNNNNNN NNN NNNNNNNNN NNNNNNNNNNNN  NN NN  
   295  296 B V  E     -TU 285 305G   0  355   16   VVVVVV VV VVVVV I V VVVVVIVVVVVVV VVV VVVVVIVVV VVVVVVVMIVIV  VI IV  
   296  297 B W  E     -TU 284 303G   6  355    0   WWWWWW WW WWWWW W W WWWWWWWWWWWWW WWW WWWWWWWWW WWWWWWWWWWWW  WW WW  
   297  298 B D  E  >  -T  283   0G   4  355    0   DDDDDD DD DDDDD D D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   298  299 B A  T  4 S+     0   0    0  355   65   SSSVTS VS TTTVS T S TTTTASSSTTTTT STS STSSSSSSS SSSSSSSSSSST  ST SS  
   299  300 B L  T  4 S+     0   0    0  355   27   MMMLLM LM LLMLM L M MLMMLLMMMMMMM MMM MLIMMMMMM MLLMMMLMMLML  ML LM  
   300  301 B K  T  4 S-     0   0   29  355   53   RRRKKR KK KKKKK K K KKKKKKKKKKKKK KKK KKKKKKKKK KKKKKKKKKKKK  KK KK  
   301  302 B A  S  < S+     0   0   17  355   52   QQQQGT QT GAAQT Q T AAAAGATSAAAAA CAS TACSSGGSS SCCCGCCGGTGA  SQ AS  
   302  303 B D  S    S-     0   0   95  355   52   EEEEEE EE EEEEE E E EEEEGEEEEEEEE EEE EDEEEEEEE EEEEEEEEEEED  EE EE  
   303  304 B R  E     -U  296   0G  69  354   61   RRRRRR RR RRRRR R R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRRRR  RR RR  
   304  305 B A  E     -     0   0G  14  355   63   AAAAAA AA AAAAA A A AAASAVAASSSSS VAV AAVVVVVVV VVVVVVVVVAVA  VC VV  
   305  306 B G  E     -U  295   0G   4  355   27   GGGGGG GG GGGGG G G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   306  307 B V  E >   -U  294   0G   7  355   69   VVVVVV VI VIIVI M I IIIIVIIIIIIII III IVTIITVII IIVIIIIVIIIV  IV II  
   307  308 B L  E >  S+U  293   0G   2  350   36   LLLLLL LL LLLLL L L LLLLLLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL LL  
   308  309 B A  G >  S-     0   0    4  351   70   AAAAAA AA AAAAA   A AAAAASAAAAAAA SAS AASSSSSSS SSSSSSSSSASA  SA SS  
   309  310 B G  G <   -     0   0    4  353   21   GGGGGG GG GGGGG   G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   310  311 B H  G <  S+     0   0    8  353    0   HHHHHH HH HHHHH   H HHHHHHHHHHHHH HHH HHHHHHHHH HHHHHHHHHHHH  HH HH  
   311  312 B D    <   -     0   0   26  353   32   DDDDDD DD DDDDD   D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   312  313 B N  S    S+     0   0   31  353   16   NNNNNN NN NNNNN   N NNNNNNNNNNNNN NNN NNNNNNNNN NNNNNNNNNNNN  NN NN  
   313  314 B R        +     0   0   40  353    5   RRRRRR RR RRRRR   R RRRRRRRRRRRRR RRR RRRRRRRRR RRRRRRRRRRRR  RR RR  
   314  315 B V        +     0   0    2  353   10   VVVVVV VV VVVVV   V VVVVVVVVVVVVV VVV VVVVVVVVV VVVVVVVVVVVV  VV VV  
   315  316 B S  S    S-     0   0    2  353   10   SSSSSS SS SSSSS   S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  SS SS  
   316  317 B C  E     -B  329   0A  10  353   17   CCCCCC CC CCCCC   C CCCCCCCRCCCCC CCC CCCCCCCCC CCCCCCCCCCCC  CC CC  
   317  318 B L  E     -B  328   0A  15  353   13   LLLLLL LL LLLLL   L LLLLLLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL LL  
   318  319 B G  E     -B  327   0A  10  353   13   GGGGGG GG GGGGG   G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   319  320 B V  E     -B  326   0A  25  353   19   VVVVVV VV VVVVV   V VVVVVVVVVVVVV VVV VVVVVIVVV VVVVVVVVVVVV  VV VV  
   320  321 B T    >   -     0   0    3  353   52   TTTTTT TT TTTTT   T TTTTTTTTTTTTT TTT TTTTTTTTT TTTTTTTTTTTT  TS TT  
   321  322 B D  T 3  S+     0   0   98  353   70   EEEEKE EE EEEEE   E EEDEDAEEEEEEE AEA EDAAAAAAA AAAAAAATAEAD  AE AA  
   322  323 B D  T 3  S-     0   0   51  352    9   DDDDDD DD DNNDN   N NNNNDDDNNNNNN DND DDDDDDDDD DDDDDDDDDDDD  DD DD  
   323  324 B G  S <  S+     0   0    0  352    4   GGGGGG GG GGGGG   G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   324  325 B M  S    S+     0   0   36  350   62   MMMMMM MM MMMMM   M MMMMMMMMMMMMM MMM MMMMMMMMM MMMMMMMMMMMM  MM MM  
   325  326 B A        -     0   0    0  350   30   AAAAAA AA AAAAA   A AAAAAAAAAAAAA AAA AAAAAAAAA AAAAAAAAAAAA  AA AA  
   326  327 B V  E     -BC 319 338A   0  350   33   VVVVVV VV VVVVV   V VVVVVVVVVVVVV VVV VVVVVVVVV VVVVVVVAVVVV  VV VV  
   327  328 B A  E     -BC 318 337A   0  349   47   CCCAAA AA SAAAG   G AAAAAAAAAAAAA AAA AAAAAAAAA AAAAAAAAAAAA  AC AA  
   328  329 B T  E     -BC 317 336A   7  349    4   TTTTTT TT TTTTT   T TTTTTTTTTTTTT TTT TTTTTTTTT TTTTTTTTTTTT  TT TT  
   329  330 B G  E     -BC 316 335A   1  349    4   GGGGGG GG GGGGG   G GGGGGGGGGGGGG GGG GGGGGGGGG GGGGGGGGGGGG  GG GG  
   330  331 B S    >   -     0   0    6  349    0   SSSSSS SS SSSSS   S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  SS SS  
   331  332 B W  T 3  S+     0   0    6  349    0   WWWWWW WW WWWWW   W WWWWWWWWWWWWW WWW WWWWWWWWW WWWWWWWWWWWW  WW WW  
   332  333 B D  T 3  S-     0   0   17  349    0   DDDDDD DD DDDDD   D DDDDDDDDDDDDD DDD DDDDDDDDD DDDDDDDDDDDD  DD DD  
   333  334 B S  S <  S+     0   0   12  349   35   SSSSSS SS SSSSS   S SSSSSSSSSSSSS SSS SSSSSSSSS SSSSSSSSSSSS  SS SS  
   334  335 B F        -     0   0   78  349   71   FFFFFF FF FFFFF   F FFFFFFFFFFFFF FFF FFFFFFFFF FFFFFFFFFFFF  FF FF  
   335  336 B L  E     -AC  50 329A   1  349    8   LLLLLL LL LLLLL   L LLLLLLLLLLLLL LLL LLLLLLLLL LLLLLLLLLLLL  LL LL  
   336  337 B K  E     -AC  49 328A  60  346   23   KKKKRK KR KRRKR   R RRRRRKRRRRRRR KRK RKKKKKKKK KKKKKKKKKRKK  KR KK  
   337  338 B I  E     -AC  48 327A   0  344   13   IIIIII II IVVII   I VVVVIIIIVVVVV IVI IIIVIIIII IIIIIIIIVIVI  II II  
   338  339 B W  E      AC  46 326A   2  341    0   WWWWWW WW WWWWW   W WWWWWWWWWWWWW WWW WWWWWWWWW WWWWWWWWWWWW  WW WW  
   339  340 B N              0   0   10  297   57   NNNNNN NN NNNNN   N NNNNNNNNNNNNN NNN NNNNNNNNN NNNNNNNNNNNN  NN NN  
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   80    0            P     P P               P                          P        
   342    3 G V        +     0   0   96   82   63            V     V V               V                          V        
   343    4 G I        -     0   0   38   84   34            I     I I               I                          I        
   344    5 G N    >   -     0   0  109   84   59            N     N N               N                          N        
   345    6 G I  G >  S+     0   0   25   84   30            I     I I               I                          I        
   346    7 G E  G 3  S+     0   0  122  126   44            E     E E               E                          D        
   347    8 G D  G <  S+     0   0  133  137   21            D     D D               D                          D        
   348    9 G L    <   -     0   0   35  141   15            L     L L               L                          L        
   349   10 G T     >  -     0   0   69  141   62            T     T T               T                          T        
   350   11 G E  H  > S+     0   0  116  143   33            E     E E               E                          E        
   351   12 G K  H >> S+     0   0   66  152   41            K     K K               K                          K        
   352   13 G D  H 3> S+     0   0   39  152   35            D     D D               D                          D        
   353   14 G K  H 3X S+     0   0   83  152   84            K     K K               K                          K        
   354   15 G L  H < S+     0   0    7  233    6            E     E E               E                          E        
   365   26 G V  H 3< S+     0   0   43  233   53            V     V T               V                          V        
   366   27 G T  T 3< S+     0   0  116  233   82            K     K K               K                          K        
   367   28 G L    <   -     0   0   49  233   61            L     L L               L                          L        
   368   29 G E        -     0   0  191  233   49            E     E E               E                          E        
   369   30 G R        -     0   0   32  233    1            R     R R               R                          R        
   370   31 G M        -     0   0   53  233   85            Q     Q Q               Q                          Q        
   371   32 G L     >  -     0   0   75  232   81            L     L M               L                          L        
   372   33 G V  H  > S+     0   0    4  232   15            V     V L               V                          V        
   373   34 G S  H  > S+     0   0   14  232    1            S     S S               S                          S        
   374   35 G K  H  > S+     0   0   93  232   38            K     K K               K                          K        
   375   36 G C  H  X S+     0   0    0  233   62            M     M C               A                          M        
   376   37 G C  H  X S+     0   0    0  233   63            C     C A               C                          C        
   377   38 G E  H  X S+     0   0   75  233   68            E     E E               E                          E        
   378   39 G E  H  X S+     0   0   60  233   26            E     E E               E                          E        
   379   40 G F  H  X S+     0   0    3  233   36            I     I I               I                          I        
   380   41 G R  H  X S+     0   0   53  233   79            K     K K               K                          K        
   381   42 G D  H  X S+     0   0   67  233   65            T     T D               T                          T        
   382   43 G Y  H  X S+     0   0   43  233    2            Y     Y Y               Y                          Y        
   383   44 G V  H >X S+     0   0    0  233   58            I     I I               I                          I        
   384   45 G E  H 3X S+     0   0   71  233   47            E     E E               E                          E        
   385   46 G E  H 3< S+     0   0  125  233   57            D     D E               G                          D        
   386   47 G R  H XX S+     0   0   94  233   69            K     K R               N                          K        
   387   48 G S  H >< S+     0   0   12  233   67            S     S S               S                          S        
   388   49 G G  T 3< S+     0   0   38  233   80            G     G G               G                          G        
   389   50 G E  T <4 S+     0   0  138  232   54            E     E E               E                          E        
   390   51 G D    XX> -     0   0    1  232    0            D     D D               D                          D        
   391   52 G P  H 3>5S+     0   0   17  233   25            P     P P               P                          P        
   392   53 G L  H 345S+     0   0    6  233    3            L     L L               L                          L        
   393   54 G V  H <45S+     0   0   24  233   29            V     V V               V                          V        
   394   55 G K  H  <5S-     0   0  149  233   80            K     K K               K                          K        
   395   56 G G     << -     0   0   38  233   34            G     G G               G                          G        
   396   57 G I        -     0   0   21  224   20            I     I I               I                          I        
   397   58 G P    >>  -     0   0   80  233   11            P     P P               P                          P        
   398   59 G E  T 34 S+     0   0   75  233   58            E     E E               E                          E        
   399   60 G D  T 34 S+     0   0  151  233   61            D     D D               D                          D        
   400   61 G K  T <4 S+     0   0  163  233   62            K     K K               K                          K        
   401   62 G N     <  -     0   0    1  233    0            N     N N               N                          N        
   402   63 G P  S    S+     0   0   36  224    0            P     P P               P                          P        
   403   64 G F  S    S-     0   0    3  224    0            F     F F               F                          F        
   404   65 G K              0   0  108  222   29            K     K K               K                          K        
   405   66 G E              0   0  201  217    3            E     E E               E                          E        
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   62   10  F      F            F                 F         F             F  F  FF
   408   14 P E        +     0   0  153  142   39  E      E            E                 E         E             E  E  EE
   409   15 P G  S    S+     0   0   38  144   37  G      G            G                 G         G             G  G  GG
   410   16 P Q  S    S-     0   0   94  148   90  Q      Q            Q                 Q         Q             Q  Q  QQ
   411   17 P A        +     0   0    1  149   53  A      A            A                 A         A             A  A  AA
   412   18 P S        +     0   0   28  149   71  S      S            S                 T         T             T  T  TT
   413   19 P H  S    S+     0   0   42  151   57  H      H            H                 H         H             H  H  HH
   414   20 P T  S  > S-     0   0    2  152   17  T      T            T                 T         T             T  T  TT
   415   21 P G  H  > S-     0   0   10  164    2  G      G            G                 G         G             G  G  GG
   416   22 P P  H  > S+     0   0   14  165    0  P      P            P                 P         P             P  P  PP
   417   23 P K  H  > S+     0   0    6  165    0  K      K            K                 K         K             K  K  KK
   418   24 P G  H  X S+     0   0    0  165    1  G      G            G                 G         G             G  G  GG
   419   25 P V  H  X S+     0   0    0  165    0  V      V            V                 V         V             V  V  VV
   420   26 P I  H  X S+     0   0    4  165   14  I      I            I                 I         I             I  I  II
   421   27 P N  H  X S+     0   0   48  165   42  N      N            N                 N         N             N  N  NN
   422   28 P D  H  X S+     0   0   14  166    0  D      D            D                 D         D             D  D  DD
   423   29 P W  H  X S+     0   0    6  166    0  W      W            W                 W         W             W  W  WW
   424   30 P R  H  < S+     0   0   67  166   26  R      R            R                 R         R             R  R  RR
   425   31 P K  H >X S+     0   0   67  166   36  K      K            K                 K         K             K  K  KK
   426   32 P F  H >X>S+     0   0    1  166    1  F      F            F                 F         F             F  F  FF
   427   33 P K  H 3<5S+     0   0   30  166    7  K      K            K                 K         K             K  K  KK
   428   34 P L  H <45S+     0   0  139  161    1  L      L            L                 L         L             L  L  LL
   429   35 P E  H <<5S+     0   0   86  161    9  E      E            E                 E         E             E  E  EE
   430   36 P S  T  <5       0   0   57  162   66  s      s            s                 s         s             s  s  ss
   431   37 P E      <       0   0  118  167   66  r      r            r                 r         r             r  r  kr
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  143   42  F      F            F                 L         L             F  I  IF
   434   69 P S        +     0   0   52  144   64  S      S            S                 S         S             S  S  SS
   435   70 P R        -     0   0  103  120   85  R      R            R                 R         R             R  R  RR
   436   71 P K        +     0   0   22  123   12  K      K            K                 K         K             K  K  KK
   437   72 P M  S    S-     0   0   12  124   13  M      M            M                 M         M             M  M  MM
   438   73 P S     >  -     0   0   52  131   65  S      S            S                 S         S             S  S  SS
   439   74 P V  H  > S+     0   0  107  130   53  V      V            V                 V         V             I  I  II
   440   75 P Q  H  > S+     0   0  133  130   52  Q      Q            Q                 Q         Q             Q  Q  QQ
   441   76 P E  H  > S+     0   0   38  134   26  E      E            E                 E         E             E  E  EE
   442   77 P Y  H  X S+     0   0   36  146   56  Y      Y            Y                 Y         Y             Y  Y  YY
   443   78 P E  H  < S+     0   0  111  154   61  E      E            E                 E         E             E  E  EE
   444   79 P L  H >X S+     0   0   45  155   57  L      L            L                 L         L             L  L  LL
   445   80 P I  H 3< S+     0   0   37  157   72  I      I            I                 I         I             I  I  II
   446   81 P H  T 3< S+     0   0  178  158   80  H      H            H                 H         H             H  H  HH
   447   82 P K  T <4 S+     0   0  140  157   65  K      K            K                 Q         Q             Q  Q  KQ
   448   83 P D     <  -     0   0   58  169   39  D      D            D                 D         D             D  D  DD
   449   84 P K        -     0   0  205  149   80  K      K            K                 K         K             K  K  KK
   450   85 P E        -     0   0   45  150   68  E      E            E                 E         E             E  E  EE
   451   86 P D    >>  -     0   0   87  169   31  D      D            D                 D         D             D  D  DD
   452   87 P E  H 3> S+     0   0  113  168   12  E      E            E                 E         E             E  E  EE
   453   88 P N  H 3> S+     0   0   73  169   59  N      N            N                 N         N             N  N  NN
   454   89 P C  H <> S+     0   0   32  170   72  C      C            C                 C         C             C  C  CC
   455   90 P L  H  X S+     0   0    4  170    2  L      L            L                 L         L             L  L  LL
   456   91 P R  H  X S+     0   0  131  170   63  R      R            R                 R         R             R  R  RR
   457   92 P K  H  X S+     0   0  112  170   59  K      K            K                 K         K             K  K  KK
   458   93 P Y  H  X S+     0   0    7  170    5  Y      Y            Y                 Y         Y             Y  Y  YY
   459   94 P R  H  X S+     0   0   31  170   31  R      R            R                 R         R             R  R  RR
   460   95 P R  H  X S+     0   0  130  170   43  R      R            R                 R         R             R  R  RR
   461   96 P Q  H  X S+     0   0   96  170   30  Q      Q            Q                 Q         Q             Q  Q  QQ
   462   97 P C  H  X S+     0   0   22  170   72  C      C            C                 C         C             C  C  CC
   463   98 P M  H  X S+     0   0   33  170   11  M      M            M                 M         M             M  M  MM
   464   99 P Q  H  X S+     0   0  115  170   54  Q      Q            Q                 Q         Q             Q  Q  QQ
   465  100 P D  H  X S+     0   0   46  170   21  D      D            D                 D         D             D  D  DD
   466  101 P M  H  X S+     0   0   23  170    2  M      M            M                 M         M             M  M  MM
   467  102 P H  H  X S+     0   0   64  170   74  H      H            H                 H         H             H  H  HH
   468  103 P Q  H  < S+     0   0  143  170   59  Q      Q            Q                 Q         Q             Q  Q  QQ
   469  104 P K  H  < S+     0   0  140  170   55  K      K            K                 K         K             K  K  KK
   470  105 P L  H  < S+     0   0   35  170   43  L      L            L                 L         L             L  L  LL
   471  106 P S     <  -     0   0   75  170   79  S      S            S                 S         S             S  S  SS
   472  107 P F        -     0   0   71  168   99  F      F            F                 F         F             F  F  FF
   473  108 P G        -     0   0   36  168   51  G      G            G                 G         G             G  G  GG
   474  109 P P        +     0   0   92  160   41  P      P            P                 P         P             P  P  PP
   475  110 P R        +     0   0  177  165   61  R      R            R                 R         R             R  R  RR
   476  111 P Y        +     0   0   51  166    5  Y      Y            Y                 Y         Y             Y  Y  YY
   477  112 P G        +     0   0   12  170   61  G      G            G                 G         G             G  G  GG
   478  113 P F  S    S-     0   0  151  170  103  F      F            F                 F         F             F  F  FF
   479  114 P V  E     -v  532   0H  28  170   13  V      V            V                 V         V             V  V  VV
   480  115 P Y  E     -v  533   0H  71  165   68  Y      Y            Y                 Y         Y             Y  Y  YY
   481  116 P E  E     -v  534   0H 108  170   41  E      E            E                 E         E             E  E  EE
   482  117 P L        -     0   0   12  170   32  L      L            L                 L         L             L  L  LL
   483  118 P E        +     0   0  134  170   74  E      E            E                 E         E             E  E  EE
   484  119 P S  S >> S-     0   0   57  170   53  S      S            S                 S         S             T  T  TT
   485  120 P G  H 3> S+     0   0   15  169   40  G      G            G                 G         G             G  G  GG
   486  121 P E  H 3> S+     0   0  127  170   23  E      E            E                 E         E             E  E  EE
   487  122 P Q  H <> S+     0   0   72  170   61  Q      Q            Q                 Q         Q             Q  Q  QQ
   488  123 P F  H  X S+     0   0   26  170    1  F      F            F                 F         F             F  F  FF
   489  124 P L  H  X S+     0   0   90  170    6  L      L            L                 L         L             L  L  LL
   490  125 P E  H  X S+     0   0  103  170   41  E      E            E                 E         E             E  E  EE
   491  126 P T  H  < S+     0   0   10  170   76  T      T            T                 T         T             T  T  TT
   492  127 P I  H  < S+     0   0   17  170   12  I      I            I                 I         I             I  I  II
   493  128 P E  H  < S+     0   0  139  170   20  E      E            E                 E         E             E  E  EE
   494  129 P K  S  < S+     0   0  172  170   35  K      K            K                 K         K             K  K  KK
   495  130 P E  S    S-     0   0   38  166    5  E      E            E                 E         E             E  E  EE
   496  131 P Q    >   -     0   0  116  170   66  Q      Q            Q                 Q         Q             Q  Q  QQ
   497  132 P K  T 3  S+     0   0  156  170   34  K      K            K                 K         K             K  K  KK
   498  133 P I  T 3  S+     0   0   68  170   87  I      I            I                 I         I             I  I  II
   499  134 P T    <   -     0   0   10  170   35  T      T            T                 T         T             T  T  TT
   500  135 P T  E     -W  558   0H   7  169   62  T      T            T                 T         T             T  T  TT
   501  136 P I  E     -Wx 557 531H   3  170   15  I      I            I                 I         I             I  I  II
   502  137 P V  E     -Wx 556 532H   0  170   35  V      V            V                 V         V             V  V  VV
   503  138 P V  E     -Wx 555 533H   0  170   12  V      V            V                 V         V             V  V  VV
   504  139 P H  E     -Wx 554 534H   0  170    6  H      H            H                 H         H             H  H  HH
   505  140 P I  E     +Wx 553 535H   2  170    1  I      I            I                 I         I             I  I  II
   506  141 P Y  E     - x   0 536H   4  170    2  Y      Y            Y                 Y         Y             Y  Y  YY
   507  142 P E    >   -     0   0   45  170   26  E      E            E                 E         E             E  E  EE
   508  143 P D  T 3  S+     0   0   95  170   51  D      D            D                 D         D             D  D  DD
   509  144 P G  T 3  S+     0   0   66  170   48  G      G            G                 G         G             G  G  GG
   510  145 P I  S X> S-     0   0   36  170   33  I      I            I                 I         I             I  V  II
   511  146 P K  T 34 S+     0   0  191  170   71  K      K            K                 K         K             K  K  KK
   512  147 P G  T 3> S+     0   0   13  170   22  G      G            G                 G         G             G  G  GG
   513  148 P C  H <> S+     0   0    0  170   35  C      C            C                 C         C             C  C  CC
   514  149 P D  H  X S+     0   0   78  170   47  D      D            D                 D         D             D  D  DD
   515  150 P A  H  > S+     0   0   44  170   50  A      A            A                 A         A             A  A  VA
   516  151 P L  H  X S+     0   0    0  170   11  L      L            L                 L         L             L  L  LL
   517  152 P N  H  X S+     0   0   19  170   16  N      N            N                 N         N             N  N  NN
   518  153 P S  H  X S+     0   0   78  170   56  S      S            S                 S         S             S  S  SS
   519  154 P S  H  X S+     0   0    6  170   35  S      S            S                 S         S             S  S  SS
   520  155 P L  H  X S+     0   0    1  170   10  L      L            L                 L         L             L  L  LL
   521  156 P I  H  X S+     0   0  105  170   85  I      I            T                 T         T             A  T  TA
   522  157 P C  H  X S+     0   0   63  170   38  C      C            C                 C         C             C  C  CC
   523  158 P L  H  X S+     0   0    0  170    4  L      L            L                 L         L             L  L  LL
   524  159 P A  H  < S+     0   0    1  170    9  A      A            A                 A         A             A  A  AA
   525  160 P A  H  < S+     0   0   61  170   67  A      A            A                 A         A             A  A  AA
   526  161 P E  H  < S+     0   0   72  170   23  E      E            E                 E         E             E  E  EE
   527  162 P Y    ><  +     0   0    5  170    2  Y      Y            Y                 Y         Y             Y  Y  YY
   528  163 P P  T 3  S+     0   0   28  170   29  P      P            P                 P         P             P  P  PP
   529  164 P M  T 3  S+     0   0   26  170   86  M      M            M                 M         M             M  L  MM
   530  165 P V  S <  S-     0   0    1  170    8  V      V            V                 V         V             V  V  VV
   531  166 P K  E     - x   0 501H  37  170    2  K      K            K                 K         K             K  K  KK
   532  167 P F  E     +vx 479 502H   0  170    1  F      F            F                 F         F             F  F  FF
   533  168 P C  E     -vx 480 503H   0  170   18  C      C            C                 C         C             C  C  CC
   534  169 P K  E     +vx 481 504H  51  170   37  K      K            K                 K         K             K  K  KK
   535  170 P I  E     - x   0 505H   1  170   21  I      I            I                 I         I             I  I  II
   536  171 P K  E >>  - x   0 506H  52  170   72  K      K            K                 K         K             K  K  KK
   537  172 P A  H >> S+     0   0   13  170   46  A      A            A                 A         A             A  A  AA
   538  173 P S  H 34 S+     0   0   88  170   30  S      S            S                 S         S             S  S  SS
   539  174 P N  H <4 S+     0   0   67  170   86  N      N            N                 N         N             N  N  NN
   540  175 P T  H << S-     0   0   25  170   73  T      T            T                 T         T             T  T  TT
   541  176 P G     <  +     0   0   66  169   22  G      G            G                 G         G             G  G  GG
   542  177 P A    >   -     0   0   39  170   55  A      A            A                 A         A             A  A  AA
   543  178 P G  T 3  S-     0   0   70  169   43  G      G            G                 G         G             G  G  GG
   544  179 P D  T 3  S+     0   0  151  169   78  D      D            D                 D         D             D  D  DD
   545  180 P R  S <  S+     0   0  167  169   58  R      R            R                 R         R             R  R  RR
   546  181 P F  S    S+     0   0   35  169    0  F      F            F                 F         F             F  F  FF
   547  182 P S    >>  -     0   0   34  169   70  S      S            S                 S         S             S  S  SS
   548  183 P S  T 34 S+     0   0   86  169   84  S      S            S                 S         S             S  S  SS
   549  184 P D  T 34 S+     0   0  126  169   66  D      D            D                 D         D             D  D  DD
   550  185 P V  T <4 S+     0   0   20  169   65  V      V            V                 V         V             V  V  VV
   551  186 P L     <  +     0   0    8  170   13  L      L            L                 L         L             L  L  LL
   552  187 P P  S    S+     0   0    1  170    0  P      P            P                 P         P             P  P  PP
   553  188 P T  E     -W  505   0H   1  170   42  T      T            T                 T         T             T  T  TT
   554  189 P L  E     -WY 504 566H   0  170    2  L      L            L                 L         L             L  L  LL
   555  190 P L  E     -WY 503 565H   4  170    9  L      L            L                 L         L             L  L  LL
   556  191 P V  E     +WY 502 564H   0  170   19  V      V            V                 V         V             V  V  VV
   557  192 P Y  E     +WY 501 562H  31  170    0  Y      Y            Y                 Y         Y             Y  Y  YY
   558  193 P K  E >  S-WY 500 561H  25  170   12  K      K            K                 K         K             K  K  KK
   559  194 P G  T 3  S-     0   0   25  170   41  G      G            G                 G         G             G  G  GG
   560  195 P G  T 3  S+     0   0   48  170   21  G      G            G                 G         G             G  G  GG
   561  196 P E  E <   -Y  558   0H  38  170   36  E      E            E                 E         E             E  E  EE
   562  197 P L  E     +Y  557   0H  34  170   12  L      L            L                 L         L             L  L  LL
   563  198 P L  E     -     0   0H   2  170   20  L      L            L                 I         I             I  I  II
   564  199 P S  E     -Y  556   0H   4  170   30  S      S            S                 S         S             S  S  SS
   565  200 P N  E     -Y  555   0H  41  170    0  N      N            N                 N         N             N  N  NN
   566  201 P F  E >   -Y  554   0H   3  170    1  F      F            F                 F         F             F  F  FF
   567  202 P I  T 3  S-     0   0   87  168   25  I      I            I                 I         I             L  I  IL
   568  203 P S  T >  S-     0   0   11  168   71  S      S            S                 S         S             S  S  SS
   569  204 P V  G X  S+     0   0    0  168   35  V      V            V                 V         V             V  V  VV
   570  205 P T  G >  S+     0   0   17  168   36  T      T            T                 A         A             A  T  AA
   571  206 P E  G <  S+     0   0  156  168   35  E      E            E                 E         E             E  E  EE
   572  207 P Q  G <  S+     0   0   84  168   43  Q      Q            Q                 Q         Q             Q  Q  QQ
   573  208 P L  S <  S-     0   0   31  168   11  L      L            L                 F         F             F  L  FF
   574  209 P A    >   -     0   0   49  168   51  A      A            A                 A         A             A  A  AA
   575  210 P E  T 3  S+     0   0  201  168   27  E      E            E                 E         E             E  E  EE
   576  211 P E  T 3  S+     0   0  166  168   21  E      E            E                 E         E             E  E  EE
   577  212 P F    <   -     0   0   17  168    0  F      F            F                 F         F             F  F  FF
   578  213 P F    >>  -     0   0  146  168   24  F      F            F                 F         F             F  F  FF
   579  214 P T  H 3> S+     0   0   24  167   24  T      T            T                 T         T             A  A  AA
   580  215 P G  H 3> S+     0   0   32  167   71  G      G            G                 G         G             G  G  GG
   581  216 P D  H <> S+     0   0   57  167    4  D      D            D                 D         D             D  D  DD
   582  217 P V  H  X S+     0   0    0  167   23  V      V            V                 V         V             V  V  VV
   583  218 P E  H  X S+     0   0   32  167    8  E      E            E                 E         E             E  E  EE
   584  219 P S  H  X S+     0   0   58  167   52  S      S            S                 S         S             S  S  SS
   585  220 P F  H  < S+     0   0    2  168    2  F      F            F                 F         F             F  F  FF
   586  221 P L  H ><>S+     0   0    0  168    0  L      L            L                 L         L             L  L  LL
   587  222 P N  H ><5S+     0   0   61  168   82  N      N            N                 N         N             N  N  NN
   588  223 P E  T 3<5S+     0   0   70  168   18  E      E            E                 E         E             E  E  EE
   589  224 P Y  T < 5S-     0   0   20  165   47  Y      Y            Y                 Y         Y             Y  Y  YY
   590  225 P G  T < 5S+     0   0    6  165    6  G      G            G                 G         G             G  G  GG
   591  226 P L      < +     0   0    2  165   18  L      L            L                 L         L             L  L  LL
   592  227 P L  S    S-     0   0   10  161    8  L      L            L                 L         L             L  L  LL
   593  228 P P        -     0   0   40  161   31  P      P            P                 P         P             P  P  PP
   594  229 P E              0   0   94  159   17  E      E            E                 E         E             E  E  EE
   595  230 P K              0   0  161  158   24  K      K            K                 K         K             R  R  RR
## ALIGNMENTS  211 -  280
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....2....:....3....:....4....:....5....:....6....:....7....:....8
     1    2 B S              0   0  117  267   60        G    N     S     N      S  S S    N                   S         
     2    3 B E     >  -     0   0  107  283   60        E    D     E     E      E  E E    G                   E         
     3    4 B L  H  > S+     0   0   52  299   33        M    L     L     L      L  L L    L                   L         
     4    5 B D  H  > S+     0   0  104  300   57        E    D     E     D      E  D E    D                   E         
     5    6 B Q  H  > S+     0   0  131  301   62        Q    P     Q     R      Q  Q Q    N                   Q         
     6    7 B L  H  X S+     0   0   27  302   65        L    L     L     L      L  L L    L                   L         
     7    8 B R  H  X S+     0   0  110  311   10        R    R     R     R      R  R R    R                   R         
     8    9 B Q  H  X S+     0   0  117  312   60        Q    M     Q     Q      Q  Q Q    Q                   Q         
     9   10 B E  H  X S+     0   0   78  313   13        E    E     E     E      E  E E    E                   E         
    10   11 B A  H  X S+     0   0    1  313   25        A    A     A     A      A  A A    A                   A         
    11   12 B E  H  X S+     0   0  121  315   21        E    E     E     E      E  E E    E                   E         
    12   13 B Q  H  X S+     0   0  111  323   73   EEE  Q    Q     Q     A      Q  Q Q    F                   T         
    13   14 B L  H  X S+     0   0   14  348    5   III  L    L     L     L      L  L L    L                   L         
    14   15 B K  H  X S+     0   0   99  348   37   KKK  K    K     R     K      R  K R    K                   R         
    15   16 B N  H  X S+     0   0   33  348   56   DDD  K    N     N     S      N  N N    N                   K         
    16   17 B Q  H  X S+     0   0   82  348   60   EEE  Q    A     Q     H      Q  Q Q    A                   K         
    17   18 B I  H  X S+     0   0    7  348   18   III  I    I     I     I      I  I I    I                   M         
    18   19 B R  H  X S+     0   0  135  348   59   KKK  A    R     Q     R      R  R R    R                   R         
    19   20 B D  H  X S+     0   0   85  349   72   QQQ  E    E     D     D      a  D D    D                   D         
    20   21 B A  H  X S+     0   0   36  249   44   KKK  A    A     A     A      v  A A    A                   A         
    21   22 B R  H >X S+     0   0   22  349   28   RRR  R    Q     R     R      P  R R    R                   R         
    22   23 B K  H 3< S+     0   0  136  350   43   RRR  K    K     K     K      S  K K    K                   M         
    23   24 B A  H 3< S+     0   0   79  350   64   EEE  A    K     A     N      g  A A    A                   A         
    24   25 B C  H << S+     0   0   19  306   94   CCC  C    V     C     V      l  C C    A                   V         
    25   26 B A     <  +     0   0   46  309   60   RRR  A    R     N     R      S  A S    C                   C         
    26   27 B D        +     0   0   88  312    3   DDD  D    D     D     D      L  D D    D                   D         
    27   28 B A        -     0   0   17  315   51   TTT  I    T     A     C      P  A S    T                   T         
    28   29 B T    >>  -     0   0   59  315   41   TTT  T    T     T     T      R  T T    T                   S         
    29   30 B L  H 3> S+     0   0    0  317    9   MMM  L    L     L     M      I  L L    L                   L         
    30   31 B S  H 34 S+     0   0   38  323   90   QQQ  A    L     V     E      R  A S    A                   A         
    31   32 B Q  H X4 S+     0   0  119  330   65   QQQ  E    N     Q     S      Q  Q Q    Q                   E         
    32   33 B I  H 3< S+     0   0   28  332   58   VVV  L    A     I     K      I  I I    A                   V         
    33   34 B T  T >< S+     0   0    0  343   62   CCC  V    T     T     T      T  T T    T                   A         
    34   35 B N  T <  S+     0   0  129  351   77   III  S    S     S     E      A  A A    T                   K         
    35   36 B N  T 3  S+     0   0  111  351   67   NNN  G    Q     N     N      G  N G    N                   D         
    36   37 B I  S <  S-     0   0   21  338   72   VVV  L    V     M     V      L  I L    M                   V         
    37   38 B D        -     0   0  138  345   57   DDD  E    E     D     D      D  D D    E                   D         
    38   39 B P        -     0   0   89  348   62   PPP  V    P     S     N      P  P S    P                   L         
    39   40 B V        -     0   0   23  350   41   LLL  A    L     V     I      V  V V    V                   I         
    40   41 B G        -     0   0   54  353   52   GGG  G    G     G     S      G  G G    G                   N         
    41   42 B R        -     0   0  115  354   44   RRR  R    R     R     R      R  R R    R                   R         
    42   43 B I        +     0   0    8  354   63   VVV  V    I     I     L      I  I I    L                   V         
    43   44 B Q        -     0   0   54  340   61   QQQ  Q    L     Q     N      Q  Q Q    Q                   S         
    44   45 B M        -     0   0   11  345   12   MMM  M    M     M     M      M  M M    M                   L         
    45   46 B R        -     0   0   49  346   51   RRR  R    R     R     R      R  R R    R                   R         
    46   47 B T  E     +A  338   0A  12  350   67   TTT  T    L     T     A      T  T T    T                   T         
    47   48 B R  E     +     0   0A  56  355   56   RRR  R    R     R     R      R  R R    R                   R         
    48   49 B R  E     -A  337   0A  60  355   15   RRR  R    R     R     R      R  R R    R                   K         
    49   50 B T  E     -A  336   0A  30  355   27   TTT  T    T     T     T      T  T T    T                   T         
    50   51 B L  E     -A  335   0A   0  355    2   LLL  L    L     L     L      L  L L    L                   L         
    51   52 B R        +     0   0  159  355   41   RRR  R    R     R     R      R  R R    R                   R         
    52   53 B G        +     0   0   20  355    0   GGG  G    G     G     G      G  G G    G                   G         
    53   54 B H        -     0   0    4  355    0   HHH  H    H     H     H      H  H H    H                   H         
    54   55 B L  S    S+     0   0  116  355   50   LLL  L    L     L     L      L  L L    L                   L         
    55   56 B A  S    S-     0   0    0  355   30   AAA  A    A     A     A      A  A A    A                   A         
    56   57 B K        -     0   0   15  355    0   KKK  K    K     K     K      K  K K    K                   K         
    57   58 B I  E     -D   73   0B   0  355    9   III  I    I     I     I      I  I I    I                   I         
    58   59 B Y  E     -     0   0B   6  355   20   YYY  Y    Y     Y     Y      Y  Y Y    Y                   Y         
    59   60 B A  E     -D   72   0B  13  355   32   AAA  A    A     A     A      A  A A    A                   A         
    60   61 B M  E     -D   71   0B  15  355   10   MMM  M    M     M     M      M  M M    M                   M         
    61   62 B H  E     -D   70   0B  44  355   33   HHH  H    H     H     H      H  H H    H                   H         
    62   63 B W  E     -D   69   0B  11  355    0   WWW  W    W     W     W      W  W W    W                   W         
    63   64 B G    >   -     0   0    3  355   54   SSS  A    A     g     A      G  G G    g                   A         
    64   65 B T  T 3  S+     0   0   75  355   66   TTT  T    Y     d     A      S  T S    g                   S         
    65   66 B D  T 3  S-     0   0   80  355   12   DDD  D    D     S     D      D  D D    E                   D         
    66   67 B S  S <  S+     0   0    3  355   57   SSS  S    S     S     S      S  S S    S                   S         
    67   68 B R  S    S+     0   0   94  355   47   RRR  K    R     D     R      R  R R    R                   R         
    68   69 B L  E     + E   0  82B  31  355   87   NNN  L    K     L     N      L  L L    N                   N         
    69   70 B L  E     -DE  62  81B   0  355   23   LLL  L    L     L     L      L  L L    L                   L         
    70   71 B L  E     -DE  61  80B   0  355    7   VVV  V    V     T     V      V  V V    V                   V         
    71   72 B S  E     -DE  60  79B   0  354    2   SSS  S    S     Q     S      S  S S    S                   S         
    72   73 B A  E     -DE  59  78B   0  354    5   AAA  A    A     K     A      A  A A    A                   A         
    73   74 B S  E >>  -DE  57  77B   0  354    2   SSS  S    S     E     S      S  S S    S                   S         
    74   75 B Q  T 34 S+     0   0    1  355    1   QQQ  Q    Q     A     Q      Q  Q Q    Q                   Q         
    75   76 B D  T 34 S-     0   0    9  355    0   DDD  D    D     S     D      D  D D    D                   D         
    76   77 B G  T <4 S+     0   0    7  355    1   GGG  G    G     C     G      G  G G    G                   G         
    77   78 B K  E  <  -EF  73  93B  52  355   34   KKK  K    K     V     K      K  K K    K                   K         
    78   79 B L  E     -EF  72  92B   0  355    4   LLL  L    L     P     L      L  L L    L                   L         
    79   80 B I  E     -EF  71  91B   0  355    7   III  I    I     V     I      I  I I    I                   I         
    80   81 B I  E     -EF  70  90B   0  355   18   VVV  V    I     V     V      V  I I    V                   V         
    81   82 B W  E     -EF  69  88B   0  355    0   WWW  W    W     F     W      W  W W    W                   W         
    82   83 B D  E >>> -EF  68  87B  21  355   18   DDD  D    D     P     D      D  D D    D                   D         
    83   84 B S  T 345S+     0   0    0  355   52   SSS  T    S     g     A      S  S S    S                   A         
    84   85 B Y  T 345S+     0   0   57  354   48   YYY  Y    Y     l     Y      Y  Y Y    Y                   Y         
    85   86 B T  T <45S-     0   0   56  354    8   TTT  T    S     I     T      T  T T    T                   T         
    86   87 B T  T  <5 +     0   0   43  354   36   TTT  T    A     L     T      T  T T    T                   T         
    87   88 B N  E   < -F   82   0B  99  354   38   NNN  N    N     S     N      N  N N    N                   N         
    88   89 B K  E     +F   81   0B  95  354    0   KKK  K    K     K     K      K  K K    K                   K         
    89   90 B V  E    S+     0   0B  66  353   49   VVV  V    V     M     I      I  V M    I                   V         
    90   91 B H  E     -F   80   0B  57  353   18   HHH  H    H     H     H      H  R H    H                   H         
    91   92 B A  E     -F   79   0B  43  353    8   AAA  A    A     A     A      A  T A    A                   A         
    92   93 B I  E     -F   78   0B   0  353    3   III  I    I     I     I      I  I I    I                   I         
    93   94 B P  E     -F   77   0B  80  353   37   PPP  P    P     P     P      P  L P    P                   P         
    94   95 B L        -     0   0   26  354    2   LLL  L    L     L     L      L  L L    L                   L         
    95   96 B R  S    S+     0   0  190  354   40   RRR  R    R     R     R      R  V R    R                   R         
    96   97 B S        -     0   0   17  354   24   SSS  S    S     S     S      S  T S    S                   S         
    97   98 B S  S    S+     0   0    6  354   36   SSS  S    S     S     S      S  R S    S                   S         
    98   99 B W        +     0   0    2  354    3   WWW  W    W     W     W      W  G W    W                   W         
    99  100 B V  E     -G  115   0C   4  354    1   VVV  V    V     V     V      V  E V    V                   V         
   100  101 B M  E     +     0   0C   5  353    4   MMM  M    M     M     M      M  I M    M                   M         
   101  102 B T  E     -G  114   0C   8  353   13   TTT  T    T     T     T      T  K T    T                   A         
   102  103 B C  E     -G  113   0C   0  353    9   CCC  C    C     C     C      C  T C    C                   C         
   103  104 B A  E     -G  112   0C   0  353    8   AAA  A    A     A     A      A  D A    A                   A         
   104  105 B Y  E     -G  111   0C   9  353   10   YYY  Y    Y     Y     Y      Y  V Y    Y                   Y         
   105  106 B A    >   -     0   0    0  353   33   AAA  A    A     A     A      A  C A    A                   A         
   106  107 B P  T 3  S+     0   0   64  353    8   PPP  P    P     P     P      P  V P    P                   P         
   107  108 B S  T 3  S-     0   0   47  353   31   SSS  S    S     S     T      S  Y S    S                   S         
   108  109 B G  S <  S+     0   0    8  353   14   AAA  G    G     G     G      G  M G    G                   S         
   109  110 B N  S    S+     0   0   50  353   43   NNN  N    N     N     S      N  Y N    S                   S         
   110  111 B Y  E     - H   0 124C  50  353   55   FFF  F    F     Y     Y      Y  V Y    F                   F         
   111  112 B V  E     -GH 104 123C   0  353    5   VVV  V    V     V     V      V  Y V    V                   V         
   112  113 B A  E     +GH 103 122C   0  353    4   AAA  A    A     A     A      A  V A    A                   A         
   113  114 B C  E     +GH 102 121C   5  353   10   CCC  C    C     C     C      C  C C    C                   C         
   114  115 B G  E     +GH 101 120C   1  353    6   GGG  G    G     G     G      G  M G    G                   G         
   115  116 B G  E >  S-G   99   0C   0  353    0   GGG  G    G     G     G      G  G G    G                   G         
   116  117 B L  T 3  S+     0   0    1  353    1   LLL  L    L     L     L      L  I L    L                   L         
   117  118 B D  T 3  S-     0   0   50  353    3   DDD  D    D     D     D      D  Y D    D                   D         
   118  119 B N  S <  S+     0   0   30  353   21   NNN  N    N     N     N      N  R N    N                   N         
   119  120 B I  E     - I   0 139C  39  353   43   III  M    I     I     L      I  L I    I                   V         
   120  121 B C  E     -HI 114 138C   0  353    7   CCC  C    C     C     C      C  C C    C                   C         
   121  122 B S  E     -HI 113 137C   9  353   14   SSS  S    S     S     S      S  V S    S                   T         
   122  123 B I  E     -HI 112 136C   0  353    6   III  I    I     I     I      I  L I    I                   V         
   123  124 B Y  E     -H  111   0C   3  353    4   YYY  Y    Y     Y     Y      Y  P Y    Y                   Y         
   124  125 B N  E     +H  110   0C  24  353   45   NNN  S    N     N     S      C  T S    S                   S         
   125  126 B L        +     0   0   11  353   12   LLL  L    L     L     L      L  T L    L                   L         
   126  127 B K  S    S+     0   0  109  353   60   KKK  K    K     K     K      K  M K    K                   R         
   127  128 B T  S    S-     0   0   64  353   71   TTT  S    S     T     T      T  A T    T                   N         
   128  129 B R  S    S+     0   0  267  336   26   KKK  R    R     R     R      R  G R    R                   R         
   129  130 B E  S    S-     0   0  173  340   28   EEE  E    E     E     E      E  V E    .                   E         
   130  131 B G        -     0   0   50  351   25   GGG  G    G     G     G      G  L G    .                   G         
   131  132 B N        +     0   0   30  349   59   TTT  N    S     N     N      N  R N    .                   T         
   132  133 B V  S    S+     0   0   58  329   58   VVV  V    V     V     V      V  G V    .                   V         
   133  134 B R  S    S-     0   0  213  347   44   RRR  K    R     R     K      R  C R    .                   R         
   134  135 B V        -     0   0   29  352   27   VVV  V    V     V     V      V  E V    .                   I         
   135  136 B S  S    S-     0   0   43  352   59   SSS  S    S     S     S      S  G T    .                   A         
   136  137 B R  E     -I  122   0C 105  344   18   RRR  R    R     R     R      R  E R    .                   K         
   137  138 B E  E     -I  121   0C  75  346   40   EEE  E    E     E     E      E  S E    .                   E         
   138  139 B L  E     +I  120   0C   1  349    5   LLL  L    L     L     L      L  N L    .                   L         
   139  140 B A  E     +I  119   0C  61  351   61   PPP  S    P     P     P      P  T P    .                   P         
   140  141 B G        +     0   0   50  351   27   GGG  A    G     G     G      G  S G    .                   G         
   141  142 B H        -     0   0    9  352    8   HHH  H    H     H     H      H  Y H    .                   H         
   142  143 B T  S    S+     0   0   64  352   62   TTT  T    T     T     T      T  L T    .                   A         
   143  144 B G  S    S-     0   0    0  352    8   GGG  G    G     G     G      g  F g    .                   G         
   144  145 B Y        -     0   0    0  352    1   YYY  Y    Y     Y     Y      y  . y    .                   Y         
   145  146 B L  E     +J  160   0D   0  352   18   LLL  L    L     L     L      L  . L    .                   L         
   146  147 B S  E     -     0   0D   3  352    1   SSS  S    S     S     S      S  . S    .                   S         
   147  148 B C  E     -J  159   0D   9  353   29   CCC  C    C     C     C      C  V C    .                   C         
   148  149 B C  E     -J  158   0D   0  353    6   CCC  C    C     C     C      C  C C    .                   C         
   149  150 B R  E     -J  157   0D  53  353   33   RRR  R    R     R     R      R  L R    .                   R         
   150  151 B F  E     -J  156   0D  10  353    2   FFF  F    F     F     F      F  L F    .                   F         
   151  152 B L  S    S-     0   0   26  353   35   III  L    L     L     L      I  H L    .                   I         
   152  153 B D  S    S-     0   0   60  353   56   DDD  D    D     D     D      D  T D    .                   D         
   153  154 B D  S    S+     0   0   60  353   13   DDD  D    D     D     D      D  Q D    .                   D         
   154  155 B N  S    S+     0   0   44  353   76   SSS  S    N     G     T      N  N N    .                   G         
   155  156 B Q  E     + K   0 169D  60  353   66   QQQ  S    L     Q     Q      Q  D Q    .                   R         
   156  157 B I  E     -JK 150 168D   0  354   13   III  I    I     I     I      I  F I    E                   I         
   157  158 B V  E     -JK 149 167D   0  354   27   III  V    I     I     L      I  F L    V                   L         
   158  159 B T  E     -JK 148 166D   0  353    0   TTT  T    T     T     T      T  F T    T                   T         
   159  160 B S  E     -JK 147 165D   0  352   19   SSS  S    S     S     S      S  . S    S                   S         
   160  161 B S  E >   -J  145   0D   0  352    0   SSS  S    S     S     S      S  . S    S                   S         
   161  162 B G  T 3  S+     0   0    0  352    0   GGG  G    G     G     G      G  . G    G                   G         
   162  163 B D  T 3  S-     0   0    5  352    0   DDD  D    D     D     D      D  . D    D                   D         
   163  164 B T  S <  S+     0   0    8  353   76   MMM  T    M     T     M      T  R T    M                   M         
   164  165 B T        -     0   0    2  353   17   TTT  T    T     T     T      T  D T    T                   T         
   165  166 B C  E     -KL 159 179D   0  352    1   CCC  C    C     C     C      C  S C    C                   C         
   166  167 B A  E     -KL 158 178D   0  353   70   GGG  A    A     A     A      A  A A    A                   A         
   167  168 B L  E     -KL 157 177D   6  353   29   LLL  L    Q     L     Q      L  L L    L                   L         
   168  169 B W  E     -KL 156 175D   2  353    0   WWW  W    W     W     W      W  W W    W                   F         
   169  170 B D  E >>> -KL 155 174D  37  353    1   DDD  D    D     D     D      D  D D    D                   D         
   170  171 B I  T 345S+     0   0    7  353   13   III  I    I     I     I      I  I I    I                   I         
   171  172 B E  T 345S+     0   0  144  353   32   EEE  E    E     E     E      E  E E    E                   E         
   172  173 B T  T <45S-     0   0   78  353   40   TTT  T    T     T     T      T  T T    T                   T         
   173  174 B G  T  <5 +     0   0   16  353   12   GGG  A    G     G     G      S  G G    G                   G         
   174  175 B Q  E   < -L  169   0D 135  353   74   QQQ  Q    K     Q     Q      Q  Q Q    Q                   Q         
   175  176 B Q  E     -L  168   0D  30  353   58   QQQ  Q    Q     Q     Q      Q  Q Q    Q                   V         
   176  177 B T  E     +     0   0D  64  353   70   TTT  K    T     T     T      T  T A    C                   A         
   177  178 B T  E     -L  167   0D  20  353   63   TTT  A    T     T     T      T  T T    A                   T         
   178  179 B T  E     -L  166   0D   5  354   78   AAA  V    T     T     T      V  T A    S                   S         
   179  180 B F  E     +L  165   0D   1  354    0   FFF  F    Y     F     F      F  F F    F                   F         
   180  181 B T        +     0   0   34  354   73   VVV  A    N     A     S      S  T T    V                   T         
   181  182 B G        +     0   0   37  354   33   GGG  G    G     G     G      G  G G    G                   G         
   182  183 B H        -     0   0    7  354    0   HHH  H    H     H     H      H  H H    H                   H         
   183  184 B T  S    S+     0   0   99  354   69   TTT  T    T     S     A      T  T T    S                   T         
   184  185 B G  S    S-     0   0    0  354   17   GGG  G    G     G     G      G  G G    G                   G         
   185  186 B D        -     0   0    1  354    0   DDD  D    D     D     D      D  D D    D                   D         
   186  187 B V  E     -M  202   0E   0  354   18   VVV  C    V     V     A      V  V V    V                   V         
   187  188 B M  E     +     0   0E   3  354   11   MMM  M    M     M     M      M  M M    M                   M         
   188  189 B S  E     -M  201   0E  16  354   17   SSS  S    S     S     S      S  S S    S                   S         
   189  190 B L  E     -M  200   0E   3  354   28   VVV  L    L     L     L      L  L L    L                   L         
   190  191 B S  E     -M  199   0E  21  354   23   AAA  A    S     S     A      S  S S    S                   S         
   191  192 B L  E     -M  198   0E  29  354   32   LLL  V    L     L     L      L  L L    L                   L         
   192  193 B A    >   -     0   0    4  354   63   SSS  S    S     S     S      A  A S    S                   G         
   193  194 B P  T 3  S+     0   0   85  354   30   NNN  P    P     P     P      P  P P    P                   P         
   194  195 B D  T 3  S-     0   0   87  354   71   DDD  D    D     D     D      D  D D    D                   D         
   195  196 B T  S <  S+     0   0   62  354   89   RRR  S    S     L     K      Q  S Y    M                   Q         
   196  197 B R  S    S+     0   0  142  355   76   FFF  K    K     K     R      R  K K    R                   N         
   197  198 B L  E     - N   0 211E  37  351   70   TTT  L    T     T     T      T  C T    M                   L         
   198  199 B F  E     -MN 191 210E   0  351    0   FFF  F    F     F     F      F  F F    F                   F         
   199  200 B V  E     -MN 190 209E   0  352   12   VVV  V    V     V     V      V  V V    I                   I         
   200  201 B S  E     -MN 189 208E   0  353    3   SSS  S    S     S     S      S  S S    S                   S         
   201  202 B G  E     +MN 188 207E   0  355    3   GGG  G    G     G     G      G  G G    G                   G         
   202  203 B A  E >   -M  186   0E   0  354   31   GGG  A    A     A     A      A  A A    A                   A         
   203  204 B C  T 3  S+     0   0    5  354    7   CCC  C    C     C     C      C  C C    C                   C         
   204  205 B D  T 3  S-     0   0   31  354    0   DDD  D    D     D     D      D  D D    D                   D         
   205  206 B A  S <  S+     0   0   20  354   39   AAA  A    A     A     A      A  A A    A                   A         
   206  207 B S  E     - O   0 222E   6  354   82   AAA  S    S     S     S      S  S T    S                   S         
   207  208 B A  E     -NO 201 221E   0  354   28   AAA  A    A     S     A      V  A S    S                   A         
   208  209 B K  E     -NO 200 220E  18  354   20   KKK  K    K     K     K      K  K K    K                   K         
   209  210 B L  E     -NO 199 219E   2  354   11   LLL  L    L     L     L      L  L L    L                   L         
   210  211 B W  E     -NO 198 217E   1  354    0   WWW  W    W     W     W      W  W W    W                   W         
   211  212 B D  E >>> -NO 197 216E  11  354    0   DDD  D    D     D     D      D  D D    D                   D         
   212  213 B V  T 345S+     0   0   12  354   39   VVV  V    V     V     I      I  V I    I                   I         
   213  214 B R  T 345S+     0   0  194  354    0   RRR  R    R     R     R      R  R R    R                   R         
   214  215 B E  T <45S-     0   0  111  353   69   TTT  E    D     D     D      D  E D    E                   T         
   215  216 B G  T  <5 +     0   0    8  354   39   GGG  G    G     G     G      S  G G    G                   G         
   216  217 B M  E      -     0   0    1  353    5   FFF  F    F     F     F      F  F .    F                   F         
   235  236 B P  T 3  S+     0   0   45  353    4   PPP  P    P     P     P      P  P .    P                   P         
   236  237 B N  T 3  S-     0   0   42  353   42   NNN  S    Q     S     N      N  N .    N                   N         
   237  238 B G  S <  S+     0   0   12  353    5   YYY  G    G     G     G      G  G .    G                   G         
   238  239 B N  S    S+     0   0   56  353   67   QQQ  E    T     Y     M      S  N .    Q                   Q         
   239  240 B A  E     - Q   0 253F   0  353   48   SSS  A    A     A     S      A  A .    A                   A         
   240  241 B F  E     -PQ 233 252F   0  353   14   FFF  I    F     F     F      F  F .    F                   F         
   241  242 B A  E     -PQ 232 251F   0  353   59   GGG  C    S     A     A      A  A .    A                   G         
   242  243 B T  E     -PQ 231 250F   0  353    6   TTT  T    T     T     T      T  T .    T                   T         
   243  244 B G  E     +PQ 230 249F   0  353    0   GGG  G    G     G     G      G  G .    G                   G         
   244  245 B S  E >   -P  228   0F   0  353    0   SSS  S    S     S     S      S  S .    S                   S         
   245  246 B D  T 3  S+     0   0   13  353    2   DDD  D    D     D     D      D  D .    D                   D         
   246  247 B D  T 3  S-     0   0   28  353    0   DDD  D    D     D     D      D  D .    D                   D         
   247  248 B A  S <  S+     0   0    6  353   38   AAA  A    A     A     A      A  A .    A                   A         
   248  249 B T        -     0   0   16  353   41   TTT  S    T     T     T      T  T .    S                   S         
   249  250 B C  E     -QR 243 263F   0  353   12   CCC  C    V     C     C      C  C .    C                   C         
   250  251 B R  E     -QR 242 262F  23  353    7   RRR  R    K     R     R      R  R .    R                   R         
   251  252 B L  E     -QR 241 261F   0  353    1   LLL  L    L     L     L      L  L .    L                   L         
   252  253 B F  E     -QR 240 259F   1  352    1   FFF  F    Y     F     F      F  F .    F                   F         
   253  254 B D  E  >> -QR 239 258F   1  352    0   DDD  D    D     D     D      D  D .    D                   D         
   254  255 B L  T >45S+     0   0   15  352   28   III  L    I     L     I      L  L .    I                   I         
   255  256 B R  T 345S+     0   0   57  352    1   RRR  R    R     R     R      R  R .    R                   R         
   256  257 B A  T 345S-     0   0    0  352   29   AAA  A    S     A     A      A  A .    A                   S         
   257  258 B D  T <<5 +     0   0    0  352   23   DDD  D    D     D     D      D  D .    D                   D         
   258  259 B Q  E      -     0   0  119  354   72   HHH  H    H     H     N      H  H H    R                   Y         
   266  267 B D  T 3  S+     0   0  161  354   42   EEE  E    D     D     E      D  D D    D                   E         
   267  268 B N  T 3  S+     0   0   66  354   66   SSS  G    N     N     N      N  N N    N                   M         
   268  269 B I    <   +     0   0   23  354   48   III  I    I     I     I      I  I I    I                   I         
   269  270 B I        +     0   0   97  354   54   VVV  I    I     I     I      I  I I    I                   V         
   270  271 B C  S    S-     0   0   10  354   48   CCC  C    C     C     C      C  C C    C                   C         
   271  272 B G        -     0   0    1  355   28   GGG  G    G     G     G      G  G G    G                   G         
   272  273 B I  E     +S  288   0G   0  355   15   III  I    V     I     I      I  I I    I                   I         
   273  274 B T  E     +     0   0G  13  355   15   TTT  T    T     T     T      T  T T    T                   T         
   274  275 B S  E     +S  287   0G  18  355    1   SSS  S    S     S     S      S  S S    S                   S         
   275  276 B V  E     +S  286   0G  10  355   16   VVV  V    V     V     V      V  V V    V                   V         
   276  277 B S  E     -S  285   0G  15  354   25   AAA  A    A     A     G      A  A A    A                   A         
   277  278 B F  E     -S  284   0G  12  354   30   FFF  F    F     F     F      F  F F    F                   F         
   278  279 B S        -     0   0    3  354    4   SSS  S    S     S     S      S  S S    S                   S         
   279  280 B K  S    S+     0   0  104  354   81   KKK  L    K     K     K      R  K K    K                   K         
   280  281 B S  S    S-     0   0    2  354    3   SSS  S    S     S     S      S  S S    S                   S         
   281  282 B G  S    S+     0   0    0  354    1   GGG  G    G     G     G      G  G G    G                   G         
   282  283 B R        +     0   0    8  354    0   RRR  R    R     R     R      R  R R    R                   R         
   283  284 B L  E     - T   0 297G   0  354   11   LLL  L    L     L     L      L  L L    L                   L         
   284  285 B L  E     -ST 277 296G   0  354    5   LLL  L    L     L     L      L  L L    L                   L         
   285  286 B L  E     -ST 276 295G   0  354   15   LLL  F    M     L     F      L  L L    L                   L         
   286  287 B A  E     -ST 275 294G   0  355   18   AAA  A    A     A     A      A  A A    A                   A         
   287  288 B G  E     -ST 274 293G   2  355   11   GGG  G    G     G     G      G  G G    G                   G         
   288  289 B Y  E >   -S  272   0G   4  355    1   YYY  Y    Y     Y     Y      Y  Y Y    Y                   Y         
   289  290 B D  T 3  S+     0   0    3  355   34   DDD  D    D     D     D      D  D D    D                   D         
   290  291 B D  T 3  S-     0   0   37  355   17   DDD  D    D     D     D      D  D D    D                   D         
   291  292 B F  S <  S+     0   0    3  355   44   FFF  F    F     F     F      F  F F    F                   F         
   292  293 B N        -     0   0   15  355   49   NNN  N    N     N     N      N  N N    N                   N         
   293  294 B C  E     -TU 287 307G   0  355   10   CCC  C    V     C     C      C  C C    C                   C         
   294  295 B N  E     -TU 286 306G   5  355   74   NNN  N    N     S     N      N  N N    N                   N         
   295  296 B V  E     -TU 285 305G   0  355   16   VVV  I    I     V     V      I  V V    I                   V         
   296  297 B W  E     -TU 284 303G   6  355    0   WWW  W    W     W     W      W  W W    W                   W         
   297  298 B D  E  >  -T  283   0G   4  355    0   DDD  D    D     D     D      D  D D    D                   D         
   298  299 B A  T  4 S+     0   0    0  355   65   TTT  S    T     A     A      A  T T    S                   T         
   299  300 B L  T  4 S+     0   0    0  355   27   LLL  M    L     L     L      M  L L    I                   L         
   300  301 B K  T  4 S-     0   0   29  355   53   KKK  K    R     K     L      K  K K    K                   K         
   301  302 B A  S  < S+     0   0   17  355   52   GGG  C    L     G     N      G  A G    A                   G         
   302  303 B D  S    S-     0   0   95  355   52   DDD  E    E     G     D      D  D E    E                   E         
   303  304 B R  E     -U  296   0G  69  354   61   RRR  R    R     R     R      R  R R    R                   R         
   304  305 B A  E     -     0   0G  14  355   63   AAA  M    V     A     V      A  A A    I                   V         
   305  306 B G  E     -U  295   0G   4  355   27   GGG  G    G     G     G      G  G G    G                   G         
   306  307 B V  E >   -U  294   0G   7  355   69   VVV  I    V     V     V      V  V V    I                   V         
   307  308 B L  E >  S+U  293   0G   2  350   36   LLL  L    L     L     L      L  L L    L                   L         
   308  309 B A  G >  S-     0   0    4  351   70   AAA  S    A     A     A      A  A A    A                   T         
   309  310 B G  G <   -     0   0    4  353   21   GGG  G    G     G     A      G  G G    G                   G         
   310  311 B H  G <  S+     0   0    8  353    0   HHH  H    H     H     H      H  H H    H                   H         
   311  312 B D    <   -     0   0   26  353   32   DDD  D    D     D     E      D  D D    D                   D         
   312  313 B N  S    S+     0   0   31  353   16   NNN  N    N     N     N      N  N N    N                   N         
   313  314 B R        +     0   0   40  353    5   RRR  R    R     R     R      R  R R    R                   R         
   314  315 B V        +     0   0    2  353   10   VVV  V    V     V     V      V  V V    V                   V         
   315  316 B S  S    S-     0   0    2  353   10   SSS  S    S     S     S      S  S S    S                   S         
   316  317 B C  E     -B  329   0A  10  353   17   CCC  C    C     C     C      C  C C    C                   C         
   317  318 B L  E     -B  328   0A  15  353   13   LLL  L    L     L     L      L  L L    L                   L         
   318  319 B G  E     -B  327   0A  10  353   13   GGG  G    G     G     G      G  G G    G                   G         
   319  320 B V  E     -B  326   0A  25  353   19   VVV  V    V     V     I      V  V V    V                   V         
   320  321 B T    >   -     0   0    3  353   52   SSS  T    T     T     T      T  T T    T                   T         
   321  322 B D  T 3  S+     0   0   98  353   70   EEE  A    D     D     A      D  D K    D                   E         
   322  323 B D  T 3  S-     0   0   51  352    9   DDD  D    D     D     D      D  D D    D                   D         
   323  324 B G  S <  S+     0   0    0  352    4   GGG  G    G     G     G      G  G G    G                   G         
   324  325 B M  S    S+     0   0   36  350   62   MMM  M    M     M     M      M  M M    M                   L         
   325  326 B A        -     0   0    0  350   30   AAA  A    A     A     A      A  A A    A                   A         
   326  327 B V  E     -BC 319 338A   0  350   33   VVV  V    V     V     I      V  V V    V                   I         
   327  328 B A  E     -BC 318 337A   0  349   47   GGG  A    C     A     C      C  A A    A                   A         
   328  329 B T  E     -BC 317 336A   7  349    4   TTT  T    I     T     T      T  T T    T                   T         
   329  330 B G  E     -BC 316 335A   1  349    4   GGG  G    G     G     G      G  G G    G                   G         
   330  331 B S    >   -     0   0    6  349    0   SSS  S    S     S     S      S  S S    S                   S         
   331  332 B W  T 3  S+     0   0    6  349    0   WWW  W    W     W     W      W  W W    W                   W         
   332  333 B D  T 3  S-     0   0   17  349    0   DDD  D    D     D     D      D  D D    D                   D         
   333  334 B S  S <  S+     0   0   12  349   35   SSS  S    S     S     S      S  S S    S                   S         
   334  335 B F        -     0   0   78  349   71   FFF  F    F     F     Y      F  F F    F                   F         
   335  336 B L  E     -AC  50 329A   1  349    8   LLL  L    L     L     L      L  L L    L                   L         
   336  337 B K  E     -AC  49 328A  60  346   23   RRR  K    G     R     R      K  K R    R                   K         
   337  338 B I  E     -AC  48 327A   0  344   13   III  I    I     I     I      I  I I    I                   I         
   338  339 B W  E      AC  46 326A   2  341    0   WWW  W    W     W     W      W  W W    W                   W         
   339  340 B N              0   0   10  297   57   NNN  N    N     N     N      N  N N    N                   N         
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   80    0         P                  P           PP PPPPPPPPPPPPPPPPPPP PPPPPPPPP
   342    3 G V        +     0   0   96   82   63         A                  A     A     AA AAAAAAAAAAAAAAAAAAA AAAAAAAAA
   343    4 G I        -     0   0   38   84   34         I                  I     L     LL LLLLILLLLLLLLLLLLLL LLLLLLLLL
   344    5 G N    >   -     0   0  109   84   59         N                  N     H     HH HHHHNHHHHHHHHHHHHHH HHHHHHHHH
   345    6 G I  G >  S+     0   0   25   84   30         I                  I     I     II IIIIIIIIIIIIIIIIIII IIIIIIIII
   346    7 G E  G 3  S+     0   0  122  126   44         E                  E     E     EE EEEEEEEEEEEEEEEEEEE EEEEEEEEE
   347    8 G D  G <  S+     0   0  133  137   21         D                  D     D     DD DDDDDDDDDDDDDDDDDDD DDDDDDDDD
   348    9 G L    <   -     0   0   35  141   15         L                  L     L     LL LLLLLLLLLLLLLLLLLLL LLLLLLLLL
   349   10 G T     >  -     0   0   69  141   62         S                  S     P     PP PPPPSPPPPPPPPPPPPPP PPPPPPPPP
   350   11 G E  H  > S+     0   0  116  143   33         E                  E     E     EE EEEEEEEEEEEEEEEEEEE EEEEEEEEE
   351   12 G K  H >> S+     0   0   66  152   41         K                  K     K     KK KKKKKKKKKKKKKKKKKKK KKKKKKKKK
   352   13 G D  H 3> S+     0   0   39  152   35         D                  D     E     EE EEEEEEEEEEEEEEEEEEE EEEEEEEEE
   353   14 G K  H 3X S+     0   0   83  152   84         K                  K     K     KK KKKKKKKKKKKKKKKKKKK KKKKKKKKK
   354   15 G L  H < S+     0   0    7  233    6         E                  E     E     EE EEEEEEEEEEEEEEEEEEE EEEEEEEEE
   365   26 G V  H 3< S+     0   0   43  233   53         V                  V     V     VV VVVVVVVVVVVVVVVVVVV VVVVVVVVV
   366   27 G T  T 3< S+     0   0  116  233   82         K                  K     T     KK KKKKKKKKKKKKKKKKKKK KKKKKKKKK
   367   28 G L    <   -     0   0   49  233   61         L                  L     L     LL LLLLLLLLLLLLLLLLLLL LLLLLLLLL
   368   29 G E        -     0   0  191  233   49         E                  E     Q     QQ QQQQDQQQQQQQQQQQQQQ QQQQQQQQQ
   369   30 G R        -     0   0   32  233    1         R                  R     R     RR RRRRRRRRRRRRRRRRRRR RRRRRRRRR
   370   31 G M        -     0   0   53  233   85         Q                  Q     Q     QQ QQQQQQQQQQQQQQQQQQQ QQQQQQQQQ
   371   32 G L     >  -     0   0   75  232   81         P                  P     Q     QQ QQQQPQQQQQQQQQQQQQQ QQQQQQQQQ
   372   33 G V  H  > S+     0   0    4  232   15         V                  V     V     VV VVVVVVVVVVVVVVVVVVV VVVVVVVVV
   373   34 G S  H  > S+     0   0   14  232    1         S                  S     S     SS SSSSSSSSSSSSSSSSSSS SSSSSSSSS
   374   35 G K  H  > S+     0   0   93  232   38         K                  K     K     KK KKKKKKKKKKKKKKKKKKK KKKKKKKKK
   375   36 G C  H  X S+     0   0    0  233   62         C                  C     C     CC CCCCCCCCCCCCCCCCCCC CCCCCCCCC
   376   37 G C  H  X S+     0   0    0  233   63         S                  S     S     SS SSSSSSSSSSSSSSSSSSS SSSSSSSSS
   377   38 G E  H  X S+     0   0   75  233   68         E                  E     E     EE EEEEEEEEEEEEEEEEEEE EEEEEEEEE
   378   39 G E  H  X S+     0   0   60  233   26         E                  D     E     EE EEEEEEEEEEEEEEEEEEE EEEEEEEEE
   379   40 G F  H  X S+     0   0    3  233   36         I                  I     I     II IIIIIIIIIIIIIIIIIII IIIIIIIII
   380   41 G R  H  X S+     0   0   53  233   79         K                  K     K     KK KKKKKKKKKKKKKKKKKKK KKKKKKKKK
   381   42 G D  H  X S+     0   0   67  233   65         N                  N     N     NN NNNNNNNNNNNNNNNNNNN NNNNNNNNN
   382   43 G Y  H  X S+     0   0   43  233    2         Y                  Y     Y     YY YYYYYYYYYYYYYYYYYYY YYYYYYYYY
   383   44 G V  H >X S+     0   0    0  233   58         I                  I     I     II IIIIIIIIIIIIIIIIIII IIIIIIIII
   384   45 G E  H 3X S+     0   0   71  233   47         E                  E     E     EE EEEEEEEEEEEEEEEEEEE EEEEEEEEE
   385   46 G E  H 3< S+     0   0  125  233   57         E                  E     E     EE EEEEEEEEEEEEEEEEEEE EEEEEEEEE
   386   47 G R  H XX S+     0   0   94  233   69         R                  R     R     RR RRRRRRRRRRRRRRRRRRR RRRRRRRRR
   387   48 G S  H >< S+     0   0   12  233   67         S                  S     S     SS SSSSSSSSSSSSSSSSSSS SSSSSSSSS
   388   49 G G  T 3< S+     0   0   38  233   80         G                  G     G     GG GGGGGGGGGGGGGGGGGGG GGGGGGGGG
   389   50 G E  T <4 S+     0   0  138  232   54         E                  E     E     EE EEEEDEEEEEEEEEEEEEE EEEEEEEEE
   390   51 G D    XX> -     0   0    1  232    0         D                  D     D     DD DDDDDDDDDDDDDDDDDDD DDDDDDDDD
   391   52 G P  H 3>5S+     0   0   17  233   25         P                  P     P     PP PPPPPPPPPPPPPPPPPPP PPPPPPPPP
   392   53 G L  H 345S+     0   0    6  233    3         L                  L     L     LL LLLLLLLLLLLLLLLLLLL LLLLLLLLL
   393   54 G V  H <45S+     0   0   24  233   29         V                  V     V     VV VVVVVVVVVVVVVVVVVVV VVVVVVVVV
   394   55 G K  H  <5S-     0   0  149  233   80         K                  K     K     KK KKKKKKKKKKKKKKKKKKK KKKKKKKKK
   395   56 G G     << -     0   0   38  233   34         G                  G     G     GG GGGGGGGGGGGGGGGGGGG GGGGGGGGG
   396   57 G I        -     0   0   21  224   20         V                  I     I     II IIIIIIIIIIIIIIIIIII IIIIIIIII
   397   58 G P    >>  -     0   0   80  233   11         P                  P     P     PP PPPPPPPPPPPPPPPPPPP PPPPPPPPP
   398   59 G E  T 34 S+     0   0   75  233   58         E                  E     E     EE EEEEEEEEEEEEEEEEEEE EEEEEEEEE
   399   60 G D  T 34 S+     0   0  151  233   61         D                  D     D     DD DDDDDDDDDDDDDDDDDDD DDDDDDDDD
   400   61 G K  T <4 S+     0   0  163  233   62         K                  R     K     KK KKKKRKKKKKKKKKKKKKK KKKKKKKKK
   401   62 G N     <  -     0   0    1  233    0         N                  N     N     NN NNNNNNNNNNNNNNNNNNN NNNNNNNNN
   402   63 G P  S    S+     0   0   36  224    0         P                  P     P     PP PPPPPPPPPPPPPPPPPPP PPPPPPPPP
   403   64 G F  S    S-     0   0    3  224    0         F                  F     F     FF FFFFFFFFFFFFFFFFFFF FFFFFFFFF
   404   65 G K              0   0  108  222   29         K                  K     K     KK KKKKKKKKKKKKKKKKKKK KKKKKKKKK
   405   66 G E              0   0  201  217    3         E                  E     E     EE EEEEEEEEEEEEEEEEEEE EEEEEEEEE
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   62   10      FF   FF FFFFF  FFFF FF FFF F  F FF                                
   408   14 P E        +     0   0  153  142   39      EE   EE EEEEE  EEEE EE EEE E  E EE                                
   409   15 P G  S    S+     0   0   38  144   37      GG   GG GGGGG  GGGG GG GGG G  G GG                                
   410   16 P Q  S    S-     0   0   94  148   90      QQ   QQ QQQQQ  QQQQ QQ QQQ Q  Q QQ                                
   411   17 P A        +     0   0    1  149   53      AA   AA AAAAA  AAAA AA VAA A  A AA                                
   412   18 P S        +     0   0   28  149   71      TT   TT TTTTT  TTTT TT TTT T  T TT                                
   413   19 P H  S    S+     0   0   42  151   57      HH   HH HHHHH  HHHH HH HHH H  H HH                                
   414   20 P T  S  > S-     0   0    2  152   17      TT   TT TTTTt  TTTT TT TTT T  T TT                                
   415   21 P G  H  > S-     0   0   10  164    2  G   GG  GGG GGGGg GGGGG GG GGG G  G GG                                
   416   22 P P  H  > S+     0   0   14  165    0  P   PP  PPP PPPPP PPPPP PP PPP P  P PP                                
   417   23 P K  H  > S+     0   0    6  165    0  K   KK  KKK KKKKK KKKKK KK KKK K  K KK                                
   418   24 P G  H  X S+     0   0    0  165    1  G   GG  GGG GGGGG GGGGG GG GGG G  G GG                                
   419   25 P V  H  X S+     0   0    0  165    0  V   VV  VVV VVVVV VVVVV VV VVV V  V VV                                
   420   26 P I  H  X S+     0   0    4  165   14  I   II  III IIIII IIIII II III I  I II                                
   421   27 P N  H  X S+     0   0   48  165   42  N   NN  NNN NNHNN NNNNN NN HNN N  N NN                                
   422   28 P D  H  X S+     0   0   14  166    0  D   DD  DDD DDDDD DDDDD DD DDD D  D DD                                
   423   29 P W  H  X S+     0   0    6  166    0  W   WW  WWW WWWWW WWWWW WW WWW W  W WW                                
   424   30 P R  H  < S+     0   0   67  166   26  R   RR  RRR RRRRR RRRRR RR RRR R  R RR                                
   425   31 P K  H >X S+     0   0   67  166   36  K   KK  KKK KKKKK KKKKK KK KKK K  K KK                                
   426   32 P F  H >X>S+     0   0    1  166    1  F   FF  FFF FFFFF FFFFF FF FFF F  F FF                                
   427   33 P K  H 3<5S+     0   0   30  166    7  K   KK  KKK KKKKK KKKKK KK KKK K  K KK                                
   428   34 P L  H <45S+     0   0  139  161    1  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   429   35 P E  H <<5S+     0   0   86  161    9  E   EE  EEE EEEEE EEEER EE EEE E  E EE                                
   430   36 P S  T  <5       0   0   57  162   66  s   ss  sss sssss sssss ss sss s  s ss                                
   431   37 P E      <       0   0  118  167   66  r   rr  rrr rrrrr rrrrr rr rrr r  r rk                                
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  143   42  F   FF  FFF VVFVL VVVVF VV FVM V  M FF                                
   434   69 P S        +     0   0   52  144   64  S   SS  SSS SSSSG SSSSS SH SSS S  S GS                                
   435   70 P R        -     0   0  103  120   85  R   RR  RRR RRRRR RRRRR RR RRR R  R RR                                
   436   71 P K        +     0   0   22  123   12  K   KK  KKK KKKKK KKKKK KK KKK K  K KK                                
   437   72 P M  S    S-     0   0   12  124   13  M   MM  MMM MMMMM MMMMM MV MMM M  M MM                                
   438   73 P S     >  -     0   0   52  131   65  S   SS  SSS SSSSS SSSSS SS SSS S  S SS                                
   439   74 P V  H  > S+     0   0  107  130   53  I   II  III IIIII IIIII II III I  I VV                                
   440   75 P Q  H  > S+     0   0  133  130   52  Q   QQ  QQQ QQQQQ QQQQQ QQ QQQ Q  Q QQ                                
   441   76 P E  H  > S+     0   0   38  134   26  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   442   77 P Y  H  X S+     0   0   36  146   56  Y   YY  YYY YYYYY YYYYY YY YYY Y  Y YY                                
   443   78 P E  H  < S+     0   0  111  154   61  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   444   79 P L  H >X S+     0   0   45  155   57  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   445   80 P I  H 3< S+     0   0   37  157   72  I   II  III IIIII IIIII II III I  I II                                
   446   81 P H  T 3< S+     0   0  178  158   80  H   HH  HHH HHHHH HHHHH NN HHH H  H HH                                
   447   82 P K  T <4 S+     0   0  140  157   65  R   RQ  RRR KKQKQ KKKKQ QQ QKQ K  Q QQ                                
   448   83 P D     <  -     0   0   58  169   39  D   DD  DDD EEDED EEEED DD DED E  D ED                                
   449   84 P K        -     0   0  205  149   80  K   KK  KKK KKKKK KKKKK KK KKK K  K KK                                
   450   85 P E        -     0   0   45  150   68  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   451   86 P D    >>  -     0   0   87  169   31  D   DD  DDD DDDDD DDDDD DD DDD D  D DD                                
   452   87 P E  H 3> S+     0   0  113  168   12  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   453   88 P N  H 3> S+     0   0   73  169   59  N   NN  NNN NNTNN NNNNN ND TNS N  G NK                                
   454   89 P C  H <> S+     0   0   32  170   72  C   CC  CCC CCCCC CCCCC CC CCC C  C CC                                
   455   90 P L  H  X S+     0   0    4  170    2  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   456   91 P R  H  X S+     0   0  131  170   63  R   RR  RRR RRRRR RRRRR RR RRR R  R RR                                
   457   92 P K  H  X S+     0   0  112  170   59  K   KK  KKK KKKKR KKKKK KK KKK K  K RK                                
   458   93 P Y  H  X S+     0   0    7  170    5  Y   YY  YYY YYYYY YYYYY YY YYY Y  Y YY                                
   459   94 P R  H  X S+     0   0   31  170   31  R   RR  RRR RRRRR RRRRR RR RRR R  R RR                                
   460   95 P R  H  X S+     0   0  130  170   43  R   RR  RRR RRRRR RRRRR RR RRR R  R KK                                
   461   96 P Q  H  X S+     0   0   96  170   30  Q   QQ  QQQ QQQQQ QQQQQ QQ QQQ Q  Q QQ                                
   462   97 P C  H  X S+     0   0   22  170   72  C   CC  CCC CCCCC CCCCC CC CCC C  C CC                                
   463   98 P M  H  X S+     0   0   33  170   11  M   MM  MMM MMMMM MMMMM MM MMM M  M MM                                
   464   99 P Q  H  X S+     0   0  115  170   54  Q   QQ  QQQ QQQQQ QQQQQ QQ QQQ Q  Q QQ                                
   465  100 P D  H  X S+     0   0   46  170   21  D   DD  DDD DDDDD DDDDD DD DDD D  D DD                                
   466  101 P M  H  X S+     0   0   23  170    2  M   MM  MMM MMMMM MMMMM MM MMM M  M MM                                
   467  102 P H  H  X S+     0   0   64  170   74  H   HH  HHH HHHHH HHHHH HH HHH H  H HH                                
   468  103 P Q  H  < S+     0   0  143  170   59  Q   QQ  QQQ QQQQQ QQQQQ QQ QQQ Q  Q QQ                                
   469  104 P K  H  < S+     0   0  140  170   55  K   KK  KKK KKKKK KKKKK KK KKK K  K KK                                
   470  105 P L  H  < S+     0   0   35  170   43  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   471  106 P S     <  -     0   0   75  170   79  S   SS  SSS SSSSS SSSSS SS SSS S  S SS                                
   472  107 P F        -     0   0   71  168   99  F   FF  FFF FFFFF FFFFF FF FFF F  F FF                                
   473  108 P G        -     0   0   36  168   51  G   GG  GGG GGGGG GGGGG GG GGG G  G GG                                
   474  109 P P        +     0   0   92  160   41  P   PP  PPP PPPPP PPPPP PP PPP P  P PP                                
   475  110 P R        +     0   0  177  165   61  R   RR  RRR RRRRR RRRRR RR RRR R  R RR                                
   476  111 P Y        +     0   0   51  166    5  Y   YY  YYY YYYYY YYYYY YY YYY Y  Y YY                                
   477  112 P G        +     0   0   12  170   61  G   GG  GGG GGGGG GGGGG GG GGG G  G GG                                
   478  113 P F  S    S-     0   0  151  170  103  F   FF  FFF FFFFF FFFFF FF FFF F  F FF                                
   479  114 P V  E     -v  532   0H  28  170   13  V   VV  VVV VVVVV VVVVV VV VVV V  V VV                                
   480  115 P Y  E     -v  533   0H  71  165   68  Y   YY  YYY YYYYY YYYYY YY YYY Y  Y RI                                
   481  116 P E  E     -v  534   0H 108  170   41  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   482  117 P L        -     0   0   12  170   32  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   483  118 P E        +     0   0  134  170   74  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   484  119 P S  S >> S-     0   0   57  170   53  T   TT  TTT TTTTT TTTTT TT TTT T  T NS                                
   485  120 P G  H 3> S+     0   0   15  169   40  G   GG  GGG GGGGG GGGGG GG GGG G  G GG                                
   486  121 P E  H 3> S+     0   0  127  170   23  E   EE  EEE EEEEE EEEEE EE EKE K  E EE                                
   487  122 P Q  H <> S+     0   0   72  170   61  Q   QQ  QQQ QQQQQ QQQQQ QQ QQQ Q  Q QQ                                
   488  123 P F  H  X S+     0   0   26  170    1  F   FF  FFF FFFFF FFFFF FF FFF F  F FF                                
   489  124 P L  H  X S+     0   0   90  170    6  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   490  125 P E  H  X S+     0   0  103  170   41  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   491  126 P T  H  < S+     0   0   10  170   76  T   TT  TTT TTTTT TTTTT TT TTT T  T AA                                
   492  127 P I  H  < S+     0   0   17  170   12  I   II  III IIIII IIIII II III I  I II                                
   493  128 P E  H  < S+     0   0  139  170   20  E   EE  GEE EEEEE EEEEE EE EEE E  E EE                                
   494  129 P K  S  < S+     0   0  172  170   35  K   KK  KKK KKKKK KKKKK KK KKK K  K KK                                
   495  130 P E  S    S-     0   0   38  166    5  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   496  131 P Q    >   -     0   0  116  170   66  Q   QQ  QQQ QQKLQ LLQLQ QQ KLQ L  Q QQ                                
   497  132 P K  T 3  S+     0   0  156  170   34  K   KK  KKK KKKKK KKKKK KK KKK K  K KK                                
   498  133 P I  T 3  S+     0   0   68  170   87  I   II  III IIIII IIIII II IIV I  V II                                
   499  134 P T    <   -     0   0   10  170   35  T   TT  TTT TTTTT TTTTT TT TTT T  T TT                                
   500  135 P T  E     -W  558   0H   7  169   62  T   TT  TTT TTTTT TTTTT TT TTT T  T TT                                
   501  136 P I  E     -Wx 557 531H   3  170   15  I   II  III IIIII IIIII II III I  I IV                                
   502  137 P V  E     -Wx 556 532H   0  170   35  V   VV  VVV VVVVV VVVVV VV VVV V  V II                                
   503  138 P V  E     -Wx 555 533H   0  170   12  V   VV  VVV VVVVV VVVVV VV VVV V  V VV                                
   504  139 P H  E     -Wx 554 534H   0  170    6  H   HH  HHH HHHHH HHHHH HH HHN H  N HH                                
   505  140 P I  E     +Wx 553 535H   2  170    1  I   II  III IIIII IIIII II III I  I II                                
   506  141 P Y  E     - x   0 536H   4  170    2  Y   YY  YYY YYYYY YYYYY YY YYY Y  Y YY                                
   507  142 P E    >   -     0   0   45  170   26  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   508  143 P D  T 3  S+     0   0   95  170   51  D   DD  DDD DDEDD DDDDD DD EDD D  D DD                                
   509  144 P G  T 3  S+     0   0   66  170   48  G   GG  GGG GGGGG GGGGG GG GGG G  G GD                                
   510  145 P I  S X> S-     0   0   36  170   33  I   II  IVI IIIII IIIII II IIV I  V II                                
   511  146 P K  T 34 S+     0   0  191  170   71  K   KK  KKK KKKKK KKKKK KK KKR K  R KK                                
   512  147 P G  T 3> S+     0   0   13  170   22  G   GG  GGG GGGGG GGGGG GG GGG G  G GG                                
   513  148 P C  H <> S+     0   0    0  170   35  C   CC  CCC CCCCC CCCCC CC CCC C  C CC                                
   514  149 P D  H  X S+     0   0   78  170   47  D   DD  DDD DDDDD DDDDD DD DDD D  D EE                                
   515  150 P A  H  > S+     0   0   44  170   50  A   AA  AAA AAAAA AAAAA AT AAA A  A AA                                
   516  151 P L  H  X S+     0   0    0  170   11  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   517  152 P N  H  X S+     0   0   19  170   16  N   NN  NNN NNNNN NNNNN NN NNN N  N NN                                
   518  153 P S  H  X S+     0   0   78  170   56  S   SS  SSS SDSSS SSSSN SS SSS S  S NN                                
   519  154 P S  H  X S+     0   0    6  170   35  S   SS  SSS SSSSS SSSSS SS SSS S  S SS                                
   520  155 P L  H  X S+     0   0    1  170   10  F   FL  FFF LLLLL LLLLF LL LLL L  L LL                                
   521  156 P I  H  X S+     0   0  105  170   85  T   TT  TTT TTTTT TTTTT TT TTA T  E NN                                
   522  157 P C  H  X S+     0   0   63  170   38  C   CC  CCC CCCCC CCCCY CC CCC C  C CC                                
   523  158 P L  H  X S+     0   0    0  170    4  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   524  159 P A  H  < S+     0   0    1  170    9  A   AA  AAA AAAAA AAAAA AA AAA A  A AA                                
   525  160 P A  H  < S+     0   0   61  170   67  A   AI  AAV AAAAA AAAAA AA AAV A  A AV                                
   526  161 P E  H  < S+     0   0   72  170   23  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   527  162 P Y    ><  +     0   0    5  170    2  Y   YY  YYY YYYYY YYYYY YY YYY Y  Y YY                                
   528  163 P P  T 3  S+     0   0   28  170   29  P   PP  PPP PPPPP PPPPP PP PPP P  P SS                                
   529  164 P M  T 3  S+     0   0   26  170   86  M   MM  MMM IIMIM IIIIM MM MIM I  M MM                                
   530  165 P V  S <  S-     0   0    1  170    8  V   VV  VVV VVVVV VVVVV VV VVV V  V VV                                
   531  166 P K  E     - x   0 501H  37  170    2  K   KK  KKK KKKKK KKKKK KK KKK K  K KK                                
   532  167 P F  E     +vx 479 502H   0  170    1  F   FF  FFF FFFFF FFFFF FF FFF F  F FF                                
   533  168 P C  E     -vx 480 503H   0  170   18  C   CC  CCC CCCCC CCCCC CC CCC C  C CC                                
   534  169 P K  E     +vx 481 504H  51  170   37  K   KK  KKK KKKKK KKKKK KK KKK K  K KK                                
   535  170 P I  E     - x   0 505H   1  170   21  I   II  III IIIII IIIII II III I  I II                                
   536  171 P K  E >>  - x   0 506H  52  170   72  K   KK  KKK KKKKK KKKKK KK KKK K  R KK                                
   537  172 P A  H >> S+     0   0   13  170   46  A   AA  AAA AAAAA AAAAA AA AAA A  A AA                                
   538  173 P S  H 34 S+     0   0   88  170   30  S   SS  SSS SSSSS SSSSS SS SSS S  S SS                                
   539  174 P N  H <4 S+     0   0   67  170   86  N   NN  NNN NNNNN NNNNN KN HNN N  N NN                                
   540  175 P T  H << S-     0   0   25  170   73  T   TT  TTT TTTTT TTTTT TT TTT T  T TT                                
   541  176 P G     <  +     0   0   66  169   22  G   GG  GGG GGGGG GGGGG GG GGG G  G GG                                
   542  177 P A    >   -     0   0   39  170   55  A   AA  AAA AAAAA AAAAA AA AAA A  A AA                                
   543  178 P G  T 3  S-     0   0   70  169   43  G   GG  GGR GGEGG GGGGR GG EGG G  G GG                                
   544  179 P D  T 3  S+     0   0  151  169   78  D   DD  DDD DDDDD DDDDD DD DDD D  D ED                                
   545  180 P R  S <  S+     0   0  167  169   58  R   RR  RRR RRRRR RRRRR RR RRR R  R RR                                
   546  181 P F  S    S+     0   0   35  169    0  F   FF  FFF FFFFF FFFFF FF FFF F  F FF                                
   547  182 P S    >>  -     0   0   34  169   70  S   SS  SSS SSSSS SSSSS SS SSS S  S SS                                
   548  183 P S  T 34 S+     0   0   86  169   84  S   ST  SSS LLSLS LLLLS SL SLT L  S SS                                
   549  184 P D  T 34 S+     0   0  126  169   66  D   DD  EDD DDDDD DDDDE EK DDD D  D DD                                
   550  185 P V  T <4 S+     0   0   20  169   65  V   VV  VVV VVVVV VVVVV VV VVV V  V VV                                
   551  186 P L     <  +     0   0    8  170   13  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   552  187 P P  S    S+     0   0    1  170    0  P   PP  PPP PPPPP PPPPP PP PPP P  P PP                                
   553  188 P T  E     -W  505   0H   1  170   42  T   TT  TTT TTTTT TTTTT TT TTT T  T TT                                
   554  189 P L  E     -WY 504 566H   0  170    2  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   555  190 P L  E     -WY 503 565H   4  170    9  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   556  191 P V  E     +WY 502 564H   0  170   19  V   VV  VIV IVVIV IIIIV VV VIV I  V VV                                
   557  192 P Y  E     +WY 501 562H  31  170    0  Y   YY  YYY YYYYY YYYYY YY YYY Y  Y YY                                
   558  193 P K  E >  S-WY 500 561H  25  170   12  K   KK  KKK KKKKK KKKKK KK KKK K  K KK                                
   559  194 P G  T 3  S-     0   0   25  170   41  G   GG  GGG GGGGG GGGGG GG GGG G  G GG                                
   560  195 P G  T 3  S+     0   0   48  170   21  G   GG  GGG GGGGG GGGGG GG GGG G  G GG                                
   561  196 P E  E <   -Y  558   0H  38  170   36  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   562  197 P L  E     +Y  557   0H  34  170   12  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   563  198 P L  E     -     0   0H   2  170   20  I   II  III IIIII IIIII II III I  I II                                
   564  199 P S  E     -Y  556   0H   4  170   30  S   SS  SSS SSSSS SSSSS SS SSS S  S SS                                
   565  200 P N  E     -Y  555   0H  41  170    0  N   NN  NNN NNNNN NNNNN NN NNN N  N NN                                
   566  201 P F  E >   -Y  554   0H   3  170    1  F   FF  FFF FFFFF FFFFF FF FFF F  F FF                                
   567  202 P I  T 3  S-     0   0   87  168   25  I   II  III IIIII IIIII II III I  I II                                
   568  203 P S  T >  S-     0   0   11  168   71  S   SS  SSS SSSSS SSSSS NS SSS S  S SS                                
   569  204 P V  G X  S+     0   0    0  168   35  V   VV  VVV VVVVV VVVVI VV VVV V  V VV                                
   570  205 P T  G >  S+     0   0   17  168   36  T   TA  TTS AAAAA AAAAA AT AAA A  A ST                                
   571  206 P E  G <  S+     0   0  156  168   35  E   EE  EEE DEEEE EEDEE QE EEE E  E EE                                
   572  207 P Q  G <  S+     0   0   84  168   43  Q   QQ  QQQ QQQQQ QQQQQ QQ QQQ Q  Q QQ                                
   573  208 P L  S <  S-     0   0   31  168   11  F   FF  FFF FFFFF FFFFF FF FFF F  F FF                                
   574  209 P A    >   -     0   0   49  168   51  T   TA  AAA AAAAA AAAAA TA AAA A  A AA                                
   575  210 P E  T 3  S+     0   0  201  168   27  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   576  211 P E  T 3  S+     0   0  166  168   21  E   EE  EEE EEEEE EEEEE EE EEE E  D DD                                
   577  212 P F    <   -     0   0   17  168    0  F   FF  FFF FFFFF FFFFF FF FFF F  F FF                                
   578  213 P F    >>  -     0   0  146  168   24  F   FF  FFF FFFFF FFFFF FF FFF F  F FF                                
   579  214 P T  H 3> S+     0   0   24  167   24  A   AA  SAA AAAAA AAAAA AA AAA A  A AA                                
   580  215 P G  H 3> S+     0   0   32  167   71  G   GG  GGG GGGGG GGGGG GG GGV G  A VV                                
   581  216 P D  H <> S+     0   0   57  167    4  D   DD  DDD DDDDD DDDDD DD DDD D  D DD                                
   582  217 P V  H  X S+     0   0    0  167   23  V   VV  VVV VVVVV VVVVV VV VVV V  V VI                                
   583  218 P E  H  X S+     0   0   32  167    8  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   584  219 P S  H  X S+     0   0   58  167   52  S   SS  SSS SSSSS SSSSS SS SSS S  S SC                                
   585  220 P F  H  < S+     0   0    2  168    2  F   FF  FFF FFFFF FFFFF FF FFF F  F FF                                
   586  221 P L  H ><>S+     0   0    0  168    0  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   587  222 P N  H ><5S+     0   0   61  168   82  N   NN  NNN NNNNN NNNNN NN NNN N  N NN                                
   588  223 P E  T 3<5S+     0   0   70  168   18  Q   QE  EEE EEEEE EEEEE EE EEE E  E EE                                
   589  224 P Y  T < 5S-     0   0   20  165   47  Y   YY  YYY YYYYY YYYYY YY YYY Y  Y YY                                
   590  225 P G  T < 5S+     0   0    6  165    6  G   GG  GGG GGGGG GGGGG GG GGG G  G GG                                
   591  226 P L      < +     0   0    2  165   18  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   592  227 P L  S    S-     0   0   10  161    8  L   LL  LLL LLLLL LLLLL LL LLL L  L LL                                
   593  228 P P        -     0   0   40  161   31  P   PP  PPP PPPPP PPPPP PP PPP P  P PP                                
   594  229 P E              0   0   94  159   17  E   EE  EEE EEEEE EEEEE EE EEE E  E EE                                
   595  230 P K              0   0  161  158   24  R   RR  RRR RRRRR RRRRR RR RRR R  R RR                                
## ALIGNMENTS  281 -  350
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....9....:....0....:....1....:....2....:....3....:....4....:....5
     1    2 B S              0   0  117  267   60   GGGG   G   EEG D     A  NAAAA   A    A AA  AEAAAAA AAAAA     AA     A
     2    3 B E     >  -     0   0  107  283   60   EEEE   E   KKEKE     K  EKKKK   K    K KK  KKKKKKK KKKKK     KKK    K
     3    4 B L  H  > S+     0   0   52  299   33   MMMM   M   IIMIY     I MLIIIII IIII  I IIIIIIIIIIIIIIIII  I IIII  I I
     4    5 B D  H  > S+     0   0  104  300   57   EEEE   E   AAEAN     T ADTTTTA ATAA  T TTAATATTTTTQTTTTT  T ATTQ  A T
     5    6 B Q  H  > S+     0   0  131  301   62   QQQQ   E   AAQAQ     A ASAAAAA AAAA  A AAAAAAAAAAAISSASS  A AAAI  A A
     6    7 B L  H  X S+     0   0   27  302   65   LLLL   L   AALAL     A ALAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
     7    8 B R  H  X S+     0   0  110  311   10   RRRR   RRRRRRRRKRRRRRR RRRRRRR RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
     8    9 B Q  H  X S+     0   0  117  312   60   KKKK   KRRRRRQHARRRRRR RQRRRRR RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
     9   10 B E  H  X S+     0   0   78  313   13   EEEE   EEEEEEELTEEEEEE EEEEEEE EEEE  E EEEEEEEEEEEDEEEEE  E EEED  E E
    10   11 B A  H  X S+     0   0    1  313   25   AAAA   AAAAAAASAAAAAAA AAAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
    11   12 B E  H  X S+     0   0  121  315   21   EDDE   DEEEEEEEEDDDEDE EEEEEEE DEEE  E EEEEEEEEEEEEEEEEE  E EEEE  E E
    12   13 B Q  H  X S+     0   0  111  323   73   SSSK   NSSSTTQGEGGGSGG QSGGGGG GGVV  G AGSSGSGGGGGAGGGGG  G SGGA  T G
    13   14 B L  H  X S+     0   0   14  348    5   LLLL   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
    14   15 B K  H  X S+     0   0   99  348   37   KKKK   KKRKKKKKKKKKKKK KKKKKKK KKKK  K KKKKKKKKKKKKKKKKK  K KKKK  K K
    15   16 B N  H  X S+     0   0   33  348   56   DDDD   EEEEEEKDAEEEEED ENDDDDA EDEE  D DDEEDEDDDDDDDDDDD  E EDDD  E D
    16   17 B Q  H  X S+     0   0   82  348   60   QQQD   QKKKKKQKKKKKKKK KAKRRKK KRKK  K RRKKKKKKRRKRRRRRR  K KKKR  K K
    17   18 B I  H  X S+     0   0    7  348   18   IIII   IIIIIIIIIIIIIII IIIIIII IIII  I IIIIIIIIIIIIIIIII  I IIII  I I
    18   19 B R  H  X S+     0   0  135  348   59   TTTT   TRRRRRARKRRRRRK RRKKKKK RKRR  K KKRRRRRKKKKKKKKKK  K RKKK  R K
    19   20 B D  H  X S+     0   0   85  349   72   AAAA   vAAAAADAaAAAAAR ADRRRRI ARAA  R RRAARARRRRRRRRRRR  R ARRR  L R
    20   21 B A  H  X S+     0   0   36  249   44   AAAA   a.....A.s...... .A..... ..SS  . .................  . ....  . .
    21   22 B R  H >X S+     0   0   22  349   28   RRRR   RKRKKKRKKKKKKKR RRRRRRK KRRR  R KRKKRKRRRRRKRRRRR  K KRRK  K R
    22   23 B K  H 3< S+     0   0  136  350   43   KKKK   KKRKRRKKKKKKKKK RKKKKKK KKEE  K KKKKKRKKKKKKKKKKK  K RKKK  K K
    23   24 B A  H 3< S+     0   0   79  350   64   GAAT   AeeeddAeDdddedd dAdddde ddAA  d ddeeeeddddddddddd  d eddd  e d
    24   25 B C  H << S+     0   0   19  306   94   VVVV   VsssllCt.mmmsml aAlllll mlSS  l llsslslllllllllll  l tlll  t l
    25   26 B A     <  +     0   0   46  309   60   QQQQ   QAAAAAAA.AAAAAA ACAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  G A
    26   27 B D        +     0   0   88  312    3   DDDD   DDDDDDDD.DDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
    27   28 B A        -     0   0   17  315   51   TTTL   TTTTTTVSTTTTTTT TTTTTTA TTTT  T TTTTTTTTTTTTTTTTT  A TTTT  T T
    28   29 B T    >>  -     0   0   59  315   41   TTTT   TSSSTTTTTSSSSST SSTSSTD STSS  T STSSTSTTTSTTSSTSS  D SSST  S T
    29   30 B L  H 3> S+     0   0    0  317    9   LLLL   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
    30   31 B S  H 34 S+     0   0   38  323   90   QQQQ   QRRRRRARLRRRRRR RLQRRRR RRRR  R RRRRRRRQRRRRRRRRR  R RRRR  R R
    31   32 B Q  H X4 S+     0   0  119  330   65   EEED   EAAAAAEAEAAAAAQ AQQQQQQ AQAA  Q QQAAQADQQQQDEEQEE  Q AEEE  A Q
    32   33 B I  H 3< S+     0   0   28  332   58   AAAH   AMMMMMLMAMMMMMV MAVVVVV MVMM  V VVMMVMVVVVVVVVVVV  L MVVV  M V
    33   34 B T  T >< S+     0   0    0  343   62   AAAV   AAAAAAVAAAAAAAA TAAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
    34   35 B N  T <  S+     0   0  129  351   77   AGAA   AAAAAASASNNNANQ EAMQQQK NQAA  Q LQAAQAQMQQQRQQQQQ  K AQQR  S Q
    35   36 B N  T 3  S+     0   0  111  351   67   GGGG   GEEEEEGDDDDDEDn DSnnnne DnEE  n qnEEsEnnnnnqnnnnn  e Ennq  D n
    36   37 B I  S <  S-     0   0   21  338   72   IIIT   LVVVIILIVIIIVIt LLttttl ItVV  t ttVVtVttttttttttt  v Vttt  V t
    37   38 B D        -     0   0  138  345   57   TSTA   ADADDDEEAEEEDEE EEDDDDE EDDD  E EDDDDADDDDDEDDDDD  E DDDE  E D
    38   39 B P        -     0   0   89  348   62   VVVV   VAAAPPVPEPPPAPT SPPPPAP PPTT  T PPPPPAAPTPTQPPPPP  A SAAA  P A
    39   40 B V        -     0   0   23  350   41   VVVV   VLLLLLVLLLLLLLL LILLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
    40   41 B G        -     0   0   54  353   52   GGGG   GPPPPPGPPPPPPPP PGPPPPP PPPP  P PPPPPPPPPPPPPPPPP  P PPPP  P P
    41   42 B R        -     0   0  115  354   44   RRRR   RRRRRRRRRRRRRRR RRRRRRR RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
    42   43 B I        +     0   0    8  354   63   IVVV   IIIIIIVVLIIIIII VIIIIIT IIII  I IIIIIIIIIIILIIIII  T IIIL  V I
    43   44 B Q        -     0   0   54  340   61   QQQQ   QVVVPPQVSVVVVVG VQGGGGQ VGVV  G GGVVMVGGGGGAGGGGG  L VGGA  S G
    44   45 B M        -     0   0   11  345   12   MMML   MMMMIIMMMMMMMMM MMMMMMM MMMM  M MMMMMMMMMMMMMMMMM  M MMMM  M M
    45   46 B R        -     0   0   49  346   51   KKKK   KRRRKKRKRKKKRKK RRRRRKK KRRR  K KRRRKRKRKRKKRRRKR  K RKKR  R K
    46   47 B T  E     +A  338   0A  12  350   67   TTTT   TPPPPPTPVPPPPPP PTPPPPV PPPP  P PPPPPPPPPPPTPPPPP  N PPPT  Q P
    47   48 B R  E     +     0   0A  56  355   56   RRRR   RRRRRRRRRRRRRRR RRRRRRR RRRR  R RRRRRRRRRRRKRRRRR  R RRRK  R R
    48   49 B R  E     -A  337   0A  60  355   15   KKKK   KRRRRRRRRRRRRRR RRRRRRK RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
    49   50 B T  E     -A  336   0A  30  355   27   TTTT   TAAATTTTSTTTATT TTTNNTT TNAA  T NNAATATTTNTTNNNNN  T ATTT  S T
    50   51 B L  E     -A  335   0A   0  355    2   LLLL   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
    51   52 B R        +     0   0  159  355   41   RRRR   RRRRKKRKRKKKRKK KRKKKKK KKKK  K KKRRKRKKKKKKKKKKK  K RKKK  K K
    52   53 B G        +     0   0   20  355    0   GGGG   GGGGGGGGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
    53   54 B H        -     0   0    4  355    0   HHHH   HHHHHHHHHHHHHHH HHHHHHH HHHH  H HHHHHHHHHHHHHHHHH  H HHHH  H H
    54   55 B L  S    S+     0   0  116  355   50   LLLL   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
    55   56 B A  S    S-     0   0    0  355   30   AAAA   AAAAAAAAAAAAAAA AAAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
    56   57 B K        -     0   0   15  355    0   KKKK   KKKKKKKKKKKKKKK KKKKKKK KKKK  K KKKKKKKKKKKKKKKKK  K KKKK  K K
    57   58 B I  E     -D   73   0B   0  355    9   IIII   IIIIIIIIIIIIIII IIIIIII IIII  I IIIIIIIIIIIIIIIII  I IIII  I I
    58   59 B Y  E     -     0   0B   6  355   20   YYYY   YYYYYYYYYYYYYYY YYYYYYY YYYY  Y YYYYYYYYYYYYYYYYY  Y YYYY  Y Y
    59   60 B A  E     -D   72   0B  13  355   32   AAAA   AAAAAAAAAAAAAAA AAAAAAA AAAA  A AAAAAAAAAAAAAAAAA  S AAAA  A A
    60   61 B M  E     -D   71   0B  15  355   10   MMMM   MMMMMMMMMMMMMMM MMMMMMM MMMM  M MMMMMMMMMMMMMMMMM  M MMMM  M M
    61   62 B H  E     -D   70   0B  44  355   33   HHHH   HHHHHHHHHHHHHHH HHHHHHH HHHH  H HHHHHHHHHHHHHHHHH  H HHHH  H H
    62   63 B W  E     -D   69   0B  11  355    0   WWWW   WWWWWWWWWWWWWWW WWWWWWW WWWW  W WWWWWWWWWWWWWWWWW  W WWWW  W W
    63   64 B G    >   -     0   0    3  355   54   SSSG   GAAAAAASSAAAAAS AGSSSSS ASAA  S SSAASASSSSSSSSSSS  S ASSS  A S
    64   65 B T  T 3  S+     0   0   75  355   66   TTTT   AATAQQTATSNNAST ANTTTTT NTAA  T TTAATTTTTTTTTTTTT  T TTTT  Q T
    65   66 B D  T 3  S-     0   0   80  355   12   DDDD   DDDDDDDDDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
    66   67 B S  S <  S+     0   0    3  355   57   SASS   SRRRQQSKNKKKRKR KSRRRRR KRRR  R RRRRRRRRRRRRRRRRR  R RRRR  K R
    67   68 B R  S    S+     0   0   94  355   47   RKKK   KRRRRRKRRRRRRRR RRRRRRR RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
    68   69 B L  E     + E   0  82B  31  355   87   LLLL   LHHHHHLHHHHHHHH HNHHHHH HHHH  H HHHHHHHHHHHHHHHHH  H HHHH  H H
    69   70 B L  E     -DE  62  81B   0  355   23   CCCC   CLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
    70   71 B L  E     -DE  61  80B   0  355    7   VVVV   VVVVVVVVVVVVVVV VVVVVVV VVVV  V VVVVVVVVVVVVVVVVV  V VVVV  V V
    71   72 B S  E     -DE  60  79B   0  354    2   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
    72   73 B A  E     -DE  59  78B   0  354    5   AAAA   AAAAAAAAAAAAAAA AAAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
    73   74 B S  E >>  -DE  57  77B   0  354    2   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
    74   75 B Q  T 34 S+     0   0    1  355    1   QQQQ   QQQQQQQQQQQQQQQ QQQQQQQ QQQQ  Q QQQQQQQQQQQQQQQQQ  Q QQQQ  Q Q
    75   76 B D  T 34 S-     0   0    9  355    0   DDDD   DDDDDDDDDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
    76   77 B G  T <4 S+     0   0    7  355    1   GGGG   GGGGGGGGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
    77   78 B K  E  <  -EF  73  93B  52  355   34   KKKK   KKKKKKKKKKKKKKK KKKKKKK KKKK  K KKKKKKKKKKKKKKKKK  K KKKK  K K
    78   79 B L  E     -EF  72  92B   0  355    4   LLLL   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
    79   80 B I  E     -EF  71  91B   0  355    7   IIII   IIIIIIIILIIIIII IIIIIII IIII  I IIIIIIIIIIIIIIIII  I IIII  I I
    80   81 B I  E     -EF  70  90B   0  355   18   VVVV   VVVVVVVIVVVVVVI VVIIIII VIVV  I IIVVIVIIIIIIIIIII  I VIII  V I
    81   82 B W  E     -EF  69  88B   0  355    0   WWWW   WWWWWWWWWWWWWWW WWWWWWW WWWW  W WWWWWWWWWWWWWWWWW  W WWWW  W W
    82   83 B D  E >>> -EF  68  87B  21  355   18   DDDD   DDDDDDDDDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
    83   84 B S  T 345S+     0   0    0  355   52   STTS   SAAAAASAAAAAAAA ASAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
    84   85 B Y  T 345S+     0   0   57  354   48   VIIY   IYYYYYYYYYYYYYY YHYYYYY YYYY  Y YYYYYYYYYYYYYYYYY  Y YYYY  Y Y
    85   86 B T  T <45S-     0   0   56  354    8   TTTT   TTTTTTTTTTTTTTT TTTTTTT TTTT  T TTTTTTTTTTTTTTTTT  T TTTT  T T
    86   87 B T  T  <5 +     0   0   43  354   36   TTTT   TTTTTTTTTTTTTTT TTTTTTT TTTT  T TTTTTTTTTTTTTTTTT  T TTTT  T T
    87   88 B N  E   < -F   82   0B  99  354   38   NNNN   NNNNNNNNNNNNNNN NNNNNNN NNNN  N NNNNNNNNNNNNNNNNN  N NNNN  N N
    88   89 B K  E     +F   81   0B  95  354    0   KKKK   KKKKKKKKKKKKKKK KKKKKKK KKKK  K KKKKKKKKKKKKKKKKK  K KKKK  K K
    89   90 B V  E    S+     0   0B  66  353   49   VVVV   VVVVVVVVIVVVVVV VVVVVVV VVVV  V VVVVVVVVVVVVVVVVV  V VVVV  V V
    90   91 B H  E     -F   80   0B  57  353   18   NNNH   NHHHHHHHHHHHHHH HHHHHHH HHHH  H HHHHHHHHHHHHHHHHH  H HHHH  H H
    91   92 B A  E     -F   79   0B  43  353    8   AAAA   AAAAAAAAAAAAAAA AAAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
    92   93 B I  E     -F   78   0B   0  353    3   IIII   IIIIIIIIIIIIIII IIIIIII IIII  I IIIIIIIIIIIIIIIII  I IIII  I I
    93   94 B P  E     -F   77   0B  80  353   37   PPPP   PPPPPPPPPPPPPPP PPPPPPP PPPP  P PPPPPPPPPPPPPPPPP  P PPPP  P P
    94   95 B L        -     0   0   26  354    2   LLLL   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
    95   96 B R  S    S+     0   0  190  354   40   KKKK   KRRRRRRRRRRRRRR RRRRRRR RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
    96   97 B S        -     0   0   17  354   24   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
    97   98 B S  S    S+     0   0    6  354   36   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
    98   99 B W        +     0   0    2  354    3   WWWW   WWWWWWWWWWWWWWW WWWWWWW WWWW  W WWWWWWWWWWWWWWWWW  W WWWW  W W
    99  100 B V  E     -G  115   0C   4  354    1   VVVV   VVVVVVVVVVVVVVV VVVVVVV VVVV  V VVVVVVVVVVVVVVVVV  V VVVV  V V
   100  101 B M  E     +     0   0C   5  353    4   MMMM   MMMMMMMMMMMMMMM MMMMMMM MMMM  M MMMMMMMMMMMMMMMMM  M MMMM  M M
   101  102 B T  E     -G  114   0C   8  353   13   TTTT   TTTTTTTTTTTTTTT TTTTTTT TTTT  T TTTTTTTTTTTTTTTTT  T TTTT  T T
   102  103 B C  E     -G  113   0C   0  353    9   CCCC   CCCCCCCCCCCCCCC CCCCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   103  104 B A  E     -G  112   0C   0  353    8   AAAS   AAAAAAAAAAAAAAA AAAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
   104  105 B Y  E     -G  111   0C   9  353   10   YYYY   YYYYYYYYYYYYYYY YYYYYYY YYYY  Y YYYYYYYYYYYYYYYYY  Y YYYY  Y Y
   105  106 B A    >   -     0   0    0  353   33   AAAA   ASSSAAAAAAAASAA SAAAAAA AASS  A AASSAAAAAAASAAAAA  A SAAS  S A
   106  107 B P  T 3  S+     0   0   64  353    8   PPPP   PPPPPPPPPPPPAPP PPPPPPP PPPP  P PPPPPPPPPPPPPPPPP  P PPPP  P P
   107  108 B S  T 3  S-     0   0   47  353   31   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   108  109 B G  S <  S+     0   0    8  353   14   GGGG   GGGGGGGGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   109  110 B N  S    S+     0   0   50  353   43   NNNN   NNNNNNNNNNNNNNN NSNNNNN NNNN  N NNNNNNNNNNNNNNNNN  N NNNN  N N
   110  111 B Y  E     - H   0 124C  50  353   55   LLLM   LFYFFFFLFSWWFSY FYYYYYY SYFF  Y YYYYYLYYYYYYYYYYY  Y FYYY  F Y
   111  112 B V  E     -GH 104 123C   0  353    5   VVVV   VVVVVVVVVVVVVVV VVVVVVV IVVV  V VVVVVVVVVVVVVVVVV  V VVVV  V V
   112  113 B A  E     +GH 103 122C   0  353    4   AAAA   AAAAAAAAAAAAAAA AAAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
   113  114 B C  E     +GH 102 121C   5  353   10   CCCC   CCCCCCCCCCCCCCC CCCCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   114  115 B G  E     +GH 101 120C   1  353    6   GGGG   GGGGGGGGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   115  116 B G  E >  S-G   99   0C   0  353    0   GGGG   GGGGGGGGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   116  117 B L  T 3  S+     0   0    1  353    1   LLLL   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
   117  118 B D  T 3  S-     0   0   50  353    3   DDDD   DDDDDDDDDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   118  119 B N  S <  S+     0   0   30  353   21   NNNN   NNNNNNNNNNNNNNN NNNNNNN NNNN  N NNNNNNNNNNNNNNNNN  N NNNN  N N
   119  120 B I  E     - I   0 139C  39  353   43   MMMM   MIIIIIMIIIIIIII IMIIIII IIII  I IIIIIIIIIIIIIIIII  I IIII  I I
   120  121 B C  E     -HI 114 138C   0  353    7   CCCC   CCCCCCCCCCCCCCC CCCCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   121  122 B S  E     -HI 113 137C   9  353   14   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   122  123 B I  E     -HI 112 136C   0  353    6   IIII   IIIIIIIIIIIIIII IIIIIIV IIII  I IIIIIIIIIIIIIIIII  V IIII  I I
   123  124 B Y  E     -H  111   0C   3  353    4   YYYY   YYYYYYYYYYYYYYY YYYYYYY YYYY  Y YYYYYYYYYYYYYYYYY  Y YYYY  Y Y
   124  125 B N  E     +H  110   0C  24  353   45   NNNN   NSNNNNNNNSSSNSN NNNNNNN SNNN  N NNSSNNNNNNNNNNNNN  N NNNN  N N
   125  126 B L        +     0   0   11  353   12   LLLL   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
   126  127 B K  S    S+     0   0  109  353   60   KKKK   KKHQRRKRKRRRNRS RKSSSSS RSNN  S SSNNSHSSSSSSSSSSS  S NSSS  R S
   127  128 B T  S    S-     0   0   64  353   71   GGGA   SQSNSSSGSGGGSGS NTASSSA GSSS  S TSNNSSSASSSASSSSS  A ASSA  Q S
   128  129 B R  S    S+     0   0  267  336   26   KKKK   KDKKKKRRRRRRKRR KRRRRRR RRKK  R RRKKRKRRRRRRRRRRR  R KRRR  R R
   129  130 B E  S    S-     0   0  173  340   28   DDDD   DGEEEEEDEDDDEDE EEEEEED DEEE  E EEDDEEEEEEEEEEEEE  D EEEE  P E
   130  131 B G        -     0   0   50  351   25   GGGG   GTGGGGGGGPPPGPG GGGGGGG PGAA  G GGGGGGGGGGGGGGGGG  G AGGG  D G
   131  132 B N        +     0   0   30  349   59   NNNN   NNnnSSNSVhnnthP gNPPPPP nPnn  P PPggPnPPPPPPPPPPP  P tPPP  t P
   132  133 B V  S    S+     0   0   58  329   58   VVVV   VAvvVVVVViiiliT nVTTTTT iTvv  T TTnnTvTTTTTTTTTTT  T nTTT  g T
   133  134 B R  S    S-     0   0  213  347   44   KKKK   KRKRRRKKRKKKRKR KRRRRRR KRKK  R RRAARKRRRRRRRRRRR  R KRRR  K R
   134  135 B V        -     0   0   29  352   27   VVVV   VGGGVVVVVVVVGVV SVVVVVV VVGG  V VVRRVGVVVVVVVVVVV  V GVVV  S V
   135  136 B S  S    S-     0   0   43  352   59   MMMM   MAAAAASSTGGGAGA ASAAAAA GAGG  A AAggAAAAAAAAAAAAA  A AAAA  n A
   136  137 B R  E     -I  122   0C 105  344   18   RRRR   RRRRRRRRRRRRRRR RRRRRRR RRRR  R RRrrRRRRRRRRRRRRR  R RRRR  k R
   137  138 B E  E     -I  121   0C  75  346   40   EEEE   EEEEEEEEEEEEEEE EEEEEEE EEEE  E EEEEEEEEEEEEEEEEE  E EEEE  E E
   138  139 B L  E     +I  120   0C   1  349    5   LLLL   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
   139  140 B A  E     +I  119   0C  61  351   61   AAAA   ASSSSSSQASSSSSS SPSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   140  141 B G        +     0   0   50  351   27   AAAA   AAAAAAAASAAAAAG AGGGGGG AGAA  G GGAAGAGGGGGGGGGGG  G AGGG  A G
   141  142 B H        -     0   0    9  352    8   HHHH   HHHHHHHHHHHHHHH HHHHHHH HHHH  H HHHHHHHHHHHHHHHHH  H HHHH  H H
   142  143 B T  S    S+     0   0   64  352   62   TTTT   TSSSTTTTTTTTSTS SGSTTSS TSSS  S SSSSSSSSSTSSTTSTT  S SSSS  T S
   143  144 B G  S    S-     0   0    0  352    8   GGGG   GGGGGGGGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   144  145 B Y        -     0   0    0  352    1   YYYY   YYYYYYYYYYYYYYY YYYYYYY YYYY  Y YYYYYYYYYYYYYYYYY  Y YYYY  Y Y
   145  146 B L  E     +J  160   0D   0  352   18   LLLL   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
   146  147 B S  E     -     0   0D   3  352    1   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   147  148 B C  E     -J  159   0D   9  353   29   CCCC   CCCCCCCCCCCCCCC CCCCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   148  149 B C  E     -J  158   0D   0  353    6   CCCC   CCCCCCCCCCCCCCC CCCCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   149  150 B R  E     -J  157   0D  53  353   33   RRRR   RRRRRRRRRRRRRRR RRRRRRR RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
   150  151 B F  E     -J  156   0D  10  353    2   FFFF   FFFFFFFFFFFFFFF FFFFFFF FFFF  F FFFFFFFFFFFFFFFFF  F FFFF  F F
   151  152 B L  S    S-     0   0   26  353   35   IILL   LILLLLLLLLLLLLI ILIVVII LIII  I VIIIILIIIVIIVVIIV  L IIII  I I
   152  153 B D  S    S-     0   0   60  353   56   SSSS   SNNNNNDNSNNNNNN NDNNNNN NNNN  N NNNNNSNNNNNNNNNNN  N NNNN  D N
   153  154 B D  S    S+     0   0   60  353   13   DDDD   DDDDDDDDDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   154  155 B N  S    S+     0   0   44  353   76   TSTS   SRRRRRNRRQQQRQR RNRRRRR QRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
   155  156 B Q  E     + K   0 169D  60  353   66   EEEE   EQQQQQNQEQQQQQR QQRRRRR QRQQ  R KRQQRQRRRRRRRRRRR  R QRRR  K R
   156  157 B I  E     -JK 150 168D   0  354   13   IIII   IIIIIIIIIIIIIII IIIIIIV IIII  I IIIIIIIIIIIIIIIII  I IIII  I I
   157  158 B V  E     -JK 149 167D   0  354   27   IIII   LVVVLLVLVLLLVLI VVIIIIL LIVV  I IIVVIVIIIIILIIIII  L VIIL  V I
   158  159 B T  E     -JK 148 166D   0  353    0   TTTT   TTTTTTTTTTTTTTT T.TTTTT TTTT  T TTTTTTTTTTTTTTTTT  T TTTT  T T
   159  160 B S  E     -JK 147 165D   0  352   19   SSSS   SSSSSSSSSSSSSSS S.SSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   160  161 B S  E >   -J  145   0D   0  352    0   SSSS   SSSSSSSSSSSSSSS S.SSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   161  162 B G  T 3  S+     0   0    0  352    0   GGGG   GGGGGGGGGGGGGGG G.GGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   162  163 B D  T 3  S-     0   0    5  352    0   DDDD   DDDDDDDDDDDDDDD D.DDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   163  164 B T  S <  S+     0   0    8  353   76   CCCC   CMMMMMTMMMMMMMM M.MMMMM MMMM  M MMMMMMMMMMMMMMMMM  M MMMM  M M
   164  165 B T        -     0   0    2  353   17   TTTT   TTTTSSTSTSSSTST T.TTTTT STTT  T TTTTTTTTTTTTTTTTT  T TTTT  T T
   165  166 B C  E     -KL 159 179D   0  352    1   CCCC   CCCCCCCCCCCCCCC C.CCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   166  167 B A  E     -KL 158 178D   0  353   70   IVVV   VMMMMMAMAIIIMIM M.MMMMM IMMM  M MMMMMMMMMMMVMMMMM  M MMMV  M M
   167  168 B L  E     -KL 157 177D   6  353   29   LLLL   LLLLLLLLLLLLLLL L.LLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
   168  169 B W  E     -KL 156 175D   2  353    0   WWWW   WWWWWWWWWWWWWWW W.WWWWW WWWW  W WWWWWWWWWWWWWWWWW  W WWWW  W W
   169  170 B D  E >>> -KL 155 174D  37  353    1   DDDD   DDDDDDDDDDDDDDD D.DDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   170  171 B I  T 345S+     0   0    7  353   13   IIII   IIIIIIIICIIIIII I.IIIII IIII  I IIIIIIIIIIIIIIIII  I IIII  I I
   171  172 B E  T 345S+     0   0  144  353   32   EEEE   EEEEEEEEEDGDEDE E.EEEED DEEE  E EEEEEEEEEEEEEEEEE  D EEEE  E E
   172  173 B T  T <45S-     0   0   78  353   40   TTTT   TAAAAATSTSSSASS A.SSSST SSAA  S TSAASASSSSSTSSSSS  T ASSS  A S
   173  174 B G  T  <5 +     0   0   16  353   12   GGGG   GGGGGGGGGGGGGGG G.GGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   174  175 B Q  E   < -L  169   0D 135  353   74   TTTS   TVVVVVQVQTTTVTS A.SSSSA TTVV  S STVVSVSSSSSQTTTST  A VTTQ  T S
   175  176 B Q  E     -L  168   0D  30  353   58   QQQQ   QRRRRRQRLRRRRRK R.KKKKK RKRR  K KKRRKRKKKKKKKKKKK  R RKKK  R K
   176  177 B T  E     +     0   0D  64  353   70   KKKK   KVVVVVKIRIIIVIV V.VVVVI IVVV  V VVVVVVVVVVVIVVVVV  I VVVI  I V
   177  178 B T  E     -L  167   0D  20  353   63   TTTT   TVVVVVTQTSTTVST M.TTTTT TTVV  T TTIITVTTTTTTTTTTT  T VTTT  Q T
   178  179 B T  E     -L  166   0D   5  354   78   VVVV   VEEEEEVESEEEEEE E.EEEEE EEEE  E EEEEEEEEEEEEEEEEE  D EEEE  E E
   179  180 B F  E     +L  165   0D   1  354    0   YFFF   FFFFFFFFFFFFFFF F.FFFFF FFFF  F FFFFFFFFFFFFFFFFF  F FFFF  F F
   180  181 B T        +     0   0   34  354   73   AAAA   ASSSNNVHQNNNSNA N.AAAAS NASS  A AASSASAAAAAAAAAAA  A SAAA  S A
   181  182 B G        +     0   0   37  354   33   GGGG   GDDDDDGDGDDDDDD D.DDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   182  183 B H        -     0   0    7  354    0   HHHH   HHHHHHHHHHHHHHH H.HHHHH HHHH  H HHHHHHHHHHHHHHHHH  H HHHH  H H
   183  184 B T  S    S+     0   0   99  354   69   QQQL   QTTTSSTTATTTTTL T.LLLLL TLTT  L LLTTLTFLLLLLLLLLL  L TLLL  T L
   184  185 B G  S    S-     0   0    0  354   17   GGGG   GGGGGGGGGGGGGGG G.GGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   185  186 B D        -     0   0    1  354    0   DDDD   DDDDDDDDDDDDDDD D.DDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   186  187 B V  E     -M  202   0E   0  354   18   CCCC   CVVVVVCVVVVVVVV V.VVVVV VVVV  V VVVVVVVVVVVVVVVVV  V VVVV  V V
   187  188 B M  E     +     0   0E   3  354   11   MMMM   MMMMMMMMMMMMMMM M.MMMMM MMMM  M MMMMMMMMMMMMMMMMM  M MMMM  M M
   188  189 B S  E     -M  201   0E  16  354   17   SSSS   SSSSSSSSSSSSSSS S.SSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   189  190 B L  E     -M  200   0E   3  354   28   LLLL   LLLLLLLILIIILII L.IIIIL IILL  I IILLILIIIIILIIIII  L LIIL  L I
   190  191 B S  E     -M  199   0E  21  354   23   AAGA   ASSSSSASSSSSSSS S.SSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   191  192 B L  E     -M  198   0E  29  354   32   VVVV   VLLLLLVLLLLLLLI L.IIIII LILL  I IILLILIIIIIIIIIII  V LIII  L I
   192  193 B A    >   -     0   0    4  354   63   ASSS   SAGGGGSGSSSSGSN G.NNNNN SNGG  N NNAANGNNNNNNNNNNN  N GNNN  G N
   193  194 B P  T 3  S+     0   0   85  354   30   PPPP   PPPPPPPPPSPPPSP P.PPPPP SPPP  P PPPPPPPPPPPPPPPPP  P PPPP  P P
   194  195 B D  T 3  S-     0   0   87  354   71   DDDD   DNSNNNDNDNNNNNT N.TTTTT NTNN  T TTSSTNTTTTTLTTTTT  T NTTL  H T
   195  196 B T  S <  S+     0   0   62  354   89   FFFF   FMQQLLFQAPPPQPN Q.NNNNN PNQQ  N NNNNNQNNNNNDNNNNN  N QNND  P N
   196  197 B R  S    S+     0   0  142  355   76   KKKN   KNNNNNNNnNNNNNq NTqnnqq NnNN  q annnqNqqqnqnnnnnn  s Nqqn  G q
   197  198 B L  E     - N   0 211E  37  351   70   FFFT   FTVITTLTtVVVVVv V.vvvii ViVV  v vivvvViviviqvvivv  i Viiq  I i
   198  199 B F  E     -MN 191 210E   0  351    0   FFFF   FFFFFFFFFFFFFFF F.FFFFF FFFF  F FFFFFFFFFFFFFFFFF  F FFFF  F F
   199  200 B V  E     -MN 190 209E   0  352   12   IIII   IVVVVVIVVVVVVVV V.VVVVV VVVV  V VVIIVVVVVVVVVVVVV  V VVVV  V V
   200  201 B S  E     -MN 189 208E   0  353    3   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   201  202 B G  E     +MN 188 207E   0  355    3   GGGG   GGGGGGGGGGGGGGG GSGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   202  203 B A  E >   -M  186   0E   0  354   31   AAAA   AAAAAAAAAAAAAAA A.AAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
   203  204 B C  T 3  S+     0   0    5  354    7   CCCC   CCCCCCCCCCCCCCC C.CCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   204  205 B D  T 3  S-     0   0   31  354    0   DDDD   DDDDDDDDDDDDDDD D.DDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   205  206 B A  S <  S+     0   0   20  354   39   FFFF   FAAAAAAAAAAAAAA A.AAAAA AAAA  A AAAATAAAAAAASSASS  A AAAA  A A
   206  207 B S  E     - O   0 222E   6  354   82   TTTT   TTSTTTSTQVMMTVF T.FFFFF VFTT  F FFTTFTFFFFFFFFFFF  F TFFF  S F
   207  208 B A  E     -NO 201 221E   0  354   28   AAAA   AAAAAAAAAAAAAAA A.AAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
   208  209 B K  E     -NO 200 220E  18  354   20   KKKK   KKKKKKKKKKKKKKK K.KKKKK KKKK  K KKKKKKKKKKKKKKKKK  K KKKK  K K
   209  210 B L  E     -NO 199 219E   2  354   11   LLLL   LLLIVVLIVVVVLVL L.LLLLL VLLL  L LLLLLLLLLLLLLLLLL  L LLLL  V L
   210  211 B W  E     -NO 198 217E   1  354    0   WWWW   WWWWWWWWWWWWWWW W.WWWWW WWWW  W WWWWWWWWWWWWWWWWW  W WWWW  W W
   211  212 B D  E >>> -NO 197 216E  11  354    0   DDDD   DDDDDDDDDDDDDDD D.DDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   212  213 B V  T 345S+     0   0   12  354   39   IIII   IIIIVVVMIIIIIII I.IIIII ITII  I VTIIIIIIIIIIIITII  I TIII  M I
   213  214 B R  T 345S+     0   0  194  354    0   RRRR   RRRRRRRRRRRRRRR R.RRRRR RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
   214  215 B E  T <45S-     0   0  111  353   69   EEEE   ETSSTTESESSSSST T.TAATT SVSS  T TVTTTSTTTATQAAVAA  T STTQ  T T
   215  216 B G  T  <5 +     0   0    8  354   39   GGGG   GGGGGGGGGGGGGGG G.GGGGG GDGG  G GDGGGGGGGGGQGGDGG  G GGGQ  G G
   216  217 B M  E      -     0   0    1  353    5   FFFF   FFFFFF.FFFFFFFF FFFFFFF FFFF  F FFFFFFFFFFFFFFFFF  F FFFF  F F
   235  236 B P  T 3  S+     0   0   45  353    4   PPPP   PPPPPP.PPPPPPPP PPPPPPP PPPP  P PPPPPPPPPPPPPPPPP  P PPPP  P P
   236  237 B N  T 3  S-     0   0   42  353   42   NNNN   NNNNNN.NSNNNNND NNDDDDD NDNN  D DDNNDNDDDDDNDDDDD  D NDDN  N D
   237  238 B G  S <  S+     0   0   12  353    5   GGGG   GGGGGG.GGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   238  239 B N  S    S+     0   0   56  353   67   NNNN   NDDDDD.DQDDDDDN DQNNNNN DNDD  N NNDDNDNNNNNHNNNNN  N ENNN  D N
   239  240 B A  E     - Q   0 253F   0  353   48   AAAA   AAAAAA.AAAAAAAA AAAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A SAAA  A A
   240  241 B F  E     -PQ 233 252F   0  353   14   VVVV   VFFFFF.FFFFFFFF FFFFFFF FFFF  F FFFFFFFFFFFFFFFFF  F FFFF  F F
   241  242 B A  E     -PQ 232 251F   0  353   59   ILII   IAAAAA.AGAAAAAG AAGGGGG AGAA  G GGAAGAGGGGGGGGGGG  G AGGG  A G
   242  243 B T  E     -PQ 231 250F   0  353    6   TTTT   TTTTTT.TTTTTTTT TTTTTTT TTTT  T TTTTTTTTTTTTTTTTT  T TTTT  T T
   243  244 B G  E     +PQ 230 249F   0  353    0   GGGG   GGGGGG.GGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   244  245 B S  E >   -P  228   0F   0  353    0   SSSS   SSSSSS.SSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   245  246 B D  T 3  S+     0   0   13  353    2   DDDD   DDDDDD.DDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   246  247 B D  T 3  S-     0   0   28  353    0   DDDD   DDDDDD.DDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   247  248 B A  S <  S+     0   0    6  353   38   AAAA   AAAAAA.AAAAAAAT AATTTTA ATAA  T ATAAAATTTTTATTTTT  A ATTA  A T
   248  249 B T        -     0   0   16  353   41   TTTS   TSSSSS.TTSSSSSS STSTTST SSSS  S SSSSTSTSSTSSTTSTT  T SSSS  S S
   249  250 B C  E     -QR 243 263F   0  353   12   CCCC   CCCCCC.CCCCCCCC CCCCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   250  251 B R  E     -QR 242 262F  23  353    7   KKKK   KRRRRR.RRRRRRRR RRRRRRR RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
   251  252 B L  E     -QR 241 261F   0  353    1   LLML   LLLLLL.LLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
   252  253 B F  E     -QR 240 259F   1  352    1   FYYY   YFFFFF.FFFFFFFF FFFFFFF FFFF  F FFFFFFFFFFFFFFFFF  F FFFF  F F
   253  254 B D  E  >> -QR 239 258F   1  352    0   DDDD   DDDDDD.DDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   254  255 B L  T >45S+     0   0   15  352   28   LLLL   LIILLL.LLLLLILI IIIIIII LIII  I IIIIIIIIIIIIIIIII  I IIII  M I
   255  256 B R  T 345S+     0   0   57  352    1   RRRR   RRRRRR.RRRRRRRR RRRRRRR RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
   256  257 B A  T 345S-     0   0    0  352   29   AAAS   AAAAAA.AAAAAAAA AAAAAAA AAAA  A AAAAAAAAAAAAAAAAA  A AAAA  A A
   257  258 B D  T <<5 +     0   0    0  352   23   DDDD   DDDDDD.DDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   258  259 B Q  E      -     0   0  119  354   72   DDDD   DHHHHH.HHHHHHHS HHSSSSS HSHH  S NSHHSHSSSSSISSSSS  S HSSI  H S
   266  267 B D  T 3  S+     0   0  161  354   42   SSSS   SDDDDD.DEDDDDDD DDDDDDD DDDD  D EDDDDDDDDDDGDDDDD  E DDDG  D D
   267  268 B N  T 3  S+     0   0   66  354   66   GSSS   SNNNNN.NNNNNNNQ NNQQQQQ NQNN  Q QQNNQNQQQQQEQQQQQ  Q NQQE  N Q
   268  269 B I    <   +     0   0   23  354   48   IIII   IIIIVV.IIIIIIII IIVVVII IVII  I VVIIVIIVIVIPVVVVV  I IVVP  I I
   269  270 B I        +     0   0   97  354   54   MMMM   MLLLLLSLLLLLLLL LILLLLL LLLL  L LLLLVLLLLLLVLLLLL  L LLLV  L L
   270  271 B C  S    S-     0   0   10  354   48   CCCC   CCCCCCDCCCCCCCC CCCCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   271  272 B G        -     0   0    1  355   28   GGGG   GGGGGGIGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   272  273 B I  E     +S  288   0G   0  355   15   VVVV   VIIIIINVIIIIIII IIIIIII IIII  I IIIIIIIIIIIIIIIII  I IIII  I I
   273  274 B T  E     +     0   0G  13  355   15   TTTT   TTTTTTATTTTTTTT TTTTTTT TTTT  T TTTTTTTTTTTTTTTTT  T TTTT  T T
   274  275 B S  E     +S  287   0G  18  355    1   SSSS   SSSSSSISSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   275  276 B V  E     +S  286   0G  10  355   16   LLLI   LVVVVVCVIVVVVVV VVVVVVV VVVV  V VVVVVVVVVVVVVVVVV  V VVVV  V V
   276  277 B S  E     -S  285   0G  15  354   25   AAAA   AAAAAAFGGGGGAGA AAAAAAA GAAA  A AAAAAAGAAAAAAAAAA  A AAAA  A A
   277  278 B F  E     -S  284   0G  12  354   30   PPPP   PFFFFFFFFFFFFFF FFFFFFF FFFF  F FFFFFFFFFFFFFFFFF  F FFFF  F F
   278  279 B S        -     0   0    3  354    4   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   279  280 B K  S    S+     0   0  104  354   81   LLLL   LIIIAALNLVVVIVV IKVVVVV VVII  V VVIIVIVVVVVVVVVVV  V IVVV  Y V
   280  281 B S  S    S-     0   0    2  354    3   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   281  282 B G  S    S+     0   0    0  354    1   GGGG   GGGGGGGGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   282  283 B R        +     0   0    8  354    0   RRRR   RRRRRRRRRRRRRRR RRRRRRR RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
   283  284 B L  E     - T   0 297G   0  354   11   LLLL   LIIIIILILIIIIIL VLLLLLL ILII  L LLIILILLLLLLLLLLL  L VLLL  L L
   284  285 B L  E     -ST 277 296G   0  354    5   IIII   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
   285  286 B L  E     -ST 276 295G   0  354   15   LLLL   LFFFFFFFFFFFFFF FLFFFFF FFFF  F FFFFFFFFFFFFFFFFF  F FFFF  F F
   286  287 B A  E     -ST 275 294G   0  355   18   AAAA   AGGGAAAAAAAAGAA GAAAAAA AAGG  A AAGGAGAAAAAAAAAAA  A GAAA  G A
   287  288 B G  E     -ST 274 293G   2  355   11   GGGG   GGGGGGGGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   288  289 B Y  E >   -S  272   0G   4  355    1   YYYY   YYYYYYYYYYYYYYY YYYYYYY YYYY  Y YYYYYYYYYYYYYYYYY  Y YYYY  Y Y
   289  290 B D  T 3  S+     0   0    3  355   34   DDDD   DDDDDDDDDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   290  291 B D  T 3  S-     0   0   37  355   17   DDDD   DDDDDDDDNDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   291  292 B F  S <  S+     0   0    3  355   44   FFFF   FWWWFFFYFYYYWYF WFFYYFF YFWW  F FFWWFWFYFYFFYYFYY  F WFFF  W F
   292  293 B N        -     0   0   15  355   49   NNNN   NTTTNNNNDTTTTTE TNEEEEE TETT  E EETTETEEEEEEEEEEE  E TEEE  Q E
   293  294 B C  E     -TU 287 307G   0  355   10   VVVC   VCCCCCCCCCCCCCC CCCCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   294  295 B N  E     -TU 286 306G   5  355   74   NNNN   NNNNNNNNNNNNNNK NNKKKKK NKNN  K KKNNKNKKKKKKKKKKK  K NKKK  N K
   295  296 B V  E     -TU 285 305G   0  355   16   IIII   IVVVVVVVVVVVVVV VVVVVVV VVVV  V VVVVVVVVVVVVVVVVV  V VVVV  V V
   296  297 B W  E     -TU 284 303G   6  355    0   WWWW   WWWWWWWWWWWWWWW WWWWWWW WWWW  W WWWWWWWWWWWWWWWWW  W WWWW  W W
   297  298 B D  E  >  -T  283   0G   4  355    0   DDDD   DDDDDDDDDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   298  299 B A  T  4 S+     0   0    0  355   65   TSSS   ATTTTTSTTTTTTTV TTVVVVV TVTT  V TVTTVTVVVVVVVVVVV  V TVVT  T V
   299  300 B L  T  4 S+     0   0    0  355   27   LLLL   LLLLLLMLLLLLLLL LMLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
   300  301 B K  T  4 S-     0   0   29  355   53   KKKK   KKKKKKKKKKKKKKR KKRRRRR KRRR  R RRKKRKRRRRRRRRRRR  R KRRR  K R
   301  302 B A  S  < S+     0   0   17  355   52   AAAS   AGGGGGSGRGGGGGG GAGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   302  303 B D  S    S-     0   0   95  355   52   EEEE   EEEEEEEETEEEEED EEDEEDE EDEE  D DDEEDEDDDEDEEEDEE  E EDDE  E D
   303  304 B R  E     -U  296   0G  69  354   61   RRRR   RRRRRRRRRRRRRRK RRKKKKR RKRR  K KKRRKRKKKKKRKKKKK  K RKKR  R K
   304  305 B A  E     -     0   0G  14  355   63   VVVV   VVVVVVVVVVVVVVV VSVVVVV VVVV  V VVVVVVVVVVVVVVVVV  V VVVV  I V
   305  306 B G  E     -U  295   0G   4  355   27   GGGG   GGGGGGGGAGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   306  307 B V  E >   -U  294   0G   7  355   69   VVVV   VVVVVVIVIVVVVVS VISSSST VSVV  S SSVVSVSSSSSTSSSSS  A VSST  V S
   307  308 B L  E >  S+U  293   0G   2  350   36   LLLL   LLLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
   308  309 B A  G >  S-     0   0    4  351   70   AAAS   ATTTAASSPAAATAS TASSSST ASTT  S SSTTSTSSSSSQSSSSS  V TSSQ  S S
   309  310 B G  G <   -     0   0    4  353   21   GGGG   GGGGGGGGSAAAGAG GGGGGGG AGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   310  311 B H  G <  S+     0   0    8  353    0   HHHH   HHHHHHHHHHHHHHH HHHHHHH HHHH  H HHHHHHHHHHHHHHHHH  H HHHH  H H
   311  312 B D    <   -     0   0   26  353   32   DDDD   DEEEEEDEDEEEEEE EDEEEED EEEE  E EEEEEEEEEEEDEEEEE  E EEED  E E
   312  313 B N  S    S+     0   0   31  353   16   NNNN   NNNNNNNNNNNNNNN NNNNNNN NNNN  N NNNNNNNNNNNNNNNNN  N NNNN  N N
   313  314 B R        +     0   0   40  353    5   RRRR   RRRRRRRRRRRRRRR RRRRRRR RRRR  R RRRRRRRRRRRRRRRRR  R RRRR  R R
   314  315 B V        +     0   0    2  353   10   VVVV   VVVVVVVVVVVVVVV VVVVVVV VVVV  V VVVVVVVVVVVVVVVVV  V VVVV  V V
   315  316 B S  S    S-     0   0    2  353   10   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   316  317 B C  E     -B  329   0A  10  353   17   CCCC   CCCCCCCCCCCCCCC CCCCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   317  318 B L  E     -B  328   0A  15  353   13   IIII   ILLLLLLLLLLLLLL LLLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
   318  319 B G  E     -B  327   0A  10  353   13   GGGG   GGGGGGGGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   319  320 B V  E     -B  326   0A  25  353   19   VVVV   VVVVVVVVVVVVVVV VVVVVVV VVVV  V VVVVVVVVVVVVVVVVV  V VVVV  V V
   320  321 B T    >   -     0   0    3  353   52   PSST   SSSSSSTSSSSSSSS STSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   321  322 B D  T 3  S+     0   0   98  353   70   ATTP   SVASSSAGSATTTAN VENNNNN ANVV  N NNAANANNNNNNNNNNN  N ANNN  S N
   322  323 B D  T 3  S-     0   0   51  352    9   DDDD   DDDDDDDDDDDDDDD DNDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   323  324 B G  S <  S+     0   0    0  352    4   GGGG   GGGGGGGGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGAGGGGG  G GGGA  G G
   324  325 B M  S    S+     0   0   36  350   62   MMMM   MMMMMMMMLMMMMMI MMIIIII MIMM  I IIMMIMIIIIIMIIIII  I MIIM  M I
   325  326 B A        -     0   0    0  350   30   AAAA   AAAAAAAAAAAAAAS AASSSSS ASAA  S SSAASASSSSSSSSSSS  S ASSS  A S
   326  327 B V  E     -BC 319 338A   0  350   33   CCCC   CLLLLLVLLLLLLLL LVLLLLL LLLL  L LLLLLLLLLLLLLLLLL  L LLLL  L L
   327  328 B A  E     -BC 318 337A   0  349   47   CCCC   CCCCCCACCCCCCCC CACCCCC CCCC  C CCCCCCCCCCCCCCCCC  C CCCC  C C
   328  329 B T  E     -BC 317 336A   7  349    4   TTTT   TTTTTTTTTTTTTTT TTTTTTT TTTT  T TTTTTTTTTTTTTTTTT  T TTTT  T T
   329  330 B G  E     -BC 316 335A   1  349    4   GGGG   GGGGGGGGGGGGGGG GGGGGGG GGGG  G GGGGGGGGGGGGGGGGG  G GGGG  G G
   330  331 B S    >   -     0   0    6  349    0   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   331  332 B W  T 3  S+     0   0    6  349    0   WWWW   WWWWWWWWWWWWWWW WWWWWWW WWWW  W WWWWWWWWWWWWWWWWW  W WWWW  W W
   332  333 B D  T 3  S-     0   0   17  349    0   DDDD   DDDDDDDDDDDDDDD DDDDDDD DDDD  D DDDDDDDDDDDDDDDDD  D DDDD  D D
   333  334 B S  S <  S+     0   0   12  349   35   SSSS   SSSSSSSSSSSSSSS SSSSSSS SSSS  S SSSSSSSSSSSSSSSSS  S SSSS  S S
   334  335 B F        -     0   0   78  349   71   FFFF   FTTTMMFLLRRRTRL TFLLLLT RLTT  L LLTTLTLLLLLMLLLLL  F TLLM  T L
   335  336 B L  E     -AC  50 329A   1  349    8   LLLL   LLLLLLLLLLLLLLL LLVLLLL LLLL  L LLLLLLLLLLVLVPVLV  L LLLL  L V
   336  337 B K  E     -AC  49 328A  60  346   23   KKKK   KRRRKKKKKLLLRLK KRrKKKK LKRR  K KKRRKRKKKKsR K K   R RKKR  K s
   337  338 B I  E     -AC  48 327A   0  344   13   IIII   IVVVVVIIIIVVVIV VViVVVI VIVV  V IIVVVVVVVVlI   V   I VVVI  V l
   338  339 B W  E      AC  46 326A   2  341    0   WWWW   WWWWWWWWWWWWWWW WWWWWWW WWWW  W WWWWWWWWWW W   W   W WWWW  W  
   339  340 B N              0   0   10  297   57   NNNN   N     N N        N                                    A       
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   80    0  P    PPP               P            PP P                    P     P   
   342    3 G V        +     0   0   96   82   63  A    AAV               V            VA V                    V     V   
   343    4 G I        -     0   0   38   84   34  L    LLI               I            IV I                    I     I   
   344    5 G N    >   -     0   0  109   84   59  H    HHN               N            NH N                    N     N   
   345    6 G I  G >  S+     0   0   25   84   30  I    IIV               V            IV V                    V     V   
   346    7 G E  G 3  S+     0   0  122  126   44  E    EEE               E            DE D                    E    HE   
   347    8 G D  G <  S+     0   0  133  137   21  D    DDD               E            DD D                    D    DD   
   348    9 G L    <   -     0   0   35  141   15  L    LLL               L            LL L                    L    LL   
   349   10 G T     >  -     0   0   69  141   62  P    SPT               T            TS T                    T    TT   
   350   11 G E  H  > S+     0   0  116  143   33  E    EED               D            DE D                    D    ED   
   351   12 G K  H >> S+     0   0   66  152   41  K    KKK               L            KK K                    K    KK   
   352   13 G D  H 3> S+     0   0   39  152   35  E    EED               D            DD D                    D    ED   
   353   14 G K  H 3X S+     0   0   83  152   84  K    KKK               K            KK K                    K    VK   
   354   15 G L  H < S+     0   0    7  233    6  E    EEE               E            EE E                    E    EE   
   365   26 G V  H 3< S+     0   0   43  233   53  V    VAV               V            VA V                    V    VV   
   366   27 G T  T 3< S+     0   0  116  233   82  K    KKK               K            KK K                    K    KK   
   367   28 G L    <   -     0   0   49  233   61  L    LLL               L            LL L                    L    TL   
   368   29 G E        -     0   0  191  233   49  Q    QQE               E            EQ E                    E    EE   
   369   30 G R        -     0   0   32  233    1  R    RRR               R            RR R                    R    RR   
   370   31 G M        -     0   0   53  233   85  Q    QQW               A            WQ W                    W    EW   
   371   32 G L     >  -     0   0   75  232   81  Q    QQL               K            LQ L                    L    ML   
   372   33 G V  H  > S+     0   0    4  232   15  V    VVT               V            TV T                    T    VT   
   373   34 G S  H  > S+     0   0   14  232    1  S    SSS               S            SS S                    S    SS   
   374   35 G K  H  > S+     0   0   93  232   38  K    KKK               K            KK K                    K    KK   
   375   36 G C  H  X S+     0   0    0  233   62  C    CCC               C            CC C                    C    TC   
   376   37 G C  H  X S+     0   0    0  233   63  S    SSC               C            CS C                    C    TC   
   377   38 G E  H  X S+     0   0   75  233   68  E    EEE               E            EE E                    E    KE   
   378   39 G E  H  X S+     0   0   60  233   26  E    EEE               E            EE E                    E    EE   
   379   40 G F  H  X S+     0   0    3  233   36  I    III               I            II M                    I    II   
   380   41 G R  H  X S+     0   0   53  233   79  K    KKK               S            KK K                    K    KK   
   381   42 G D  H  X S+     0   0   67  233   65  N    NND               E            DK E                    E    EE   
   382   43 G Y  H  X S+     0   0   43  233    2  Y    YYY               Y            YY Y                    Y    FY   
   383   44 G V  H >X S+     0   0    0  233   58  I    III               I            II I                    I    VI   
   384   45 G E  H 3X S+     0   0   71  233   47  E    EEV               Q            QE Q                    Q    EQ   
   385   46 G E  H 3< S+     0   0  125  233   57  E    EEA               S            AA E                    A    SA   
   386   47 G R  H XX S+     0   0   94  233   69  R    RRG               G            GR R                    L    SG   
   387   48 G S  H >< S+     0   0   12  233   67  S    SSM               A            EC V                    V    SV   
   388   49 G G  T 3< S+     0   0   38  233   80  R    GGD               D            EG E                    E    AE   
   389   50 G E  T <4 S+     0   0  138  232   54  E    DEE               E            EE E                    E    EE   
   390   51 G D    XX> -     0   0    1  232    0  D    DDD               D            DD D                    D    DD   
   391   52 G P  H 3>5S+     0   0   17  233   25  P    PPI               P            IP T                    T    PT   
   392   53 G L  H 345S+     0   0    6  233    3  L    LLL               L            LL L                    L    LL   
   393   54 G V  H <45S+     0   0   24  233   29  V    VVV               V            VV V                    V    LV   
   394   55 G K  H  <5S-     0   0  149  233   80  K    KKK               K            KK K                    K    KK   
   395   56 G G     << -     0   0   38  233   34  G    GGG               G            GG G                    G    GG   
   396   57 G I        -     0   0   21  224   20  I    III               I            II I                    I    II   
   397   58 G P    >>  -     0   0   80  233   11  P    PPP               P            SP S                    S    PS   
   398   59 G E  T 34 S+     0   0   75  233   58  E    EEE               E            EE E                    E    EE   
   399   60 G D  T 34 S+     0   0  151  233   61  D    DDD               E            ED E                    E    DE   
   400   61 G K  T <4 S+     0   0  163  233   62  K    KKK               K            KK K                    K    KK   
   401   62 G N     <  -     0   0    1  233    0  N    NNN               N            NN N                    N    NN   
   402   63 G P  S    S+     0   0   36  224    0  P    PPP               P            PP P                    P    PP   
   403   64 G F  S    S-     0   0    3  224    0  F    FFF               F            FY F                    F    FF   
   404   65 G K              0   0  108  222   29  K    KKK               K            KK K                    K    KK   
   405   66 G E              0   0  201  217    3  E    EEE               E            EE E                    E    EE   
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   62   10                                 F                         F          F 
   408   14 P E        +     0   0  153  142   39                                 E                         E          E 
   409   15 P G  S    S+     0   0   38  144   37                                 G                         G          G 
   410   16 P Q  S    S-     0   0   94  148   90                                 Q                         Q          Q 
   411   17 P A        +     0   0    1  149   53                                 A                         A          A 
   412   18 P S        +     0   0   28  149   71                                 T                         T          T 
   413   19 P H  S    S+     0   0   42  151   57                                 H                         H          H 
   414   20 P T  S  > S-     0   0    2  152   17                                 T                         T          T 
   415   21 P G  H  > S-     0   0   10  164    2                                 G                         GG         G 
   416   22 P P  H  > S+     0   0   14  165    0                                 P                         PP         P 
   417   23 P K  H  > S+     0   0    6  165    0                                 K                         KK         K 
   418   24 P G  H  X S+     0   0    0  165    1                                 G                         GG         G 
   419   25 P V  H  X S+     0   0    0  165    0                                 V                         VV         V 
   420   26 P I  H  X S+     0   0    4  165   14                                 I                         II         I 
   421   27 P N  H  X S+     0   0   48  165   42                                 N                         NN         N 
   422   28 P D  H  X S+     0   0   14  166    0                                 D                         DD         D 
   423   29 P W  H  X S+     0   0    6  166    0                                 W                         WW         W 
   424   30 P R  H  < S+     0   0   67  166   26                                 R                         RR         R 
   425   31 P K  H >X S+     0   0   67  166   36                                 K                         KK         K 
   426   32 P F  H >X>S+     0   0    1  166    1                                 F                         FF         F 
   427   33 P K  H 3<5S+     0   0   30  166    7                                 K                         KK         K 
   428   34 P L  H <45S+     0   0  139  161    1                                 L                         LL         L 
   429   35 P E  H <<5S+     0   0   86  161    9                                 E                         EE         E 
   430   36 P S  T  <5       0   0   57  162   66                                 s                         ss         s 
   431   37 P E      <       0   0  118  167   66                                 r                         rr         r 
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  143   42                                 F                         IF         F 
   434   69 P S        +     0   0   52  144   64                                 C                         RC         S 
   435   70 P R        -     0   0  103  120   85                                 R                         RR         R 
   436   71 P K        +     0   0   22  123   12                                 K                         KK         K 
   437   72 P M  S    S-     0   0   12  124   13                                 M                         MM         M 
   438   73 P S     >  -     0   0   52  131   65                                 S                         SS         S 
   439   74 P V  H  > S+     0   0  107  130   53                                 M                         VM         M 
   440   75 P Q  H  > S+     0   0  133  130   52                                 Q                         QQ         Q 
   441   76 P E  H  > S+     0   0   38  134   26                                 E                         EE         E 
   442   77 P Y  H  X S+     0   0   36  146   56                                 Y                         YY         Y 
   443   78 P E  H  < S+     0   0  111  154   61                                 E                         EE         E 
   444   79 P L  H >X S+     0   0   45  155   57                                 L                         LL         L 
   445   80 P I  H 3< S+     0   0   37  157   72                                 I                         II         I 
   446   81 P H  T 3< S+     0   0  178  158   80                                 N                         HN         H 
   447   82 P K  T <4 S+     0   0  140  157   65                                 D                         QD         G 
   448   83 P D     <  -     0   0   58  169   39                                 E                         EE         E 
   449   84 P K        -     0   0  205  149   80                                 K                         KK         Q 
   450   85 P E        -     0   0   45  150   68                                 E                         EE         E 
   451   86 P D    >>  -     0   0   87  169   31                                 D                         DD         D 
   452   87 P E  H 3> S+     0   0  113  168   12                                 E                         EE         E 
   453   88 P N  H 3> S+     0   0   73  169   59                                 S                         RS         S 
   454   89 P C  H <> S+     0   0   32  170   72                                 C                         CC         C 
   455   90 P L  H  X S+     0   0    4  170    2                                 L                         LL         L 
   456   91 P R  H  X S+     0   0  131  170   63                                 Q                         RQ         Q 
   457   92 P K  H  X S+     0   0  112  170   59                                 K                         KK         K 
   458   93 P Y  H  X S+     0   0    7  170    5                                 Y                         YY         Y 
   459   94 P R  H  X S+     0   0   31  170   31                                 R                         RR         R 
   460   95 P R  H  X S+     0   0  130  170   43                                 K                         RK         K 
   461   96 P Q  H  X S+     0   0   96  170   30                                 R                         QR         R 
   462   97 P C  H  X S+     0   0   22  170   72                                 C                         CC         C 
   463   98 P M  H  X S+     0   0   33  170   11                                 M                         MM         M 
   464   99 P Q  H  X S+     0   0  115  170   54                                 Q                         HQ         Q 
   465  100 P D  H  X S+     0   0   46  170   21                                 D                         ND         D 
   466  101 P M  H  X S+     0   0   23  170    2                                 M                         MM         M 
   467  102 P H  H  X S+     0   0   64  170   74                                 H                         HH         H 
   468  103 P Q  H  < S+     0   0  143  170   59                                 Q                         QQ         Q 
   469  104 P K  H  < S+     0   0  140  170   55                                 R                         KR         R 
   470  105 P L  H  < S+     0   0   35  170   43                                 L                         LL         L 
   471  106 P S     <  -     0   0   75  170   79                                 S                         SS         S 
   472  107 P F        -     0   0   71  168   99                                 F                         FF         F 
   473  108 P G        -     0   0   36  168   51                                 G                         GG         G 
   474  109 P P        +     0   0   92  160   41                                 P                         PP         P 
   475  110 P R        +     0   0  177  165   61                                 K                         KK         R 
   476  111 P Y        +     0   0   51  166    5                                 Y                         YY         Y 
   477  112 P G        +     0   0   12  170   61                                 G                         GG         G 
   478  113 P F  S    S-     0   0  151  170  103                                 Y                         FY         S 
   479  114 P V  E     -v  532   0H  28  170   13                                 L                         LL         L 
   480  115 P Y  E     -v  533   0H  71  165   68                                 C                         CC         Y 
   481  116 P E  E     -v  534   0H 108  170   41                                 E                         EE         E 
   482  117 P L        -     0   0   12  170   32                                 L                         LL         L 
   483  118 P E        +     0   0  134  170   74                                 Q                         EQ         Q 
   484  119 P S  S >> S-     0   0   57  170   53                                 N                         TN         N 
   485  120 P G  H 3> S+     0   0   15  169   40                                 G                         GG         G 
   486  121 P E  H 3> S+     0   0  127  170   23                                 E                         EE         E 
   487  122 P Q  H <> S+     0   0   72  170   61                                 Q                         QQ         Q 
   488  123 P F  H  X S+     0   0   26  170    1                                 F                         FF         F 
   489  124 P L  H  X S+     0   0   90  170    6                                 L                         LL         L 
   490  125 P E  H  X S+     0   0  103  170   41                                 E                         EE         E 
   491  126 P T  H  < S+     0   0   10  170   76                                 A                         AA         V 
   492  127 P I  H  < S+     0   0   17  170   12                                 I                         II         I 
   493  128 P E  H  < S+     0   0  139  170   20                                 E                         EE         E 
   494  129 P K  S  < S+     0   0  172  170   35                                 K                         KK         K 
   495  130 P E  S    S-     0   0   38  166    5                                 E                         EE         E 
   496  131 P Q    >   -     0   0  116  170   66                                 R                         QR         R 
   497  132 P K  T 3  S+     0   0  156  170   34                                 K                         KK         K 
   498  133 P I  T 3  S+     0   0   68  170   87                                 T                         ST         T 
   499  134 P T    <   -     0   0   10  170   35                                 T                         TT         V 
   500  135 P T  E     -W  558   0H   7  169   62                                 T                         TT         L 
   501  136 P I  E     -Wx 557 531H   3  170   15                                 V                         VV         V 
   502  137 P V  E     -Wx 556 532H   0  170   35                                 I                         II         I 
   503  138 P V  E     -Wx 555 533H   0  170   12                                 V                         VV         V 
   504  139 P H  E     -Wx 554 534H   0  170    6                                 H                         HH         H 
   505  140 P I  E     +Wx 553 535H   2  170    1                                 I                         II         I 
   506  141 P Y  E     - x   0 536H   4  170    2                                 Y                         YY         Y 
   507  142 P E    >   -     0   0   45  170   26                                 E                         EE         E 
   508  143 P D  T 3  S+     0   0   95  170   51                                 D                         ND         D 
   509  144 P G  T 3  S+     0   0   66  170   48                                 G                         DG         G 
   510  145 P I  S X> S-     0   0   36  170   33                                 I                         VI         I 
   511  146 P K  T 34 S+     0   0  191  170   71                                 K                         EK         K 
   512  147 P G  T 3> S+     0   0   13  170   22                                 G                         GG         G 
   513  148 P C  H <> S+     0   0    0  170   35                                 C                         CC         C 
   514  149 P D  H  X S+     0   0   78  170   47                                 N                         ED         E 
   515  150 P A  H  > S+     0   0   44  170   50                                 A                         AA         A 
   516  151 P L  H  X S+     0   0    0  170   11                                 L                         LL         L 
   517  152 P N  H  X S+     0   0   19  170   16                                 N                         NN         N 
   518  153 P S  H  X S+     0   0   78  170   56                                 S                         SS         N 
   519  154 P S  H  X S+     0   0    6  170   35                                 S                         GS         S 
   520  155 P L  H  X S+     0   0    1  170   10                                 L                         LL         L 
   521  156 P I  H  X S+     0   0  105  170   85                                 T                         AT         T 
   522  157 P C  H  X S+     0   0   63  170   38                                 C                         CC         C 
   523  158 P L  H  X S+     0   0    0  170    4                                 L                         LL         L 
   524  159 P A  H  < S+     0   0    1  170    9                                 A                         AA         A 
   525  160 P A  H  < S+     0   0   61  170   67                                 A                         TA         A 
   526  161 P E  H  < S+     0   0   72  170   23                                 E                         EE         E 
   527  162 P Y    ><  +     0   0    5  170    2                                 Y                         YY         Y 
   528  163 P P  T 3  S+     0   0   28  170   29                                 T                         PT         S 
   529  164 P M  T 3  S+     0   0   26  170   86                                 T                         TT         T 
   530  165 P V  S <  S-     0   0    1  170    8                                 V                         LV         M 
   531  166 P K  E     - x   0 501H  37  170    2                                 K                         RK         R 
   532  167 P F  E     +vx 479 502H   0  170    1                                 F                         FF         F 
   533  168 P C  E     -vx 480 503H   0  170   18                                 C                         CC         C 
   534  169 P K  E     +vx 481 504H  51  170   37                                 K                         KK         K 
   535  170 P I  E     - x   0 505H   1  170   21                                 I                         II         I 
   536  171 P K  E >>  - x   0 506H  52  170   72                                 K                         RK         K 
   537  172 P A  H >> S+     0   0   13  170   46                                 A                         AA         A 
   538  173 P S  H 34 S+     0   0   88  170   30                                 S                         SS         S 
   539  174 P N  H <4 S+     0   0   67  170   86                                 N                         NK         N 
   540  175 P T  H << S-     0   0   25  170   73                                 T                         TT         T 
   541  176 P G     <  +     0   0   66  169   22                                 G                         GG         G 
   542  177 P A    >   -     0   0   39  170   55                                 A                         AA         A 
   543  178 P G  T 3  S-     0   0   70  169   43                                 G                         GG         G 
   544  179 P D  T 3  S+     0   0  151  169   78                                 D                         DD         D 
   545  180 P R  S <  S+     0   0  167  169   58                                 R                         RR         R 
   546  181 P F  S    S+     0   0   35  169    0                                 F                         FF         F 
   547  182 P S    >>  -     0   0   34  169   70                                 S                         SS         S 
   548  183 P S  T 34 S+     0   0   86  169   84                                 D                         AD         T 
   549  184 P D  T 34 S+     0   0  126  169   66                                 E                         GE         D 
   550  185 P V  T <4 S+     0   0   20  169   65                                 V                         VV         V 
   551  186 P L     <  +     0   0    8  170   13                                 L                         LL         L 
   552  187 P P  S    S+     0   0    1  170    0                                 P                         PP         P 
   553  188 P T  E     -W  505   0H   1  170   42                                 T                         TT         T 
   554  189 P L  E     -WY 504 566H   0  170    2                                 L                         LL         L 
   555  190 P L  E     -WY 503 565H   4  170    9                                 L                         LL         L 
   556  191 P V  E     +WY 502 564H   0  170   19                                 V                         VI         V 
   557  192 P Y  E     +WY 501 562H  31  170    0                                 Y                         YY         Y 
   558  193 P K  E >  S-WY 500 561H  25  170   12                                 K                         KK         K 
   559  194 P G  T 3  S-     0   0   25  170   41                                 G                         AG         G 
   560  195 P G  T 3  S+     0   0   48  170   21                                 G                         GG         G 
   561  196 P E  E <   -Y  558   0H  38  170   36                                 E                         EE         E 
   562  197 P L  E     +Y  557   0H  34  170   12                                 L                         LL         L 
   563  198 P L  E     -     0   0H   2  170   20                                 L                         LL         L 
   564  199 P S  E     -Y  556   0H   4  170   30                                 S                         GS         S 
   565  200 P N  E     -Y  555   0H  41  170    0                                 N                         NN         N 
   566  201 P F  E >   -Y  554   0H   3  170    1                                 F                         FF         F 
   567  202 P I  T 3  S-     0   0   87  168   25                                 I                         II         I 
   568  203 P S  T >  S-     0   0   11  168   71                                 S                         NS         S 
   569  204 P V  G X  S+     0   0    0  168   35                                 V                         VV         I 
   570  205 P T  G >  S+     0   0   17  168   36                                 S                         TS         T 
   571  206 P E  G <  S+     0   0  156  168   35                                 E                         EE         E 
   572  207 P Q  G <  S+     0   0   84  168   43                                 Q                         RQ         H 
   573  208 P L  S <  S-     0   0   31  168   11                                 F                         LF         F 
   574  209 P A    >   -     0   0   49  168   51                                 N                         GN         R 
   575  210 P E  T 3  S+     0   0  201  168   27                                 E                         EE         E 
   576  211 P E  T 3  S+     0   0  166  168   21                                 E                         EE         E 
   577  212 P F    <   -     0   0   17  168    0                                 F                         FF         F 
   578  213 P F    >>  -     0   0  146  168   24                                 F                         FF         F 
   579  214 P T  H 3> S+     0   0   24  167   24                                 A                         AA         A 
   580  215 P G  H 3> S+     0   0   32  167   71                                 V                         GV         V 
   581  216 P D  H <> S+     0   0   57  167    4                                 D                         DD         D 
   582  217 P V  H  X S+     0   0    0  167   23                                 V                         VV         V 
   583  218 P E  H  X S+     0   0   32  167    8                                 E                         EE         E 
   584  219 P S  H  X S+     0   0   58  167   52                                 S                         SS         S 
   585  220 P F  H  < S+     0   0    2  168    2                                 F                         LF         F 
   586  221 P L  H ><>S+     0   0    0  168    0                                 L                         LL         L 
   587  222 P N  H ><5S+     0   0   61  168   82                                 N                         CN         H 
   588  223 P E  T 3<5S+     0   0   70  168   18                                 E                         EE         E 
   589  224 P Y  T < 5S-     0   0   20  165   47                                 Y                         YY         Y 
   590  225 P G  T < 5S+     0   0    6  165    6                                 G                         GG         G 
   591  226 P L      < +     0   0    2  165   18                                 L                         LL         L 
   592  227 P L  S    S-     0   0   10  161    8                                 L                         LL         L 
   593  228 P P        -     0   0   40  161   31                                 P                         PP         P 
   594  229 P E              0   0   94  159   17                                 E                         EE         E 
   595  230 P K              0   0  161  158   24                                 R                         RR         K 
## ALIGNMENTS  351 -  420
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....6....:....7....:....8....:....9....:....0....:....1....:....2
     1    2 B S              0   0  117  267   60   A S AA   TS AASAA  ESAE S AASSA  AAAA DSS AAS  A  A  AAA AA     G A  
     2    3 B E     >  -     0   0  107  283   60   R R RR  KKR RRRRRKKKRRK RKRRRRR KRRRRKKRRKRRRK R  R  RRR RR     R R  
     3    4 B L  H  > S+     0   0   52  299   33   I IIII  III IIIIIIIIIII IIIIIII IIIIIIIIIIIIII I  I  III II     I I  
     4    5 B D  H  > S+     0   0  104  300   57   Q QAQQ  QQQ QQQQQQQQQQQ QQQQQQQ QQQQQQAQQQQQQQ Q  Q  QQQ QQ     Q Q  
     5    6 B Q  H  > S+     0   0  131  301   62   Q QSQQ  IIQ QQQQQTIQQQQ QLQQQQQ LQQQQLAQQLQQQL Q  Q  QQQ QQ     Q Q  
     6    7 B L  H  X S+     0   0   27  302   65   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
     7    8 B R  H  X S+     0   0  110  311   10   R RRRR  RRR RRRRRRRRRRR RRRRRRR RRRRRRRRRRRRRR R  R  RRR RR     R R  
     8    9 B Q  H  X S+     0   0  117  312   60   R RRRR  RRR RRRRRRRRRRR RRRRRRR RRRRRRRRRRRRRR R  R  RRR RR     R R  
     9   10 B E  H  X S+     0   0   78  313   13   E EEEE  DDE EEEEEDDDEED EDEEEEE DEEEEDEEEDEEED E  E  EEE EE     E E  
    10   11 B A  H  X S+     0   0    1  313   25   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
    11   12 B E  H  X S+     0   0  121  315   21   E EDEE  EEE EEEEEEEEEEE EEEEEEE EEEEEEDEEEEEEE E  E  EEE EE     E E  
    12   13 B Q  H  X S+     0   0  111  323   73   T SSTT  AAS TTTTTNAGTTS TATNTTT ATTHTAGTTATTTA T  N  NNT TT     T N  
    13   14 B L  H  X S+     0   0   14  348    5   L LLLL  LLL LLLLLLLMLLM LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
    14   15 B K  H  X S+     0   0   99  348   37   K KKKK  KKK KKKKKKKKKKK KKKKKKK KKKKKKKKKKKKKK K  K  KKK KK     K K  
    15   16 B N  H  X S+     0   0   33  348   56   D DEDD  DDD DDDDDDDEDDE DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
    16   17 B Q  H  X S+     0   0   82  348   60   R RKRR  RRR RRRRRKRQRRQ RRRRRRR RRRRRRKRRRRRRR R  R  RRR RR     R R  
    17   18 B I  H  X S+     0   0    7  348   18   I IIII  III IIIIIIIIIII IIIIIII IIIIIILIIIIIII I  I  III II     I I  
    18   19 B R  H  X S+     0   0  135  348   59   K KRKK  KKK KKKKKKKRKKR KKKKKKK KKKKKKRKKKKKKK K  R  RRK KK     K R  
    19   20 B D  H  X S+     0   0   85  349   72   R RARR  RRR RRRRRRRTRRA RRRRRRR RRRRRRARRRRRRR R  L  LLR RR     R L  
    20   21 B A  H  X S+     0   0   36  249   44   . ....  ... .......N..N ....... ......A....... .  .  ... ..     . .  
    21   22 B R  H >X S+     0   0   22  349   28   K KKKK  KKK KKKKKKKRKKR KKKKKKK KKKKKKRKKKKKKK K  K  KKK KK     K K  
    22   23 B K  H 3< S+     0   0  136  350   43   K KKKK  KKK KKKKKKKDKKD KKKKKKK KKKKKKDKKKKKKK K  K  KKK KK     K K  
    23   24 B A  H 3< S+     0   0   79  350   64   d dedd  ddd eddddddVddV ddddddd ddddddQddddddd d  e  eee ed     e e  
    24   25 B C  H << S+     0   0   19  306   94   l ltll  lll lllllllMllM lllllll llllllTlllllll l  l  lll ll     l l  
    25   26 B A     <  +     0   0   46  309   60   A AAAA  AAA AAASSAANAAN AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
    26   27 B D        +     0   0   88  312    3   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
    27   28 B A        -     0   0   17  315   51   T ATTT  TTA TTTTTTTTTTT TTTTTTT TTTATTTTTTTTTT T  T  TTT TT     T T  
    28   29 B T    >>  -     0   0   59  315   41   T TSTT  TTT TTTTTTTSTTT TTTTTTT TTTTTTSTTTTTTT T  S  SST TT     T S  
    29   30 B L  H 3> S+     0   0    0  317    9   L LLLL  LLL LLLVLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
    30   31 B S  H 34 S+     0   0   38  323   90   R MRRR  RRM RRRRRRRKRRK RRRRRRR RRRSRRRRRRRRRR R  Y  YYR RR     R Y  
    31   32 B Q  H X4 S+     0   0  119  330   65   T NATS  DDN AAAVVDDTAAT ADAAAAT DADGTDAAADTAAD A  E  EEA AT     A E  
    32   33 B I  H 3< S+     0   0   28  332   58   V LMVV  VVL VVVIIVVYVVF VVVVVVV VVVIVVMVVVVVVV V  V  VVV VV     V V  
    33   34 B T  T >< S+     0   0    0  343   62   A AAAA  AAA AAAAAAATAAT AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
    34   35 B N  T <  S+     0   0  129  351   77   Q RAQQ  RRR AQQQQRRRQQR QRQQQQQ RQQRQRTQQRQQQR Q  Q  QQA AQ     A Q  
    35   36 B N  T 3  S+     0   0  111  351   67   q aEqq  qra qqqqqddDqqD qdqqqqq dqhaqdDqqdqqqd q  q  qqq qq     q q  
    36   37 B I  S <  S-     0   0   21  338   72   h qVhh  ttq hhhhhvvLhhL hvhhhhh vhhqhvThhvhhhv h  h  hhh hh     h h  
    37   38 B D        -     0   0  138  345   57   E EEEE  EEE EEEEEEEPEEP EEEEEEE EEEEEEPEEEEEEE D  E  EEE EE     E E  
    38   39 B P        -     0   0   89  348   62   P ATPP  QQA QPPPPAANPPG PAPPPPP APAAPAPPPAPPPA P  P  PPP PP     P P  
    39   40 B V        -     0   0   23  350   41   I LLII  LLL IIIIILLLIIL ILVIIII LIILILLIILIIIL I  L  LLI II     I L  
    40   41 B G        -     0   0   54  353   52   P PPPP  PPP PPPPPPPPPPP PPPPPPP PPPPPPPPPPPSPP P  P  PPP PP     P P  
    41   42 B R        -     0   0  115  354   44   K KRKR  RRK KKKKKRRRKKK KRKKKKK RKKKKRRKKRKRKR K  K  KKK KK     K K  
    42   43 B I        +     0   0    8  354   63   N NING  LLN NNNNNLLlNNm NLNNNNN LNNNNLINNLNNNL N  N  NNN Sn     S N  
    43   44 B Q        -     0   0   54  340   61   q qVqq  AAq qqqqqTTnqqg qTqqqqq TqqqqTTqqTqqqT q  n  nnq ql     q n  
    44   45 B M        -     0   0   11  345   12   m mMmm  MMm mmmmmMMimmi mMmmmmm MmmmmMLmmMmmmM m  m  mmm mM     m m  
    45   46 B R        -     0   0   49  346   51   K KKKK  KKK RKKRRKKKKRK KEKKKKK KKKKKKKKKKKKKK K  K  RKR KK     R K  
    46   47 B T  E     +A  338   0A  12  350   67   A TPAA  TTT TAAAATTIAAV ATTAAAA TTTTATAAATAPAT T  T  TTA PA     T T  
    47   48 B R  E     +     0   0A  56  355   56   K RRKK  KKR KKKKKKKRKKR KKKKKKK KKKRKKRKKKKKKK K  K  KKK KK     K K  
    48   49 B R  E     -A  337   0A  60  355   15   R KRRR  RRK RRRRRRRRRRR RRRRRRR RRRKRRRRRRRRRR R  K  KKR RR     R K  
    49   50 B T  E     -A  336   0A  30  355   27   T TATT  TTT TTTTTTTTTTN TTTTTTT TTTTTTTTTTTTTT T  T  TTT TT     T T  
    50   51 B L  E     -A  335   0A   0  355    2   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
    51   52 B R        +     0   0  159  355   41   K KKKK  KKK KKKKKKKKKKK KKKKKKK KKKKKKKKKKKKKK K  K  KKK KK     K K  
    52   53 B G        +     0   0   20  355    0   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
    53   54 B H        -     0   0    4  355    0   H HHHH  HHH HHHHHHHHHHH HHHHHHH HHHHHHHHHHHHHH H  H  HHH HH     H H  
    54   55 B L  S    S+     0   0  116  355   50   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
    55   56 B A  S    S-     0   0    0  355   30   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
    56   57 B K        -     0   0   15  355    0   K KKKK  KKK KKKKKKKKKKK KKKKKKK KKKKKKKKKKKKKK K  K  KKK KK     K K  
    57   58 B I  E     -D   73   0B   0  355    9   I IIII  III IIIIIIIIIII IIIIIII IIIIIIIIIIIIII I  I  III II     I I  
    58   59 B Y  E     -     0   0B   6  355   20   Y YYYY  YYY YYYYYYYYYYY YYYYYYY YYYYYYYYYYYYYY Y  Y  YYY YY     Y Y  
    59   60 B A  E     -D   72   0B  13  355   32   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
    60   61 B M  E     -D   71   0B  15  355   10   M MMMM  MMM MMMMMMMMMMM MMMMMMM MMMMMMLMMMMMMM M  M  MMM MM     M M  
    61   62 B H  E     -D   70   0B  44  355   33   H HHHH  HHH HHHHHHHHHHH HHHHHHH HHHHHHHHHHHHHH H  H  HHH HH     H H  
    62   63 B W  E     -D   69   0B  11  355    0   W WWWW  WWW WWWWWWWWWWW WWWWWWW WWWWWWWWWWWWWW W  W  WWW WW     W W  
    63   64 B G    >   -     0   0    3  355   54   S SASS  SSS SSSSSSSASSA SSSSSSS SSSSSSASSSSSSS S  S  SSS SS     S S  
    64   65 B T  T 3  S+     0   0   75  355   66   T TATT  TTT TTTTTTTETTE TTTTTTT TTTTTTATTTTTTT T  T  TTT TT     T T  
    65   66 B D  T 3  S-     0   0   80  355   12   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
    66   67 B S  S <  S+     0   0    3  355   57   R RKRR  RRR RRRRRRRSRRN RRRRRRR RRRRRRTRRRRRRR R  R  RRR RR     R R  
    67   68 B R  S    S+     0   0   94  355   47   R RRRR  RRR RRRRRRRIRRV RRRRRRR RRRRRRRRRRRRRR R  R  RRR RR     R R  
    68   69 B L  E     + E   0  82B  31  355   87   H HHHH  HHH HHHHHHHHHHH HHHHHHH HHHHHHHHHHHHHH H  H  HHH HH     H H  
    69   70 B L  E     -DE  62  81B   0  355   23   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLILLLLLLL L  L  LLL LL     L L  
    70   71 B L  E     -DE  61  80B   0  355    7   V VVVV  VVV VVVVVVVVVVV VVVVVVV VVVVVVVVVVVVVV V  V  VVV VV     V V  
    71   72 B S  E     -DE  60  79B   0  354    2   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
    72   73 B A  E     -DE  59  78B   0  354    5   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
    73   74 B S  E >>  -DE  57  77B   0  354    2   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
    74   75 B Q  T 34 S+     0   0    1  355    1   Q QQQQ  QQQ QQQQQQQQQQQ QQQQQQQ QQQQQQQQQQQQQQ Q  Q  QQQ QQ     Q Q  
    75   76 B D  T 34 S-     0   0    9  355    0   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
    76   77 B G  T <4 S+     0   0    7  355    1   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
    77   78 B K  E  <  -EF  73  93B  52  355   34   K KKKK  KKK KKKKKKKKKKK KKKKKKK KKKKKKKKKKKKKK K  K  KKK KK     K K  
    78   79 B L  E     -EF  72  92B   0  355    4   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
    79   80 B I  E     -EF  71  91B   0  355    7   I IIII  III IIIIIIILIIL IIIIIII IIIIIIIIIIIIII I  I  III II     I I  
    80   81 B I  E     -EF  70  90B   0  355   18   I IVII  III IIIIIIIVIIV IIIIIII IIIIIIVIIIIIII I  I  III II     I I  
    81   82 B W  E     -EF  69  88B   0  355    0   W WWWW  WWW WWWWWWWWWWW WWWWWWW WWWWWWWWWWWWWW W  W  WWW WW     W W  
    82   83 B D  E >>> -EF  68  87B  21  355   18   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
    83   84 B S  T 345S+     0   0    0  355   52   A AAAA  AAA AAAAAAAGAAG AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
    84   85 B Y  T 345S+     0   0   57  354   48   Y YYYY  YYY YYYYYYYLYYL YYYYYYY YYYYYYYYYYYYYY Y  Y  YYY YY     Y Y  
    85   86 B T  T <45S-     0   0   56  354    8   T TTTT  TTT TTTTTTTTTTT TTTTTTT TTTTTTTTTTTTTT T  T  TTT TT     T T  
    86   87 B T  T  <5 +     0   0   43  354   36   T TTTT  TTT TTTTTTTTTTT TTTTTTT TTTTTTTTTTTTTT T  T  TTT TT     T T  
    87   88 B N  E   < -F   82   0B  99  354   38   N NNNN  NNN NNNNNNNNNNN NNNNNNN NNNNNNNNNNNNNN N  N  NNN NN     N N  
    88   89 B K  E     +F   81   0B  95  354    0   K KKKK  KKK KKKKKKKKKKK KKKKKKK KKKKKKKKKKKKKK K  K  KKK KK     K K  
    89   90 B V  E    S+     0   0B  66  353   49   V VVVV  VVV VVVVVVVVVVV VVVVVVV VVVVVVVVVVVVVV V  V  VVV VV     V V  
    90   91 B H  E     -F   80   0B  57  353   18   H HHHH  HHH HHHHHHHHHHH HHHHHHH HHHHHHHHHHHHHH H  H  HHH HH     H H  
    91   92 B A  E     -F   79   0B  43  353    8   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
    92   93 B I  E     -F   78   0B   0  353    3   I IIII  III IIIIIIIIIII IIIIIII IIIIIIIIIIIIII I  I  III II     I I  
    93   94 B P  E     -F   77   0B  80  353   37   P PPPP  PPP PPPPPPPPPPP PPPPPPP PPPPPPPPPPPPPP P  P  PPP PP     P P  
    94   95 B L        -     0   0   26  354    2   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
    95   96 B R  S    S+     0   0  190  354   40   R RRRR  RRR RRRRRRRRRRR RRRRRRR RRRRRRRRRRRRRR R  R  RRR RR     R R  
    96   97 B S        -     0   0   17  354   24   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
    97   98 B S  S    S+     0   0    6  354   36   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
    98   99 B W        +     0   0    2  354    3   W WWWW  WWW WWWWWWWWWWW WWWWWWW WWWWWWWWWWWWWW W  W  WWW WW     W W  
    99  100 B V  E     -G  115   0C   4  354    1   V VVVV  VVV VVVVVVVVVVV VVVVVVV VVVVVVVVVVVVVV V  V  VVV VV     V V  
   100  101 B M  E     +     0   0C   5  353    4   M MMMM  MMM MMMMMMMMMMM MMMMMMM MMMMMMMMMMMMMM M  M  MMM MM     M M  
   101  102 B T  E     -G  114   0C   8  353   13   T TTTT  TTT TTTTTTTTTTT TTTTTTT TTTTTTTTTTTTTT T  T  TTT TT     T T  
   102  103 B C  E     -G  113   0C   0  353    9   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCACCCCCCC C  C  CCC CC     C C  
   103  104 B A  E     -G  112   0C   0  353    8   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
   104  105 B Y  E     -G  111   0C   9  353   10   Y YYYY  YYY YYYYYYYYYYY YYYYYYY YYYYYYYYYYYYYY Y  Y  YYY YY     Y Y  
   105  106 B A    >   -     0   0    0  353   33   A ASAA  SSA AAAAASSSAAS ASAAAAA SAAAASAAASAAAS A  A  AAA SA     A A  
   106  107 B P  T 3  S+     0   0   64  353    8   P PPPP  PPP PPPPPPPPPPP PPPPPPP PPPPPPPPPPPPPP P  P  PPP PP     P P  
   107  108 B S  T 3  S-     0   0   47  353   31   S SSSS  SSS SSSSSSSTSST SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   108  109 B G  S <  S+     0   0    8  353   14   G GGGG  GGG GGGGGGGTGGA GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   109  110 B N  S    S+     0   0   50  353   43   N NNNN  NNN NNNNNNNNNNN NNNNNNN NNNNNNNNNNNNNN N  N  NNN NN     N N  
   110  111 B Y  E     - H   0 124C  50  353   55   Y YFYY  YYY YFFFFYYFFFF FYYFFFY YYYYYYLFFYYYFY Y  F  FFY YY     F F  
   111  112 B V  E     -GH 104 123C   0  353    5   V VVVV  VVV VVVVVVVVVVV VVVVVVV VVVVVVVVVVVVVV V  V  VVV VV     V V  
   112  113 B A  E     +GH 103 122C   0  353    4   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
   113  114 B C  E     +GH 102 121C   5  353   10   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCCCCCCCCC C  C  CCC CC     C C  
   114  115 B G  E     +GH 101 120C   1  353    6   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   115  116 B G  E >  S-G   99   0C   0  353    0   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   116  117 B L  T 3  S+     0   0    1  353    1   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
   117  118 B D  T 3  S-     0   0   50  353    3   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   118  119 B N  S <  S+     0   0   30  353   21   N NNNN  NNN NNNNNNNNNNN NNNNNNN NNNNNNNNNNNNNN N  N  NNN NN     N N  
   119  120 B I  E     - I   0 139C  39  353   43   I IIII  III IIIIIIIIIII IIIIIII IIIIIIVIIIIIII I  I  III II     I I  
   120  121 B C  E     -HI 114 138C   0  353    7   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCCCCCCCCC C  C  CCC CC     C C  
   121  122 B S  E     -HI 113 137C   9  353   14   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   122  123 B I  E     -HI 112 136C   0  353    6   I IIII  III IIIIIIIIIII IIIIIII IIIIIIIIIIIIII I  I  III II     I I  
   123  124 B Y  E     -H  111   0C   3  353    4   Y YYYY  YYY YYYYYYYYYYY YYYYYYY YYYYYYYYYYYYYY Y  Y  YYY YY     Y Y  
   124  125 B N  E     +H  110   0C  24  353   45   N NNNN  NNN NNNNNNNNNNN NNNNNNN NNNNNNSNNNNNNN N  N  NNN NN     N N  
   125  126 B L        +     0   0   11  353   12   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
   126  127 B K  S    S+     0   0  109  353   60   N NRNN  SSN NNNNNSSRNNR NSNNNNN SNNNNSRNNSNNNS N  N  NNN NN     N N  
   127  128 B T  S    S-     0   0   64  353   71   q sSqq  AAs qqqqqAASqqS qAqqqqq AqqsqAgqqAqqqA q  s  ssq qq     q s  
   128  129 B R  S    S+     0   0  267  336   26   r rKrr  RRr rrrrrRRRrrR rRrrrrr RrrrrRprrRrrrR r  r  rrr rr     r r  
   129  130 B E  S    S-     0   0  173  340   28   E DEED  EED DDDDDEEEDDE DEDDDDD EDDDEEGDDEDDDE D  D  DDD DD     D D  
   130  131 B G        -     0   0   50  351   25   G GgGG  GGG GGGGGGGVGGQ GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   131  132 B N        +     0   0   30  349   59   P PgPP  PPP PPPPPPPPPPP PPPPPPP PPPPPPQPPPPPPP P  P  PPP PP     P P  
   132  133 B V  S    S+     0   0   58  329   58   T TvTT  TTT TTTTTTTITTI TTTTTTT TTTTTTVTTTTTTT T  T  TTT TT     T T  
   133  134 B R  S    S-     0   0  213  347   44   R RKRR  RRR RRRRRRRRRRR RRRRRRR RRRRRRKRRRRRRR R  R  RRK RR     R R  
   134  135 B V        -     0   0   29  352   27   V VGVV  VVV VVVVVVVVVVV VVVVVVV VVVVVVVVVVVVVV V  V  VVV VV     V V  
   135  136 B S  S    S-     0   0   43  352   59   A AAAA  AAA AAAAAAACAAC AAAAAAA AAAAAAAAAAAAAA A  Y  YYA AA     A Y  
   136  137 B R  E     -I  122   0C 105  344   18   R RRRR  RRR RRRRRRRRRRR RRRRRRR RRRRRRRRRRRRRR R  R  RRR RR     R R  
   137  138 B E  E     -I  121   0C  75  346   40   E EEEE  EEE EEEEEEEEEEE EEEEEEE EEEEEEEEEEEEEE E  E  EEE EE     E E  
   138  139 B L  E     +I  120   0C   1  349    5   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
   139  140 B A  E     +I  119   0C  61  351   61   S SSSS  SSS SSSSSSSNSSN SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   140  141 B G        +     0   0   50  351   27   G GAGG  GGG GGGGGGGSGGS GGGGGGG GGGGGGAGGGGGGG G  G  GGG GG     G G  
   141  142 B H        -     0   0    9  352    8   H HHHH  HHH HHHHHHHHHHH HHHHHHH HHHHHHHHHHHHHH H  H  HHH HH     H H  
   142  143 B T  S    S+     0   0   64  352   62   A SSAA  SSS AAAAASSTAAT ASAAAAA SAASASSAASAAAS A  A  AAA AA     A A  
   143  144 B G  S    S-     0   0    0  352    8   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   144  145 B Y        -     0   0    0  352    1   Y YYYY  YYY YYYYYYYYYYY YYYYYYY YYYYYYYYYYYYYY Y  Y  YYY YY     Y Y  
   145  146 B L  E     +J  160   0D   0  352   18   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
   146  147 B S  E     -     0   0D   3  352    1   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   147  148 B C  E     -J  159   0D   9  353   29   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCCCCCCCCC C  C  CCC CC     C C  
   148  149 B C  E     -J  158   0D   0  353    6   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCCCCCCCCC C  C  CCC CC     C C  
   149  150 B R  E     -J  157   0D  53  353   33   R RRRR  RRR RRRRRRRRRRR RRRRRRR RRRRRRRRRRRRRR R  R  RRR RR     R R  
   150  151 B F  E     -J  156   0D  10  353    2   F FFFF  FFF FFFFFFFFFFF FFFFFFF FFFFFFFFFFFFFF F  F  FFF FF     F F  
   151  152 B L  S    S-     0   0   26  353   35   I IIII  III IIIIIIILIIL IIIIIII IIIIIIIIIIIIII I  I  III II     I I  
   152  153 B D  S    S-     0   0   60  353   56   N NNNN  NNN NNNNNSSNNNN NSNNNNN SNNNNSNNNSNNNS N  N  NNN NN     N N  
   153  154 B D  S    S+     0   0   60  353   13   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   154  155 B N  S    S+     0   0   44  353   76   R RRRR  RRR RRRRRKKRRRR RKRRRRR KRRRRKRRRKRRRK R  R  RRR RR     R R  
   155  156 B Q  E     + K   0 169D  60  353   66   S SQSS  RRS SSSSSRRQSSQ SRSSSSS RSSSSRQSSRSSSR S  S  SSS TS     S S  
   156  157 B I  E     -JK 150 168D   0  354   13   I IIII  III IIIIIIIIIII IIIIIII IIIIIIIIIIIIII I  I  III II     I I  
   157  158 B V  E     -JK 149 167D   0  354   27   L LVLL  LLL LLLLLLLILLV LLLLLLL LLLLLLVLLLLLLL L  L  LLI IL     L L  
   158  159 B T  E     -JK 148 166D   0  353    0   T TTTT  TTT TTTTTTTTTTT TTTTTTT TTTTTTTTTTTTTT T  T  TTT TT     T T  
   159  160 B S  E     -JK 147 165D   0  352   19   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   160  161 B S  E >   -J  145   0D   0  352    0   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   161  162 B G  T 3  S+     0   0    0  352    0   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   162  163 B D  T 3  S-     0   0    5  352    0   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   163  164 B T  S <  S+     0   0    8  353   76   M MMMM  MMM MMMMMMMMMMM MMMMMMM MMMMMMMMMMMMMM M  M  MMM MM     M M  
   164  165 B T        -     0   0    2  353   17   T TTTT  TTT TTTTTTTSTTT TTTTTTT TTTTTTTTTTTTTT T  T  TTT TT     T T  
   165  166 B C  E     -KL 159 179D   0  352    1   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCCCCCCCCC C  C  CCC CC     C C  
   166  167 B A  E     -KL 158 178D   0  353   70   M MMMM  VVM MMMMMVVIMMI MVMIMMM VMMMMVMMMVMMMV M  M  MMM MM     M M  
   167  168 B L  E     -KL 157 177D   6  353   29   K KLKK  LLK KKKRRLLLKKL KLKKKKK LKKKKLLKKLKKKL K  K  KKK KK     K K  
   168  169 B W  E     -KL 156 175D   2  353    0   W WWWW  WWW WWWWWWWWWWW WWWWWWW WWWWWWWWWWWWWW W  W  WWW WW     W W  
   169  170 B D  E >>> -KL 155 174D  37  353    1   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   170  171 B I  T 345S+     0   0    7  353   13   I VIII  IIV IIIIILLIIIV ILIIIII LIIVILIIILIIIL I  I  III II     I I  
   171  172 B E  T 345S+     0   0  144  353   32   E EEEE  EEE EEEEEEEEEEE EEEEEEE EEEEEEEEEEEEEE E  E  EEE EE     E E  
   172  173 B T  T <45S-     0   0   78  353   40   T TATT  TTT TTTTTTTNTTN TTTTTTT TTTTTTQTTTTTTT T  T  TTT TT     T T  
   173  174 B G  T  <5 +     0   0   16  353   12   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   174  175 B Q  E   < -L  169   0D 135  353   74   Q SVQQ  QQS TQQQQSSTQQT QSTQQQT STTSQSTQQSTTQS T  T  TTT ST     T T  
   175  176 B Q  E     -L  168   0D  30  353   58   K KRKK  KKK KKKKKKKKKKK KKKRKKK KKKKKKRKKKKRKK K  K  KKK KK     K K  
   176  177 B T  E     +     0   0D  64  353   70   V VVVV  IIV VVVVVVVIVVI VVVIVVV VVVVVVTVVVVVVV V  V  VVV VV     V V  
   177  178 B T  E     -L  167   0D  20  353   63   T TMTT  TTT VTTTTHHTTTT THITTTI HIMTIHMTTHIVTH I  V  VVV VI     M V  
   178  179 B T  E     -L  166   0D   5  354   78   E EEEE  EEE EEEEEEEEEEE EEEEEEE EEEEEEEEEEEEEE E  E  EEE EE     E E  
   179  180 B F  E     +L  165   0D   1  354    0   F FFFF  FFF FFFFFFFFFFF FFFFFFF FFFFFFFFFFFFFF F  F  FFF FF     F F  
   180  181 B T        +     0   0   34  354   73   A ASAA  AAA AAAAAAASAAS AAAAAAA AAAAAANAAAAAAA A  A  AAA AA     A A  
   181  182 B G        +     0   0   37  354   33   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   182  183 B H        -     0   0    7  354    0   H HHHH  HHH HHHHHHHHHHH HHHHHHH HHHHHHHHHHHHHH H  H  HHH HH     H H  
   183  184 B T  S    S+     0   0   99  354   69   L LTLL  LLL LLLLLLLNLLN LLLLLLL LLLLLLTLLLLLLL L  L  LLL LL     L L  
   184  185 B G  S    S-     0   0    0  354   17   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   185  186 B D        -     0   0    1  354    0   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   186  187 B V  E     -M  202   0E   0  354   18   V VVVV  VVV VVVVVVVVVVV VVVVVVV VVVVVVVVVVVVVV V  V  VVV VV     V V  
   187  188 B M  E     +     0   0E   3  354   11   M MMMM  MMM MVMMMMMMMMM MMMMMMM MMMMMMMMMMMMMM M  M  MMM MM     M M  
   188  189 B S  E     -M  201   0E  16  354   17   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSCSSSSSSS S  S  SSS SS     S S  
   189  190 B L  E     -M  200   0E   3  354   28   I ILII  LLI IIIIILLVIIV ILIIIII LIIIILIIILIIIL I  I  III II     I I  
   190  191 B S  E     -M  199   0E  21  354   23   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   191  192 B L  E     -M  198   0E  29  354   32   L ILLL  III LLLLLIIILLV LILLLLL ILLILILLLILLLI L  L  LLL LL     L L  
   192  193 B A    >   -     0   0    4  354   63   N NGNN  NNN NNNNNNNSNNS NNNNNNN NNNNNNANNNDNNN N  N  NNN NN     N N  
   193  194 B P  T 3  S+     0   0   85  354   30   P PPPP  PPP PPPPPPPPPPP PPPPPPP PPPPPPPPPPPPPP P  P  PPP PP     P P  
   194  195 B D  T 3  S-     0   0   87  354   71   T TNTT  LLT TTTTTLLDTTD TLTTTTT LTTTTLNTTLTTTL T  T  TTT TT     T T  
   195  196 B T  S <  S+     0   0   62  354   89   N NQNN  DDN NNNNNDDKNNK NDNNNNN DNNNNDANNDNNND N  N  NNN NN     N N  
   196  197 B R  S    S+     0   0  142  355   76   s qNss  nnq qqqqqhnNqqN qhqqqqq hqqqshNqqhqqqh q  q  qqq qq     q q  
   197  198 B L  E     - N   0 211E  37  351   70   t tVtt  qqt tttttqqYttY tqttttt qttttqLttqtttq t  t  ttt tt     t t  
   198  199 B F  E     -MN 191 210E   0  351    0   F FFFF  FFF FFFFFFFFFFF FFFFFFF FFFFFFFFFFFFFF F  F  FFF FF     F F  
   199  200 B V  E     -MN 190 209E   0  352   12   I VVII  VVV IIIIIVVIIII IVIIIII VIIVIVVIIVIIIV I  V  VVI II     I V  
   200  201 B S  E     -MN 189 208E   0  353    3   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   201  202 B G  E     +MN 188 207E   0  355    3   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   202  203 B A  E >   -M  186   0E   0  354   31   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
   203  204 B C  T 3  S+     0   0    5  354    7   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCCCCCCCCC C  C  CCC CC     C C  
   204  205 B D  T 3  S-     0   0   31  354    0   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   205  206 B A  S <  S+     0   0   20  354   39   A AAAA  AAA AAAAAAAAAAA AASAAAS ASAAAAAAAASAAA A  S  SSA AS     A S  
   206  207 B S  E     - O   0 222E   6  354   82   F FTFF  FFF FFFFFFFTFFT FFFFFFF FFFFFFTFFFFFFF F  F  FFF FF     F F  
   207  208 B A  E     -NO 201 221E   0  354   28   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
   208  209 B K  E     -NO 200 220E  18  354   20   K KKKK  KKK KKKKKKKKKKK KKKKKKK KKKKKKKKKKKKKK K  K  KKK KK     K K  
   209  210 B L  E     -NO 199 219E   2  354   11   L LLLL  LLL LMLLLLLLLLL LLLLLLL LLLLLLVLLLLLLL L  L  LLL LL     L L  
   210  211 B W  E     -NO 198 217E   1  354    0   W WWWW  WWW WWWWWWWWWWW WWWWWWW WWWWWWWWWWWWWW W  W  WWW WW     W W  
   211  212 B D  E >>> -NO 197 216E  11  354    0   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   212  213 B V  T 345S+     0   0   12  354   39   I VIII  IIV IIIIIIIIIIL IIIIIII IIIIIIIIIIIIII I  I  III II     I I  
   213  214 B R  T 345S+     0   0  194  354    0   R RRRR  RRR RRRRRRRRRRR RRRRRRR RRRRRRRRRRRRRR R  R  RRR RR     R R  
   214  215 B E  T <45S-     0   0  111  353   69   A ASAA  QQA AAAAAQQAAAS AQAAAAA QAAAAQTAAQAAAQ A  A  AAA AA     A A  
   215  216 B G  T  <5 +     0   0    8  354   39   G GGGG  QQG GGGGGQQGGGG GQGGGGG QGGGGQGGGQGGGQ G  G  GGG GG     G G  
   216  217 B M  E      -     0   0    1  353    5   F FFFF  FFF FFFFFFFFFFF FFFFFFF FFFFFFFFFFFFFF F  F  FFF FF     F F  
   235  236 B P  T 3  S+     0   0   45  353    4   P PPPP  PPP PPPPPPPPPPP PPPPPPP PPPPPPPPPPPPPP P  P  PPP PP     P P  
   236  237 B N  T 3  S-     0   0   42  353   42   D DNDD  NND DDDDDNNNDDN DNDDDDD NDDDDNNDDNDDDN D  D  DDD DD     D D  
   237  238 B G  S <  S+     0   0   12  353    5   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   238  239 B N  S    S+     0   0   56  353   67   H HDHH  NNH HHHHHNNLHHL HNHHHHH NHHHHNDHHNHHHN H  H  HHH HH     H H  
   239  240 B A  E     - Q   0 253F   0  353   48   S SASS  AAS SSSSSAASSSS SASSSSS ASSSSAASSASSSA S  S  SSS SS     S S  
   240  241 B F  E     -PQ 233 252F   0  353   14   F FFFF  FFF FFFFFFFFFFF FFFFFFF FFFFFFFFFFFFFF F  F  FFF FF     F F  
   241  242 B A  E     -PQ 232 251F   0  353   59   V VAVV  GGV VVVVVGGGVVG VGVVVVV GVVVVGAVVGVVVG V  V  VVV VV     V V  
   242  243 B T  E     -PQ 231 250F   0  353    6   T TTTT  TTT TTTTTTTTTTT TTTTTTT TTTTTTTTTTTTTT T  T  TTT TT     T T  
   243  244 B G  E     +PQ 230 249F   0  353    0   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   244  245 B S  E >   -P  228   0F   0  353    0   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   245  246 B D  T 3  S+     0   0   13  353    2   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   246  247 B D  T 3  S-     0   0   28  353    0   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   247  248 B A  S <  S+     0   0    6  353   38   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
   248  249 B T        -     0   0   16  353   41   T TSTT  SST TTTTTSSSTTS TSTTTTT STTTTSSTTSTTTS T  T  TTT TT     T T  
   249  250 B C  E     -QR 243 263F   0  353   12   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCCCCCCCCC C  C  CCC CC     C C  
   250  251 B R  E     -QR 242 262F  23  353    7   R RRRR  RRR RRRRRRRRRRR RRRRRRR RRRRRRKRRRRRRR R  R  RRR RR     R R  
   251  252 B L  E     -QR 241 261F   0  353    1   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
   252  253 B F  E     -QR 240 259F   1  352    1   F FFFF  FFF FFFFFFFFFFF FFFFFFF FFFFFFFFFFFFFF F  F  FFF FF     F F  
   253  254 B D  E  >> -QR 239 258F   1  352    0   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   254  255 B L  T >45S+     0   0   15  352   28   I IIII  III IIIIIIIIIII IIIIIII IIIIIILIIIIIII I  I  III II     I I  
   255  256 B R  T 345S+     0   0   57  352    1   R RRRR  RRR RRRRRRRRRRR RRRRRRR RRRRRRRRRRRRRR R  R  RRR RR     R R  
   256  257 B A  T 345S-     0   0    0  352   29   A AAAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
   257  258 B D  T <<5 +     0   0    0  352   23   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   258  259 B Q  E      -     0   0  119  354   72   S HHSS  IIH SSSSSIIHSSH SISSSSS ISSSSIHSSISSSI S  S  SSS SS     S S  
   266  267 B D  T 3  S+     0   0  161  354   42   E EDEE  GGE EEEEEPPDEED EPEEEEE PEEEEPDEEPEEEP E  E  EEE EE     E E  
   267  268 B N  T 3  S+     0   0   66  354   66   S SHSS  EES SSSSSEEVSSN SESSSSS ESSASENSSESSSE S  S  SSS SS     T S  
   268  269 B I    <   +     0   0   23  354   48   I IIII  PPI IIIIIPPIIII IPIIIII PIIIIPIIIPIIIP I  I  III II     I I  
   269  270 B I        +     0   0   97  354   54   L LLLL  VVL LLLLLVVLLLL LVLLLLL VLLLLVLLLVLLLV L  L  LLL LL     L L  
   270  271 B C  S    S-     0   0   10  354   48   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCCCCCCCCC C  C  CCC CC     C C  
   271  272 B G        -     0   0    1  355   28   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   272  273 B I  E     +S  288   0G   0  355   15   I IIII  III IIIIIIIIIII IIIIIII IIIIIIIIIIIIII I  I  III II     I I  
   273  274 B T  E     +     0   0G  13  355   15   T TTTT  TTT TTTTTTTTTTT TTTTTTT TTTTTTTTTTTTTT T  T  TTT TT     T T  
   274  275 B S  E     +S  287   0G  18  355    1   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   275  276 B V  E     +S  286   0G  10  355   16   V VVVV  VVV VVVVVVVVVVV VVVVVVV VVVVVVVVVVVVVV V  V  VVV VV     V V  
   276  277 B S  E     -S  285   0G  15  354   25   A AAAA  AAA AAAAAAAAAAG AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
   277  278 B F  E     -S  284   0G  12  354   30   T CFTT  FFC TTTTTFFFTTF TFTTTTT FTTTTFFTTFTTTF T  T  TTT TT     T T  
   278  279 B S        -     0   0    3  354    4   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   279  280 B K  S    S+     0   0  104  354   81   V VIVV  VVV VVVVVVVLVVF VVVVVVV VVVVVVIVVVVVVV V  V  VVV VV     V V  
   280  281 B S  S    S-     0   0    2  354    3   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   281  282 B G  S    S+     0   0    0  354    1   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   282  283 B R        +     0   0    8  354    0   R RRRR  RRR RRRRRRRRRRR RRRRRRR RRRRRRRRRRRRRR R  R  RRR RR     R R  
   283  284 B L  E     - T   0 297G   0  354   11   L LLLL  LLL LLLLLLLFLLF LLLLLLL LLLLLLVLLLLLLL L  L  LLL LL     L L  
   284  285 B L  E     -ST 277 296G   0  354    5   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
   285  286 B L  E     -ST 276 295G   0  354   15   F FFFF  FFF FFFFFFFFFFF FFFFFFF FFFFFFFFFFFFFF F  F  FFF FF     F F  
   286  287 B A  E     -ST 275 294G   0  355   18   A AGAA  AAA AAAAAAAAAAA AAAAAAA AAAAAAAAAAAAAA A  A  AAA AA     A A  
   287  288 B G  E     -ST 274 293G   2  355   11   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   288  289 B Y  E >   -S  272   0G   4  355    1   Y YYYY  YYY YYYYYYYYYYY YYYYYYY YYYYYYYYYYYYYY Y  Y  YYY YY     Y Y  
   289  290 B D  T 3  S+     0   0    3  355   34   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   290  291 B D  T 3  S-     0   0   37  355   17   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   291  292 B F  S <  S+     0   0    3  355   44   F FWFF  FFF FFFFFFFFFFF FFFYFFF FFFFFFYFFFFFFF F  F  FFF FF     F F  
   292  293 B N        -     0   0   15  355   49   E ETEE  EEE EEEEEEESEET EEEEEEE EEEEEENEEEEEEE E  E  EEE EE     E E  
   293  294 B C  E     -TU 287 307G   0  355   10   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCCCCCCCCC C  C  CCC CC     C C  
   294  295 B N  E     -TU 286 306G   5  355   74   K KNKK  KKK KKKKKKKNKKN KKKKKKK KKKKKKNKKKKKKK K  K  KKK KK     K K  
   295  296 B V  E     -TU 285 305G   0  355   16   V VVVV  VVV VVVVVVVVVVV VVVVVVV VVVVVVVVVVVVVV V  V  VVV VV     V V  
   296  297 B W  E     -TU 284 303G   6  355    0   W WWWW  WWW WWWWWWWWWWW WWWWWWW WWWWWWWWWWWWWW W  W  WWW WW     W W  
   297  298 B D  E  >  -T  283   0G   4  355    0   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   298  299 B A  T  4 S+     0   0    0  355   65   V ITVI  VVI VVIVVVVTIIT IVVVIII VVIIVVTIIVIVIV V  L  ILV VI     I L  
   299  300 B L  T  4 S+     0   0    0  355   27   T TLTT  LLT TTTTTLLLTTL TLTTTTT LTTTTLLTTLTTTL T  T  TTT TT     T T  
   300  301 B K  T  4 S-     0   0   29  355   53   R RKRR  RRR RRRRRRRKRRK RRRRRRR RRRRRRKRRRRRRR R  R  RRR RR     R R  
   301  302 B A  S  < S+     0   0   17  355   52   G AGGG  GGA GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  A  AAG GG     G A  
   302  303 B D  S    S-     0   0   95  355   52   E EEEE  EEE EEEEEEEEEEE EEEDEED EEEEEEEEEEDEEE E  E  EEE ED     E E  
   303  304 B R  E     -U  296   0G  69  354   61   K KRKK  RRK KKKKKRRRKKR KRKKKKK RKKKKRRKKRKKKR K  K  KKK KK     K K  
   304  305 B A  E     -     0   0G  14  355   63   V VVVV  VIV VVVVVVVVVVV VVVVVVV VVVVVVIVVVVVVV V  V  VVV VV     V V  
   305  306 B G  E     -U  295   0G   4  355   27   G GGGG  GGG GGGGGGGVGGL GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   306  307 B V  E >   -U  294   0G   7  355   69   S SVSS  TTS SSSSSTTSSSS STSSSSS TSSSSTVSSTSSST S  S  SSS SS     S S  
   307  308 B L  E >  S+U  293   0G   2  350   36   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
   308  309 B A  G >  S-     0   0    4  351   70   V VTVV  QQV VVVVVQQTVVT VQVVVVV QVVVVQAVVQVVVQ V  V  VVV VV     V V  
   309  310 B G  G <   -     0   0    4  353   21   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   310  311 B H  G <  S+     0   0    8  353    0   H HHHH  HHH HHHHHHHHHHH HHHHHHH HHHHHHHHHHHHHH H  H  HHH HH     H H  
   311  312 B D    <   -     0   0   26  353   32   E DEEE  DDD EDEEEDDGEEG EDEEEEE DEEDEDEEEDEEED E  E  EEE EE     E E  
   312  313 B N  S    S+     0   0   31  353   16   N NNNN  NNN NNNNNNNNNNN NNNNNNN NNNNNNNNNNNNNN N  N  NNN NN     N N  
   313  314 B R        +     0   0   40  353    5   R RRRR  RRR RRRRRRRRRRR RRRRRRR RRRRRRRRRRRRRR R  R  RRR RR     R R  
   314  315 B V        +     0   0    2  353   10   V VVVV  VVV VVVVVVVVVVV VVVVVVV VVVVVVVVVVVVVV V  V  VVV VV     V V  
   315  316 B S  S    S-     0   0    2  353   10   S SSSS  SSS SSSSSSSSSSS SGSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   316  317 B C  E     -B  329   0A  10  353   17   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCCCCCCCCC C  C  CCC CC     C C  
   317  318 B L  E     -B  328   0A  15  353   13   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLMLLLLLLL L  L  LLL LL     L L  
   318  319 B G  E     -B  327   0A  10  353   13   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   319  320 B V  E     -B  326   0A  25  353   19   V VVVV  VVV VVVVVVVVVVV VVVVVVV VVVVVVVVVVVVVV V  V  VVV VV     V V  
   320  321 B T    >   -     0   0    3  353   52   S SSSS  SSS SSSSSSSSSSP SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   321  322 B D  T 3  S+     0   0   98  353   70   N NTNN  NNN NNNNNNNTNNT NNNNNNN NNNNNNGNNNNNNN N  N  NNN NN     N N  
   322  323 B D  T 3  S-     0   0   51  352    9   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   323  324 B G  S <  S+     0   0    0  352    4   G GGGG  AAG GGGGGAAGGGG GAGGGGG AGGGGAGGGAGGGA G  G  GGA AG     G G  
   324  325 B M  S    S+     0   0   36  350   62   I MMII  MMM IITIILLMTIM TLIVTTI LIIMILVTTLMITL I  I  III II     I I  
   325  326 B A        -     0   0    0  350   30   S SASS  SSS SSSSSSSASSA SSSSSSS SSSSSSASSSSSSS S  S  SSS SS     S S  
   326  327 B V  E     -BC 319 338A   0  350   33   L LLLL  LLL LLLLLLLLLLL LLLLLLL LLLLLLLLLLLLLL L  L  LLL LL     L L  
   327  328 B A  E     -BC 318 337A   0  349   47   C CCCC  CCC CCCCCCCCCCC CCCCCCC CCCCCCCCCCCCCC C  C  CCC CC     C C  
   328  329 B T  E     -BC 317 336A   7  349    4   T TTTT  TTT TTTTTTTTTTT TTTTTTT TTTTTTTTTTTTTT T  T  TTT TT     T T  
   329  330 B G  E     -BC 316 335A   1  349    4   G GGGG  GGG GGGGGGGGGGG GGGGGGG GGGGGGGGGGGGGG G  G  GGG GG     G G  
   330  331 B S    >   -     0   0    6  349    0   S SSSS  SSS SSSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSS SS     S S  
   331  332 B W  T 3  S+     0   0    6  349    0   W WWWW  WWW WWWWWWWWWWW WWWWWWW WWWWWWWWWWWWWW W  W  WWW WW     W W  
   332  333 B D  T 3  S-     0   0   17  349    0   D DDDD  DDD DDDDDDDDDDD DDDDDDD DDDDDDDDDDDDDD D  D  DDD DD     D D  
   333  334 B S  S <  S+     0   0   12  349   35   S SSSS  SSS ASSSSSSSSSS SSSSSSS SSSSSSSSSSSSSS S  S  SSA AS     A S  
   334  335 B F        -     0   0   78  349   71   L LTLL  MML FLLLLMMLLLL LMLLLLL MLVLLMLLLMLSLM L  L  LLF FL     V L  
   335  336 B L  E     -AC  50 329A   1  349    8   L LLLL  LLL LLLVVLLLLLL LLLLLLL LLLVLLLLLLLLLL L  L  LLL LL     L L  
   336  337 B K  E     -AC  49 328A  60  346   23   K KRKK  RRK KKKKKRRKKKK KRKKKKK RKKsKRKKKRKKKR K  K  KKK KK     K K  
   337  338 B I  E     -AC  48 327A   0  344   13   I LVII  VIL VIIIIIIIIVI IIIIIII IIImIIVIIIIIII I  V  VVV VI     V V  
   338  339 B W  E      AC  46 326A   2  341    0   W WWWW  WWW WWWWWWWWWWW WWWWWWW WWW WWWWWWWWWW W  W  WWW WW     W W  
   339  340 B N              0   0   10  297   57   A S AA  A S AAAAAAAAAAA AAAAAAA AAA AASAAAAAAA A  A  AAA AA     A A  
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   80    0                                  P                               P P   
   342    3 G V        +     0   0   96   82   63                                  A                               I I   
   343    4 G I        -     0   0   38   84   34                                  L                               I I   
   344    5 G N    >   -     0   0  109   84   59                                  H                               D D   
   345    6 G I  G >  S+     0   0   25   84   30                                  I                               V V   
   346    7 G E  G 3  S+     0   0  122  126   44          Q   Q                   E                QQ QQ   Q  QQQQE E  Q
   347    8 G D  G <  S+     0   0  133  137   21          E   D                   D              D DD DD   D  EEDEN N  D
   348    9 G L    <   -     0   0   35  141   15    L     L   M                   L              M LL LM   M  LLLLM M  L
   349   10 G T     >  -     0   0   69  141   62    T     S   T                   P              T SS ST   T  SSSST T  S
   350   11 G E  H  > S+     0   0  116  143   33    E     E   E                   E              E EE EE   E  EEEED D  E
   351   12 G K  H >> S+     0   0   66  152   41    K     K   K                   K              K KK KK   K  KKKKL L  K
   352   13 G D  H 3> S+     0   0   39  152   35    E     D   E                   E              E EE DD   E  EEEED D  D
   353   14 G K  H 3X S+     0   0   83  152   84    L     L   L                   K              L LL LL   L  LLLLK K  L
   354   15 G L  H < S+     0   0    7  233    6    E     E   E                   E              E EE EE   E  EEEEE E  E
   365   26 G V  H 3< S+     0   0   43  233   53    V     V   V                   V              V VV VV   V  VVVVV V  V
   366   27 G T  T 3< S+     0   0  116  233   82    K     K   K                   K              K KK KK   K  KKKKK K  K
   367   28 G L    <   -     0   0   49  233   61    N     N   N                   L              N NN NT   N  NNNNL L  N
   368   29 G E        -     0   0  191  233   49    E     P   E                   Q              E PP TE   E  PPPPE E  T
   369   30 G R        -     0   0   32  233    1    R     R   R                   R              R RR RR   R  RRRRR R  R
   370   31 G M        -     0   0   53  233   85    S     T   Q                   Q              Q DD II   Q  AADAA A  I
   371   32 G L     >  -     0   0   75  232   81    M     L   M                   .              M LP PM   M  LLLLK K  P
   372   33 G V  H  > S+     0   0    4  232   15    I     I   V                   .              V II VV   V  IIIIV V  I
   373   34 G S  H  > S+     0   0   14  232    1    S     S   S                   .              S SS SS   S  SSSSS S  S
   374   35 G K  H  > S+     0   0   93  232   38    K     K   K                   .              K KK KK   K  KKKKK K  K
   375   36 G C  H  X S+     0   0    0  233   62    T     T   T                   Q              T TT AS   T  TTTTC C  A
   376   37 G C  H  X S+     0   0    0  233   63    G     G   G                   A              G GG GI   A  GGGGC C  G
   377   38 G E  H  X S+     0   0   75  233   68    K     K   K                   K              K KK KP   K  KKKKE E  K
   378   39 G E  H  X S+     0   0   60  233   26    E     E   E                   E              E EE EE   E  EEEEE E  E
   379   40 G F  H  X S+     0   0    3  233   36    L     I   I                   I              L II II   L  IIIII I  I
   380   41 G R  H  X S+     0   0   53  233   79    K     K   K                   K              K KK KK   K  KKKKT T  K
   381   42 G D  H  X S+     0   0   67  233   65    D     D   E                   N              E DD ES   D  DDDDE E  E
   382   43 G Y  H  X S+     0   0   43  233    2    Y     Y   Y                   Y              Y YY YY   Y  YYYYY Y  Y
   383   44 G V  H >X S+     0   0    0  233   58    V     V   V                   I              I VV VI   I  VVVVI I  V
   384   45 G E  H 3X S+     0   0   71  233   47    E     E   E                   E              E EE EE   E  EEEEQ Q  E
   385   46 G E  H 3< S+     0   0  125  233   57    A     A   S                   E              S AA AS   S  AAAAG G  A
   386   47 G R  H XX S+     0   0   94  233   69    H     E   M                   R              M QQ QH   M  EEQEG G  Q
   387   48 G S  H >< S+     0   0   12  233   67    A     A   A                   S              A AS AM   A  AAAAA A  A
   388   49 G G  T 3< S+     0   0   38  233   80    G     G   G                   R              G GG GS   P  GGGGD D  G
   389   50 G E  T <4 S+     0   0  138  232   54    D     N   E                   E              E TT NE   E  NNTNE E  N
   390   51 G D    XX> -     0   0    1  232    0    D     D   D                   D              D DD DD   D  DDDDD D  D
   391   52 G P  H 3>5S+     0   0   17  233   25    P     P   P                   P              P PP PP   P  PPPPP P  P
   392   53 G L  H 345S+     0   0    6  233    3    L     L   L                   L              L LL FL   F  LLLLL L  F
   393   54 G V  H <45S+     0   0   24  233   29    L     L   L                   V              L LL IV   L  LLLLV V  L
   394   55 G K  H  <5S-     0   0  149  233   80    K     K   K                   K              K KK KK   K  KKKKK K  K
   395   56 G G     << -     0   0   38  233   34    G     G   G                   G              G GG GG   G  GGGGG G  G
   396   57 G I        -     0   0   21  224   20    I     I   V                   I              V II IV   I  IIIII I  I
   397   58 G P    >>  -     0   0   80  233   11    P     P   P                   P              P PP PP   P  PPPPP P  P
   398   59 G E  T 34 S+     0   0   75  233   58    E     E   E                   E              E EE EE   E  EEEEE E  E
   399   60 G D  T 34 S+     0   0  151  233   61    D     D   D                   D              D DD DD   D  DDDDE E  D
   400   61 G K  T <4 S+     0   0  163  233   62    K     K   K                   K              K KK KK   K  KKKKK K  K
   401   62 G N     <  -     0   0    1  233    0    N     N   N                   N              N NN NN   N  NNNNN N  N
   402   63 G P  S    S+     0   0   36  224    0    P     P   P                   P              P PP PP   P  PPPPP P  P
   403   64 G F  S    S-     0   0    3  224    0    F     F   F                   F              F FF FF   F  FFFFF F  F
   404   65 G K              0   0  108  222   29    K     K   K                   K              K KK KK   K  KKKKK K  K
   405   66 G E              0   0  201  217    3    E     E   E                   E              E EE EE   E  EEEEE E  E
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   62   10         F                                                            F 
   408   14 P E        +     0   0  153  142   39         E                                                            E 
   409   15 P G  S    S+     0   0   38  144   37         G                                                            G 
   410   16 P Q  S    S-     0   0   94  148   90         Q                E                                           Q 
   411   17 P A        +     0   0    1  149   53         A                A                                           A 
   412   18 P S        +     0   0   28  149   71         T                I                                           T 
   413   19 P H  S    S+     0   0   42  151   57         H                H                                           H 
   414   20 P T  S  > S-     0   0    2  152   17  S      T                T                                           t 
   415   21 P G  H  > S-     0   0   10  164    2  G      G                G                                           w 
   416   22 P P  H  > S+     0   0   14  165    0  P      P                P                                           P 
   417   23 P K  H  > S+     0   0    6  165    0  K      K                K                                           N 
   418   24 P G  H  X S+     0   0    0  165    1  G      G                G                                           C 
   419   25 P V  H  X S+     0   0    0  165    0  V      V                V                                           V 
   420   26 P I  H  X S+     0   0    4  165   14  I      I                I                                           I 
   421   27 P N  H  X S+     0   0   48  165   42  N      N                N                                           N 
   422   28 P D  H  X S+     0   0   14  166    0  D      D                D                                           D 
   423   29 P W  H  X S+     0   0    6  166    0  W      W                W                                           W 
   424   30 P R  H  < S+     0   0   67  166   26  R      R                R                                           R 
   425   31 P K  H >X S+     0   0   67  166   36  K      K                K                                           K 
   426   32 P F  H >X>S+     0   0    1  166    1  F      F                F                                           F 
   427   33 P K  H 3<5S+     0   0   30  166    7  K      K                K                                           K 
   428   34 P L  H <45S+     0   0  139  161    1  L      L                L                                           L 
   429   35 P E  H <<5S+     0   0   86  161    9  E      E                E                                           Q 
   430   36 P S  T  <5       0   0   57  162   66  s      s                a                                           s 
   431   37 P E      <       0   0  118  167   66  r      r                r                                           r 
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  143   42  F      F                F                                           F 
   434   69 P S        +     0   0   52  144   64  C      S                S                                           C 
   435   70 P R        -     0   0  103  120   85  R      R                R                                           R 
   436   71 P K        +     0   0   22  123   12  K      K                K                                           K 
   437   72 P M  S    S-     0   0   12  124   13  M      M                M                                           M 
   438   73 P S     >  -     0   0   52  131   65  S      S                S                                           S 
   439   74 P V  H  > S+     0   0  107  130   53  M      M                M                                           M 
   440   75 P Q  H  > S+     0   0  133  130   52  Q      Q                Q                                           Q 
   441   76 P E  H  > S+     0   0   38  134   26  E      E                E                                           E 
   442   77 P Y  H  X S+     0   0   36  146   56  Y      Y                Y                                           Y 
   443   78 P E  H  < S+     0   0  111  154   61  E      E                E                                           E 
   444   79 P L  H >X S+     0   0   45  155   57  L      L                I                                           L 
   445   80 P I  H 3< S+     0   0   37  157   72  I      I                I                                           I 
   446   81 P H  T 3< S+     0   0  178  158   80  Q      H                N                                           H 
   447   82 P K  T <4 S+     0   0  140  157   65  D      D                D                                           A 
   448   83 P D     <  -     0   0   58  169   39  D      E                D                                           A 
   449   84 P K        -     0   0  205  149   80  K      Q                K                                           Q 
   450   85 P E        -     0   0   45  150   68  E      E                E                                           E 
   451   86 P D    >>  -     0   0   87  169   31  D      D                D                                           D 
   452   87 P E  H 3> S+     0   0  113  168   12  E      E                E                                           E 
   453   88 P N  H 3> S+     0   0   73  169   59  S      S                S                                           S 
   454   89 P C  H <> S+     0   0   32  170   72  C      C                C                                           C 
   455   90 P L  H  X S+     0   0    4  170    2  L      L                L                                           L 
   456   91 P R  H  X S+     0   0  131  170   63  Q      R                R                                           Q 
   457   92 P K  H  X S+     0   0  112  170   59  K      K                K                                           Q 
   458   93 P Y  H  X S+     0   0    7  170    5  Y      Y                Y                                           Y 
   459   94 P R  H  X S+     0   0   31  170   31  R      R                R                                           R 
   460   95 P R  H  X S+     0   0  130  170   43  K      K                K                                           K 
   461   96 P Q  H  X S+     0   0   96  170   30  R      R                R                                           R 
   462   97 P C  H  X S+     0   0   22  170   72  C      C                C                                           C 
   463   98 P M  H  X S+     0   0   33  170   11  M      M                M                                           M 
   464   99 P Q  H  X S+     0   0  115  170   54  Q      Q                Q                                           Q 
   465  100 P D  H  X S+     0   0   46  170   21  D      D                D                                           D 
   466  101 P M  H  X S+     0   0   23  170    2  M      M                M                                           M 
   467  102 P H  H  X S+     0   0   64  170   74  H      H                H                                           H 
   468  103 P Q  H  < S+     0   0  143  170   59  Q      Q                Q                                           Q 
   469  104 P K  H  < S+     0   0  140  170   55  R      R                R                                           R 
   470  105 P L  H  < S+     0   0   35  170   43  L      L                L                                           L 
   471  106 P S     <  -     0   0   75  170   79  S      S                S                                           S 
   472  107 P F        -     0   0   71  168   99  F      F                F                                           F 
   473  108 P G        -     0   0   36  168   51  G      G                G                                           G 
   474  109 P P        +     0   0   92  160   41  P      P                P                                           P 
   475  110 P R        +     0   0  177  165   61  K      R                K                                           K 
   476  111 P Y        +     0   0   51  166    5  Y      Y                Y                                           F 
   477  112 P G        +     0   0   12  170   61  G      G                G                                           G 
   478  113 P F  S    S-     0   0  151  170  103  Y      Y                F                                           F 
   479  114 P V  E     -v  532   0H  28  170   13  L      L                L                                           L 
   480  115 P Y  E     -v  533   0H  71  165   68  C      C                S                                           C 
   481  116 P E  E     -v  534   0H 108  170   41  E      E                E                                           E 
   482  117 P L        -     0   0   12  170   32  L      L                L                                           L 
   483  118 P E        +     0   0  134  170   74  Q      Q                Q                                           Q 
   484  119 P S  S >> S-     0   0   57  170   53  N      N                N                                           N 
   485  120 P G  H 3> S+     0   0   15  169   40  G      G                G                                           G 
   486  121 P E  H 3> S+     0   0  127  170   23  E      E                E                                           E 
   487  122 P Q  H <> S+     0   0   72  170   61  Q      Q                Q                                           Q 
   488  123 P F  H  X S+     0   0   26  170    1  F      F                F                                           F 
   489  124 P L  H  X S+     0   0   90  170    6  L      L                L                                           L 
   490  125 P E  H  X S+     0   0  103  170   41  E      E                E                                           E 
   491  126 P T  H  < S+     0   0   10  170   76  A      V                A                                           A 
   492  127 P I  H  < S+     0   0   17  170   12  I      I                V                                           V 
   493  128 P E  H  < S+     0   0  139  170   20  E      E                E                                           E 
   494  129 P K  S  < S+     0   0  172  170   35  K      K                K                                           K 
   495  130 P E  S    S-     0   0   38  166    5  E      E                E                                           E 
   496  131 P Q    >   -     0   0  116  170   66  R      R                R                                           H 
   497  132 P K  T 3  S+     0   0  156  170   34  K      K                K                                           K 
   498  133 P I  T 3  S+     0   0   68  170   87  T      T                T                                           T 
   499  134 P T    <   -     0   0   10  170   35  T      V                T                                           T 
   500  135 P T  E     -W  558   0H   7  169   62  T      M                T                                           T 
   501  136 P I  E     -Wx 557 531H   3  170   15  V      V                V                                           V 
   502  137 P V  E     -Wx 556 532H   0  170   35  I      I                I                                           I 
   503  138 P V  E     -Wx 555 533H   0  170   12  V      V                V                                           V 
   504  139 P H  E     -Wx 554 534H   0  170    6  H      H                H                                           H 
   505  140 P I  E     +Wx 553 535H   2  170    1  I      I                I                                           I 
   506  141 P Y  E     - x   0 536H   4  170    2  Y      Y                Y                                           Y 
   507  142 P E    >   -     0   0   45  170   26  E      E                E                                           E 
   508  143 P D  T 3  S+     0   0   95  170   51  D      D                D                                           D 
   509  144 P G  T 3  S+     0   0   66  170   48  G      G                D                                           G 
   510  145 P I  S X> S-     0   0   36  170   33  I      V                V                                           V 
   511  146 P K  T 34 S+     0   0  191  170   71  K      K                K                                           K 
   512  147 P G  T 3> S+     0   0   13  170   22  G      G                G                                           G 
   513  148 P C  H <> S+     0   0    0  170   35  C      C                C                                           C 
   514  149 P D  H  X S+     0   0   78  170   47  D      E                E                                           E 
   515  150 P A  H  > S+     0   0   44  170   50  A      A                P                                           A 
   516  151 P L  H  X S+     0   0    0  170   11  L      L                L                                           L 
   517  152 P N  H  X S+     0   0   19  170   16  N      N                N                                           N 
   518  153 P S  H  X S+     0   0   78  170   56  N      N                N                                           S 
   519  154 P S  H  X S+     0   0    6  170   35  S      S                S                                           S 
   520  155 P L  H  X S+     0   0    1  170   10  L      L                L                                           L 
   521  156 P I  H  X S+     0   0  105  170   85  T      T                T                                           T 
   522  157 P C  H  X S+     0   0   63  170   38  C      C                C                                           C 
   523  158 P L  H  X S+     0   0    0  170    4  L      L                L                                           L 
   524  159 P A  H  < S+     0   0    1  170    9  A      A                A                                           A 
   525  160 P A  H  < S+     0   0   61  170   67  A      A                A                                           A 
   526  161 P E  H  < S+     0   0   72  170   23  E      E                E                                           E 
   527  162 P Y    ><  +     0   0    5  170    2  Y      Y                Y                                           Y 
   528  163 P P  T 3  S+     0   0   28  170   29  A      S                S                                           P 
   529  164 P M  T 3  S+     0   0   26  170   86  T      T                T                                           T 
   530  165 P V  S <  S-     0   0    1  170    8  V      L                V                                           V 
   531  166 P K  E     - x   0 501H  37  170    2  K      R                K                                           K 
   532  167 P F  E     +vx 479 502H   0  170    1  F      F                F                                           F 
   533  168 P C  E     -vx 480 503H   0  170   18  C      C                C                                           C 
   534  169 P K  E     +vx 481 504H  51  170   37  K      K                K                                           K 
   535  170 P I  E     - x   0 505H   1  170   21  I      I                I                                           I 
   536  171 P K  E >>  - x   0 506H  52  170   72  K      K                K                                           K 
   537  172 P A  H >> S+     0   0   13  170   46  A      A                A                                           A 
   538  173 P S  H 34 S+     0   0   88  170   30  S      S                S                                           S 
   539  174 P N  H <4 S+     0   0   67  170   86  D      N                N                                           S 
   540  175 P T  H << S-     0   0   25  170   73  T      T                T                                           T 
   541  176 P G     <  +     0   0   66  169   22  G      G                G                                           G 
   542  177 P A    >   -     0   0   39  170   55  A      A                A                                           A 
   543  178 P G  T 3  S-     0   0   70  169   43  G      G                G                                           G 
   544  179 P D  T 3  S+     0   0  151  169   78  D      D                D                                           D 
   545  180 P R  S <  S+     0   0  167  169   58  R      R                R                                           R 
   546  181 P F  S    S+     0   0   35  169    0  F      F                F                                           F 
   547  182 P S    >>  -     0   0   34  169   70  S      S                S                                           S 
   548  183 P S  T 34 S+     0   0   86  169   84  D      A                T                                           S 
   549  184 P D  T 34 S+     0   0  126  169   66  E      D                D                                           E 
   550  185 P V  T <4 S+     0   0   20  169   65  V      V                V                                           V 
   551  186 P L     <  +     0   0    8  170   13  L      L                L                                           L 
   552  187 P P  S    S+     0   0    1  170    0  P      P                P                                           P 
   553  188 P T  E     -W  505   0H   1  170   42  T      T                T                                           S 
   554  189 P L  E     -WY 504 566H   0  170    2  L      L                L                                           L 
   555  190 P L  E     -WY 503 565H   4  170    9  L      L                L                                           L 
   556  191 P V  E     +WY 502 564H   0  170   19  V      V                V                                           V 
   557  192 P Y  E     +WY 501 562H  31  170    0  Y      Y                Y                                           Y 
   558  193 P K  E >  S-WY 500 561H  25  170   12  K      K                R                                           K 
   559  194 P G  T 3  S-     0   0   25  170   41  G      G                A                                           A 
   560  195 P G  T 3  S+     0   0   48  170   21  G      G                G                                           G 
   561  196 P E  E <   -Y  558   0H  38  170   36  E      E                E                                           E 
   562  197 P L  E     +Y  557   0H  34  170   12  L      L                L                                           L 
   563  198 P L  E     -     0   0H   2  170   20  L      L                V                                           L 
   564  199 P S  E     -Y  556   0H   4  170   30  S      S                S                                           S 
   565  200 P N  E     -Y  555   0H  41  170    0  N      N                N                                           N 
   566  201 P F  E >   -Y  554   0H   3  170    1  F      F                F                                           F 
   567  202 P I  T 3  S-     0   0   87  168   25  I      I                I                                           I 
   568  203 P S  T >  S-     0   0   11  168   71  S      N                S                                           S 
   569  204 P V  G X  S+     0   0    0  168   35  V      F                V                                           V 
   570  205 P T  G >  S+     0   0   17  168   36  S      T                T                                           S 
   571  206 P E  G <  S+     0   0  156  168   35  E      E                D                                           E 
   572  207 P Q  G <  S+     0   0   84  168   43  Q      Q                Q                                           Q 
   573  208 P L  S <  S-     0   0   31  168   11  F      F                F                                           F 
   574  209 P A    >   -     0   0   49  168   51  N      S                N                                           S 
   575  210 P E  T 3  S+     0   0  201  168   27  D      E                E                                           E 
   576  211 P E  T 3  S+     0   0  166  168   21  E      E                E                                           E 
   577  212 P F    <   -     0   0   17  168    0  F      F                F                                           F 
   578  213 P F    >>  -     0   0  146  168   24  F      Y                F                                           F 
   579  214 P T  H 3> S+     0   0   24  167   24  A      A                A                                           A 
   580  215 P G  H 3> S+     0   0   32  167   71  V      V                V                                           V 
   581  216 P D  H <> S+     0   0   57  167    4  D      D                D                                           D 
   582  217 P V  H  X S+     0   0    0  167   23  V      V                V                                           V 
   583  218 P E  H  X S+     0   0   32  167    8  E      E                E                                           E 
   584  219 P S  H  X S+     0   0   58  167   52  S      S                T                                           A 
   585  220 P F  H  < S+     0   0    2  168    2  F      F                F                                           F 
   586  221 P L  H ><>S+     0   0    0  168    0  L      L                L                                           L 
   587  222 P N  H ><5S+     0   0   61  168   82  N      H                N                                           N 
   588  223 P E  T 3<5S+     0   0   70  168   18  E      E                E                                           E 
   589  224 P Y  T < 5S-     0   0   20  165   47  Y      Y                Y                                           Y 
   590  225 P G  T < 5S+     0   0    6  165    6  G      G                G                                           G 
   591  226 P L      < +     0   0    2  165   18  L      L                L                                           L 
   592  227 P L  S    S-     0   0   10  161    8  L      L                L                                           L 
   593  228 P P        -     0   0   40  161   31  P      P                P                                           P 
   594  229 P E              0   0   94  159   17  E      E                E                                           E 
   595  230 P K              0   0  161  158   24  R      K                K                                           R 
## ALIGNMENTS  421 -  490
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....3....:....4....:....5....:....6....:....7....:....8....:....9
     1    2 B S              0   0  117  267   60               G   NA D   AAA  A         A                  A   GAEEAAAA
     2    3 B E     >  -     0   0  107  283   60            H  E   RE R   EEE  E         E                  D   DKRKKKKD
     3    4 B L  H  > S+     0   0   52  299   33            V  M   IM I   IMM  I      M  M                  A   AILIIIIV
     4    5 B D  H  > S+     0   0  104  300   57            E  E   AD V   DDD  D      E  D                  A   AIAAIIIA
     5    6 B Q  H  > S+     0   0  131  301   62            E  Q   AA S   AAA  A      S  A                  E   EQVAQQQE
     6    7 B L  H  X S+     0   0   27  302   65            L  M   AL A   LLL  L      L  L                  L   LTAATTTL
     7    8 B R  H  X S+     0   0  110  311   10            R  K   RK R   KKK  K      Q  K                  K   KRRRRRRK
     8    9 B Q  H  X S+     0   0  117  312   60            N  K   RK R   KKKQ K      R  K                  K   KKKRKKKR
     9   10 B E  H  X S+     0   0   78  313   13            E  E   EE E   EEEE E      E  E                  K   KEKEEEEK
    10   11 B A  H  X S+     0   0    1  313   25            A  A   AC A   CCCI C      N  C                  C   CIAAIIIC
    11   12 B E  H  X S+     0   0  121  315   21            E  E   DD D   DDDE D      Q  D                  E E EDEEDDDA
    12   13 B Q  H  X S+     0   0  111  323   73            N  G   VG L   SGAK S      Q  A                  S K SQATQQQQ
    13   14 B L  H  X S+     0   0   14  348    5            I  L   LL L   LLLL L      L  L                  L L LILLIIIL
    14   15 B K  H  X S+     0   0   99  348   37            K  K   KR K   RRRK R      L  R                  K R KKKKKKKK
    15   16 B N  H  X S+     0   0   33  348   56            K  T   EA E   TATT T      D  T                  E E EESEEEEE
    16   17 B Q  H  X S+     0   0   82  348   60            E  Q   RQ R   KQQA K      V  Q                  T T TEEKEEEK
    17   18 B I  H  X S+     0   0    7  348   18            I  I   II I   IIII I      I  I                  I I ITIITTTI
    18   19 B R  H  X S+     0   0  135  348   59            R  E   KE K   EEEK E      N  E                  E V ERARRRRE
    19   20 B D  H  X S+     0   0   85  349   72            D  A   QA Q   AAAA A      s  A                  K t KAkAAAAq
    20   21 B A  H  X S+     0   0   36  249   44            .  A   .A .   AAA. A      a  A                  T k TNd.NNNe
    21   22 B R  H >X S+     0   0   22  349   28            K  R   RR R   RRRK R      K  R                  R R RRKKRRRK
    22   23 B K  H 3< S+     0   0  136  350   43            R  K   KK K   KKKR N      R  K                  E K EEKREEEI
    23   24 B A  H 3< S+     0   0   79  350   64            l  A   eA e   AAAq A      D  A                  V K AADdAAAG
    24   25 B C  H << S+     0   0   19  306   94            l  A   lV l   VAAl V      .  A                  K . KK.lKKK.
    25   26 B A     <  +     0   0   46  309   60            K  H   SN A   NNND N      .  N                  A . SE.AEEEG
    26   27 B D        +     0   0   88  312    3            D  D   DD D   DDDD D      .  D                  D . DD.DDDDN
    27   28 B A        -     0   0   17  315   51            S  T   TG T   GTGG G      T  G                  G . GTCTTTTA
    28   29 B T    >>  -     0   0   59  315   41            S  D   TS T   STSG S      S  S                  G . GTSTTTTG
    29   30 B L  H 3> S+     0   0    0  317    9            L  M   LM L   MMMM M      L  M                  F . FMILMMMA
    30   31 B S  H 34 S+     0   0   38  323   90            S  A   KS K   STSA S      L  S                  Q Y QKQRKKKK
    31   32 B Q  H X4 S+     0   0  119  330   65            E  A   KA K   SAAA S      Q  A                  S H SKEAKKKP
    32   33 B I  H 3< S+     0   0   28  332   58            V  A   MA M   AAAH A      T  A                  A V AFAMFFFL
    33   34 B T  T >< S+     0   0    0  343   62            A  A   AS A   AAAQ A      T  A                  N Q NTAATTTP
    34   35 B N  T <  S+     0   0  129  351   77            A  A   ES Q   GNGA G      S  G                  A A ASAASSSA
    35   36 B N  T 3  S+     0   0  111  351   67            G  G   SG E   GGGP G      S  G                  S K SEQEEEEA
    36   37 B I  S <  S-     0   0   21  338   72            V  V   IV V   VVV. V      I  V                  . . SI.IIII.
    37   38 B D        -     0   0  138  345   57            D  A   EA D   AAA. A      E  A                  A . GPIDPPP.
    38   39 B P        -     0   0   89  348   62            A  P   PS T   SSSA S      S  S                  G D AGDPGGG.
    39   40 B V        -     0   0   23  350   41            I  A   LV L   VVVM V      L  V                  A I KILLIII.
    40   41 B G        -     0   0   54  353   52            G  P   PG P   GGGG G      H  G                  K P ASKPSSSP
    41   42 B R        -     0   0  115  354   44            R  R   RR R   RRRK R      N  R                  P S IRNRRRRK
    42   43 B I        +     0   0    8  354   63            V  V   lV l   VVVV F      Y  V                  i P lslIsssF
    43   44 B Q        -     0   0   54  340   61            Q  Q   .Q .   QQQA .      R  Q                  a P phpPhhh.
    44   45 B M        -     0   0   11  345   12            M  L   mL m   LLLL .      L  L                  p . PVlIVVV.
    45   46 B R        -     0   0   49  346   51            R  K   KK K   KKKK .      R  K                  K V KKKKKKK.
    46   47 B T  E     +A  338   0A  12  350   67            T  T   VL S   LLLC .      S  L                  C C CFAPFFF.
    47   48 B R  E     +     0   0A  56  355   56            R  R   KR K   RRRR G      R  R                  R R RKRRKKKR
    48   49 B R  E     -A  337   0A  60  355   15            R  K   RK R   KKKK R      R  K                  R R RRRRRRRR
    49   50 B T  E     -A  336   0A  30  355   27            T  T   NT T   TTNV R      V  N                  L V LGVTGGGL
    50   51 B L  E     -A  335   0A   0  355    2            L  L   LL L   LLLL S      L  L                  L L LLLLLLLL
    51   52 B R        +     0   0  159  355   41            R  K   KK R   KKKK R      T  K                  K K KRKKRRRK
    52   53 B G        +     0   0   20  355    0            G  G   GG G   GGGG G      G  G                  G G GGGGGGGG
    53   54 B H        -     0   0    4  355    0            H  H   HH H   HHHH H      H  H                  H H HHHHHHHH
    54   55 B L  S    S+     0   0  116  355   50            L  L   LL L   LLLF L      Y  L                  F C FIFLIIIF
    55   56 B A  S    S-     0   0    0  355   30            A  A   AA A   AAAA A      G  A                  G G GSGASSSG
    56   57 B K        -     0   0   15  355    0            K  K   KK K   KKKK K      K  K                  K K KKKKKKKK
    57   58 B I  E     -D   73   0B   0  355    9            I  I   II I   IIII I      I  I                  I I IIVIIIII
    58   59 B Y  E     -     0   0B   6  355   20            Y  Y   YY Y   YYYY Y      F  Y                  Y Y YYYYYYYY
    59   60 B A  E     -D   72   0B  13  355   32            A  A   AA A   AAAA A      S  A                  A A AAAAAAAA
    60   61 B M  E     -D   71   0B  15  355   10            M  M   MM M   MMML M      M  M                  M L MMMMMMMM
    61   62 B H  E     -D   70   0B  44  355   33            H  H   QH Q   HHHH H      H  H                  Q H QHHHHHHQ
    62   63 B W  E     -D   69   0B  11  355    0            W  W   WW W   WWWW W      W  W                  W W WWWWWWWW
    63   64 B G    >   -     0   0    3  355   54            G  C   SS S   SSSa S      A  s                  G S GASAAAAG
    64   65 B T  T 3  S+     0   0   75  355   66            T  T   SA N   AEAg A      A  s                  G T GSGQSSSG
    65   66 B D  T 3  S-     0   0   80  355   12            D  D   DD D   DDDE D      D  A                  D D DDDDDDDD
    66   67 B S  S <  S+     0   0    3  355   57            S  N   SS N   SSSr S      S  S                  S S SSNQSSSS
    67   68 B R  S    S+     0   0   94  355   47            R  R   QR Q   RRRr R      Q  Q                  S N STQRTTTT
    68   69 B L  E     + E   0  82B  31  355   87            H  L   HQ H   QQSH Q      H  X                  S R SHNHHHHS
    69   70 B L  E     -DE  62  81B   0  355   23            V  M   LM L   MMML M      L  X                  L L LLLLLLLL
    70   71 B L  E     -DE  61  80B   0  355    7            V  V   VV I   VVVV V      V  X                  V V VVVVVVVV
    71   72 B S  E     -DE  60  79B   0  354    2            S  S   SS S   SSSS S      S  X                  S S SSSSSSSS
    72   73 B A  E     -DE  59  78B   0  354    5            A  A   AA A   AAAA A      A  A                  A A AAAAAAAA
    73   74 B S  E >>  -DE  57  77B   0  354    2            S  S   SS S   SSSS S      S  S                  S S SSSSSSSS
    74   75 B Q  T 34 S+     0   0    1  355    1            Q  Q   QQ Q   QQQQ Q      Q  Q                  Q Q QQQQQQQQ
    75   76 B D  T 34 S-     0   0    9  355    0            D  D   DD D   DDDD D      D  D                  D D DDDDDDDD
    76   77 B G  T <4 S+     0   0    7  355    1            G  G   GG G   GGGG G      G  G                  G G GGGGGGGG
    77   78 B K  E  <  -EF  73  93B  52  355   34            K  K   KK K   KKKK K      K  K                  K K KLKKLLLK
    78   79 B L  E     -EF  72  92B   0  355    4            L  L   LL L   LLLL L      L  L                  L L LMLLMMML
    79   80 B I  E     -EF  71  91B   0  355    7            I  L   IL I   LLLI L      I  L                  I I ILIILLLI
    80   81 B I  E     -EF  70  90B   0  355   18            L  I   VI V   IIVV I      V  V                  V I VTIVTTTV
    81   82 B W  E     -EF  69  88B   0  355    0            W  W   WW W   WWWW W      W  W                  W W WWWWWWWW
    82   83 B D  E >>> -EF  68  87B  21  355   18            D  D   ND N   DDDN D      D  D                  N K NDNDDDDN
    83   84 B S  T 345S+     0   0    0  355   52            s  A   VC A   TTTG T      A  T                  A A AGGAGGGA
    84   85 B Y  T 345S+     0   0   57  354   48            .  H   YF Y   FFFL F      Y  F                  Q Q QQYYQQQQ
    85   86 B T  T <45S-     0   0   56  354    8            .  S   ST S   TTTT T      S  T                  T M TTTTTTTS
    86   87 B T  T  <5 +     0   0   43  354   36            .  G   TG T   GGGA G      S  G                  T Q TTTTTTTT
    87   88 B N  E   < -F   82   0B  99  354   38            .  N   NN N   NNNN N      A  N                  N Q NNNNNNNN
    88   89 B K  E     +F   81   0B  95  354    0            .  K   KK K   KKKK K      K  K                  K K KKKKKKKK
    89   90 B V  E    S+     0   0B  66  353   49            .  V   IL M   LLLV L      L  L                  I V IIVVIIIV
    90   91 B H  E     -F   80   0B  57  353   18            .  N   HI H   VVVH V      Y  V                  Q Q QHQHHHHQ
    91   92 B A  E     -F   79   0B  43  353    8            .  A   CA C   AAAA A      A  A                  A V ACAACCCS
    92   93 B I  E     -F   78   0B   0  353    3            .  V   IV I   VVVI V      I  V                  I I IIIIIIII
    93   94 B P  E     -F   77   0B  80  353   37            .  P   PP P   PPPP P      P  P                  P P PRPPRRRP
    94   95 B L        -     0   0   26  354    2            .  L   LL L   LLLL L      L  L                  L L LILLIIIL
    95   96 B R  S    S+     0   0  190  354   40            .  K   RK R   KKKR K      R  K                  R R RRRRRRRR
    96   97 B S        -     0   0   17  354   24            .  S   SS S   SSSS S      S  S                  S S SSSSSSSS
    97   98 B S  S    S+     0   0    6  354   36            .  S   AA A   AAAS A      S  A                  S S SSSSSSSS
    98   99 B W        +     0   0    2  354    3            .  W   WW W   WWWW W      W  W                  W W WWWWWWWW
    99  100 B V  E     -G  115   0C   4  354    1            .  V   VV V   VVVV V      V  V                  V V VVVVVVVV
   100  101 B M  E     +     0   0C   5  353    4            .  M   MM M   MMMM M      M  M                  M M MMMMMMMM
   101  102 B T  E     -G  114   0C   8  353   13            .  T   TS T   SSST S      T  S                  T T TTTTTTTT
   102  103 B C  E     -G  113   0C   0  353    9            .  C   TV T   VVVC V      C  V                  C C CCCCCCCC
   103  104 B A  E     -G  112   0C   0  353    8            .  S   AA A   AADA A      A  A                  A A AAAAAAAA
   104  105 B Y  E     -G  111   0C   9  353   10            .  Y   YF Y   FFFF F      Y  F                  F F FYFYYYYF
   105  106 B A    >   -     0   0    0  353   33            .  A   SA S   AAAS A      S  A                  E E EAEAAAAE
   106  107 B P  T 3  S+     0   0   64  353    8            .  P   PP P   PPPP P      P  P                  q p qPpPPPPq
   107  108 B S  T 3  S-     0   0   47  353   31            .  S   SS S   SSSS S      S  S                  q r qSqPSSSq
   108  109 B G  S <  S+     0   0    8  353   14            .  G   GG G   GGGG G      G  G                  R G RMGAMMMR
   109  110 B N  S    S+     0   0   50  353   43            .  N   QN Q   NNNG N      N  N                  N Q NKRTKKKN
   110  111 B Y  E     - H   0 124C  50  353   55            .  L   YL Y   LLLR L      Y  L                  M M MFFLFFFM
   111  112 B V  E     -GH 104 123C   0  353    5            .  V   VV V   VVVI V      V  V                  V V VVVLVVVV
   112  113 B A  E     +GH 103 122C   0  353    4            .  A   AA A   AAAA A      A  A                  A A AAAPAAAA
   113  114 B C  E     +GH 102 121C   5  353   10            .  S   CS C   SSSC S      A  S                  C C CCCACCCC
   114  115 B G  E     +GH 101 120C   1  353    6            .  G   GG G   GGGG G      G  G                  G G GGGAGGGG
   115  116 B G  E >  S-G   99   0C   0  353    0            .  G   GG G   GGGG G      G  G                  G G GGGAGGGG
   116  117 B L  T 3  S+     0   0    1  353    1            .  L   LL L   LLLL L      L  L                  L L LLLSLLLL
   117  118 B D  T 3  S-     0   0   50  353    3            .  D   DD D   DDDD D      D  D                  D D DDDTDDDD
   118  119 B N  S <  S+     0   0   30  353   21            .  N   NN N   NNNN N      N  N                  N N NNNINNNN
   119  120 B I  E     - I   0 139C  39  353   43            .  M   II I   IIIT I      V  I                  L R LILSIIIL
   120  121 B C  E     -HI 114 138C   0  353    7            .  C   CC C   CCCC C      C  C                  C C CVCAVVVC
   121  122 B S  E     -HI 113 137C   9  353   14            .  T   ST S   TTTS T      S  T                  S S SSSRSSSS
   122  123 B I  E     -HI 112 136C   0  353    6            .  V   IV V   VVVI V      I  V                  I I IIISIIII
   123  124 B Y  E     -H  111   0C   3  353    4            .  Y   YY Y   YYYY Y      F  Y                  F Y FYYTYYYF
   124  125 B N  E     +H  110   0C  24  353   45            .  N   NN N   NNNN N      E  N                  H H HSETSSSH
   125  126 B L        +     0   0   11  353   12            .  L   LI L   VIIV V      L  I                  L I LILSIIIL
   126  127 B K  S    S+     0   0  109  353   60            .  K   NK Q   KKKA K      A  K                  S S SAGAAAAS
   127  128 B T  S    S-     0   0   64  353   71            .  T   SA A   AAAa A      q  A                  Q Q QpQppppQ
   128  129 B R  S    S+     0   0  267  336   26            .  .   R. R   ...k .      n  .                  . . .s.wsss.
   129  130 B E  S    S-     0   0  173  340   28            .  .   D. D   ...D .      N  .                  . . .E.PEEE.
   130  131 B G        -     0   0   50  351   25            .  .   Ga G   aaaQ a      G  a                  A A ApsApppA
   131  132 B N        +     0   0   30  349   59            t  p   Pp P   pppP p      A  p                  q q qnvGnnnq
   132  133 B V  S    S+     0   0   58  329   58            n  i   N. N   ...I .      .  .                  m v m.MV...m
   133  134 B R  S    S-     0   0  213  347   44            K  K   RK R   KKKK K      .  K                  R R RNRRNNNR
   134  135 B V        -     0   0   29  352   27            V  T   PT P   TTTV T      V  T                  A P ATAVTTTA
   135  136 B S  S    S-     0   0   43  352   59            S  V   AL A   LLLQ L      K  L                  T A TTTVTTTT
   136  137 B R  E     -I  122   0C 105  344   18            .  K   RR R   RRRR R      R  R                  K R KAR.AAAK
   137  138 B E  E     -I  121   0C  75  346   40            .  E   EE E   EEEE E      E  E                  E E EEE.EEEE
   138  139 B L  E     +I  120   0C   1  349    5            L  L   LL L   LLLL L      L  L                  L L LLL.LLLL
   139  140 B A  E     +I  119   0C  61  351   61            Y  D   SD S   DDDA D      S  D                  A T AAA.AAAA
   140  141 B G        +     0   0   50  351   27            F  A   AA A   AAAG A      F  A                  A A AGA.GGGA
   141  142 B H        -     0   0    9  352    8            F  H   HH H   HHHH H      H  H                  H H HHH.HHHH
   142  143 B T  S    S+     0   0   64  352   62            L  T   VT V   TTTT T      T  T                  D D DVD.VVVD
   143  144 B G  S    S-     0   0    0  352    8            G  G   GG G   GGGG G      G  G                  G G GGG.GGGG
   144  145 B Y        -     0   0    0  352    1            Y  Y   YY Y   YYYY Y      F  Y                  Y Y YYY.YYYY
   145  146 B L  E     +J  160   0D   0  352   18            L  L   LL L   LLLL L      L  L                  L L LIL.IIIL
   146  147 B S  E     -     0   0D   3  352    1            S  S   SS S   SSSS S      S  S                  S S SSS.SSSS
   147  148 B C  E     -J  159   0D   9  353   29            C  C   CC C   CCCC C      C  C                  C C CCC.CCCC
   148  149 B C  E     -J  158   0D   0  353    6            C  C   CC C   CCCC C      C  C                  C C CMC.MMMC
   149  150 B R  E     -J  157   0D  53  353   33            R  R   RR R   RRRR R      R  R                  R R RRR.RRRR
   150  151 B F  E     -J  156   0D  10  353    2            F  F   FF F   FFFF F      F  F                  F F FYF.YYYF
   151  152 B L  S    S-     0   0   26  353   35            L  I   LL L   ILLL I      I  L                  I I VVV.VVVI
   152  153 B D  S    S-     0   0   60  353   56            D  S   DS D   SSSD S      N  S                  D D DDN.DDDD
   153  154 B D  S    S+     0   0   60  353   13            D  D   DD D   DDDE D      D  D                  E E EEQ.EEEE
   154  155 B N  S    S+     0   0   44  353   76            A  T   RT R   TSST T      R  S                  A S ANE.NNNH
   155  156 B Q  E     + K   0 169D  60  353   66            R  E   HE R   EEET E      Q  E                  S T NRS.RRRQ
   156  157 B I  E     -JK 150 168D   0  354   13            I  I   II I   IIIV I      I  I                  I I III.IIII
   157  158 B V  E     -JK 149 167D   0  354   27            V  V   LL L   LLLV I      L  L                  V V VLL.LLLV
   158  159 B T  E     -JK 148 166D   0  353    0            T  T   TT T   TTTT T      T  T                  T T TTT.TTTT
   159  160 B S  E     -JK 147 165D   0  352   19            S  S   SA S   AAAA A      S  A                  S S SSS.SSSS
   160  161 B S  E >   -J  145   0D   0  352    0            S  S   SS S   SSSS S      S  S                  S S SSS.SSSS
   161  162 B G  T 3  S+     0   0    0  352    0            G  G   GG G   GGGG G      G  G                  G G GGG.GGGG
   162  163 B D  T 3  S-     0   0    5  352    0            D  D   DD D   DDDD D      D  D                  D D DDD.DDDD
   163  164 B T  S <  S+     0   0    8  353   76            M  T   TT M   TTTM T      H  T                  S S SSS.SSSS
   164  165 B T        -     0   0    2  353   17            T  T   TT N   TTTT T      T  T                  N K NTT.TTTN
   165  166 B C  E     -KL 159 179D   0  352    1            C  C   CC C   CCCC C      C  C                  C C CCC.CCCC
   166  167 B A  E     -KL 158 178D   0  353   70            A  A   FC F   CCCM C      A  C                  I M ICI.CCCI
   167  168 B L  E     -KL 157 177D   6  353   29            L  L   LL L   LLLR L      L  L                  L L LLI.LLLL
   168  169 B W  E     -KL 156 175D   2  353    0            W  W   WW W   WWWW W      W  W                  W W WWW.WWWW
   169  170 B D  E >>> -KL 155 174D  37  353    1            D  D   DD D   DDDD D      D  D                  D D DDD.DDDD
   170  171 B I  T 345S+     0   0    7  353   13            I  L   IL I   LLLV L      I  L                  V I VVV.VVVI
   171  172 B E  T 345S+     0   0  144  353   32            E  E   DE D   EEEE E      E  E                  E E EEE.EEEE
   172  173 B T  T <45S-     0   0   78  353   40            T  T   AT A   TTTT T      R  T                  S R SQM.QQQS
   173  174 B G  T  <5 +     0   0   16  353   12            G  G   GG G   GGGG G      G  G                  G G GSG.SSSG
   174  175 B Q  E   < -L  169   0D 135  353   74            M  K   VK V   KKKQ K      Q  K                  E E EAV.AAAE
   175  176 B Q  E     -L  168   0D  30  353   58            Q  Q   KQ K   QQQQ Q      P  Q                  V V VKT.KKKV
   176  177 B T  E     +     0   0D  64  353   70            T  K   TK T   KKKQ K      I  K                  K K KIT.IIIK
   177  178 B T  E     -L  167   0D  20  353   63            T  T   HV H   ITIQ V      T  I                  T T TMA.MMMT
   178  179 B T  E     -L  166   0D   5  354   78            A  V   EI E   IVIQ I      V  I                  T T TDHEDDDT
   179  180 B F  E     +L  165   0D   1  354    0            F  F   FF F   FFFY F      F  F                  F F FFFFFFFF
   180  181 B T        +     0   0   34  354   73            T  L   TT N   TTTV T      K  T                  R R RKTNKKKR
   181  182 B G        +     0   0   37  354   33            G  N   DN D   NNND N      G  N                  E E EDDDDDDE
   182  183 B H        -     0   0    7  354    0            H  H   HH H   HHHH H      H  H                  H H HHHHHHHH
   183  184 B T  S    S+     0   0   99  354   69            T  I   QI Q   IIIQ I      A  I                  S A SQGSQQQS
   184  185 B G  S    S-     0   0    0  354   17            G  G   GG G   GGGG G      G  G                  G G GAGGAAAG
   185  186 B D        -     0   0    1  354    0            D  D   DD D   DDDD D      T  D                  D D DDDDDDDD
   186  187 B V  E     -M  202   0E   0  354   18            V  C   VC V   CCCV C      V  C                  V V VVVVVVVV
   187  188 B M  E     +     0   0E   3  354   11            M  M   MM M   MMMM M      T  M                  M M MMMMMMMM
   188  189 B S  E     -M  201   0E  16  354   17            S  C   SS S   SSSS S      G  S                  S A SCSSCCCS
   189  190 B L  E     -M  200   0E   3  354   28            L  L   VL V   LLLI L      I  L                  V V VVVLVVVV
   190  191 B S  E     -M  199   0E  21  354   23            S  S   SA S   AAAS A      S  A                  S S SSSSSSSS
   191  192 B L  E     -M  198   0E  29  354   32            V  L   IL I   LLLI L      L  L                  I L IVILVVVI
   192  193 B A    >   -     0   0    4  354   63            T  S   CS S   SSSA S      T  S                  N N NSLGSSSN
   193  194 B P  T 3  S+     0   0   85  354   30            E  P   PP A   PPPP P      P  P                  P P PPPPPPPA
   194  195 B D  T 3  S-     0   0   87  354   71            D  D   TD N   DDDR D      D  D                  H H HDSNDDDQ
   195  196 B T  S <  S+     0   0   62  354   89            K  N   DT D   MMMQ M      G  M                  N D NQVLQQQN
   196  197 B R  S    S+     0   0  142  355   76            N  N   pN p   NNNa N      Q  N                  p l pNdNNNNp
   197  198 B L  E     - N   0 211E  37  351   70            T  M   iT l   TMYl T      T  Y                  m m mTvTTTTm
   198  199 B F  E     -MN 191 210E   0  351    0            F  F   FF F   FFFF F      F  F                  F F FFFFFFFF
   199  200 B V  E     -MN 190 209E   0  352   12            I  I   VI V   IIIV V      V  I                  I V IVVVVVVI
   200  201 B S  E     -MN 189 208E   0  353    3            S  S   SS S   SSSS S      S  S                  S S SSSSSSSS
   201  202 B G  E     +MN 188 207E   0  355    3            G  G   GG G   GGGG G      G  G                  G G GGGGGGGG
   202  203 B A  E >   -M  186   0E   0  354   31            A  A   AA A   AAAA A      A  A                  S S SASAAAAS
   203  204 B C  T 3  S+     0   0    5  354    7            C  C   CC C   CCCC C      C  C                  C C CCCCCCCC
   204  205 B D  T 3  S-     0   0   31  354    0            D  D   DD D   DDDD D      D  D                  D D DDDDDDDD
   205  206 B A  S <  S+     0   0   20  354   39            A  S   SS S   SSSA S      A  S                  S A SSSASSSS
   206  207 B S  E     - O   0 222E   6  354   82            T  L   AL T   LLLT L      T  L                  T T TMLTMMMT
   207  208 B A  E     -NO 201 221E   0  354   28            A  A   AA A   AAAA A      A  A                  A A AAAAAAAA
   208  209 B K  E     -NO 200 220E  18  354   20            K  K   KK K   KKKK K      K  K                  K K KKKKKKKK
   209  210 B L  E     -NO 199 219E   2  354   11            L  L   IL I   LLLL L      L  L                  V V VLVVLLLV
   210  211 B W  E     -NO 198 217E   1  354    0            W  W   WW W   WWWW W      W  W                  W W WWWWWWWW
   211  212 B D  E >>> -NO 197 216E  11  354    0            D  D   DD D   DDDD D      D  D                  D D DDDDDDDD
   212  213 B V  T 345S+     0   0   12  354   39            L  I   IL I   LLVV L      L  V                  I L IIIVIIII
   213  214 B R  T 345S+     0   0  194  354    0            R  R   RR R   RRRA R      R  R                  R R RRRRRRRR
   214  215 B E  T <45S-     0   0  111  353   69            D  D   LE L   EEET E      D  E                  T T TMETMMMA
   215  216 B G  T  <5 +     0   0    8  354   39            G  G   KG K   GGGP G      G  G                  G G GEGGEEEG
   216  217 B M  E      -     0   0    1  353    5            F  L   FF F   FFFF F      F  F                  F F FHFFHHHF
   235  236 B P  T 3  S+     0   0   45  353    4            P  P   PP P   PPPP P      P  P                  P P PPPPPPPP
   236  237 B N  T 3  S-     0   0   42  353   42            N  S   SN S   SSSA S      N  S                  S S SSDNSSSN
   237  238 B G  S <  S+     0   0   12  353    5            N  A   GG G   GGGG G      G  G                  G G GGGGGGGG
   238  239 B N  S    S+     0   0   56  353   67            M  T   TN T   NNNN N      M  N                  N N NNKDNNNN
   239  240 B A  E     - Q   0 253F   0  353   48            A  A   AA A   AAAV A      A  A                  A A AAAAAAAA
   240  241 B F  E     -PQ 233 252F   0  353   14            F  F   II I   IVVF I      F  V                  L L LFFFFFFL
   241  242 B A  E     -PQ 232 251F   0  353   59            G  I   GI G   IIIG I      G  I                  G G GIGAIIIG
   242  243 B T  E     -PQ 231 250F   0  353    6            T  T   TT T   TTTT T      T  T                  T T TTTTTTTT
   243  244 B G  E     +PQ 230 249F   0  353    0            G  G   GG G   GGGG G      G  G                  G G GGGGGGGG
   244  245 B S  E >   -P  228   0F   0  353    0            S  S   SS S   SSSS S      S  S                  S S SSSSSSSS
   245  246 B D  T 3  S+     0   0   13  353    2            D  D   DD D   DDDD D      D  D                  D D DDDDDDDD
   246  247 B D  T 3  S-     0   0   28  353    0            D  D   DD D   DDDD D      D  D                  D D DDDDDDDD
   247  248 B A  S <  S+     0   0    6  353   38            A  C   AC A   CCCA C      G  C                  S S SFSAFFFS
   248  249 B T        -     0   0   16  353   41            T  T   SQ S   SSSS S      T  S                  S S SSSSSSSS
   249  250 B C  E     -QR 243 263F   0  353   12            C  C   CC C   CCCC C      C  C                  C C CCCCCCCC
   250  251 B R  E     -QR 242 262F  23  353    7            R  K   RK R   KKKR K      R  K                  R R RKRRKKKR
   251  252 B L  E     -QR 241 261F   0  353    1            L  M   LM L   MMML M      L  M                  L L LLLLLLLL
   252  253 B F  E     -QR 240 259F   1  352    1            F  Y   FY F   YYYY Y      F  Y                  F F FFFFFFFF
   253  254 B D  E  >> -QR 239 258F   1  352    0            D  D   DD D   DDDD D      D  D                  D D DDDDDDDD
   254  255 B L  T >45S+     0   0   15  352   28            I  I   LL L   LLLL L      I  L                  L L LIMLIIIL
   255  256 B R  T 345S+     0   0   57  352    1            R  R   RR R   RRRR R      R  R                  R R RRRRRRRR
   256  257 B A  T 345S-     0   0    0  352   29            S  A   AA A   SSAA S      A  A                  A A AACAAAAA
   257  258 B D  T <<5 +     0   0    0  352   23            D  D   DD D   DDDY D      D  D                  Y Y YDYDDDDY
   258  259 B Q  E      -     0   0  119  354   72            N  D   KD K   DDDH D      P  D                  N N NSNHSSSS
   266  267 B D  T 3  S+     0   0  161  354   42            D  S   ET E   TTSD T      A  S                  D D DEDDEEED
   267  268 B N  T 3  S+     0   0   66  354   66            N  A   DS D   SSSK S      E  S                  K K KSKNSSSK
   268  269 B I    <   +     0   0   23  354   48            I  L   VL L   LLLI L      E  L                  I I IMIVMMMI
   269  270 B I        +     0   0   97  354   54            A  N   LN L   NNNL N      G  N                  L L LQLLQQQL
   270  271 B C  S    S-     0   0   10  354   48            C  S   HA H   AAAC A      A  A                  C C CHCCHHHC
   271  272 B G        -     0   0    1  355   28            G  G   GG G   GGGG G      K  G                  G G GGGGGGGG
   272  273 B I  E     +S  288   0G   0  355   15            I  V   IV V   VVVI V      V  V                  I I IVIIVVVI
   273  274 B T  E     +     0   0G  13  355   15            T  T   TT T   TTTT T      F  T                  T T TTTTTTTT
   274  275 B S  E     +S  287   0G  18  355    1            S  S   SS S   SSSS S      S  S                  S S SSSSSSSS
   275  276 B V  E     +S  286   0G  10  355   16            V  V   VL I   VLLV V      V  L                  V V VVVVVVVV
   276  277 B S  E     -S  285   0G  15  354   25            A  A   AA D   AAAA A      G  A                  S S SAAAAAAA
   277  278 B F  E     -S  284   0G  12  354   30            F  L   FL F   LLLF L      F  L                  F F FIFFIIIF
   278  279 B S        -     0   0    3  354    4            S  S   SS S   SSSS S      G  S                  S S SSSSSSSS
   279  280 B K  S    S+     0   0  104  354   81            K  V   AS A   NNNY N      K  N                  K K KSRASSSK
   280  281 B S  S    S-     0   0    2  354    3            S  S   SS S   SSSS S      S  S                  S S STSSTTTS
   281  282 B G  S    S+     0   0    0  354    1            G  G   GG G   GGGG G      G  G                  G G GGGGGGGG
   282  283 B R        +     0   0    8  354    0            R  R   RR R   RRRR R      R  R                  R R RRRRRRRR
   283  284 B L  E     - T   0 297G   0  354   11            L  L   LL L   LLLF L      L  L                  F F FYLIYYYF
   284  285 B L  E     -ST 277 296G   0  354    5            F  I   LI L   IIIL I      L  I                  L L LLLLLLLL
   285  286 B L  E     -ST 276 295G   0  354   15            F  F   FF F   FFFF F      F  F                  F F FFFFFFFF
   286  287 B A  E     -ST 275 294G   0  355   18            A  A   GA G   AAAA A      A  A                  A A ACAACCCA
   287  288 B G  E     -ST 274 293G   2  355   11            G  G   GG G   GGGG G      G  G                  G G GGGGGGGG
   288  289 B Y  E >   -S  272   0G   4  355    1            Y  Y   YY Y   YYYY Y      C  Y                  Y Y YYYYYYYY
   289  290 B D  T 3  S+     0   0    3  355   34            D  D   DD D   DDDD D      E  D                  D D DDDDDDDD
   290  291 B D  T 3  S-     0   0   37  355   17            D  D   DD D   DDDD D      D  D                  D D DDDDDDDD
   291  292 B F  S <  S+     0   0    3  355   44            F  F   YF Y   FFFF F      F  F                  Y Y YLYFLLLY
   292  293 B N        -     0   0   15  355   49            N  N   SN S   NNNN N      N  N                  N N NGNNGGGN
   293  294 B C  E     -TU 287 307G   0  355   10            C  C   TC T   CCCC C      C  C                  C C CCCCCCCC
   294  295 B N  E     -TU 286 306G   5  355   74            N  N   HH Q   HHHY H      N  H                  Y Y YLYNLLLY
   295  296 B V  E     -TU 285 305G   0  355   16            I  I   VI V   IIIV I      V  I                  C C CWVVWWWC
   296  297 B W  E     -TU 284 303G   6  355    0            W  W   WW W   WWWW W      F  W                  W W WWWWWWWW
   297  298 B D  E  >  -T  283   0G   4  355    0            D  D   DD D   DDDD D      D  D                  D D DDDDDDDD
   298  299 B A  T  4 S+     0   0    0  355   65            A  S   TS T   SSST S      T  S                  V V VVVTVVVV
   299  300 B L  T  4 S+     0   0    0  355   27            M  L   LL L   LLLL L      L  L                  L L LLTLLLLL
   300  301 B K  T  4 S-     0   0   29  355   53            K  K   KK K   KKKT K      K  K                  s s sKnKKKKs
   301  302 B A  S  < S+     0   0   17  355   52            G  G   GG G   GGGG G      G  G                  g g gGgGGGGg
   302  303 B D  S    S-     0   0   95  355   52            D  E   EE E   EEEK E      E  E                  S M ADIEDDDQ
   303  304 B R  E     -U  296   0G  69  354   61            R  K   RK R   KKKQ K      H  K                  H H HYPRYYYH
   304  305 B A  E     -     0   0G  14  355   63            A  V   VV V   VVVI V      I  V                  I V IIAVIIIV
   305  306 B G  E     -U  295   0G   4  355   27            G  G   GG G   GGGG G      G  G                  Y Y YTYGTTTY
   306  307 B V  E >   -U  294   0G   7  355   69            V  V   IV V   VVVV V      V  V                  Q Q QKQVKKKQ
   307  308 B L  E >  S+U  293   0G   2  350   36            L  L   LL L   LLLL L      L  L                  L L LLLLLLLL
   308  309 B A  G >  S-     0   0    4  351   70            A  S   SS A   SSSA S      A  S                  A A ATAATTTA
   309  310 B G  G <   -     0   0    4  353   21            G  G   GG G   GGGG G      A  G                  G G GGGGGGGG
   310  311 B H  G <  S+     0   0    8  353    0            H  H   HH H   HHHH H      H  H                  H H HHHHHHHH
   311  312 B D    <   -     0   0   26  353   32            D  D   DD D   DDDD D      E  D                  E E EEEEEEEE
   312  313 B N  S    S+     0   0   31  353   16            N  N   NN N   NNNN N      N  N                  N N NNNNNNNN
   313  314 B R        +     0   0   40  353    5            R  R   RR R   RRRR R      R  R                  R R RRRRRRRR
   314  315 B V        +     0   0    2  353   10            V  V   VV V   VVVV V      V  V                  V V VVVVVVVV
   315  316 B S  S    S-     0   0    2  353   10            S  S   SS S   SSSS S      S  S                  S S SSSSSSSS
   316  317 B C  E     -B  329   0A  10  353   17            C  C   CC C   CCCC C      C  C                  C C CCCCCCCC
   317  318 B L  E     -B  328   0A  15  353   13            L  T   LT L   TTTL T      V  T                  L L LLLLLLLL
   318  319 B G  E     -B  327   0A  10  353   13            G  G   GG G   GGGG G      G  G                  G G GGGGGGGG
   319  320 B V  E     -B  326   0A  25  353   19            I  V   VV V   VVVV V      V  V                  V V VVVVVVVV
   320  321 B T    >   -     0   0    3  353   52            T  P   SP S   PPPS P      S  P                  N D NSNSSSSN
   321  322 B D  T 3  S+     0   0   98  353   70            V  G   NA K   EVES E      D  E                  P P PPPSPPPT
   322  323 B D  T 3  S-     0   0   51  352    9            D  D   DD D   DDDD D      D  D                  A K ADKDDDDS
   323  324 B G  S <  S+     0   0    0  352    4            G  G   GG G   GGGG G      G  G                  G G GGGGGGGG
   324  325 B M  S    S+     0   0   36  350   62            M  M   MM M   MMMQ M      M  M                  Q Q QYEMYYYQ
   325  326 B A        -     0   0    0  350   30            A  C   AG A   GGGA G      A  G                  A A AAAAAAAA
   326  327 B V  E     -BC 319 338A   0  350   33            V  V   LV L   VVVL V      L  V                  L L LLLLLLLL
   327  328 B A  E     -BC 318 337A   0  349   47            A  C   CC C   CCCC C      C  C                  C C CCCCCCCC
   328  329 B T  E     -BC 317 336A   7  349    4            T  T   TT T   TTTT T      T  T                  T T TTTTTTTT
   329  330 B G  E     -BC 316 335A   1  349    4            G  G   GG G   GGGG G      G  G                  G G GGGGGGGG
   330  331 B S    >   -     0   0    6  349    0            S  S   SS S   SSSS S      S  S                  S S SSSSSSSS
   331  332 B W  T 3  S+     0   0    6  349    0            W  W   WW W   WWWW W      W  W                  W W WWWWWWWW
   332  333 B D  T 3  S-     0   0   17  349    0            D  D   DD D   DDDD D      D  D                  D D DDDDDDDD
   333  334 B S  S <  S+     0   0   12  349   35            S  S   SS S   SSSS S      T  S                  T T TSTSSSST
   334  335 B F        -     0   0   78  349   71            F  F   LF L   FFFT F      T  F                  L L LTLMTTTL
   335  336 B L  E     -AC  50 329A   1  349    8            L  L   LL L   LLLL L      L  L                  L L LLLLLLLL
   336  337 B K  E     -AC  49 328A  60  346   23            K  K   KK K   KKKK K      R  K                  K K KRKKRRRK
   337  338 B I  E     -AC  48 327A   0  344   13            V  I   VL V   LLLV L      V  L                  I I IIIVIIII
   338  339 B W  E      AC  46 326A   2  341    0            W  W   WW W   WWWW W      W  W                  W W WWWWWWWW
   339  340 B N              0   0   10  297   57            N  N   AN A   NNNA N      T  N                  A A AAAAAAAA
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   80    0                                                                        
   342    3 G V        +     0   0   96   82   63                                                                        
   343    4 G I        -     0   0   38   84   34                                                                        
   344    5 G N    >   -     0   0  109   84   59                                                                        
   345    6 G I  G >  S+     0   0   25   84   30                                                                        
   346    7 G E  G 3  S+     0   0  122  126   44  Q QQQQQQQQ  Q QQQ           Q  QQQQ        Q                          
   347    8 G D  G <  S+     0   0  133  137   21  D DDDDDDDD  D DED      D    D  DDEED D   D D                          
   348    9 G L    <   -     0   0   35  141   15  L LLLLLLLL  L LLL      L    L  LLLLM M   M M                          
   349   10 G T     >  -     0   0   69  141   62  S SSSSSSSS  T SSS      S    S  SSSSS S   S T                          
   350   11 G E  H  > S+     0   0  116  143   33  E EEEEEEEE  E EEE      E    E  EEEED DE  D E                          
   351   12 G K  H >> S+     0   0   66  152   41  K KKKKKKKK  K RKK      K    K  KKKKK KK  K K                          
   352   13 G D  H 3> S+     0   0   39  152   35  D DDEDDDDD  E EEE      E    E  EDDDE EE  D D                          
   353   14 G K  H 3X S+     0   0   83  152   84  L LLLLLLLL  L LLL      L    L  LILII IL  I I                          
   354   15 G L  H < S+     0   0    7  233    6  E EEEEEEEE  E EEE      E    E  EEEEE EE  E E                          
   365   26 G V  H 3< S+     0   0   43  233   53  V VVVVVVVV  V VVV      V    M  VVVAV VV  A V                          
   366   27 G T  T 3< S+     0   0  116  233   82  K KKTKKKKK  K KKK      Q    K  KKKKN NK  K K                          
   367   28 G L    <   -     0   0   49  233   61  N NNNNNNNN  N NNN      N    N  NNNNT TN  N T                          
   368   29 G E        -     0   0  191  233   49  T TTPTTTTT  E PPT      P    P  TTTTP AP  T E                          
   369   30 G R        -     0   0   32  233    1  R RRRRRRRR  R RRR      R    R  RRRRR RR  R R                          
   370   31 G M        -     0   0   53  233   85  I IIAIIIII  Q DTL      A    D  VEVEI TA  E A                          
   371   32 G L     >  -     0   0   75  232   81  P PPPPPPPP  M LPP      P    P  PPPPA AP  P P                          
   372   33 G V  H  > S+     0   0    4  232   15  I IIIIIIII  I III      I    I  IIIVV VI  V I                          
   373   34 G S  H  > S+     0   0   14  232    1  S SSSSSSSS  S SSS      S    S  SSSSS SS  S S                          
   374   35 G K  H  > S+     0   0   93  232   38  K KKKKKKKK  K KKK      K    K  KKKKT AK  K T                          
   375   36 G C  H  X S+     0   0    0  233   62  A AATAAAAA  T TTT      T    T  STTTT TT  T S                          
   376   37 G C  H  X S+     0   0    0  233   63  G GGGGGGGG  G GGG      G    G  GGGAA AG  A L                          
   377   38 G E  H  X S+     0   0   75  233   68  K KKKKKKKK  K KKK      K    K  KKKKP PK  K S                          
   378   39 G E  H  X S+     0   0   60  233   26  E EEEEEEEE  E EEE      D    E  DNEEE EE  E E                          
   379   40 G F  H  X S+     0   0    3  233   36  I IIIIIIII  L III      I    I  IIIII II  I M                          
   380   41 G R  H  X S+     0   0   53  233   79  K KKKKKKKK  K KKK      R    K  KKKCI IK  C K                          
   381   42 G D  H  X S+     0   0   67  233   65  E EEDEEEEE  E DDE      E    D  DDDEA AD  E T                          
   382   43 G Y  H  X S+     0   0   43  233    2  Y YYFYYYYY  Y YYY      Y    Y  YFFWF FY  W Y                          
   383   44 G V  H >X S+     0   0    0  233   58  V VVVVVVVV  I VVV      V    V  VVVVV VV  V I                          
   384   45 G E  H 3X S+     0   0   71  233   47  E EEEEEEEE  E EEE      E    E  EEEEE EE  E E                          
   385   46 G E  H 3< S+     0   0  125  233   57  A AAAAAAAA  S AAA      A    A  ATAAG GA  A S                          
   386   47 G R  H XX S+     0   0   94  233   69  Q QQQQQQQQ  M QEE      Q    Q  QQEQL LQ  Q H                          
   387   48 G S  H >< S+     0   0   12  233   67  A AAAAAAAA  A AAA      A    A  AAASS SA  S A                          
   388   49 G G  T 3< S+     0   0   38  233   80  G GGVGGGGG  A GGG      G    G  GAGAA AE  A T                          
   389   50 G E  T <4 S+     0   0  138  232   54  N NNNNNNNN  E TNN      N    A  NNNEE EN  E E                          
   390   51 G D    XX> -     0   0    1  232    0  D DDDDDDDD  D DDD      D    D  DDDDD DD  D D                          
   391   52 G P  H 3>5S+     0   0   17  233   25  P PPPPPPPP  P PPP      P    P  PPPPP PP  P P                          
   392   53 G L  H 345S+     0   0    6  233    3  F FFLFFFFF  L LLL      L    L  LLLLL LL  L L                          
   393   54 G V  H <45S+     0   0   24  233   29  L LLLLLLLL  L LLL      L    L  LLLVV VL  V I                          
   394   55 G K  H  <5S-     0   0  149  233   80  K KKKKKKKK  K KKK      K    K  KKKKK KQ  K K                          
   395   56 G G     << -     0   0   38  233   34  G GGGGGGGG  G GGG      G    G  GGGGG GG  G G                          
   396   57 G I        -     0   0   21  224   20  I IIIIIIII  V IVV      I    I  VVVVV VI  V V                          
   397   58 G P    >>  -     0   0   80  233   11  P PPPPPPPP  P PPP      P    P  PPPPP PS  P P                          
   398   59 G E  T 34 S+     0   0   75  233   58  E EEEEEEEE  E EEE      E    D  EEEEE EE  E D                          
   399   60 G D  T 34 S+     0   0  151  233   61  D DDDDDDDD  D DDD      D    D  DDDDD DD  D D                          
   400   61 G K  T <4 S+     0   0  163  233   62  K KKKKKKKK  K KKK      R    K  KKKKK KK  K R                          
   401   62 G N     <  -     0   0    1  233    0  N NNNNNNNN  N NNN      N    N  NNNNN NN  N N                          
   402   63 G P  S    S+     0   0   36  224    0  P PPPPPPPP  P PPP      P    P  PPPPP PP  P P                          
   403   64 G F  S    S-     0   0    3  224    0  F FFFFFFFF  F FFF      F    F  FFFFF FF  F F                          
   404   65 G K              0   0  108  222   29  K KKKKKKKK  K KKK      K    K  RKKKK KK  K K                          
   405   66 G E              0   0  201  217    3  E EEEEEEEE  E EEE      E    E  EEEEE EE  E E                          
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   62   10             F                            L L  LL   LL LLL   L          
   408   14 P E        +     0   0  153  142   39             D                  E         E E EEEEEEPP EEEEE E          
   409   15 P G  S    S+     0   0   38  144   37             G                  V         E E LEELDLEE EEELL E          
   410   16 P Q  S    S-     0   0   94  148   90             P       E P        P         N N PTTPPPTT STSPP S P        
   411   17 P A        +     0   0    1  149   53             A       A AA       A         A A AAAAVAPP AAAAA V A        
   412   18 P S        +     0   0   28  149   71             M       T TT       N         T T NTTNTNTT TTTNN T T        
   413   19 P H  S    S+     0   0   42  151   57   H         N       H QQ       H         H H HHHHVHQQ HHHHH H Q        
   414   20 P T  S  > S-     0   0    2  152   17   T         T       T TT       T         T T TTTTtTTT TTTTT T T        
   415   21 P G  H  > S-     0   0   10  164    2   G         G       G GG       G         G G GGGGgGGGGGGGGG G G        
   416   22 P P  H  > S+     0   0   14  165    0   P         P       P PP       P         P P PPPPPPPPPPPPPP P P        
   417   23 P K  H  > S+     0   0    6  165    0   K         K       K KK       K         K K KKKKKKKKKKKKKK K K        
   418   24 P G  H  X S+     0   0    0  165    1   G         G       G GG       G         G G GGGGGGGGGGGGGG G G        
   419   25 P V  H  X S+     0   0    0  165    0   V         V       V VV       V         V V VVVVVVVVVVVVVV V V        
   420   26 P I  H  X S+     0   0    4  165   14   I         I       I II       I         I I IIIIIIIIIIIIII I I        
   421   27 P N  H  X S+     0   0   48  165   42   H         N       H HH       N         N N NNNNNNNNNNNNNN N H        
   422   28 P D  H  X S+     0   0   14  166    0   D         D       D DD       D         D D DDDDDDDDDDDDDD D D        
   423   29 P W  H  X S+     0   0    6  166    0   W         W       W WW       W         W W WWWWWWWWWWWWWW W W        
   424   30 P R  H  < S+     0   0   67  166   26   R         R       R RR       R         R R RRRRRRRRRRRRRR R R        
   425   31 P K  H >X S+     0   0   67  166   36   K         K       K KK       R         R R RRRRKRRRRRRRRR R K        
   426   32 P F  H >X>S+     0   0    1  166    1   F         F       F FF       F         F F FFFYFFFFFFFFFF F F        
   427   33 P K  H 3<5S+     0   0   30  166    7   K         K       K KK       K         K K KKKKKKKKKKKKKK K K        
   428   34 P L  H <45S+     0   0  139  161    1   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   429   35 P E  H <<5S+     0   0   86  161    9   I         E       E EE       D         E E DEEDEDEEEEEEDD E E        
   430   36 P S  T  <5       0   0   57  162   66   s         s       s ss       s         s s ssssssssssssss s s        
   431   37 P E      <       0   0  118  167   66   k         r       i kk       r         n n rnnrcrnnnsnsrr n s        
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  143   42   L         F       R VV       L         L L VLLQVVIILLLLVV L V        
   434   69 P S        +     0   0   52  144   64   S         S       K NN       N         N N NNNNgNNNNNNNNN N Q        
   435   70 P R        -     0   0  103  120   85   R         R       M RR       R         R R RRRRrRRRRRRRRR R .        
   436   71 P K        +     0   0   22  123   12   K         K       S KK       K         K K KKKKKKKKKKKKKK K .        
   437   72 P M  S    S-     0   0   12  124   13   M         M       M MM       M         M M MMMMMMMMMMMMMM M .        
   438   73 P S     >  -     0   0   52  131   65   S         S       Q SS       S         S S SSSSSSSSSSSSSS S .        
   439   74 P V  H  > S+     0   0  107  130   53   M         M       . VV       V         V V VVVAAVVVVVVVVV V .        
   440   75 P Q  H  > S+     0   0  133  130   52   Q         Q       . QQ       Q         Q Q QQQQQQPPQQQQQQ Q .        
   441   76 P E  H  > S+     0   0   38  134   26   E         E       E EE       E         E E EEEEEEEEEEEEEE E .        
   442   77 P Y  H  X S+     0   0   36  146   56   Y         Y       Y YY       Y         Y Y YYYYYYYYYYYYYY Y .        
   443   78 P E  H  < S+     0   0  111  154   61   E         E       E EE       E         E E EEEEEEEEEEEEDD E E        
   444   79 P L  H >X S+     0   0   45  155   57   L         L       I MM       L         L L MLLLLMLLMMLMMM M Y        
   445   80 P I  H 3< S+     0   0   37  157   72   I         T       I II       I         L L ILLIIILLLLLLII L E        
   446   81 P H  T 3< S+     0   0  178  158   80   N         Q       N QQ       Q         K K QKKQKQKKKKKKQQ K M        
   447   82 P K  T <4 S+     0   0  140  157   65   D         .       D EE       D         E E DEEEEDEEEEEEEE E I        
   448   83 P D     <  -     0   0   58  169   39   K         G       G EE       E         E E EEEEEEEEEEEEEE E Q        
   449   84 P K        -     0   0  205  149   80   .         K       K .D       .         . . .............. . E        
   450   85 P E        -     0   0   45  150   68   E         E       E .E       .         . . .............. . E        
   451   86 P D    >>  -     0   0   87  169   31   D         D       D DQ       D         D D DDDDDDDDDDDDDD D D        
   452   87 P E  H 3> S+     0   0  113  168   12   E         E       E E.       E         E E EEEEEEEEEEEEEE E E        
   453   88 P N  H 3> S+     0   0   73  169   59   H         N       T Q.       R         G G RGGSKRGGGGGGRR G Q        
   454   89 P C  H <> S+     0   0   32  170   72   C         C       C CC       C         C C CCCCSCCCCCCCSS C C        
   455   90 P L  H  X S+     0   0    4  170    2   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   456   91 P R  H  X S+     0   0  131  170   63   K         R       R RR       K         K K KKKKRKKKKKKKKK K R        
   457   92 P K  H  X S+     0   0  112  170   59   K         K       K KK       R         K K RSSRKRKKKKKKHH K K        
   458   93 P Y  H  X S+     0   0    7  170    5   Y         Y       Y YY       Y         Y Y YYYYYYYYYYYYYY Y Y        
   459   94 P R  H  X S+     0   0   31  170   31   R         R       Q RR       R         R R RRRRRRRRRRRRRR R R        
   460   95 P R  H  X S+     0   0  130  170   43   K         K       K KK       K         R R KKKKKKKKKKRKKK K K        
   461   96 P Q  H  X S+     0   0   96  170   30   Q         Q       R QQ       Q         Q Q QRRQQQRRRRRRQQ R Q        
   462   97 P C  H  X S+     0   0   22  170   72   C         S       C CC       C         C C CCCCCCCCCCCCCC C C        
   463   98 P M  H  X S+     0   0   33  170   11   M         M       M MM       M         M M MMMMMMMMMMMMMM M M        
   464   99 P Q  H  X S+     0   0  115  170   54   H         Q       L QQ       Q         E E QQQQQQQQQQEQQQ Q Q        
   465  100 P D  H  X S+     0   0   46  170   21   D         E       D DD       E         E E EEEEEEDDEEEEEE E D        
   466  101 P M  H  X S+     0   0   23  170    2   M         M       M MM       M         M M MMMMMMMMMMMMMM M M        
   467  102 P H  H  X S+     0   0   64  170   74   H         H       H HH       H         H H HHHHHHHHHHHHHH H H        
   468  103 P Q  H  < S+     0   0  143  170   59   Q         Q       Q EE       E         N N EDDEEEDDEESEEE E E        
   469  104 P K  H  < S+     0   0  140  170   55   R         K       R RR       R         K K RKKRRRKKKKKKRR K R        
   470  105 P L  H  < S+     0   0   35  170   43   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   471  106 P S     <  -     0   0   75  170   79   S         S       S SS       S         S S SSSSSSSSSSSSSS S S        
   472  107 P F        -     0   0   71  168   99   F         F       F FF       F         F F FFFFFFFFFFFFFF F F        
   473  108 P G        -     0   0   36  168   51   G         G       G GG       G         G G GGGGGGGGGGGGGG G G        
   474  109 P P        +     0   0   92  160   41   P         P       P PP       P         P P PPPPPPPPPPPPPP P P        
   475  110 P R        +     0   0  177  165   61   K         K       Q KK       K         R R KKKKKKRRRRKRSS R K        
   476  111 P Y        +     0   0   51  166    5   Y         F       Y FF       F         F F FFFFFFFFFFFFFF F F        
   477  112 P G        +     0   0   12  170   61   G         E       G DD       E         E E EEEEEEEEDEEEEE D D        
   478  113 P F  S    S-     0   0  151  170  103   Y         V       Y SS       S         G G CGGCGCGGGGGGQQ G S        
   479  114 P V  E     -v  532   0H  28  170   13   L         V       L VV       V         V V VVVVVVVVVVVVVV V V        
   480  115 P Y  E     -v  533   0H  71  165   68   V         Y       S FF       H         H H HYYHYHHHHHHHHH H F        
   481  116 P E  E     -v  534   0H 108  170   41   E         E       E DD       E         D D EDDEDEEEDDDDEE D D        
   482  117 P L        -     0   0   12  170   32   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   483  118 P E        +     0   0  134  170   74   K         E       E EE       E         D D EDDEDEDDDDDDEE D E        
   484  119 P S  S >> S-     0   0   57  170   53   S         N       S SS       S         S S SSSSSSSSSSSSSS S S        
   485  120 P G  H 3> S+     0   0   15  169   40   G         G       G GG       G         G G GGGGGGGGGGGGGG G G        
   486  121 P E  H 3> S+     0   0  127  170   23   D         E       E EE       E         E E EEEEEEEEEEEEDD E E        
   487  122 P Q  H <> S+     0   0   72  170   61   E         Q       Q AA       A         A A AAAAAAAAAAAAAA A A        
   488  123 P F  H  X S+     0   0   26  170    1   F         F       F FF       F         F F FFFFFFFFFFFFFF F F        
   489  124 P L  H  X S+     0   0   90  170    6   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   490  125 P E  H  X S+     0   0  103  170   41   E         E       E DD       E         E E EEEEEEEEEEEEEE E D        
   491  126 P T  H  < S+     0   0   10  170   76   A         V       A VV       V         V V VVVVVVVVVVVVVV V V        
   492  127 P I  H  < S+     0   0   17  170   12   I         I       I II       I         I I IIIIIIIIIIIIII I I        
   493  128 P E  H  < S+     0   0  139  170   20   E         E       E EE       E         E E EEEEEEEEEEEEEE E E        
   494  129 P K  S  < S+     0   0  172  170   35   K         K       K NN       K         K K KKKKKKKKKKKKKK K N        
   495  130 P E  S    S-     0   0   38  166    5   E         E       E EE       E         E E EEEEEEEEEEEEEE E E        
   496  131 P Q    >   -     0   0  116  170   66   S         H       R HH       H         H H HHHHHHHHHHHHHH H H        
   497  132 P K  T 3  S+     0   0  156  170   34   K         K       K RR       R         H H RHHRRRYYHHHHRR H R        
   498  133 P I  T 3  S+     0   0   68  170   87   T         N       T LL       L         S S LSSLLLSSSSSSLL S L        
   499  134 P T    <   -     0   0   10  170   35   T         T       T TT       T         T T TTTTTTTTTTTTTT T T        
   500  135 P T  E     -W  558   0H   7  169   62   T         T       T LL       L         V V LVVL.LVVVVVVLL V L        
   501  136 P I  E     -Wx 557 531H   3  170   15   V         V       I VV       V         V V VVVVVVVVVVVVVV V V        
   502  137 P V  E     -Wx 556 532H   0  170   35   I         M       I VV       V         V V VVVVVVVVVVVVVV V V        
   503  138 P V  E     -Wx 555 533H   0  170   12   V         V       V VV       V         V V VVVVVVVVVVVVVV V V        
   504  139 P H  E     -Wx 554 534H   0  170    6   H         H       H HH       H         H H NHHHHNHHHHHHHH H H        
   505  140 P I  E     +Wx 553 535H   2  170    1   I         I       I II       I         I I IIIIIIIIIIIIII I I        
   506  141 P Y  E     - x   0 536H   4  170    2   F         Y       Y YY       Y         Y Y YYYYYYYYYYYYYY Y Y        
   507  142 P E    >   -     0   0   45  170   26   A         E       E EE       Q         K K QKKQKQKKKKKKQQ K E        
   508  143 P D  T 3  S+     0   0   95  170   51   D         D       D DD       H         I I QNNHDQVVVVDVHH V D        
   509  144 P G  T 3  S+     0   0   66  170   48   D         S       G GG       G         G G DGGGGDGGGGGGGG G G        
   510  145 P I  S X> S-     0   0   36  170   33   I         V       I II       V         I I VIIVVVVVVVVVVV V I        
   511  146 P K  T 34 S+     0   0  191  170   71   K         K       K RR       K         K K KKKKPKKKKKKKKK K R        
   512  147 P G  T 3> S+     0   0   13  170   22   G         G       G GG       G         G G GGGGGGGGGGGGGG G G        
   513  148 P C  H <> S+     0   0    0  170   35   C         C       C CC       C         C C CCCCCCCCCCCCCC C C        
   514  149 P D  H  X S+     0   0   78  170   47   E         E       D DD       E         E E EEEEEEEEEEEEEE E D        
   515  150 P A  H  > S+     0   0   44  170   50   A         A       L AA       E         Q Q QAAQAQEEEEQEQQ E A        
   516  151 P L  H  X S+     0   0    0  170   11   L         L       L LL       L         L L MLLMLMLLLLLLLL L L        
   517  152 P N  H  X S+     0   0   19  170   16   N         N       N NN       N         N N NNNNNNNNNNNNNN N N        
   518  153 P S  H  X S+     0   0   78  170   56   N         N       N NN       S         S S SSSSSSSSSSSSSS S N        
   519  154 P S  H  X S+     0   0    6  170   35   C         C       S CC       C         C C CCCCSCCCCCCCCC C C        
   520  155 P L  H  X S+     0   0    1  170   10   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   521  156 P I  H  X S+     0   0  105  170   85   T         T       T TT       D         D D DDDDDDDDDDDDDD D T        
   522  157 P C  H  X S+     0   0   63  170   38   C         C       C CC       C         C C CCCCCCCCCCCCCC C C        
   523  158 P L  H  X S+     0   0    0  170    4   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   524  159 P A  H  < S+     0   0    1  170    9   A         A       A AA       A         A A AAASAAAAAAAAAA A A        
   525  160 P A  H  < S+     0   0   61  170   67   L         L       V AA       T         T T TTTSTTIITTTTSS T A        
   526  161 P E  H  < S+     0   0   72  170   23   E         E       E EE       E         E E EEEEEEEEQQEQEE Q E        
   527  162 P Y    ><  +     0   0    5  170    2   Y         Y       Y YY       Y         Y Y YYYYYYYYYYYYYY Y Y        
   528  163 P P  T 3  S+     0   0   28  170   29   P         T       S SS       P         P P PPPPAPPPPPPPSS P S        
   529  164 P M  T 3  S+     0   0   26  170   86   T         T       M TT       S         T T TTTTSTTTTTTTGG T T        
   530  165 P V  S <  S-     0   0    1  170    8   V         V       V VV       V         V V VVVVVVVVVVVVII V V        
   531  166 P K  E     - x   0 501H  37  170    2   K         K       R KK       K         K K KKKKKKKKKKKKKK K K        
   532  167 P F  E     +vx 479 502H   0  170    1   F         F       F FF       F         F F FFFFFFFFFFFFFF F F        
   533  168 P C  E     -vx 480 503H   0  170   18   C         C       C CC       C         C C CCCCCCCCCCCCCC C C        
   534  169 P K  E     +vx 481 504H  51  170   37   K         K       K RR       R         R R RRRRRRRRRRKRRR R R        
   535  170 P I  E     - x   0 505H   1  170   21   I         I       I II       I         I I IIIIIIIIIIIIII I I        
   536  171 P K  E >>  - x   0 506H  52  170   72   K         K       K RR       D         D D DDDDCDDDDDDDDD D R        
   537  172 P A  H >> S+     0   0   13  170   46   A         A       A AA       A         A A AAAAAAAAAAAAAA A A        
   538  173 P S  H 34 S+     0   0   88  170   30   A         S       S SS       V         V V VVVVCVVVVVVVEE V S        
   539  174 P N  H <4 S+     0   0   67  170   86   D         S       D AA       A         S S AAAADAAASSSSAA S A        
   540  175 P T  H << S-     0   0   25  170   73   T         T       T TT       T         S S TSSTTTSSSSSSTT S T        
   541  176 P G     <  +     0   0   66  169   22   G         G       G GG       G         G G GGGGGGGGGGGGGG G G        
   542  177 P A    >   -     0   0   39  170   55   A         A       A AA       A         A A AAAAAAAAAAAAAA A A        
   543  178 P G  T 3  S-     0   0   70  169   43   G         Q       G GG       A         A A AAAAGASSSAAALL S G        
   544  179 P D  T 3  S+     0   0  151  169   78   E         D       D EE       E         E E EEEEDEEEEEEEEE E E        
   545  180 P R  S <  S+     0   0  167  169   58   R         R       R RR       R         R R RRRRRRRRRRRRRR R R        
   546  181 P F  S    S+     0   0   35  169    0   F         F       F FF       F         F F FFFFFFFFFFFFFF F F        
   547  182 P S    >>  -     0   0   34  169   70   S         P       S SS       S         S S SSSSCSSSSSSSSS S S        
   548  183 P S  T 34 S+     0   0   86  169   84   S         E       P EE       S         D D SDDSDSDDDDDDPP D E        
   549  184 P D  T 34 S+     0   0  126  169   66   E         K       E DD       E         E E EEEEDEEEDDEDEE D D        
   550  185 P V  T <4 S+     0   0   20  169   65   V         V       V VV       V         Y Y VYYVVVVVVVYVVV V V        
   551  186 P L     <  +     0   0    8  170   13   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   552  187 P P  S    S+     0   0    1  170    0   P         P       P PP       P         P P PPPPPPPPPPPPPP P P        
   553  188 P T  E     -W  505   0H   1  170   42   T         T       T TT       T         T T TTTTATTTATTTAA A T        
   554  189 P L  E     -WY 504 566H   0  170    2   L         F       L LL       L         L L LLLLLLLLLLLLLL L L        
   555  190 P L  E     -WY 503 565H   4  170    9   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   556  191 P V  E     +WY 502 564H   0  170   19   V         V       V VV       V         V V VVVVVVVVVVVVVV V V        
   557  192 P Y  E     +WY 501 562H  31  170    0   Y         Y       Y YY       Y         Y Y YYYYYYYYYYYYYY Y Y        
   558  193 P K  E >  S-WY 500 561H  25  170   12   K         K       R KK       K         K K KKKKKKKKKKKKKK K K        
   559  194 P G  T 3  S-     0   0   25  170   41   A         A       G AA       A         A A SAAAASAAAAAAAA A A        
   560  195 P G  T 3  S+     0   0   48  170   21   G         G       G GG       G         G G GGGGGGGGGGGGGG G G        
   561  196 P E  E <   -Y  558   0H  38  170   36   E         E       E EE       E         E E EEEEEEEEEEEEEE E E        
   562  197 P L  E     +Y  557   0H  34  170   12   L         L       L MM       L         L L LLLLLLLLLLLLLL L M        
   563  198 P L  E     -     0   0H   2  170   20   I         I       V LL       L         L L LLLLLLLLLLILLL L L        
   564  199 P S  E     -Y  556   0H   4  170   30   S         G       S GG       G         G G GGGGGGGGGGGGGG G G        
   565  200 P N  E     -Y  555   0H  41  170    0   N         N       N NN       N         N N NNNNNNNNNNNNNN N N        
   566  201 P F  E >   -Y  554   0H   3  170    1   F         F       F FF       F         F F FFFFFFFFFFFFFF F F        
   567  202 P I  T 3  S-     0   0   87  168   25   I         I       L LL       L         L L LLLLLLLLLLLLLL L L        
   568  203 P S  T >  S-     0   0   11  168   71   S         C       S CC       A         S S SSSAASAAAASAAA A C        
   569  204 P V  G X  S+     0   0    0  168   35   V         I       V VV       V         C C ICCIVICCCCCCVV C V        
   570  205 P T  G >  S+     0   0   17  168   36   T         T       T TT       T         T T TTTTTTTTTTTTTT T T        
   571  206 P E  G <  S+     0   0  156  168   35   E         E       E KK       K         Q Q KQQKQKQQQQQQKK Q K        
   572  207 P Q  G <  S+     0   0   84  168   43   N         H       Q HH       H         H H HHHNHHHHHHHHHH H H        
   573  208 P L  S <  S-     0   0   31  168   11   L         F       F MM       F         L L FLLFFFLLLLMLFF L M        
   574  209 P A    >   -     0   0   49  168   51   N         N       N NN       N         S S NNNNSNTTNSNSNN N N        
   575  210 P E  T 3  S+     0   0  201  168   27   D         E       E EE       E         E E EEEEEEEEEEEEEE E E        
   576  211 P E  T 3  S+     0   0  166  168   21   E         E       E EE       E         E E EEEEEEEEEEEENN E E        
   577  212 P F    <   -     0   0   17  168    0   F         F       F FF       F         F F FFFFFFFFFFFFFF F F        
   578  213 P F    >>  -     0   0  146  168   24   F         F       F FF       F         F F FFFFFFFFFFFFFF F F        
   579  214 P T  H 3> S+     0   0   24  167   24   A         A       A AA       A         A A AAAAAAAAAAAAAA A A        
   580  215 P G  H 3> S+     0   0   32  167   71   V         V       V TT       T         T T TTTTTTTTTTTTTT T T        
   581  216 P D  H <> S+     0   0   57  167    4   D         D       D DD       D         D D DDDDDDDDDDDDDD D D        
   582  217 P V  H  X S+     0   0    0  167   23   V         V       V VV       V         V V VVVVVVVVVVVVVV V V        
   583  218 P E  H  X S+     0   0   32  167    8   E         E       E EE       E         E E EEEEEEEEEEEEEE E E        
   584  219 P S  H  X S+     0   0   58  167   52   S         S       T NN       A         A A AGGGAAAAAAAAGG A N        
   585  220 P F  H  < S+     0   0    2  168    2   F         F       F FF       F         F F FFFFFFFFFFFFFF F F        
   586  221 P L  H ><>S+     0   0    0  168    0   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   587  222 P N  H ><5S+     0   0   61  168   82   N         N       K NN       N         N N NNNNNNNNNNNNNN N N        
   588  223 P E  T 3<5S+     0   0   70  168   18   E         E       E EE       E         S S ESSEAESSSSSSEE S E        
   589  224 P Y  T < 5S-     0   0   20  165   47   Y         Y       Y YY       Y         Y Y YYYYYYYYYYYYYY Y Y        
   590  225 P G  T < 5S+     0   0    6  165    6   G         G       G GG       G         G G GGGGGGGGGGGGGG G G        
   591  226 P L      < +     0   0    2  165   18   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   592  227 P L  S    S-     0   0   10  161    8   L         L       L LL       L         L L LLLLLLLLLLLLLL L L        
   593  228 P P        -     0   0   40  161   31   P         P       P PP       P         P P PPPPPPPPPPPPPP P P        
   594  229 P E              0   0   94  159   17   E         E       Q EE       E         E E EEEEEEEEEEEEEE E E        
   595  230 P K              0   0  161  158   24   R         K         KK       K         K K KKKKKKKKKKKKKK K K        
## ALIGNMENTS  491 -  560
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....0....:....1....:....2....:....3....:....4....:....5....:....6
     1    2 B S              0   0  117  267   60         E E A                                                  E D     
     2    3 B E     >  -     0   0  107  283   60         T T KK                                                 T T     
     3    4 B L  H  > S+     0   0   52  299   33         L LIII                                                 L L     
     4    5 B D  H  > S+     0   0  104  300   57         A ASDE                                                 A E     
     5    6 B Q  H  > S+     0   0  131  301   62         S SNAA                                                 A N     
     6    7 B L  H  X S+     0   0   27  302   65         L LAAA                                                 L L     
     7    8 B R  H  X S+     0   0  110  311   10         K KRKK                                                 R R     
     8    9 B Q  H  X S+     0   0  117  312   60         S SLSG                                                 S K     
     9   10 B E  H  X S+     0   0   78  313   13         E EEQQ                                                 E E     
    10   11 B A  H  X S+     0   0    1  313   25         A AAAV                                                 A A     
    11   12 B E  H  X S+     0   0  121  315   21         E EQEE                                                 E E     
    12   13 B Q  H  X S+     0   0  111  323   73         S SQAV                                                 G Q     
    13   14 B L  H  X S+     0   0   14  348    5         L LLLL                                           LLLL  LLL LL L
    14   15 B K  H  X S+     0   0   99  348   37         K KKRK                                           RGRR  KRR RR R
    15   16 B N  H  X S+     0   0   33  348   56         G GEHQ                                           EEDE  GDK HE D
    16   17 B Q  H  X S+     0   0   82  348   60         K KKAI                                           RRQR  KQK RR Q
    17   18 B I  H  X S+     0   0    7  348   18         L LIIL                                           LLLL  LLL LL L
    18   19 B R  H  X S+     0   0  135  348   59         E ENQQ                                           KKRK  ERQ KR R
    19   20 B D  H  X S+     0   0   85  349   72         E EAvk                                           qqqq  EqA qq q
    20   21 B A  H  X S+     0   0   36  249   44         E EQtm                                           aaaa  EaD ay a
    21   22 B R  H >X S+     0   0   22  349   28         R RRSS                                           RRRR  RRR RS R
    22   23 B K  H 3< S+     0   0  136  350   43         A AKKR                                           AAYA  AYR SK Y
    23   24 B A  H 3< S+     0   0   79  350   64         K KVDT                                           QQSQ  KSN QA S
    24   25 B C  H << S+     0   0   19  306   94         L LI..                                           ....  L.L .. .
    25   26 B A     <  +     0   0   46  309   60         H HN..                                           ....  H.N .. .
    26   27 B D        +     0   0   88  312    3         D DD..                                           ....  D.D .. .
    27   28 B A        -     0   0   17  315   51         V VV..                                           ....  V.A .. .
    28   29 B T    >>  -     0   0   59  315   41         E EN..                                           ....  E.E .. .
    29   30 B L  H 3> S+     0   0    0  317    9         L LMLL                                           ....  L.L .. .
    30   31 B S  H 34 S+     0   0   38  323   90         H HKRP                                           ....  H.F .. .
    31   32 B Q  H X4 S+     0   0  119  330   65         Q QDGS                                           ..A.  QAV .Q A
    32   33 B I  H 3< S+     0   0   28  332   58         V VLIL                                           ..A.  VAM .G A
    33   34 B T  T >< S+     0   0    0  343   62         A ADIL                                           EGQG  AQG GR Q
    34   35 B N  T <  S+     0   0  129  351   77         E EVNV                                           RRGK  EGK RT G
    35   36 B N  T 3  S+     0   0  111  351   67         R RAQQ                                           SNrS  RrK TP r
    36   37 B I  S <  S-     0   0   21  338   72         V V...                                           PPrP  VrA P. r
    37   38 B D        -     0   0  138  345   57         E E...                                           VVVV  EVG VV V
    38   39 B P        -     0   0   89  348   62         A AE..                                           SSST  ASG TS S
    39   40 B V        -     0   0   23  350   41         L LI..                                           FFFF  LFS FF F
    40   41 B G        -     0   0   54  353   52         G GSPP                                           GGGG  GGP GN G
    41   42 B R        -     0   0  115  354   44         Q QPRR                                           PPAP  QAS PP A
    42   43 B I        +     0   0    8  354   63         f fLVV                                           TTTT  fTI TT T
    43   44 B Q        -     0   0   54  340   61         . .K..                                           DDDD  .DQ DD D
    44   45 B M        -     0   0   11  345   12         m mL..                                           LLLL  mLV LL L
    45   46 B R        -     0   0   49  346   51         K KK..                                           VVVV  KVR VV V
    46   47 B T  E     +A  338   0A  12  350   67         T TE..                                           CCCC  TCC CC C
    47   48 B R  E     +     0   0A  56  355   56         R RRRR                                           CCCC  RCR CC C
    48   49 B R  E     -A  337   0A  60  355   15         R RRRR                                           RRRR  RRR RR R
    49   50 B T  E     -A  336   0A  30  355   27         T TVIT                                           TITT  TTI TT T
    50   51 B L  E     -A  335   0A   0  355    2         L LFLL                                           LLLL  LLL LL L
    51   52 B R        +     0   0  159  355   41         K KKKK                                           QQQQ  KQK QQ Q
    52   53 B G        +     0   0   20  355    0         G GGGG                                           GGGG  GGG GG G
    53   54 B H        -     0   0    4  355    0         H HHHH                                           HHHH  HHH HH H
    54   55 B L  S    S+     0   0  116  355   50         G GSFF                                           TTTT  GTT TS T
    55   56 B A  S    S-     0   0    0  355   30         N NSGG                                           GGGG  NGG GG G
    56   57 B K        -     0   0   15  355    0         K KKKK                                           KKKK  KKK KK K
    57   58 B I  E     -D   73   0B   0  355    9         V VVVV                                           VVVV  VVV VV V
    58   59 B Y  E     -     0   0B   6  355   20         L LAYY                                           YYYY  LYL YY Y
    59   60 B A  E     -D   72   0B  13  355   32         C CSAA                                           SSSS  CSD SS S
    60   61 B M  E     -D   71   0B  15  355   10         M MLMV                                           LLLL  MLM LL L
    61   62 B H  E     -D   70   0B  44  355   33         D DAHH                                           DDDD  DDD DD D
    62   63 B W  E     -D   69   0B  11  355    0         W WWWW                                           WWWW  WWW WW W
    63   64 B G    >   -     0   0    3  355   54         C CSSS                                           TTTT  CTS TT T
    64   65 B T  T 3  S+     0   0   75  355   66         K KKGG                                           PPPT  RPL SP P
    65   66 B D  T 3  S-     0   0   80  355   12         D DDNN                                           EEEE  DED EE E
    66   67 B S  S <  S+     0   0    3  355   57         K KSGG                                           RKRK  KRK KK R
    67   68 B R  S    S+     0   0   94  355   47         R RKRH                                           NNNN  RNR SN N
    68   69 B L  E     + E   0  82B  31  355   87         R RTDD                                           RRRR  RRR QW R
    69   70 B L  E     -DE  62  81B   0  355   23         I IIIL                                           IIII  III II I
    70   71 B L  E     -DE  61  80B   0  355    7         V VLVV                                           VVVV  VVV VV V
    71   72 B S  E     -DE  60  79B   0  354    2         S STSS                                           SSSS  SSS SS S
    72   73 B A  E     -DE  59  78B   0  354    5         S SAAA                                           AAAA  SAS AA A
    73   74 B S  E >>  -DE  57  77B   0  354    2         S SGSS                                           SSSS  SSS SS S
    74   75 B Q  T 34 S+     0   0    1  355    1         Q QQQQ                                           QQQQ  QQQ QQ Q
    75   76 B D  T 34 S-     0   0    9  355    0         D DDDD                                           DDDD  DDD DD D
    76   77 B G  T <4 S+     0   0    7  355    1         G GRGG                                           GGGG  GGG GG G
    77   78 B K  E  <  -EF  73  93B  52  355   34         K KMKK                                           RRRR  KRK RR R
    78   79 B L  E     -EF  72  92B   0  355    4         V VLLL                                           LLLL  VLI LL L
    79   80 B I  E     -EF  71  91B   0  355    7         I IIII                                           IIII  IIL II I
    80   81 B I  E     -EF  70  90B   0  355   18         V VLII                                           VVVV  VVV VV V
    81   82 B W  E     -EF  69  88B   0  355    0         W WWWW                                           WWWW  WWW WW W
    82   83 B D  E >>> -EF  68  87B  21  355   18         D DDNN                                           NNNN  DND NN N
    83   84 B S  T 345S+     0   0    0  355   52         S SAST                                           AAAA  SAG AA A
    84   85 B Y  T 345S+     0   0   57  354   48         F FVHH                                           LLLL  FLF LL L
    85   86 B T  T <45S-     0   0   56  354    8         T TTNN                                           TTTT  TTT TT T
    86   87 B T  T  <5 +     0   0   43  354   36         T TTMM                                           SSSS  TST RS S
    87   88 B N  E   < -F   82   0B  99  354   38         N NYMM                                           QQQQ  NQN QQ Q
    88   89 B K  E     +F   81   0B  95  354    0         K KKKK                                           KKKK  KKK KK K
    89   90 B V  E    S+     0   0B  66  353   49         E ELAA                                           TTTT  ETE IT T
    90   91 B H  E     -F   80   0B  57  353   18         H HSHH                                           HHHH  HHQ HH H
    91   92 B A  E     -F   79   0B  43  353    8         A AASS                                           AAAA  AAA AA A
    92   93 B I  E     -F   78   0B   0  353    3         V VIII                                           IIII  VII II I
    93   94 B P  E     -F   77   0B  80  353   37         T TPPP                                           KKKK  TKS KK K
    94   95 B L        -     0   0   26  354    2         M MLLL                                           LLLL  MLL LL L
    95   96 B R  S    S+     0   0  190  354   40         P PQHH                                           PPPP  PPP PH P
    96   97 B S        -     0   0   17  354   24         C CASS                                           CCCC  CCT CC C
    97   98 B S  S    S+     0   0    6  354   36         T TRSS                                           AAAA  TAT AP A
    98   99 B W        +     0   0    2  354    3         W WGWW                                           WWWW  WWW WW W
    99  100 B V  E     -G  115   0C   4  354    1         V VIVV                                           VVVV  VVV VV V
   100  101 B M  E     +     0   0C   5  353    4         M MMMM                                           MMMM  MMN MM M
   101  102 B T  E     -G  114   0C   8  353   13         A ACTT                                           TTTT  ATA TT T
   102  103 B C  E     -G  113   0C   0  353    9         C CCCC                                           CCCC  CCC CC C
   103  104 B A  E     -G  112   0C   0  353    8         A ADAA                                           AAAA  AAA AA A
   104  105 B Y  E     -G  111   0C   9  353   10         Y YYFF                                           FFFF  YFY FF F
   105  106 B A    >   -     0   0    0  353   33         A ASEE                                           SSSS  ASA SA S
   106  107 B P  T 3  S+     0   0   64  353    8         P PTqq                                           PPPP  PPP PP P
   107  108 B S  T 3  S-     0   0   47  353   31         S SSrr                                           TANS  SNS TN N
   108  109 B G  S <  S+     0   0    8  353   14         G GGNN                                           GGGG  GGG GG G
   109  110 B N  S    S+     0   0   50  353   43         C CNEE                                           QQQQ  CQG QQ Q
   110  111 B Y  E     - H   0 124C  50  353   55         A AYMM                                           SSSS  ASS SS S
   111  112 B V  E     -GH 104 123C   0  353    5         I IVVV                                           VVVV  IVI VV V
   112  113 B A  E     +GH 103 122C   0  353    4         A ACAA                                           AAAA  AAA AA A
   113  114 B C  E     +GH 102 121C   5  353   10         C CVCC                                           CCCC  CCC CC C
   114  115 B G  E     +GH 101 120C   1  353    6         G GGGG                                           GGGG  GGG GG G
   115  116 B G  E >  S-G   99   0C   0  353    0         G GGGG                                           GGGG  GGG GG G
   116  117 B L  T 3  S+     0   0    1  353    1         L LLLL                                           LLLL  LLL LL L
   117  118 B D  T 3  S-     0   0   50  353    3         D DDDD                                           DDDD  DDD DD D
   118  119 B N  S <  S+     0   0   30  353   21         N NNNN                                           SSSS  NSN SS S
   119  120 B I  E     - I   0 139C  39  353   43         K KILL                                           VVVV  KVK VA V
   120  121 B C  E     -HI 114 138C   0  353    7         C CCCC                                           CCCC  CCC CC C
   121  122 B S  E     -HI 113 137C   9  353   14         S SSSS                                           SSSS  SSS SS S
   122  123 B I  E     -HI 112 136C   0  353    6         V VVII                                           IIII  VIV II I
   123  124 B Y  E     -H  111   0C   3  353    4         Y YFYY                                           FFFF  YFF FF F
   124  125 B N  E     +H  110   0C  24  353   45         P PSKK                                           NNSN  PSP NN S
   125  126 B L        +     0   0   11  353   12         L LLII                                           LLLL  LLL LL L
   126  127 B K  S    S+     0   0  109  353   60         T TSNN                                           NNSN  TSN NN S
   127  128 B T  S    S-     0   0   64  353   71         f faQQ                                           ssss  fss ss s
   128  129 B R  S    S+     0   0  267  336   26         k kqPP                                           kkkk  kks kr k
   129  130 B E  S    S-     0   0  173  340   28         N NNQQ                                           DDDD  NDN DD D
   130  131 B G        -     0   0   50  351   25         E EsVV                                           GGGG  EGs GG G
   131  132 B N        +     0   0   30  349   59         N Nn..                                           NNTN  NTt NN T
   132  133 B V  S    S+     0   0   58  329   58         M MyTM                                           LLVL  MVL LM V
   133  134 B R  S    S-     0   0  213  347   44         A AKRR                                           PTPA  APS PP P
   134  135 B V        -     0   0   29  352   27         A APAA                                           VVVM  AVV VV V
   135  136 B S  S    S-     0   0   43  352   59         k kFTN                                           SSSS  kSs SS S
   136  137 B R  E     -I  122   0C 105  344   18         k kRSS                                           RRRK  rRk RR R
   137  138 B E  E     -I  121   0C  75  346   40         S SQEE                                           MMMM  SMQ MI M
   138  139 B L  E     +I  120   0C   1  349    5         V VLLL                                           LLLL  VLN LL L
   139  140 B A  E     +I  119   0C  61  351   61         A AVAA                                           SSTS  ATP ST T
   140  141 B G        +     0   0   50  351   27         M MGGG                                           GGGG  MGV GG G
   141  142 B H        -     0   0    9  352    8         H HHHH                                           HHHH  HHS HH H
   142  143 B T  S    S+     0   0   64  352   62         T TTDD                                           KKRK  TRS KK R
   143  144 B G  S    S-     0   0    0  352    8         N NGGG                                           GGGG  NGg GG G
   144  145 B Y        -     0   0    0  352    1         Y YYYY                                           YYYY  YYy YY Y
   145  146 B L  E     +J  160   0D   0  352   18         L LLLL                                           VVVV  LVI VV V
   146  147 B S  E     -     0   0D   3  352    1         S SSSS                                           SSSS  SSS SS S
   147  148 B C  E     -J  159   0D   9  353   29         A ASCC                                           SSCS  ACA SS C
   148  149 B C  E     -J  158   0D   0  353    6         C CCCC                                           CCCC  CCC CC C
   149  150 B R  E     -J  157   0D  53  353   33         S SKRR                                           QQQQ  SQT QQ Q
   150  151 B F  E     -J  156   0D  10  353    2         F FFFF                                           YYYY  FYF YY Y
   151  152 B L  S    S-     0   0   26  353   35         T TIVV                                           VVVV  TVT VV V
   152  153 B D  S    S-     0   0   60  353   56         n nSDD                                           pppp  nph pp p
   153  154 B D  S    S+     0   0   60  353   13         d mDDE                                           dddd  ddd de d
   154  155 B N  S    S+     0   0   44  353   76         M QRSS                                           TTAT  MAY TS A
   155  156 B Q  E     + K   0 169D  60  353   66         Q QHKK                                           HHHH  QHQ HR H
   156  157 B I  E     -JK 150 168D   0  354   13         I IIII                                           LLLL  ILI LL L
   157  158 B V  E     -JK 149 167D   0  354   27         L LLLL                                           IIII  LIL II I
   158  159 B T  E     -JK 148 166D   0  353    0         T TTTT                                           TTTT  TTT TT T
   159  160 B S  E     -JK 147 165D   0  352   19         A ASTT                                           SSSS  ASA GS S
   160  161 B S  E >   -J  145   0D   0  352    0         S SSSS                                           SSSS  SSS SS S
   161  162 B G  T 3  S+     0   0    0  352    0         G GGGG                                           GGGG  GGG GG G
   162  163 B D  T 3  S-     0   0    5  352    0         D DDDD                                           DDDD  DDD DD D
   163  164 B T  S <  S+     0   0    8  353   76         G GQSS                                           QQQQ  GQS QQ Q
   164  165 B T        -     0   0    2  353   17         T TSMM                                           TTTT  TTT TT T
   165  166 B C  E     -KL 159 179D   0  352    1         C CCCC                                           CCCC  CCC CC C
   166  167 B A  E     -KL 158 178D   0  353   70         A AIII                                           VVIV  AIA VV I
   167  168 B L  E     -KL 157 177D   6  353   29         L LFLL                                           LLLL  LLL LL L
   168  169 B W  E     -KL 156 175D   2  353    0         W WWWW                                           WWWW  WWW WW W
   169  170 B D  E >>> -KL 155 174D  37  353    1         D DDDD                                           DDDD  DDD DD D
   170  171 B I  T 345S+     0   0    7  353   13         V VVII                                           IIVI  VVV IV V
   171  172 B E  T 345S+     0   0  144  353   32         E EEEE                                           TTTT  ETE TT T
   172  173 B T  T <45S-     0   0   78  353   40         S SMRR                                           TTTT  STS TT T
   173  174 B G  T  <5 +     0   0   16  353   12         G GTNS                                           GGGG  GGG GG G
   174  175 B Q  E   < -L  169   0D 135  353   74         Q QHEE                                           ILLL  QLQ LQ L
   175  176 B Q  E     -L  168   0D  30  353   58         L LANN                                           RRKR  LKL KR K
   176  177 B T  E     +     0   0D  64  353   70         L LVVI                                           TTTT  LTL TI T
   177  178 B T  E     -L  167   0D  20  353   63         Q QSVV                                           SSSS  QSQ SS S
   178  179 B T  E     -L  166   0D   5  354   78         S SHQQ                                           VVVV  SVS VI V
   179  180 B F  E     +L  165   0D   1  354    0         F FFFF                                           FFFF  FFF FF F
   180  181 B T        +     0   0   34  354   73         H HQTT                                           gggg  HgH gg g
   181  182 B G        +     0   0   37  354   33         G GEDD                                           gggg  GgG gg g
   182  183 B H        -     0   0    7  354    0         H HHHH                                           HHHH  HHH HH H
   183  184 B T  S    S+     0   0   99  354   69         G GTTT                                           TTTT  GTQ TT T
   184  185 B G  S    S-     0   0    0  354   17         A AGGG                                           AAAA  AAS AA A
   185  186 B D        -     0   0    1  354    0         D DDDD                                           DDDD  DDD DD D
   186  187 B V  E     -M  202   0E   0  354   18         V VCVV                                           VVVV  VVV VV V
   187  188 B M  E     +     0   0E   3  354   11         L LMMM                                           LLLL  LLM LQ L
   188  189 B S  E     -M  201   0E  16  354   17         C CASS                                           SSSS  CSD SS S
   189  190 B L  E     -M  200   0E   3  354   28         L LVVV                                           VVVV  LVA IV V
   190  191 B S  E     -M  199   0E  21  354   23         D DSAA                                           SSSS  DSA SS S
   191  192 B L  E     -M  198   0E  29  354   32         L LVLL                                           IIII  LIL II I
   192  193 B A    >   -     0   0    4  354   63         A ASDD                                           NSSS  ASS NN S
   193  194 B P  T 3  S+     0   0   85  354   30         P PPPP                                           GGGG  PGP GS G
   194  195 B D  T 3  S-     0   0   87  354   71         S SIHH                                           SSSS  SSC SS S
   195  196 B T  S <  S+     0   0   62  354   89         E EESS                                           NNNN  ENE NN N
   196  197 B R  S    S+     0   0  142  355   76         t tqpp                                           ssps  tpt st p
   197  198 B L  E     - N   0 211E  37  351   70         t tvlv                                           mmwm  twl mm w
   198  199 B F  E     -MN 191 210E   0  351    0         F FFFF                                           FFFF  FFF FF F
   199  200 B V  E     -MN 190 209E   0  352   12         V VVVV                                           VVIV  VII VV I
   200  201 B S  E     -MN 189 208E   0  353    3         S SSTT                                           SSSS  SSS SS S
   201  202 B G  E     +MN 188 207E   0  355    3         G GGGG                                           GGGG  GGG GG G
   202  203 B A  E >   -M  186   0E   0  354   31         G GSSS                                           SSSS  GSG SS S
   203  204 B C  T 3  S+     0   0    5  354    7         C CCCC                                           CCCC  CCC CC C
   204  205 B D  T 3  S-     0   0   31  354    0         D DDDD                                           DDDD  DDD DD D
   205  206 B A  S <  S+     0   0   20  354   39         K KGSS                                           SSSA  KSK AA S
   206  207 B S  E     - O   0 222E   6  354   82         K KSTT                                           TTTT  KTN TT T
   207  208 B A  E     -NO 201 221E   0  354   28         A ASAA                                           AAAA  AAA AV A
   208  209 B K  E     -NO 200 220E  18  354   20         M MKKK                                           RRRR  MRC RR R
   209  210 B L  E     -NO 199 219E   2  354   11         V VLLL                                           LLLL  VLV LL L
   210  211 B W  E     -NO 198 217E   1  354    0         W WWWW                                           WWWW  WWW WW W
   211  212 B D  E >>> -NO 197 216E  11  354    0         D DDDD                                           DDDD  DDD DD D
   212  213 B V  T 345S+     0   0   12  354   39         M MVSS                                           TTTT  MTM TI T
   213  214 B R  T 345S+     0   0  194  354    0         R RRrr                                           rrrr  RrR rr r
   214  215 B E  T <45S-     0   0  111  353   69         S SMpp                                           aaaa  SaT aa a
   215  216 B G  T  <5 +     0   0    8  354   39         G GNSS                                           SSSS  GSA SS S
   216  217 B M  E      -     0   0    1  353    5         Y YFFF                                           FFFF  YFF FF F
   235  236 B P  T 3  S+     0   0   45  353    4         P PPPP                                           PPPP  PPP PP P
   236  237 B N  T 3  S-     0   0   42  353   42         S SNDD                                           DDDD  SDT DD D
   237  238 B G  S <  S+     0   0   12  353    5         G GGGG                                           GGGG  GGG GG G
   238  239 B N  S    S+     0   0   56  353   67         D DNNH                                           NNYN  DYE NH Y
   239  240 B A  E     - Q   0 253F   0  353   48         A AAAA                                           RRRR  ARA RR R
   240  241 B F  E     -PQ 233 252F   0  353   14         F FFFF                                           FFFF  FFF FF F
   241  242 B A  E     -PQ 232 251F   0  353   59         A AAGG                                           GGGG  AGA GG G
   242  243 B T  E     -PQ 231 250F   0  353    6         S STTT                                           TTTT  STT TT T
   243  244 B G  E     +PQ 230 249F   0  353    0         G GGGG                                           GGGG  GGG GG G
   244  245 B S  E >   -P  228   0F   0  353    0         S SSSS                                           SSSS  SSS SS S
   245  246 B D  T 3  S+     0   0   13  353    2         D DDDD                                           DDDD  DDD DD D
   246  247 B D  T 3  S-     0   0   28  353    0         D DDDD                                           DDDD  DDD DD D
   247  248 B A  S <  S+     0   0    6  353   38         A ACSS                                           GGGG  AGG GG G
   248  249 B T        -     0   0   16  353   41         T TTTT                                           TTTT  TTT TT T
   249  250 B C  E     -QR 243 263F   0  353   12         C CCCC                                           CCCC  CCI CC C
   250  251 B R  E     -QR 242 262F  23  353    7         R RRQQ                                           RRRR  RRK RR R
   251  252 B L  E     -QR 241 261F   0  353    1         L LLFF                                           LLLL  LLM LL L
   252  253 B F  E     -QR 240 259F   1  352    1         Y YFFF                                           FFYF  YYY FF Y
   253  254 B D  E  >> -QR 239 258F   1  352    0         D DDDD                                           DDDD  DDD DD D
   254  255 B L  T >45S+     0   0   15  352   28         L LLMT                                           IVII  LIL IM I
   255  256 B R  T 345S+     0   0   57  352    1         R RRRR                                           RRRR  RRR RR R
   256  257 B A  T 345S-     0   0    0  352   29         A AACC                                           TTTT  ATA TT T
   257  258 B D  T <<5 +     0   0    0  352   23         D DSLL                                           GGGG  DGD GG G
   258  259 B Q  E      -     0   0  119  354   72         K KDSS                                           HQPQ  pPR QR P
   266  267 B D  T 3  S+     0   0  161  354   42         E EDEE                                           QQHE  PHP QE H
   267  268 B N  T 3  S+     0   0   66  354   66         S SNKK                                           HHGH  GGN HP G
   268  269 B I    <   +     0   0   23  354   48         I IVII                                           ggdg  ldV sn d
   269  270 B I        +     0   0   97  354   54         I IRLL                                           iina  lnL il n
   270  271 B C  S    S-     0   0   10  354   48         F FECC                                           PAVP  SGF PP G
   271  272 B G        -     0   0    1  355   28         G GGGG                                           HHPH  LPG PT P
   272  273 B I  E     +S  288   0G   0  355   15         A AVII                                           VVVV  EVV VV V
   273  274 B T  E     +     0   0G  13  355   15         S STTT                                           TTTT  STN TT T
   274  275 B S  E     +S  287   0G  18  355    1         S SSSS                                           SSSS  ESS SS S
   275  276 B V  E     +S  286   0G  10  355   16         V VIVV                                           IIII  RIV II I
   276  277 B S  E     -S  285   0G  15  354   25         D DSDD                                           AAAA  SAD AA A
   277  278 B F  E     -S  284   0G  12  354   30         F FFFF                                           FFFF  AFF FF F
   278  279 B S        -     0   0    3  354    4         S SSSS                                           SSSS  CSS SS S
   279  280 B K  S    S+     0   0  104  354   81         L LKRR                                           IIVI  GVV AI V
   280  281 B S  S    S-     0   0    2  354    3         S SSSS                                           SSSS  LSS SS S
   281  282 B G  S    S+     0   0    0  354    1         G GGGG                                           GGGG  RGG GG G
   282  283 B R        +     0   0    8  354    0         R RRRR                                           RRRR  RRR RR R
   283  284 B L  E     - T   0 297G   0  354   11         L LVII                                           LLLL  LLI LL L
   284  285 B L  E     -ST 277 296G   0  354    5         L LLLL                                           LLLL  LLV LL L
   285  286 B L  E     -ST 276 295G   0  354   15         F FFFF                                           FFFF  FFL FF F
   286  287 B A  E     -ST 275 294G   0  355   18         A AAAG                                           AAAA  AAG AA A
   287  288 B G  E     -ST 274 293G   2  355   11         G GAGG                                           GGGG  GGG GG G
   288  289 B Y  E >   -S  272   0G   4  355    1         Y YYYY                                           YYYY  YYY YY Y
   289  290 B D  T 3  S+     0   0    3  355   34         N NEDD                                           SSAS  NAN TS A
   290  291 B D  T 3  S-     0   0   37  355   17         D DDDD                                           NNSN  DSD NN S
   291  292 B F  S <  S+     0   0    3  355   44         Y YKFF                                           GGNG  YNY GG N
   292  293 B N        -     0   0   15  355   49         T TKNN                                           DDnD  TnL DD n
   293  294 B C  E     -TU 287 307G   0  355   10         I IVAA                                           CCcC  IcV CC c
   294  295 B N  E     -TU 286 306G   5  355   74         N NIYY                                           YYYY  NYH YY Y
   295  296 B V  E     -TU 285 305G   0  355   16         V VACC                                           VVVV  VVV VV V
   296  297 B W  E     -TU 284 303G   6  355    0         W WWWW                                           WWWW  WWW WW W
   297  298 B D  E  >  -T  283   0G   4  355    0         D DDDD                                           DDDD  DDD DD D
   298  299 B A  T  4 S+     0   0    0  355   65         V VSVV                                           TTTT  VTT TT T
   299  300 B L  T  4 S+     0   0    0  355   27         L LLIQ                                           LLLL  LLI LL L
   300  301 B K  T  4 S-     0   0   29  355   53         K KkrC                                           llll  KlT ll l
   301  302 B A  S  < S+     0   0   17  355   52         G GimR                                           avvv  GvG ve v
   302  303 B D  S    S-     0   0   95  355   52         S Slnn                                           vvvv  AvE vv v
   303  304 B R  E     -U  296   0G  69  354   61         R Rlqq                                           llll  RlK in l
   304  305 B A  E     -     0   0G  14  355   63         V VDQH                                           GGGG  AGL GL G
   305  306 B G  E     -U  295   0G   4  355   27         S SGWW                                           SSLS  SLT SG L
   306  307 B V  E >   -U  294   0G   7  355   69         I ILTT                                           LLQL  IQA Ln Q
   307  308 B L  E >  S+U  293   0G   2  350   36         L LPLL                                           QQQQ  LQL Qq Q
   308  309 B A  G >  S-     0   0    4  351   70         F FNSS                                           NNDN  FDF DN D
   309  310 B G  G <   -     0   0    4  353   21         G GGGG                                           SSSS  GSG SS S
   310  311 B H  G <  S+     0   0    8  353    0         H HHHH                                           HHHH  HHH HH H
   311  312 B D    <   -     0   0   26  353   32         E EDDD                                           EEKD  ERE ED R
   312  313 B N  S    S+     0   0   31  353   16         N NNNN                                           GGNS  NNN DG N
   313  314 B R        +     0   0   40  353    5         R RRRR                                           RRRR  RRR RR R
   314  315 B V        +     0   0    2  353   10         V VVVV                                           IIII  VII II I
   315  316 B S  S    S-     0   0    2  353   10         S SSSS                                           TSSS  SSS SS S
   316  317 B C  E     -B  329   0A  10  353   17         T TCCC                                           CCCC  TCC CC C
   317  318 B L  E     -B  328   0A  15  353   13         L LLLL                                           LLLL  LLL LL L
   318  319 B G  E     -B  327   0A  10  353   13         R RAGG                                           GGGG  RGK GG G
   319  320 B V  E     -B  326   0A  25  353   19         V VVVM                                           LLLL  VLM LM L
   320  321 B T    >   -     0   0    3  353   52         S SSCC                                           SSSS  SSS SS S
   321  322 B D  T 3  S+     0   0   98  353   70         P PPPP                                           AAAA  PAP AS A
   322  323 B D  T 3  S-     0   0   51  352    9         D DDTT                                           DDDD  DDD DD D
   323  324 B G  S <  S+     0   0    0  352    4         G GGGG                                           GGGG  GGG GG G
   324  325 B M  S    S+     0   0   36  350   62         T THEE                                           SSSS  TST SS S
   325  326 B A        -     0   0    0  350   30         A AAAA                                           AAAA  AAS AA A
   326  327 B V  E     -BC 319 338A   0  350   33         F FLLL                                           LLLL  FLF LL L
   327  328 B A  E     -BC 318 337A   0  349   47         C CACC                                           CCCC  CCC CC C
   328  329 B T  E     -BC 317 336A   7  349    4         S STTT                                           TTTT  STT TT T
   329  330 B G  E     -BC 316 335A   1  349    4         G GGGG                                           GGGG  GGG GG G
   330  331 B S    >   -     0   0    6  349    0         S SSSS                                           SSSS  SSS SS S
   331  332 B W  T 3  S+     0   0    6  349    0         W WWWW                                           WWWW  WWW WW W
   332  333 B D  T 3  S-     0   0   17  349    0         D DDDD                                           DDDD  DDD DD D
   333  334 B S  S <  S+     0   0   12  349   35         H HMTT                                           TTST  HST TK S
   334  335 B F        -     0   0   78  349   71         T TTLL                                           NNNN  TNT NN N
   335  336 B L  E     -AC  50 329A   1  349    8         L LMLL                                           LLLL  LLL LL L
   336  337 B K  E     -AC  49 328A  60  346   23         R RKKK                                           KKKK  RKR KK K
   337  338 B I  E     -AC  48 327A   0  344   13         V VIVI                                           IIII   II II I
   338  339 B W  E      AC  46 326A   2  341    0         W WFWW                                           WWWW   WW WW W
   339  340 B N              0   0   10  297   57         A AA S                                           AAAA   AA AA A
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   80    0                                                                        
   342    3 G V        +     0   0   96   82   63                                                                        
   343    4 G I        -     0   0   38   84   34                                                                        
   344    5 G N    >   -     0   0  109   84   59                                                                        
   345    6 G I  G >  S+     0   0   25   84   30                                                                        
   346    7 G E  G 3  S+     0   0  122  126   44  QQ                                                                    
   347    8 G D  G <  S+     0   0  133  137   21  DDDD    D    D    D                                                   
   348    9 G L    <   -     0   0   35  141   15  LLMM    M    M    M                                                   
   349   10 G T     >  -     0   0   69  141   62  SSSS    S    S    S                                                   
   350   11 G E  H  > S+     0   0  116  143   33  KEDD    D    D    D                                                   
   351   12 G K  H >> S+     0   0   66  152   41  KKKK    K    K    K                                                   
   352   13 G D  H 3> S+     0   0   39  152   35  EEEE    E    E    E                                                   
   353   14 G K  H 3X S+     0   0   83  152   84  LLII    I    I    I                                                   
   354   15 G L  H < S+     0   0    7  233    6  EEEE    E    EE   E     EE                       E          E         
   365   26 G V  H 3< S+     0   0   43  233   53  VVVV    V    VV   V     VV                       A          A         
   366   27 G T  T 3< S+     0   0  116  233   82  KTNS    S    NN   S     NN                       S          S         
   367   28 G L    <   -     0   0   49  233   61  NTTT    T    TI   T     II                       I          V         
   368   29 G E        -     0   0  191  233   49  PPPP    P    PE   T     ED                       E          Q         
   369   30 G R        -     0   0   32  233    1  RRRR    R    RR   R     RR                       R          R         
   370   31 G M        -     0   0   53  233   85  AATT    T    TM   T     MM                       I          I         
   371   32 G L     >  -     0   0   75  232   81  PPAA    A    PM   A     MK                       K          Q         
   372   33 G V  H  > S+     0   0    4  232   15  VIVV    V    VV   V     VV                       V          V         
   373   34 G S  H  > S+     0   0   14  232    1  SSSA    S    AS   S     SS                       S          S         
   374   35 G K  H  > S+     0   0   93  232   38  RRGA    A    AK   V     KK                       K          Q         
   375   36 G C  H  X S+     0   0    0  233   62  TTSN    N    NA   N     AA                       A          A         
   376   37 G C  H  X S+     0   0    0  233   63  GGAC    C    CA   C     AA                       S          C         
   377   38 G E  H  X S+     0   0   75  233   68  KKAA    A    AA   K     AA                       A          E         
   378   39 G E  H  X S+     0   0   60  233   26  EEEE    D    LD   E     DE                       d          E         
   379   40 G F  H  X S+     0   0    3  233   36  IITT    T    TL   T     LL                       c          L         
   380   41 G R  H  X S+     0   0   53  233   79  KKII    I    VM   M     ML                       M          I         
   381   42 G D  H  X S+     0   0   67  233   65  DEAA    A    TA   E     AA                       S          K         
   382   43 G Y  H  X S+     0   0   43  233    2  YYFF    Y    FY   W     YY                       Y          Y         
   383   44 G V  H >X S+     0   0    0  233   58  VVVV    V    VC   V     CC                       C          C         
   384   45 G E  H 3X S+     0   0   71  233   47  EEEE    E    EE   E     EE                       E          Q         
   385   46 G E  H 3< S+     0   0  125  233   57  AAEE    G    QN   A     NA                       E          E         
   386   47 G R  H XX S+     0   0   94  233   69  QQRR    L    MH   Q     HH                       H          H         
   387   48 G S  H >< S+     0   0   12  233   67  AALL    L    VA   T     AA                       A          Q         
   388   49 G G  T 3< S+     0   0   38  233   80  GEPP    P    PK   E     KK                       R          K         
   389   50 G E  T <4 S+     0   0  138  232   54  RRNN    N    NE   G     EE                       N          T         
   390   51 G D    XX> -     0   0    1  232    0  DDDD    D    DD   D     DD                       D          D         
   391   52 G P  H 3>5S+     0   0   17  233   25  PPPP    P    PP   P     PP                       P          V         
   392   53 G L  H 345S+     0   0    6  233    3  LLLL    L    LL   L     LL                       L          L         
   393   54 G V  H <45S+     0   0   24  233   29  LLII    I    IV   I     VV                       L          V         
   394   55 G K  H  <5S-     0   0  149  233   80  RRKK    K    KT   K     TT                       V          T         
   395   56 G G     << -     0   0   38  233   34  GGGG    G    GP   G     PP                       G          G         
   396   57 G I        -     0   0   21  224   20  VVVV    V    VV   V     VV                       I          I         
   397   58 G P    >>  -     0   0   80  233   11  PPSP    P    AP   S     PP                       P          S         
   398   59 G E  T 34 S+     0   0   75  233   58  EEDD    D    DS   D     SS                       T          P         
   399   60 G D  T 34 S+     0   0  151  233   61  DDDE    D    DS   D     SS                       S          S         
   400   61 G K  T <4 S+     0   0  163  233   62  RRKK    K    KE   K     EE                       E          E         
   401   62 G N     <  -     0   0    1  233    0  NNNN    N    NN   N     NN                       N          N         
   402   63 G P  S    S+     0   0   36  224    0  PPPP    P    PP   P     PP                       P          P         
   403   64 G F  S    S-     0   0    3  224    0  FFYY    Y    YF   Y     FF                       F          F         
   404   65 G K              0   0  108  222   29  KKKK    K    KR   K     RR                       K          K         
   405   66 G E              0   0  201  217    3  EE            E         EE                       D          E         
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   62   10                                                                        
   408   14 P E        +     0   0  153  142   39      EEE        EEE EEEEE  EEEDEDEEEEEDEEEEEDEDEDD EDEEEE     D   D  D 
   409   15 P G  S    S+     0   0   38  144   37      DDD        GGG GGGGG  GGGGGGGGGGGGGGGGGGGGGGG GGGGGG     G   G  G 
   410   16 P Q  S    S-     0   0   94  148   90      PPP        III IIIII  IIISISIIIIISIIIIISIIIIT ITIIII     L   S  S 
   411   17 P A        +     0   0    1  149   53      VVV        SSS SSSST  SSSASASSSSSASSSSSASTSTA SASSSS     T   V  A 
   412   18 P S        +     0   0   28  149   71      TTT        VVV VVVVV  VVVVVVVIVVIVVVVVVVVVVVV VVVIII     V   I  V 
   413   19 P H  S    S+     0   0   42  151   57      VVV        NNN NNNNN  NNNNNNNNNNNNNNNNNNNNNNN NNNNNN     N   N  N 
   414   20 P T  S  > S-     0   0    2  152   17      ttt        TTT TTTTT  TTTTTTTTTTTTTTTTTTTTTTT TTTTTT     T   T  T 
   415   21 P G  H  > S-     0   0   10  164    2      ggg        GGG GGGGG  GGGGGGGGGGGGGGGGGGGGGGG GGGGGG     G   G  G 
   416   22 P P  H  > S+     0   0   14  165    0      PPP        PPP PPPPP  PPPPPPPPPPPPPPPPPPPPPPP PPPPPP     P   P  P 
   417   23 P K  H  > S+     0   0    6  165    0      KKK        KKK KKKKK  KKKKKKKKKKKKKKKKKKKKKKK KKKKKK     K   K  K 
   418   24 P G  H  X S+     0   0    0  165    1      GGG        GGG GGGGG  GGGGGGGGGGGGGGGGGGGGGGG GGGGGG     G   G  G 
   419   25 P V  H  X S+     0   0    0  165    0      VVV        VVV VVVVV  VVVVVVVVVVVVVVVVVVVVVVV VVVVVV     V   V  V 
   420   26 P I  H  X S+     0   0    4  165   14      III        III IIIII  IILIIIIIIIIIIIIIIIIIIII IIIIII     I   I  I 
   421   27 P N  H  X S+     0   0   48  165   42      NNN        NNN NNNNN  NNNNNNNNNNNNNNNNNNHNNNN NNNNNN     N   N  N 
   422   28 P D  H  X S+     0   0   14  166    0      DDD        DDD DDDDD  DDDDDDDDDDDDDDDDDDDDDDD DDDDDD     D   D  D 
   423   29 P W  H  X S+     0   0    6  166    0      WWW        WWW WWWWW  WWWWWWWWWWWWWWWWWWWWWWW WWWWWW     W   W  W 
   424   30 P R  H  < S+     0   0   67  166   26      RRR        RRR RRRRR  RRRRRRRRRRRRRRRRRRRRRRR RRRRRR     R   R  R 
   425   31 P K  H >X S+     0   0   67  166   36      KKK        RRR RRRRR  RRRRRRRRRRRRRRRRRRRRRRR RRRRRR     R   R  K 
   426   32 P F  H >X>S+     0   0    1  166    1      FFF        FFF FFFFF  FFFFFFFFFFFFFYFFFFYFFFF FFFFFF     F   F  Y 
   427   33 P K  H 3<5S+     0   0   30  166    7      KKK        kkk kkkkk  kkkkkkkkkkkkkkkkkkkkkkk kkkkkk     k   k  k 
   428   34 P L  H <45S+     0   0  139  161    1      LLL        lll lllll  lllllllllllllllllllllll llllll     l   l  l 
   429   35 P E  H <<5S+     0   0   86  161    9      EEE        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  E 
   430   36 P S  T  <5       0   0   57  162   66      sss        ttt ttttt  ttttttttttttttttttttttt tttttt     t   t  v 
   431   37 P E      <       0   0  118  167   66      mmm        kkk kkkkq  kekkkkkkkkkkkkkkkkkkkkk kkkkkk     k   k  k 
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  143   42      SSS        iii iiiii  iliiiiiiiiiiiiiiiiiimii iiiiii     i   i  i 
   434   69 P S        +     0   0   52  144   64      AAA        SSS SSSSS  SGSNSNSSSSSNSSSSSNSNSNN SNSSSS     N   N  K 
   435   70 P R        -     0   0  103  120   85      ...        GGG GGGEG  GAGGGGGGGGGGGGGGGGGGSGG GGGGGG     G   .  S 
   436   71 P K        +     0   0   22  123   12      ...        KKK KKKKK  KKKKKKKKKKKKKKKKKKKKKKK KKKKKK     K   .  K 
   437   72 P M  S    S-     0   0   12  124   13      ...        MMM MMMMM  MMMMMMMMMMMMMMMMMMMMMMM MMMMMM     M   .  M 
   438   73 P S     >  -     0   0   52  131   65      ...        TTT TTTTT  TTTTTTTTTTTTTTTTTTTTTTT TTTTTT     T   G  T 
   439   74 P V  H  > S+     0   0  107  130   53      ...        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   K  M 
   440   75 P Q  H  > S+     0   0  133  130   52      ...        KKK KKKKK  KKKQKQKKKKKQKKKKKQKKKKQ KQKKKK     K   M  Q 
   441   76 P E  H  > S+     0   0   38  134   26      ...        EEE EEEEE  EEEEEEEEEEDEEEEEEEDEEEE DEDEEE     E   T  E 
   442   77 P Y  H  X S+     0   0   36  146   56      QQQ        FFF FFFFF  FFFYFYFFFFFYFFFCFYFYFYY LYLFFF     Y   M  Y 
   443   78 P E  H  < S+     0   0  111  154   61      EEE        ASA ATAAA  AAANANAAAATNAAAGANAGAGN ANAGGG     G   Q  N 
   444   79 P L  H >X S+     0   0   45  155   57      YYY        VMM RMMMM  MMMMMMMTMMMMMMIMMMMVVMM VMVTTT     I   E  M 
   445   80 P I  H 3< S+     0   0   37  157   72      EEE        MMM MMMMM  MMRIMIMVMMMIMMMMMILVMMI MIMKKK     M   Y  L 
   446   81 P H  T 3< S+     0   0  178  158   80      LLL        NNN NNNNN  NNNHNHNDNNNHNNNDNHNNNKH NHNDDD     Q   N  Q 
   447   82 P K  T <4 S+     0   0  140  157   65      III        EEE EEEEE  EEENENEKEEENEEEKENEDEED EDEKKK     D   M  E 
   448   83 P D     <  -     0   0   58  169   39      KKK        DDD DDDDD  DDDDDDDNDDDDDDDNDDDKDEG DGDNNN     G   F  D 
   449   84 P K        -     0   0  205  149   80      EEE        QQR QQQRQ  QQQEQEQLQQQEQQQLQEQQQQE QEQLLL     Q   E  E 
   450   85 P E        -     0   0   45  150   68      EEE        DDD DDDDD  DDDDDDDDDDDDDDDDDDDDDDD DDDDDD     D   D  D 
   451   86 P D    >>  -     0   0   87  169   31      DDD        DDD DDDDD  DDDDDDDDDDDDDDDDDDDDDDD DDDDDD     D   D  D 
   452   87 P E  H 3> S+     0   0  113  168   12      EEE        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  E 
   453   88 P N  H 3> S+     0   0   73  169   59      KKK        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEAEE EAEEEE     A   E  D 
   454   89 P C  H <> S+     0   0   32  170   72      SSS        FFF FFFFF  FFFFFFFFFFFFFFFFFFFFFFF FFFFFF     F   F  F 
   455   90 P L  H  X S+     0   0    4  170    2      LLL        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   456   91 P R  H  X S+     0   0  131  170   63      RRR        QQQ QQQQQ  QQQQQQQQQQQQQQQQQQQQQQQ QQQQQQ     Q   Q  R 
   457   92 P K  H  X S+     0   0  112  170   59      KKK        KQQ QQQQQ  QQQRQRQQQQQRQQQQQRQQQQQ QQQQQQ     Q   Q  Q 
   458   93 P Y  H  X S+     0   0    7  170    5      YYY        YYY YYYYY  YYYYYYYYYYYYYYYYYYYYYYY YYYYYY     Y   Y  Y 
   459   94 P R  H  X S+     0   0   31  170   31      RRR        RRR RRRRR  RRRRRRRRRRRRRRRRRRRRRRR RRRRRR     R   R  R 
   460   95 P R  H  X S+     0   0  130  170   43      KKK        KKK KKKKK  KKKKKKKKKKKKKKKKKKKKKKK KKKKKK     K   R  M 
   461   96 P Q  H  X S+     0   0   96  170   30      QQQ        QQQ QQQQQ  QQQQQQQQQQQQQQQQQQQQQQQ QQQQQQ     Q   Q  Q 
   462   97 P C  H  X S+     0   0   22  170   72      CCC        RRR RRRRR  RRRRRRRRRRRRRRRRRRRRRRR RRRRRR     R   R  R 
   463   98 P M  H  X S+     0   0   33  170   11      MMM        MMM MMMMM  MMIMMMMMMMMMMMMMMMMMMMM MMMMMM     M   M  I 
   464   99 P Q  H  X S+     0   0  115  170   54      QQQ        EEE DEEEE  EEEEEEEEEEEEEEEDEEEDEDE EEEEEE     E   E  E 
   465  100 P D  H  X S+     0   0   46  170   21      EEE        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  E 
   466  101 P M  H  X S+     0   0   23  170    2      MMM        MMM MMMMM  MMMMMMMMMMMMMMMMMMMMMMM MMMMMM     M   M  M 
   467  102 P H  H  X S+     0   0   64  170   74      HHH        RQR RRRRR  QRRRRRRRRRRRRRRRRRRRRRR RRRRRR     R   R  R 
   468  103 P Q  H  < S+     0   0  143  170   59      EEE        QQQ QQQQQ  QQQQQQQQQQQQQQQQQQQQRQQ QQQQQQ     Q   K  R 
   469  104 P K  H  < S+     0   0  140  170   55      RRR        QQQ QQQQQ  QQQQQQQQQQQQQQQQQQQQQQQ QQQQQQ     Q   Q  Q 
   470  105 P L  H  < S+     0   0   35  170   43      LLL        LLL LLLLL  LLLLLLLFLLLLLLLLLLLLLLL LLLFFF     L   L  L 
   471  106 P S     <  -     0   0   75  170   79      SSS        HHH HHHHH  HHHYHYHQHHHYHHHHHYHHHHH YHYHHH     H   Y  C 
   472  107 P F        -     0   0   71  168   99      FFF        KRK KKKKK  KRKSKSKKKKKSKKKKKSKSRSS QSQKKK     S   T  R 
   473  108 P G        -     0   0   36  168   51      GGG        GGG GGGGG  GGGGGGGGGGGGGGGGGGGgGgG GGGGGG     G   G  G 
   474  109 P P        +     0   0   92  160   41      PPP        PPP PPPPP  PPPQPQPPPPPQPPPPPQPhPhQ PQPPPP     P   K  K 
   475  110 P R        +     0   0  177  165   61      KKK        QQQ QQQQQ  QQQQQQQQQQQQQQQQQQQQQQQ QQQQQQ     Q   R  R 
   476  111 P Y        +     0   0   51  166    5      FFF        FFF FFFFF  FFFFFFFFFFFFFFFFFFFFFFF FFFFFF     F   F  F 
   477  112 P G        +     0   0   12  170   61      EEE        KRK KKKKK  RKKKKKKKKKKKKKKKKKKSKRK KKKKKK     K   E  E 
   478  113 P F  S    S-     0   0  151  170  103      GGS        KQQ QQQQQ  QQQQQQQQQQQQQQQQQKQQQQQ QQQQQQ     Q   S  R 
   479  114 P V  E     -v  532   0H  28  170   13      VVV        VVV VVVVV  VVVVVVVVVVVVVVVVVVVVVVV VVVVVV     V   V  V 
   480  115 P Y  E     -v  533   0H  71  165   68      YYY        FFF FFFFF  FFFFFFFFFFFFFFFLFFFFFFF FFFFFF     F   Y  Q 
   481  116 P E  E     -v  534   0H 108  170   41      DDD        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  E 
   482  117 P L        -     0   0   12  170   32      LLL        III IIIII  IIIIIIIIIIIIIIIIIIIIIII IIIIII     I   L  L 
   483  118 P E        +     0   0  134  170   74      DDD        PPP PPPPP  PPPTSTSPSSPTSPSPSTPTPTT PSPPPP     P   S  G 
   484  119 P S  S >> S-     0   0   57  170   53      SSS        SSS SSSSS  SSSSSSSSSSSSSSSSSSSSSSS SSSSSS     S   S  G 
   485  120 P G  H 3> S+     0   0   15  169   40      GGG        GGG GGGGG  GGGGGGGGGGGGGGGGGGGGGGG GGGGGG     G   G  G 
   486  121 P E  H 3> S+     0   0  127  170   23      EEE        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  E 
   487  122 P Q  H <> S+     0   0   72  170   61      AAA        GGG GGGGG  GGGAGAGGGGGAGGGGGAGAGAE GGGGGG     G   E  E 
   488  123 P F  H  X S+     0   0   26  170    1      FFF        FFF FFFFF  FFFFFFFFFFFFFFFFFFFFFFF FFFFFF     F   F  F 
   489  124 P L  H  X S+     0   0   90  170    6      LLL        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   490  125 P E  H  X S+     0   0  103  170   41      EEE        DDE DDDDD  DDDDDDDDDDDDDDDDDDDDDDD DDDDDD     E   D  E 
   491  126 P T  H  < S+     0   0   10  170   76      VVV        MMM MMMMM  MMMTMTMMMMMTMMMMMTMTMTT MTMMMM     T   T  A 
   492  127 P I  H  < S+     0   0   17  170   12      III        III IIIII  IIIVIVIIIIIVIIIIIVIVIVV IVIIII     V   I  L 
   493  128 P E  H  < S+     0   0  139  170   20      EEE        DDD DDDDD  DDDDDDDDDDDDDDDDDDDDDDD DDDDDD     D   E  D 
   494  129 P K  S  < S+     0   0  172  170   35      KKK        KKK KKKKK  KKKKKKKKKKKKKKKKKKKKKKK KKKKKK     K   R  K 
   495  130 P E  S    S-     0   0   38  166    5      EEE        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  E 
   496  131 P Q    >   -     0   0  116  170   66      HHH        QQQ QQQQQ  QQQHQHQQQQQHQQQQQHPQQQH QHQQQQ     P   Q  D 
   497  132 P K  T 3  S+     0   0  156  170   34      RRR        KKK KKKKK  KKKKKKKKKKKKKKKKKKKKKKK RKRKKK     K   K  K 
   498  133 P I  T 3  S+     0   0   68  170   87      LLL        SSS SSSSS  SSSSSSSNSSSSSSSSSSGNSSN SNSSSS     S   N  S 
   499  134 P T    <   -     0   0   10  170   35      TTT        TTT TTTTT  TTTTITITIITTITITITTTTTT TTTTTT     T   T  T 
   500  135 P T  E     -W  558   0H   7  169   62      VVV        LLL PVLLL  LLLLVLVLVVLLVLVLVLLLLLL LLLLLL     L   L  L 
   501  136 P I  E     -Wx 557 531H   3  170   15      VVV        III IIIII  IIIIIIIIIIIIIIIIIIIIIII IIIIII     V   V  I 
   502  137 P V  E     -Wx 556 532H   0  170   35      VVV        MMM MMMMM  MMMMMMMMMMMMMMMMMMMVMVM MMMMMM     I   M  M 
   503  138 P V  E     -Wx 555 533H   0  170   12      VVV        VVV VVVVV  VVVIVIVVVVVIVVVVVIVIVII VIVVVV     I   I  I 
   504  139 P H  E     -Wx 554 534H   0  170    6      HHH        HHH HHHHH  HHHHHHHHHHHHHHHHHHHHHHH HHHHHH     H   H  H 
   505  140 P I  E     +Wx 553 535H   2  170    1      III        III IIIII  IIIIIIIIIIIIIIIIIIIIIII IIIIII     I   I  I 
   506  141 P Y  E     - x   0 536H   4  170    2      YYY        YYY YYYYY  YYYYYYYYYYYYYYYYYYYYYYY YYYYYY     Y   Y  Y 
   507  142 P E    >   -     0   0   45  170   26      KKK        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  E 
   508  143 P D  T 3  S+     0   0   95  170   51      DDD        DDD DDDDD  DDDDDDDDDDDDDDDDDDDDDDD DDDDDD     D   D  P 
   509  144 P G  T 3  S+     0   0   66  170   48      GGG        GGG GGGGG  GGGDGDGGGGGDGGGGGDGDGDD GDGGGG     D   D  E 
   510  145 P I  S X> S-     0   0   36  170   33      VVV        III IIIII  IIIIIIIIIIIIIIIVIIIIVII IIIVVV     I   I  I 
   511  146 P K  T 34 S+     0   0  191  170   71      PPP        PPP PPPPP  PPPPPPPPPPPPPPPPPPPPPPP PPPPPP     P   P  P 
   512  147 P G  T 3> S+     0   0   13  170   22      GGG        GGG GGGGG  GGGGGGGGGGGGGGGGGGGGGGG GGGGGG     G   S  G 
   513  148 P C  H <> S+     0   0    0  170   35      CCC        TTT TTNTT  TTTATATTTTTTTTTTTSTATAS TSTTTT     A   C  C 
   514  149 P D  H  X S+     0   0   78  170   47      EEE        EDE EEEEE  DEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  D 
   515  150 P A  H  > S+     0   0   44  170   50      AAA        AAA AAAAA  AAASASAAAAASAAAAASAAAAS ASAAAA     P   S  A 
   516  151 P L  H  X S+     0   0    0  170   11      LLL        MMM MMMMM  MMMLMLMMMMMLMMMMMLMMMMV MVMMMM     M   M  M 
   517  152 P N  H  X S+     0   0   19  170   16      NNN        NHN NNNHN  HNNHNNNNNNHNNNNNNNNNHNN NNNNNN     N   N  S 
   518  153 P S  H  X S+     0   0   78  170   56      SSS        GGG GGGGG  GGGGGGGGGGGGGGGGGGGGGGG GGGGGG     G   G  G 
   519  154 P S  H  X S+     0   0    6  170   35      SSS        CCC CCCCC  CCCCCCCCCCCCCCCCCCCCCCC CCCCCC     C   C  S 
   520  155 P L  H  X S+     0   0    1  170   10      LLL        MMM MMMMM  MMMMMMMMMMMMMMMMMMMMMMM MMMMMM     M   L  L 
   521  156 P I  H  X S+     0   0  105  170   85      DDD        III VIIII  IIIIIIIIIIIIIIIIIIIIIIM LILIII     I   I  L 
   522  157 P C  H  X S+     0   0   63  170   38      CCC        CCC CCCCC  CCCCCCCCCCCCCCCCCCCCCCC CCCCCC     C   C  C 
   523  158 P L  H  X S+     0   0    0  170    4      LLL        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   524  159 P A  H  < S+     0   0    1  170    9      AAA        AAA AAAAA  AAAAAAAAAAAAAAAAAAAAAAA AAAAAA     A   A  A 
   525  160 P A  H  < S+     0   0   61  170   67      TTT        AAA ATAAA  AAAAAAATAAAAAGAAAAAAGAA AAATTT     A   A  H 
   526  161 P E  H  < S+     0   0   72  170   23      EEE        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  E 
   527  162 P Y    ><  +     0   0    5  170    2      YYY        YYY YYYYY  YYYYYYYYYYYYYYYYYYYYYYY YYYYYY     Y   Y  Y 
   528  163 P P  T 3  S+     0   0   28  170   29      AAA        PPP PPPPP  PPPPPPPPPPPPPPPPPPPSPTP PPPPPP     P   P  P 
   529  164 P M  T 3  S+     0   0   26  170   86      SSS        AAA AAAAA  AAATATAAAAATAAATATASAST ATAAAA     A   V  L 
   530  165 P V  S <  S-     0   0    1  170    8      VVV        VVV VVVVV  VVVVVVVVVVVVVVVVVVVVVVV VVVVVV     V   V  V 
   531  166 P K  E     - x   0 501H  37  170    2      KKK        KKK KKKKK  KKKKKKKKKKKKKKKKKKKKKKK KKKKKK     K   K  K 
   532  167 P F  E     +vx 479 502H   0  170    1      FFF        FFF FFFFF  FFFFFFFFFFFFFFFFFFFFFFF FFFFFF     F   F  F 
   533  168 P C  E     -vx 480 503H   0  170   18      CCC        CCC CCCCC  CCCCCCCCCCCCCCCCCCCCCCC CCCCCC     C   C  C 
   534  169 P K  E     +vx 481 504H  51  170   37      RRR        RRR RRRRR  RRRKRRRRRRRRRRKRRKRRRRR RRRRRR     K   R  C 
   535  170 P I  E     - x   0 505H   1  170   21      III        VVV VVVVV  VVVVVVVVVVVVVVVVVVVVVVV VVVVVV     V   I  V 
   536  171 P K  E >>  - x   0 506H  52  170   72      CCC        KKK KKKKK  KKKKKKKKKKKKKKKRKKKKRKK RKRRRR     K   K  R 
   537  172 P A  H >> S+     0   0   13  170   46      AAA        SSS SSSSS  SSSSSSSSSSSSSSSSSSSSSSS SSSSSS     S   S  S 
   538  173 P S  H 34 S+     0   0   88  170   30      CCC        SSS SSSSS  SSSSSSSSSSSSSSSSSSSSSSS SSSSSS     S   S  S 
   539  174 P N  H <4 S+     0   0   67  170   86      DDD        VVV VVVVV  VVVLVLVVVVVLVVVVVLVLVLL VLVVVV     L   A  A 
   540  175 P T  H << S-     0   0   25  170   73      TTT        III IIIII  IIIIIIIIIIIIIIIIIIIIIII IIIIII     I   I  I 
   541  176 P G     <  +     0   0   66  169   22      GGG        GGG GGGGG  GGGGGGGGGGGGGGGGGGGGGGG GGGGGG     G   G  S 
   542  177 P A    >   -     0   0   39  170   55      AAA        AAA AAAAA  AAAAAAAAAAAAAAAAAAAAAAA AAAAAA     A   A  I 
   543  178 P G  T 3  S-     0   0   70  169   43      GGG        SSS SSSSS  SSSSSSSSSSSSSSSSSSSSSSS SSSSSS     S   S  S 
   544  179 P D  T 3  S+     0   0  151  169   78      DDD        SSS SSSSS  GSSASASSSSSTSSSSSTSSSST STSSSS     T   S  A 
   545  180 P R  S <  S+     0   0  167  169   58      RRR        RRR RRRRR  RRRRRRRRRRRRRRQRRRRRRRR RRRRRR     R   R  L 
   546  181 P F  S    S+     0   0   35  169    0      FFF        FFF FFFFF  FFFFFFFFFFFFFFFFFFFFFFF FFFFFF     F   F  F 
   547  182 P S    >>  -     0   0   34  169   70      CCC        TTT TTTTT  TTTTTTTTTTTTTTTTTTTTTTT TTTTTT     T   T  R 
   548  183 P S  T 34 S+     0   0   86  169   84      DDD        RSR RRRRR  RRRNRNRRRRRNRRRRRNRNRNN rNRRRR     N   E  E 
   549  184 P D  T 34 S+     0   0  126  169   66      DDD        NSN NNNNN  NNNNNNNNNNNNNNNNNNNNNNN nNNNNN     N   N  S 
   550  185 P V  T <4 S+     0   0   20  169   65      VVV        AAA AAAAA  AAAAAAAAAAAAAAAAAAAAAAA AAAAAA     A   A  A 
   551  186 P L     <  +     0   0    8  170   13      LLL        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   552  187 P P  S    S+     0   0    1  170    0      PPP        PPP PPPPP  PPPPPPPPPPPPPPPPPPPPPPP PPPPPP     P   P  P 
   553  188 P T  E     -W  505   0H   1  170   42      AAA        AAA AAAAA  AAAAAAAAAAAAAAAAAAAAAAA AAAAAA     A   A  A 
   554  189 P L  E     -WY 504 566H   0  170    2      LLL        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   555  190 P L  E     -WY 503 565H   4  170    9      LLL        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   556  191 P V  E     +WY 502 564H   0  170   19      VVV        ILI IIIII  IIIVIVIIIIIVIIIIIIIIIIM IIIIII     I   V  V 
   557  192 P Y  E     +WY 501 562H  31  170    0      YYY        YYY YYYYY  YYYYYYYYYYYYYYYYYYYYYYY YYYYYY     Y   Y  Y 
   558  193 P K  E >  S-WY 500 561H  25  170   12      KKK        KKK KKKKK  KKKKKKKKKKKKKKKKKKKKKKK KKKKKK     R   K  K 
   559  194 P G  T 3  S-     0   0   25  170   41      AAA        GGG GGGGG  GGAAGAGAGGGAGGGAGAGGGGG GGGAAA     G   G  G 
   560  195 P G  T 3  S+     0   0   48  170   21      GGG        GGG GGGGG  GGGGGGGGGGGGGGGGGGGGGGG GGGGGG     G   G  G 
   561  196 P E  E <   -Y  558   0H  38  170   36      EEE        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  D 
   562  197 P L  E     +Y  557   0H  34  170   12      LLL        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   563  198 P L  E     -     0   0H   2  170   20      LLL        III IIIVI  IIIIIIIIIIVIIIIIIIIIIII IIIIII     I   I  I 
   564  199 P S  E     -Y  556   0H   4  170   30      GGG        GGG GGGGG  GGGGGGGGGGGGGGGGGGGGGGG GGGGGG     G   G  G 
   565  200 P N  E     -Y  555   0H  41  170    0      NNN        NNN NNNNN  NNNNNNNNNNNNNNNNNNNNNNN NNNNNN     N   N  N 
   566  201 P F  E >   -Y  554   0H   3  170    1      FFF        FFF FFFFF  FFFFFFFFFFFFFFFFFFFFFFF FFFFFF     F   F  F 
   567  202 P I  T 3  S-     0   0   87  168   25      LLL        VVV VVVVV  VVVVVVVVVVVVVVVVVVVVVVV VVVVVV     V   V  V 
   568  203 P S  T >  S-     0   0   11  168   71      AAA        RRR RRRRR  RRRRRRRRRRRRRRRRRRRRRRR RRRRRR     R   R  R 
   569  204 P V  G X  S+     0   0    0  168   35      VVV        VVV VVVVV  VVVIVIVVVVVIVIVVVIVVVVI VIVVVV     V   I  L 
   570  205 P T  G >  S+     0   0   17  168   36      TTT        TTT TTTTT  TTTTTTTTTTTTTTTTTTTTTTT TTTTTT     T   S  T 
   571  206 P E  G <  S+     0   0  156  168   35      QQQ        DDD DDDDD  DDDDDDDDDDDDDDDDDDDDDDD DDDDDD     D   D  D 
   572  207 P Q  G <  S+     0   0   84  168   43      HHH        QQQ QQQQQ  QQQQQQQQQQQQQQQQQQQQQQQ QQQQQQ     Q   Q  Q 
   573  208 P L  S <  S-     0   0   31  168   11      FFF        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   574  209 P A    >   -     0   0   49  168   51      SSS        GGG GGGGG  GGGGGGGGGGGGGGGGGGGGGGG GGGGGG     G   G  G 
   575  210 P E  T 3  S+     0   0  201  168   27      EEE        EEE EEEEE  EEEEDEDEDDEEDEDEDEEEEEE EEEEEE     E   M  E 
   576  211 P E  T 3  S+     0   0  166  168   21      EEE        DDD DDDDD  DDDDDDDDDDDDDDDDDDDDDDD DDDDDD     D   D  D 
   577  212 P F    <   -     0   0   17  168    0      FFF        FFF FFFFF  FFFFFFFFFFFFFFFFFFFFFFF FFFFFF     F   F  F 
   578  213 P F    >>  -     0   0  146  168   24      FFF        FFF FFFFF  FFFFFFFFFFFFFFFFFFFFFFF FFFFFF     F   F  F 
   579  214 P T  H 3> S+     0   0   24  167   24      AAA        AAA AAAAA  AAAAAAAAAAAAAAAAAAAAAAA AAAAAA     A   A  A 
   580  215 P G  H 3> S+     0   0   32  167   71      TTT        VVV VVVVV  VVVVVVVVVVVVVVVVVVVVVVV VVVVVV     V   V  V 
   581  216 P D  H <> S+     0   0   57  167    4      DDD        DDD DDDDD  DDDDDDDDDDDDDDDDDDDDDDD DDDDDD     D   D  D 
   582  217 P V  H  X S+     0   0    0  167   23      VVV        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   583  218 P E  H  X S+     0   0   32  167    8      EEE        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  E 
   584  219 P S  H  X S+     0   0   58  167   52      AAA        AAA AAAAA  AAAAAAAAAAAAAAAAAAAAAAA AAAAAA     A   A  A 
   585  220 P F  H  < S+     0   0    2  168    2      FFF        FFF FFFFF  FFFFFFFFFFFFFFFFFFFFFFF FFFFFF     F   F  L 
   586  221 P L  H ><>S+     0   0    0  168    0      LLL        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   587  222 P N  H ><5S+     0   0   61  168   82      NNN        QQQ QQQQQ  QQQQQQQQQQQQQQQQQQQQQQQ QQQQQQ     Q   R  Q 
   588  223 P E  T 3<5S+     0   0   70  168   18      AAA        EEE EEEEE  EEEEEEEEEEEEEEEEEEEEEEE EEEEEE     E   E  E 
   589  224 P Y  T < 5S-     0   0   20  165   47      YYY        FFF FFFFF  FFFCFCFFFFFCFFFFFCFCFCC FCFFFF     C   C  Y 
   590  225 P G  T < 5S+     0   0    6  165    6      GGG        GGG GGGGG  GGGGGGGGGGGGGGGGGGGGGGG GGGGGG     G   S  G 
   591  226 P L      < +     0   0    2  165   18      LLL        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   592  227 P L  S    S-     0   0   10  161    8      LLL        LLL LLLLL  LLLLLLLLLLLLLLLLLLLLLLL LLLLLL     L   L  L 
   593  228 P P        -     0   0   40  161   31      PPP        PPP PPPPP  PPPPPPPPPPPPPPPPPPPPPPP PPPPPP     P   P  P 
   594  229 P E              0   0   94  159   17      EEE        EEE EEEEE  DEEEEEEEEEEEEEEEEEEEEEE EEEEEE     D   E  E 
   595  230 P K              0   0  161  158   24      KKK        KKK KKKKK  KKKKKKKKKKKKKKKKKKKKKKK KKKKKK     K   K  K 
## ALIGNMENTS  561 -  630
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....7....:....8....:....9....:....0....:....1....:....2....:....3
     1    2 B S              0   0  117  267   60                          E        E          T                         
     2    3 B E     >  -     0   0  107  283   60                          T        T          K K                       
     3    4 B L  H  > S+     0   0   52  299   33                          V        V          I I                       
     4    5 B D  H  > S+     0   0  104  300   57                          N        N          IDD                       
     5    6 B Q  H  > S+     0   0  131  301   62                          N        N          ATL                       
     6    7 B L  H  X S+     0   0   27  302   65                          L        L          AAS                       
     7    8 B R  H  X S+     0   0  110  311   10  K                       R        R          RRR                       
     8    9 B Q  H  X S+     0   0  117  312   60  A                       D        D          SEQ                       
     9   10 B E  H  X S+     0   0   78  313   13  E                       R        R          EEE                       
    10   11 B A  H  X S+     0   0    1  313   25  V                       L        L          AVT                       
    11   12 B E  H  X S+     0   0  121  315   21  Q  E                    R        I          QPK                       
    12   13 B Q  H  X S+     0   0  111  323   73  S  K    D     D     DD  Q        Q          ASH                       
    13   14 B L  H  X S+     0   0   14  348    5  LLLLLL LL LL LL L LLLLL R LL L  LR          LLL                       
    14   15 B K  H  X S+     0   0   99  348   37  RRRKRR RR RR RR R RRRRR R KR R  RR          YTY                       
    15   16 B N  H  X S+     0   0   33  348   56  EEEQEE EE EE EE E EEEEE L EE E  EL          NQN                       
    16   17 B Q  H  X S+     0   0   82  348   60  QRRKRR RK RR RK R RRKKR Q RR R  RQ          EQQ                       
    17   18 B I  H  X S+     0   0    7  348   18  LLLRLL LL LL LL L LLLLL L LL L  LL          LII                       
    18   19 B R  H  X S+     0   0  135  348   59  HRKLKR KK RR KK K RRKKS L KR K  KL          EED                       
    19   20 B D  H  X S+     0   0   85  349   72  Eqqqeq qq qq qq e qqqqr d qq e  qd          Kkk                       
    20   21 B A  H  X S+     0   0   36  249   44  .saaas aa ys aa a syaaa g as a  ag          Ves                       
    21   22 B R  H >X S+     0   0   22  349   28  KRRRRR KR SR KK K RSKRR R RK R  KR          KHR                       
    22   23 B K  H 3< S+     0   0  136  350   43  RTASST SS KT ST S TKTSS S AS S  SS          NSA                       
    23   24 B A  H 3< S+     0   0   79  350   64  aQQQQQ QQ AQ QQ Q QAQQQ P QQ Q  QP          RgH                       
    24   25 B C  H << S+     0   0   19  306   94  l..... .. .. .. . ..... . .. .  ..          La.                       
    25   26 B A     <  +     0   0   46  309   60  L..... .. .. .. . ..... . .. .  ..          HQ.                       
    26   27 B D        +     0   0   88  312    3  D..... .. .. .. . ..... . .. .  ..          DGD                       
    27   28 B A        -     0   0   17  315   51  T..... .. .. .. . ..... . .. .  ..          SSA                       
    28   29 B T    >>  -     0   0   59  315   41  D..... .. .. .. . ..... . .. .  ..          TPN                       
    29   30 B L  H 3> S+     0   0    0  317    9  G..... .. .. .. . ..... . .. .  ..          LVL                       
    30   31 B S  H 34 S+     0   0   38  323   90  GG...G .. .G .. . G.... . .G .  ..          DRL                       
    31   32 B Q  H X4 S+     0   0  119  330   65  PR...R .. QR .. . RQ... . .R .  ..          EAD                       
    32   33 B I  H 3< S+     0   0   28  332   58  FT...T .. GT .. . TG... . .V .  ..          IPM                       
    33   34 B T  T >< S+     0   0    0  343   62  IP..GP G. RP G. . PR..G . .P G  G.          SSA                       
    34   35 B N  T <  S+     0   0  129  351   77  PVGGRV RG TV RG G VTGGR . GV R  R.          YAK                       
    35   36 B N  T 3  S+     0   0  111  351   67  aSkkSS Tk AS Ak k SAkkA . qS A  S.          SAS                       
    36   37 B I  S <  S-     0   0   21  338   72  fFppPF Pp .F Pp p F.ppP . r. P  A.          I.V                       
    37   38 B D        -     0   0  138  345   57  VNVVVN VV VN VV L NVVVV V V. V  IV          P.S                       
    38   39 B P        -     0   0   89  348   62  VPSTTP TI SP TT T PSTTT K S. T  SK          G.P                       
    39   40 B V        -     0   0   23  350   41  VTFFFT FF FT FF F TFFFF F FF F  FF          I.L                       
    40   41 B G        -     0   0   54  353   52  IDGGGD GG ND GG G DNGGG G GN G  NG          P.K                       
    41   42 B R        -     0   0  115  354   44  SLPPPL PP QL PP P LPPPP A PP P  SA          KKT                       
    42   43 B I        +     0   0    8  354   63  FVTTTV TT TV TT T VTTTT T TT T  TT          nLd                       
    43   44 B Q        -     0   0   54  340   61  v.DDD. DD D. DD D .DDDD D DD D  DD          n.i                       
    44   45 B M        -     0   0   11  345   12  m.LLL. IL L. IL L .LLLI L LL L  LL          l.l                       
    45   46 B R        -     0   0   49  346   51  V.VVV. LV V. LV V .VVVL V VV V  IV          K.T                       
    46   47 B T  E     +A  338   0A  12  350   67  CCCCCC CC CC CC C CCCCC C CC C  CC          L.P                       
    47   48 B R  E     +     0   0A  56  355   56  VCCCCC CC CC CC C CCCCC C CC C  CC          YRT                       
    48   49 B R  E     -A  337   0A  60  355   15  RRRRRR RR RR RR R RRRRR R RR R  RR          NRL                       
    49   50 B T  E     -A  336   0A  30  355   27  TTTITT TI TT TI T TTIIT T TT A  TT          TTV                       
    50   51 B L  E     -A  335   0A   0  355    2  LLLLLP LL LL LL L LLLLL L LL L  LL          LLL                       
    51   52 B R        +     0   0  159  355   41  QQQQQQ QQ QQ QQ Q QQQQQ Q QQ Q  QQ          RKK                       
    52   53 B G        +     0   0   20  355    0  GGGGGG GG GG GG G GGGGG G GG G  GG          GGG                       
    53   54 B H        -     0   0    4  355    0  HHHHHH HH HH HH H HHHHH H HH H  HH          HHH                       
    54   55 B L  S    S+     0   0  116  355   50  TSTTAS TT SS TT T SSTTT T SS T  TT          NFN                       
    55   56 B A  S    S-     0   0    0  355   30  GGGGGG GG GG GG G GGGGG G GG G  GG          NGN                       
    56   57 B K        -     0   0   15  355    0  KKKKKK KK KK KK K KKKKK K KK K  KK          KRK                       
    57   58 B I  E     -D   73   0B   0  355    9  IVVVVV VV VV VV V VVVVV V VV V  VV          IIV                       
    58   59 B Y  E     -     0   0B   6  355   20  YYYYYY YY YY YY Y YYYYY Y YY Y  YH          AAS                       
    59   60 B A  E     -D   72   0B  13  355   32  SSSSSS SS SS AS S SSSSS S SS S  SS          KAD                       
    60   61 B M  E     -D   71   0B  15  355   10  LLLLLL LL LL LL L LLLLL L LL L  LL          TLF                       
    61   62 B H  E     -D   70   0B  44  355   33  DDDDDD DD DD DD D DDDDD D DD D  DD          QHR                       
    62   63 B W  E     -D   69   0B  11  355    0  WWWWWW WW WW WW W WWWWW W WW W  WW          WWW                       
    63   64 B G    >   -     0   0    3  355   54  aTTTTT TT TT TT T TTTTT T TT T  TT          SGS                       
    64   65 B T  T 3  S+     0   0   75  355   66  rPAPSP SP PP SP S PPPPS P PP S  PP          SGS                       
    65   66 B D  T 3  S-     0   0   80  355   12  EEEEEE EE EE EE E EEEEE E EE E  EE          DDD                       
    66   67 B S  S <  S+     0   0    3  355   57  TKKKKK KK KK KK K KKKKK R RK K  RS          SSS                       
    67   68 B R  S    S+     0   0   94  355   47  SNNNNN NN NN NN N NNNNN N NN N  NN          SKK                       
    68   69 B L  E     + E   0  82B  31  355   87  RWRRRW RR WW RR R WWRRR R RW R  RR          KTS                       
    69   70 B L  E     -DE  62  81B   0  355   23  IIIIII II II II I IIIII I II I  II          LVI                       
    70   71 B L  E     -DE  61  80B   0  355    7  VVVVVV VV VV VV V VVVVV V VV V  VV          LVL                       
    71   72 B S  E     -DE  60  79B   0  354    2  SSSSSS SS SS SS S SSSSS S SS S  SS          STS                       
    72   73 B A  E     -DE  59  78B   0  354    5  AAAAAA AA AA TA A AAAAA A AA A  AA          AAA                       
    73   74 B S  E >>  -DE  57  77B   0  354    2  SSSSSS SS SS SS S SSSSS S SS S  SS          SGS                       
    74   75 B Q  T 34 S+     0   0    1  355    1  QQQQQQ QQ QQ QQ Q QQQQQ Q QQ Q  QQ          QQQ                       
    75   76 B D  T 34 S-     0   0    9  355    0  DDDDDD DD DD DD D DDDDD D DD D  DD          DDD                       
    76   77 B G  T <4 S+     0   0    7  355    1  GGGGGG GG GG GG G GGGGG G GG G  GG          GGG                       
    77   78 B K  E  <  -EF  73  93B  52  355   34  RRRRRR RR RR RR R RRRRR R RR R  RR          YNF                       
    78   79 B L  E     -EF  72  92B   0  355    4  LLLLLL LL LL LL L LLLLL L LL L  LL          MLM                       
    79   80 B I  E     -EF  71  91B   0  355    7  IIIIII II II II I IIIII I II I  II          IIL                       
    80   81 B I  E     -EF  70  90B   0  355   18  VVVVVV VV VV VV V VVVVV V VV V  VV          LLI                       
    81   82 B W  E     -EF  69  88B   0  355    0  WWWWWW WW WW WW W WWWWW W WW W  WW          WWW                       
    82   83 B D  E >>> -EF  68  87B  21  355   18  NNNNNN NN NN NN N NNNNN N NN N  NN          DND                       
    83   84 B S  T 345S+     0   0    0  355   52  AAAAAA AA AA AA A AAAAA A AA A  AA          AAT                       
    84   85 B Y  T 345S+     0   0   57  354   48  ILLLLL LL LL LL L LLLLL L LL L  LL          VID                       
    85   86 B T  T <45S-     0   0   56  354    8  STTTTT TT TT TT T TTTTT T TT T  TT          TTT                       
    86   87 B T  T  <5 +     0   0   43  354   36  SSSSSS SS SS SS S SSSSS S SS S  SS          GSG                       
    87   88 B N  E   < -F   82   0B  99  354   38  QQQQQQ QQ QQ QQ Q QQQQQ Q QQ Q  QQ          FNL                       
    88   89 B K  E     +F   81   0B  95  354    0  KKKKKK KK KK KK K KKKKK K KK K  KK          KKK                       
    89   90 B V  E    S+     0   0B  66  353   49  TTTTTT TT TT TT T TTTTT T TT T  TT          KLK                       
    90   91 B H  E     -F   80   0B  57  353   18  YHHHHH HH HH HH H HHHHH H HH H  HH          QQN                       
    91   92 B A  E     -F   79   0B  43  353    8  SAAAAA AA AA AA A AAAAA A AA A  AA          ASA                       
    92   93 B I  E     -F   78   0B   0  353    3  LIIIII II II II I IIIII I II I  II          III                       
    93   94 B P  E     -F   77   0B  80  353   37  KKKKKK KK KK KK K KKKKK K KK K  KK          NGP                       
    94   95 B L        -     0   0   26  354    2  LLLLLL LL LL LL L LLLLL L LL L  LL          LLL                       
    95   96 B R  S    S+     0   0  190  354   40  AHPPPH PP HH PP P HHPPP P PH P  QP          EKD                       
    96   97 B S        -     0   0   17  354   24  CCCCCC CC CC CC C CCCCC C CC C  CC          NSS                       
    97   98 B S  S    S+     0   0    6  354   36  APAAAP AA PP AA A PPAAA A AP A  PA          QSQ                       
    98   99 B W        +     0   0    2  354    3  WWWWWW WW WW WW W WWWWW W WW W  WW          WYW                       
    99  100 B V  E     -G  115   0C   4  354    1  VVVVVV VV VV VV V VVVVV V VV V  VV          VVV                       
   100  101 B M  E     +     0   0C   5  353    4  KMMMMM MM MM MM M MMMMM M MM M  MM          LML                       
   101  102 B T  E     -G  114   0C   8  353   13  ATTTTT TT TT TT T TETTT T TA T  TT          TAT                       
   102  103 B C  E     -G  113   0C   0  353    9  ACCCCC CC CC CC C CCCCC C CC C  CC          CVC                       
   103  104 B A  E     -G  112   0C   0  353    8  AAAAAA AA AA AA A AAAAA A AA A  AA          SGG                       
   104  105 B Y  E     -G  111   0C   9  353   10  IFFFFF FF FF FF F FFFFF F FF F  FF          YII                       
   105  106 B A    >   -     0   0    0  353   33  SASSSA SS AA SS S AASSS S SA S  AS          SES                       
   106  107 B P  T 3  S+     0   0   64  353    8  PPPPPP PP PP PP P PPPPP P PP P  PP          SqP                       
   107  108 B S  T 3  S-     0   0   47  353   31  GNTSTN TS NN TS T NNSST N SN T  NN          DrS                       
   108  109 B G  S <  S+     0   0    8  353   14  GGGGGG GG GG GG G GGGGG G GG G  GG          GGG                       
   109  110 B N  S    S+     0   0   50  353   43  NQQQQQ QQ QQ QQ Q QQQQQ Q QQ Q  QQ          KNN                       
   110  111 B Y  E     - H   0 124C  50  353   55  TSSSSS SS SS SS S SSSSS T SS S  ST          LLL                       
   111  112 B V  E     -GH 104 123C   0  353    5  VVVVVV VV VV VV V VVVVV V VV V  VV          AVA                       
   112  113 B A  E     +GH 103 122C   0  353    4  AAAAAA AA AA AA A AAAAA A AA A  AA          AAV                       
   113  114 B C  E     +GH 102 121C   5  353   10  CCCCCC CC CC CC C CCCCC C CC C  CC          SCS                       
   114  115 B G  E     +GH 101 120C   1  353    6  GGGGGG GG GG GG G GGGGG G GG G  GG          AGG                       
   115  116 B G  E >  S-G   99   0C   0  353    0  GGGGGG GG GG GG G GGGGG G GG G  Gg          GGG                       
   116  117 B L  T 3  S+     0   0    1  353    1  LLLLLL LL LL LL L LLLLL L LL L  Ll          LLL                       
   117  118 B D  T 3  S-     0   0   50  353    3  DDDDDD DD DD DD D DDDDD D DD D  DE          DDN                       
   118  119 B N  S <  S+     0   0   30  353   21  NSSSSS SS SS SS S SSSSS S SS S  SS          NNN                       
   119  120 B I  E     - I   0 139C  39  353   43  VAVVVA VV AA VA V AAAVV V MA V  AV          ALN                       
   120  121 B C  E     -HI 114 138C   0  353    7  CCCCCC CC CC CC C CCCCC C CC C  CC          CCC                       
   121  122 B S  E     -HI 113 137C   9  353   14  SSSSSS SS SS SS S SSSSS S SS S  SS          TTT                       
   122  123 B I  E     -HI 112 136C   0  353    6  IIIILI II II II I IIIII I II I  II          III                       
   123  124 B Y  E     -H  111   0C   3  353    4  FFFFFF FF FF FF F FFFFF F FF F  FF          YFY                       
   124  125 B N  E     +H  110   0C  24  353   45  NNNNNN NN NN NN N NNNNN S NN N  NS          KPR                       
   125  126 B L        +     0   0   11  353   12  LLLLLL LL LL LL L LLLLL L LL L  LL          VRV                       
   126  127 B K  S    S+     0   0  109  353   60  SNNNNN NN NN NN N NSNNN S NN N  NS          KNP                       
   127  128 B T  S    S-     0   0   64  353   71  ssssss ss ss ss s sssss s ss s  ss          qNr                       
   128  129 B R  S    S+     0   0  267  336   26  krkkrr rk rr rk k rrkkr k kr r  rk          r.q                       
   129  130 B E  S    S-     0   0  173  340   28  EDDDDD DD DD DD D DDDDD D DD D  DD          FVQ                       
   130  131 B G        -     0   0   50  351   25  GGGgGG Gg GG Gg G GGggG G gG G  GG          GGS                       
   131  132 B N        +     0   0   30  349   59  NNNhNN Nh NN Nh N NNhhN T pN N  NT          G..                       
   132  133 B V  S    S+     0   0   58  329   58  LIL.LI L. MI L. L IM..L V .M L  IV          T..                       
   133  134 B R  S    S-     0   0  213  347   44  PPPPAP NP PP NP P PPPPN P PP A  PP          RK.                       
   134  135 B V        -     0   0   29  352   27  VVVVVV VV VV VV V VVVVV V VV V  VV          VAV                       
   135  136 B S  S    S-     0   0   43  352   59  SSSSSS SS SS SS S SSSSS S SS S  SS          QAV                       
   136  137 B R  E     -I  122   0C 105  344   18  GRKRRR RR RR RR R RRRRR R RR Q  RR          S.S                       
   137  138 B E  E     -I  121   0C  75  346   40  TIMMMI MM II MM T IVMMM M MI M  IM          VEI                       
   138  139 B L  E     +I  120   0C   1  349    5  LLLLLL LL LL LL L LLLLL L LL L  LL          FMF                       
   139  140 B A  E     +I  119   0C  61  351   61  ATSSST SS TT SS S TTSSS S ST S  TS          KAK                       
   140  141 B G        +     0   0   50  351   27  GGGGGG GG GG GG G GGGGG G GG G  GG          GSG                       
   141  142 B H        -     0   0    9  352    8  HHHHHH HH HH HH H HHHHH H HH H  HH          HHH                       
   142  143 B T  S    S+     0   0   64  352   62  TKKKKK KK KK KK K KKKKK K KK K  KK          TDT                       
   143  144 B G  S    S-     0   0    0  352    8  GGGGGG GG GG GG G GGGGG G GG G  GG          AGG                       
   144  145 B Y        -     0   0    0  352    1  YYYYYY YY YY YY Y YYYYY Y YY Y  YY          YFY                       
   145  146 B L  E     +J  160   0D   0  352   18  LVVVVV VV VV VV V VAVVV V VV V  VV          VLI                       
   146  147 B S  E     -     0   0D   3  352    1  SSSSSS SS SS SS S SSSSS S SS S  YS          SSS                       
   147  148 B C  E     -J  159   0D   9  353   29  SSASSS SS SS SS S SSSSS C SS S  SC          DCD                       
   148  149 B C  E     -J  158   0D   0  353    6  CCCCCC CC CC CC C CCCCC C CC C  CC          CCT                       
   149  150 B R  E     -J  157   0D  53  353   33  KQQQQQ QQ QQ QQ Q QQQQQ R QQ Q  QR          GRA                       
   150  151 B F  E     -J  156   0D  10  353    2  YYYYYY YY YY YY Y YYYYY Y YY Y  YY          FFF                       
   151  152 B L  S    S-     0   0   26  353   35  MVVVVV VV VV VV V VVVVV V VV V  VV          ILT                       
   152  153 B D  S    S-     0   0   60  353   56  pppppp pp pp pp p ppppp p pp p  pp          TSD                       
   153  154 B D  S    S+     0   0   60  353   13  eeddde dd ee dd d eeddd d de d  ed          NEN                       
   154  155 B N  S    S+     0   0   44  353   76  KTTTTT TT TT TT T TTTTT A TT T  TA          TQA                       
   155  156 B Q  E     + K   0 169D  60  353   66  HRHHHR HH RR HH H RRHHH H HR H  RH          TEH                       
   156  157 B I  E     -JK 150 168D   0  354   13  ILLLLL LV LL LL L LLLLL L LL L  LL          IIV                       
   157  158 B V  E     -JK 149 167D   0  354   27  VIIIII II II II I IIIII I II V  II          IIV                       
   158  159 B T  E     -JK 148 166D   0  353    0  TTTTTT TT TT TT T TTTTT T TT T  TT          TTT                       
   159  160 B S  E     -JK 147 165D   0  352   19  SSSSGS GS GS GS G SGSSG S AS G  SS          ASA                       
   160  161 B S  E >   -J  145   0D   0  352    0  SSSSSS SS SS SS S SSSSS S SS S  SS          SSS                       
   161  162 B G  T 3  S+     0   0    0  352    0  GGGGGG GG GG GG G GGGGG G GG G  GG          GGG                       
   162  163 B D  T 3  S-     0   0    5  352    0  DDDDDD DD DD DD D DDDDD D DD D  DD          DDD                       
   163  164 B T  S <  S+     0   0    8  353   76  HQQQQQ QQ QQ QQ Q QQQQQ Q QQ Q  QQ          MSM                       
   164  165 B T        -     0   0    2  353   17  TTTTTT TT TT TT T TTTTT T TT T  TT          TTT                       
   165  166 B C  E     -KL 159 179D   0  352    1  CCCCCC CC CC CC C CCCCC C CC C  CC          CCC                       
   166  167 B A  E     -KL 158 178D   0  353   70  RVVVVV VV VV VV V VVVVV V VV V  VV          SIA                       
   167  168 B L  E     -KL 157 177D   6  353   29  FLLLLL LL LL LL L LLLLL L LL L  LL          LLY                       
   168  169 B W  E     -KL 156 175D   2  353    0  WWWWWW WW WW WW W WWWWW W WW W  WW          WWW                       
   169  170 B D  E >>> -KL 155 174D  37  353    1  DDDDDD DD DD DD D DDDDD D DD D  DD          DDD                       
   170  171 B I  T 345S+     0   0    7  353   13  VVIIIV II VV II I VVIII V IV I  VV          III                       
   171  172 B E  T 345S+     0   0  144  353   32  ETTTTT TT TT TT T TTTTT T TT T  TT          TNP                       
   172  173 B T  T <45S-     0   0   78  353   40  TTTTTT TT TT TT T TTTTT T TT T  TT          KTK                       
   173  174 B G  T  <5 +     0   0   16  353   12  QGGGGG GG GG GG G GGGGG G GG G  GG          GHT                       
   174  175 B Q  E   < -L  169   0D 135  353   74  CQLLLQ LL QQ LL L QQLLL L LQ F  QL          VKK                       
   175  176 B Q  E     -L  168   0D  30  353   58  CRRRRR RR RR RR R RRRRR K RR R  RK          KPR                       
   176  177 B T  E     +     0   0D  64  353   70  IITTTI TT II TT T IITTT T TI T  IT          SVV                       
   177  178 B T  E     -L  167   0D  20  353   63  ASSSSS SS SS SS S SSSSS S SS S  SS          RSR                       
   178  179 B T  E     -L  166   0D   5  354   78  VIVVVI VV II VV V IIVVV V VI V  VV          DRE                       
   179  180 B F  E     +L  165   0D   1  354    0  FFFFFF FF FF FF F FFFFF F FF F  FF          FFY                       
   180  181 B T        +     0   0   34  354   73  gggggg gg gg gg g ggggl g gg g  gg          VEA                       
   181  182 B G        +     0   0   37  354   33  gggggg gg gg gg g ggggg g gg g  gg          EED                       
   182  183 B H        -     0   0    7  354    0  HHHHHH HH HH HH H HHHHH H HH H  HH          HHH                       
   183  184 B T  S    S+     0   0   99  354   69  TTTTTT TT TT TT T TTTTT T TT T  TT          LTL                       
   184  185 B G  S    S-     0   0    0  354   17  GAAAAA AA AA AA A AAAAA A AA A  AA          GAG                       
   185  186 B D        -     0   0    1  354    0  DDDDDD DD DD DD D DDDDD D DD D  DD          DDD                       
   186  187 B V  E     -M  202   0E   0  354   18  VVVVVV VV VV VV V VVVVV V VV V  VV          VAV                       
   187  188 B M  E     +     0   0E   3  354   11  MLLQLL LQ LL LL L LLSQL L LQ L  LL          LML                       
   188  189 B S  E     -M  201   0E  16  354   17  SSSSSS SS SS SS S SSSSS S SS S  SS          CFS                       
   189  190 B L  E     -M  200   0E   3  354   28  VLVVIL IV LL IV V LLVVI V VV I  VV          MLL                       
   190  191 B S  E     -M  199   0E  21  354   23  SSSSSS SS SS SS S SSSSS S SS S  SS          SSs                       
   191  192 B L  E     -M  198   0E  29  354   32  VIIIII II II II I IIIII I II I  II          ILp                       
   192  193 B A    >   -     0   0    4  354   63  SNNSNN NS NN NS N NNSSN S NN N  NS          FRP                       
   193  194 B P  T 3  S+     0   0   85  354   30  SSGSGS GS PS GS Q SSSSG E GS G  SE          PPP                       
   194  195 B D  T 3  S-     0   0   87  354   71  SSSSSS SS LS SS S SLSSS S SS S  SS          SSN                       
   195  196 B T  S <  S+     0   0   62  354   89  SINNNI NN NN NN N NNNNN N NN N  NN          NDT                       
   196  197 B R  S    S+     0   0  142  355   76  psspss sp tt sp s sapps p st s  sp          Krn                       
   197  198 B L  E     - N   0 211E  37  351   70  vmmlmm ml mm ml l mmlll r mm m  mr          .vl                       
   198  199 B F  E     -MN 191 210E   0  351    0  FFFFFF FF FF FF F FFFFF F FF F  FF          .FF                       
   199  200 B V  E     -MN 190 209E   0  352   12  IVVVVV VV VV VV V VIVVV I IV V  VI          LVA                       
   200  201 B S  E     -MN 189 208E   0  353    3  SSSSSS SS SS SS S SSSSS S SS S  SS          NSS                       
   201  202 B G  E     +MN 188 207E   0  355    3  GGGGGG GG GG GG G GGGGG G GG G  GG          dCC                       
   202  203 B A  E >   -M  186   0E   0  354   31  SSSSSS SS SS SS S SSSSS S SS S  SS          sSG                       
   203  204 B C  T 3  S+     0   0    5  354    7  CCCCCC CC CC CC C CCCCC C CC C  CC          SVS                       
   204  205 B D  T 3  S-     0   0   31  354    0  DDDDDD DD DD DD D DDDDD D DD D  DD          DDD                       
   205  206 B A  S <  S+     0   0   20  354   39  KASTSA AS TA GT A ATTTA T ST S  MT          GQG                       
   206  207 B S  E     - O   0 222E   6  354   82  STTTTT TT TT TT T TTTTT T TT T  TT          STY                       
   207  208 B A  E     -NO 201 221E   0  354   28  AVAAAV AA VV AA A VVAAA A VV A  AT          ACA                       
   208  209 B K  E     -NO 200 220E  18  354   20  KRRRRR RR RR RR R RRRGR R RR R  RR          KKF                       
   209  210 B L  E     -NO 199 219E   2  354   11  LLLLLL LL LL LL L LLLLL L LL L  LL          IVV                       
   210  211 B W  E     -NO 198 217E   1  354    0  WWWWWW WW WW WW W WWWWW W WW W  WW          WWW                       
   211  212 B D  E >>> -NO 197 216E  11  354    0  DDDDDD DD DD DD D DDDDD D DD D  DD          DDD                       
   212  213 B V  T 345S+     0   0   12  354   39  VITTTI TT LI TT T ILTTT T TI T  TT          LTT                       
   213  214 B R  T 345S+     0   0  194  354    0  rrrrrr rr rr rr r rrrrr r rr r  rr          RrR                       
   214  215 B E  T <45S-     0   0  111  353   69  paaaaa aa aa aa a ataaa a aa a  aa          SpS                       
   215  216 B G  T  <5 +     0   0    8  354   39  ASSSSS SS SS SS S SSSSS S SS S  SS          PTT                       
   216  217 B M  E      -     0   0    1  353    5  LFFFFF FF FF FF F FFFSF F FF F  FF          FLF                       
   235  236 B P  T 3  S+     0   0   45  353    4  SPPPPP PP PP PP P PPPPP P PP P  PP          PPK                       
   236  237 B N  T 3  S-     0   0   42  353   42  EDDDDD DD DD DD D DDDDD D DD D  DD          NSD                       
   237  238 B G  S <  S+     0   0   12  353    5  GGGSGG GG GG GG G GGGGG G GG G  GG          GDG                       
   238  239 B N  S    S+     0   0   56  353   67  RQNNNQ NN QQ NN N QQNNN H HH N  QH          NNN                       
   239  240 B A  E     - Q   0 253F   0  353   48  HRRRRR RR RR RR R RRRRR R RR R  RR          SnS                       
   240  241 B F  E     -PQ 233 252F   0  353   14  FFFFFF FF FF FF F FFFFF F FF F  FF          FfI                       
   241  242 B A  E     -PQ 232 251F   0  353   59  GGGGGG GG GG GG G GGGGG G GG G  GG          AAA                       
   242  243 B T  E     -PQ 231 250F   0  353    6  TTTTTT TT TT TT T TTTTT T ST T  TT          TST                       
   243  244 B G  E     +PQ 230 249F   0  353    0  GGGGGG GG GG GG G GGGGG G GG G  GG          GCG                       
   244  245 B S  E >   -P  228   0F   0  353    0  SSSSSS SS SS SS S SSSSS S SS S  SS          SSS                       
   245  246 B D  T 3  S+     0   0   13  353    2  DDDEDD ED DD DD D DDDEE E DD D  DE          DED                       
   246  247 B D  T 3  S-     0   0   28  353    0  DDDDDD DD DD DD D DDDDD D DD D  DD          DDD                       
   247  248 B A  S <  S+     0   0    6  353   38  GGGGGG GG GG GG G GGGGG G GG G  SG          GNG                       
   248  249 B T        -     0   0   16  353   41  STTTTT TT TT TS T TTSTT T TT T  TT          LTV                       
   249  250 B C  E     -QR 243 263F   0  353   12  CCCCCC CC CC CC C CCCCC C CC C  CC          IVI                       
   250  251 B R  E     -QR 242 262F  23  353    7  RRRRRR RR RR RR R RRRRR R RR R  RR          RRR                       
   251  252 B L  E     -QR 241 261F   0  353    1  LLLLLL LL LL LL L LLLLL L LL L  LL          LIM                       
   252  253 B F  E     -QR 240 259F   1  352    1  FFFFFF FF FF FF F FFFFF Y FF F  YY          FFL                       
   253  254 B D  E  >> -QR 239 258F   1  352    0  DDDDDD DD DD DD D DDDDD D DD D  DD          DDD                       
   254  255 B L  T >45S+     0   0   15  352   28  IVIIIV II MM II I VMIII I IM I  MI          IIL                       
   255  256 B R  T 345S+     0   0   57  352    1  GRRRRR RR RR RR R RRRRR R RR R  RR          RRR                       
   256  257 B A  T 345S-     0   0    0  352   29  TTTTTT TT TT TT T TTTTT T TT T  TT          AAA                       
   257  258 B D  T <<5 +     0   0    0  352   23  GGGGGG GG GG GG G GGGGG G GG G  GG          DSD                       
   258  259 B Q  E      -     0   0  119  354   72  DRQQRR QQ RR QQ Q RRQQQ P QR Q  QP          sGs                       
   266  267 B D  T 3  S+     0   0  161  354   42  KEQPQE QP EE QP Q EEPPQ Q QE Q  QQ          IPI                       
   267  268 B N  T 3  S+     0   0   66  354   66  QPHHHP HH PP HH H PPHHH G HP H  HG          SAI                       
   268  269 B I    <   +     0   0   23  354   48  adnggd sg dd sg g ddggq d dd g  ed          iss                       
   269  270 B I        +     0   0   97  354   54  plvial mi ll ii f lliim n al a  vn          nsn                       
   270  271 B C  S    S-     0   0   10  354   48  VPPPAP AP PP PP P PPPPA L PP A  PL          PDQ                       
   271  272 B G        -     0   0    1  355   28  NTHHHT HH IT HH P TIHHH P HT H  IP          GGG                       
   272  273 B I  E     +S  288   0G   0  355   15  VVVVVV VV VV VV V VVVVV V VV V  VV          VLV                       
   273  274 B T  E     +     0   0G  13  355   15  TTTTTT TT TT TT K TTTTT T TT T  TT          FTS                       
   274  275 B S  E     +S  287   0G  18  355    1  SSSSSS SS SS SS T SSSSS S SS S  SS          SSS                       
   275  276 B V  E     +S  286   0G  10  355   16  VIIMII IM II MM I IVIMI I II I  II          LLL                       
   276  277 B S  E     -S  285   0G  15  354   25  AAAAAA AA AA AA A AAAAA A AA A  AA          DAD                       
   277  278 B F  E     -S  284   0G  12  354   30  FFFFFF FF FF FF F FFFFF F FF F  FF          FVF                       
   278  279 B S        -     0   0    3  354    4  SSSSSS SS SS PS S SSSSS S SS S  SS          SSS                       
   279  280 B K  S    S+     0   0  104  354   81  RIIIMI II II II I IIIII A TI I  IA          NKG                       
   280  281 B S  S    S-     0   0    2  354    3  SSSSSS SS SS SS S SSSSS S SS S  SS          SSS                       
   281  282 B G  S    S+     0   0    0  354    1  GGGGGG GG GG GG G GGGGG G GG G  GG          GGG                       
   282  283 B R        +     0   0    8  354    0  RRRRRR RR RR RR R RRRRR R RR R  RR          RRR                       
   283  284 B L  E     - T   0 297G   0  354   11  LLLLLL LL LL LL L LLLLL L LL L  LL          LLL                       
   284  285 B L  E     -ST 277 296G   0  354    5  LLLLLL LL LL LL L LLLLL L LL L  LL          LVM                       
   285  286 B L  E     -ST 276 295G   0  354   15  FFFFFF IF FF FF F FFFFI F FF F  FF          YFY                       
   286  287 B A  E     -ST 275 294G   0  355   18  AAAVAA AV AA AV A AAVVA A AA A  AA          ACA                       
   287  288 B G  E     -ST 274 293G   2  355   11  GGGGGG GG GG GG G GGGGG G GG G  GG          CGC                       
   288  289 B Y  E >   -S  272   0G   4  355    1  YYYYYY YY YY YY Y YYYYY Y YY Y  YY          YDY                       
   289  290 B D  T 3  S+     0   0    3  355   34  SSSSTS TS SS TS T SSSST A TS T  SA          SST                       
   290  291 B D  T 3  S-     0   0   37  355   17  NNNNNN NN NN NN N NNNNN N NN N  SN          EED                       
   291  292 B F  S <  S+     0   0    3  355   44  GGGGGG GG GG GG R GGGGG N GG G  GN          FGF                       
   292  293 B N        -     0   0   15  355   49  NDDDDD DD DD AD D DDDDD n DD D  Dn          GNG                       
   293  294 B C  E     -TU 287 307G   0  355   10  CCCCCC CC CC CC C CCCCC c CC C  Cc          CFC                       
   294  295 B N  E     -TU 286 306G   5  355   74  YYYYYY YY YY YY Y YYYYY Y YY Y  YY          LSV                       
   295  296 B V  E     -TU 285 305G   0  355   16  VVVVVV VV VV VV V VVVVV V VV V  VV          VCV                       
   296  297 B W  E     -TU 284 303G   6  355    0  WWWWWW WW WW WW W WWWWW W WW W  WW          WFW                       
   297  298 B D  E  >  -T  283   0G   4  355    0  DDDDDD DD DD DD D DDDDD D DD D  DD          DDD                       
   298  299 B A  T  4 S+     0   0    0  355   65  TTTTTT TT TT TT T TTTTT T TT T  TT          VIV                       
   299  300 B L  T  4 S+     0   0    0  355   27  LLLLLL LL LL LL L LLLLL V LL L  LV          LLL                       
   300  301 B K  T  4 S-     0   0   29  355   53  llllll ll ll ll l lllll l ll l  ml          ksk                       
   301  302 B A  S  < S+     0   0   17  355   52  vvvvve vv vv vv v vevvv e ve v  ee          esg                       
   302  303 B D  S    S-     0   0   95  355   52  vvvvvv vv vv vv v vmvvv v vv v  vv          igI                       
   303  304 B R  E     -U  296   0G  69  354   61  lldlln ll ll ll n lnlll d ln l  nd          sy.                       
   304  305 B A  E     -     0   0G  14  355   63  GGLGGL GG GG GR L GLGGG L GL G  LL          VTV                       
   305  306 B G  E     -U  295   0G   4  355   27  GNGASG SA TN SS G NGSGS G KG S  GG          GNG                       
   306  307 B V  E >   -U  294   0G   7  355   69  gLsVLn LV LL LV s LtVVL e Ln L  te          NTK                       
   307  308 B L  E >  S+U  293   0G   2  350   36  dQqQQq QQ QQ QQ q QqQQQ q Qq Q  qq          ..L                       
   308  309 B A  G >  S-     0   0    4  351   70  DNNNNN NN NN NN N NNNNN D NN N  ND          .GE                       
   309  310 B G  G <   -     0   0    4  353   21  GSSSTS SS SS SS S SSSSS S SS T  SS          DAG                       
   310  311 B H  G <  S+     0   0    8  353    0  HHHHHH HH HH HH H HHHHH H HH H  HH          HHH                       
   311  312 B D    <   -     0   0   26  353   32  TEEEEE EE DE DE E EEEEE K DD E  EK          VDS                       
   312  313 B N  S    S+     0   0   31  353   16  NGGGGG GG GG GG G GGGGG N GG D  AN          NRN                       
   313  314 B R        +     0   0   40  353    5  RRRRRR RR RR RR Q RRRRR R RR R  RR          KYR                       
   314  315 B V        +     0   0    2  353   10  VIIIII II II II I IIIII I II I  II          IIE                       
   315  316 B S  S    S-     0   0    2  353   10  SSSSSS TS SS SS S SSSST S SS S  SS          NSS                       
   316  317 B C  E     -B  329   0A  10  353   17  CCCCCC CC CC CC C CCCCC C CC C  CC          HCG                       
   317  318 B L  E     -B  328   0A  15  353   13  LLLLLL LL LL LL L LLLLL L LL L  LL          IIV                       
   318  319 B G  E     -B  327   0A  10  353   13  GGGGGG GG GG GG G GGGGG G GG G  GG          SGR                       
   319  320 B V  E     -B  326   0A  25  353   19  LLLLLL LL LL LL L LLLLM M LM L  LM          VIA                       
   320  321 B T    >   -     0   0    3  353   52  ASSSSS SS SS SS S SSSSS S SS S  SS          SSS                       
   321  322 B D  T 3  S+     0   0   98  353   70  ASAAAS AA SS AA A SSAAA A AS A  SA          PPP                       
   322  323 B D  T 3  S-     0   0   51  352    9  DDDDDD DD DD DD D DDDDD D DD D  DD          DHD                       
   323  324 B G  S <  S+     0   0    0  352    4  GGGGGG GG GG GG G GGGGG G GG G  GG          GEG                       
   324  325 B M  S    S+     0   0   36  350   62  DSSSSS SS SS SS S SSSSS S SS S  SS          TDL                       
   325  326 B A        -     0   0    0  350   30  AAAAAA AA AA AA A AAAAA A AA A  AA          AAA                       
   326  327 B V  E     -BC 319 338A   0  350   33  LLLLLL LL LL LL L LLLLL L LL L  LL          VIV                       
   327  328 B A  E     -BC 318 337A   0  349   47  CCCCCC CC CC CC C CCCCC C CC C  CC          ACC                       
   328  329 B T  E     -BC 317 336A   7  349    4  TTTTTT TT TT TT T TTTTT T TT T  TT          TTT                       
   329  330 B G  E     -BC 316 335A   1  349    4  GGGGGG GG GG GG G GGGGG G GG G  GG          SGG                       
   330  331 B S    >   -     0   0    6  349    0  SSSSSS SS SS SS S SSSSS S SS S  SS          SSS                       
   331  332 B W  T 3  S+     0   0    6  349    0  YWYWWW WW WW WW W WWWWW W WW W  WW          WWW                       
   332  333 B D  T 3  S-     0   0   17  349    0  DDDDDD DD DD DD D DDDDD D DD D  DD          DDD                       
   333  334 B S  S <  S+     0   0   12  349   35  AKTTTK TT KK TT T KKTTT S SK T  KS          STS                       
   334  335 B F        -     0   0   78  349   71  TNNNNN NN NN NN N NNNNN N NN N  NN          TQT                       
   335  336 B L  E     -AC  50 329A   1  349    8  LLLLLL LL LL LL L LLLLL L LL I  LL          IAM                       
   336  337 B K  E     -AC  49 328A  60  346   23  KKKKKK KK KK KK K KKKKK K KK K  KK          KKK                       
   337  338 B I  E     -AC  48 327A   0  344   13  VIIIII II II II I IIIII I II I  II          IVI                       
   338  339 B W  E      AC  46 326A   2  341    0  WWWWWW WW WW WW W WWWWW W WW W  WW          WWW                       
   339  340 B N              0   0   10  297   57  SAAAAA AA AA AA A AAAAA A AA A  AA          SAS                       
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   80    0                                                                        
   342    3 G V        +     0   0   96   82   63                                                                        
   343    4 G I        -     0   0   38   84   34                                                                        
   344    5 G N    >   -     0   0  109   84   59                                                                        
   345    6 G I  G >  S+     0   0   25   84   30                                                                        
   346    7 G E  G 3  S+     0   0  122  126   44                                N           NN                          
   347    8 G D  G <  S+     0   0  133  137   21                                N           NN                          
   348    9 G L    <   -     0   0   35  141   15                                M    M M    MM                          
   349   10 G T     >  -     0   0   69  141   62                                A    A A    AA                          
   350   11 G E  H  > S+     0   0  116  143   33                                K    K K    KK                          
   351   12 G K  H >> S+     0   0   66  152   41                                I    I I    II   K KK        K          
   352   13 G D  H 3> S+     0   0   39  152   35                                A    A A    AA   D DD        D          
   353   14 G K  H 3X S+     0   0   83  152   84                                D    E E    DD   A AA        A          
   354   15 G L  H < S+     0   0    7  233    6           E       E            E   EEEE EE EE   QEQQEEEEEEEEQEE EEEEEEE
   365   26 G V  H 3< S+     0   0   43  233   53           A       A            V   AVAV AA VV   AAAAAAAAAAAAVAA AAAAAAA
   366   27 G T  T 3< S+     0   0  116  233   82           N       S            N   YNYN NY NN   SASSNCGSGGGYEGG SGGSAGG
   367   28 G L    <   -     0   0   49  233   61           I       I            I   MIMI VM II   MLMMIMILIIIMMII VVVGVVV
   368   29 G E        -     0   0  191  233   49           E       E            E   DEDE ED ED   EKEEEDECEEEDDDE EEEREEE
   369   30 G R        -     0   0   32  233    1           R       R            R   RRRR RR RR   RRRRRRRRRRRRRRR RRRRRRR
   370   31 G M        -     0   0   53  233   85           I       I            M   MMMM IM MM   WIWWIVIIVIMIWMV IIISIII
   371   32 G L     >  -     0   0   75  232   81           K       K            M   KKKK KK MM   PLPPKKKKKKKKPKK KKKRKKK
   372   33 G V  H  > S+     0   0    4  232   15           V       V            V   VVVV VV VV   LVLLVVVVVVVVLVV VVVVVVV
   373   34 G S  H  > S+     0   0   14  232    1           S       S            S   SSSS SS SS   SSSSSSSSSSSSSSS SSSSSSS
   374   35 G K  H  > S+     0   0   93  232   38           K       K            K   KKKK KK KK   KQKKKQKKKKKKKKK QQQQQQQ
   375   36 G C  H  X S+     0   0    0  233   62           A       A            A   AAAA AA AA   SASSAAAAAAAASAA AAAAAAA
   376   37 G C  H  X S+     0   0    0  233   63           S       S            A   AAAA SA AA   IIIISASAASAAIAA AAAAAAA
   377   38 G E  H  X S+     0   0   75  233   68           A       A            A   AAAA AA AA   AEAAAASATSTAVGS AAAAAAA
   378   39 G E  H  X S+     0   0   60  233   26           D       D            E   DEDE DD DE   ADAADDDDDDDDADD EEEEEEE
   379   40 G F  H  X S+     0   0    3  233   36           L       L            L   LLLL LL LL   MIMMLLLLLLLLMLL LLLLLLL
   380   41 G R  H  X S+     0   0   53  233   79           M       M            M   LLLL ML MM   RKRRMLMMLMLLRLL QQQQQQQ
   381   42 G D  H  X S+     0   0   67  233   65           R       S            A   AAAA HA AA   EREEHAGTQGQAEQQ QQQQQQQ
   382   43 G Y  H  X S+     0   0   43  233    2           Y       Y            Y   YFYF YY YY   YFYYYYYYFYFYYFF YYYYYYY
   383   44 G V  H >X S+     0   0    0  233   58           C       C            C   CCCC CC CC   VAVVCCCCCCCCVCC CCCCCCC
   384   45 G E  H 3X S+     0   0   71  233   47           E       E            E   DEDE SD EE   EMEESEEDTETDEAM LMMMMMM
   385   46 G E  H 3< S+     0   0  125  233   57           E       E            A   ASAA EA NS   EDEEEAQAEQEAEEE QQQQQQQ
   386   47 G R  H XX S+     0   0   94  233   69           H       H            H   HHHH HH HH   NHNNHHHHQHQHNQQ NNNNNNN
   387   48 G S  H >< S+     0   0   12  233   67           A       A            A   IVIV AI AA   EMEEAVAAAAAIEAA AAAAAAA
   388   49 G G  T 3< S+     0   0   38  233   80           K       R            K   GKGK KG KK   KTKKKRRCKRKGKKK ACCCCCC
   389   50 G E  T <4 S+     0   0  138  232   54           N       S            E   EEEE YE EE   NHNNYENESNSETSS KKKKKKK
   390   51 G D    XX> -     0   0    1  232    0           D       D            D   DDDD DD DD   DDDDDDDDDDDDDDD DDDDDDD
   391   52 G P  H 3>5S+     0   0   17  233   25           P       P            P   PPPP PP PP   PHPPRPPPPPPPPPP AAAAAAA
   392   53 G L  H 345S+     0   0    6  233    3           L       L            L   LLLL LL LL   LLLLLLLLFLFLLFF LLLLLLL
   393   54 G V  H <45S+     0   0   24  233   29           L       L            V   IVIV LI VV   IIIILVLILLLIILL LLLLLLL
   394   55 G K  H  <5S-     0   0  149  233   80           V       M            T   ITIP MI TT   HIHHTTVTVVVIHVV VVVVVVV
   395   56 G G     << -     0   0   38  233   34           G       G            P   PPPP GP PP   AgAAGPGPGGGPAGG GGGGGGG
   396   57 G I        -     0   0   21  224   20           I       I            V   VVVL IV VV   .a..IVVVIVIV.II VVVIVVV
   397   58 G P    >>  -     0   0   80  233   11           P       P            P   PPPP PP PP   PSPPPPPPPPPPPPP PPPPPPP
   398   59 G E  T 34 S+     0   0   75  233   58           T       T            S   AAAA AA SS   DEDDAAATAAAADAA TAATAAA
   399   60 G D  T 34 S+     0   0  151  233   61           S       S            S   SASA SS SS   KKKKSSSSASASKAA GGGGGGG
   400   61 G K  T <4 S+     0   0  163  233   62           E       E            E   EEEE EE EE   KAKKEEEETETEKTT SSSSSSS
   401   62 G N     <  -     0   0    1  233    0           N       N            N   NNNN NN NN   NNNNNNNNNNNNNNN NNNNNNN
   402   63 G P  S    S+     0   0   36  224    0           P       P            P   PPPP PP PP    P  PPPPPPPP PP PPPPPPP
   403   64 G F  S    S-     0   0    3  224    0           F       F            F   FFFF FF FF    F  FFFFFFFF FF FFFFFFF
   404   65 G K              0   0  108  222   29           K                    R   RRRR KR RR    R  KRKRKKKR KK RRRRRRR
   405   66 G E              0   0  201  217    3           D                    E   EEEE DE EE    E  DEDEEDEE EE EEEEEEE
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   62   10                                                                        
   408   14 P E        +     0   0  153  142   39        E     E  E       D D  D  D      D  D                    E       
   409   15 P G  S    S+     0   0   38  144   37        G     G  G       G G  G  G      G  G                    G       
   410   16 P Q  S    S-     0   0   94  148   90        I     I  I       S S  S  S      S  S                    S       
   411   17 P A        +     0   0    1  149   53        S     S  S       A A  S  A      A  A                    V       
   412   18 P S        +     0   0   28  149   71        V     V  V       V V  V  V      V  I                    V       
   413   19 P H  S    S+     0   0   42  151   57        N     N  N       N N  N  N      N  N                    N       
   414   20 P T  S  > S-     0   0    2  152   17        T     T  T       T T  T  T      T  T                    T       
   415   21 P G  H  > S-     0   0   10  164    2        G     G  G       G G  G  G      G  G                    G       
   416   22 P P  H  > S+     0   0   14  165    0        P     P  P       P P  P  P      P  P                    P       
   417   23 P K  H  > S+     0   0    6  165    0        K     K  K       K K  K  K      K  K                    K       
   418   24 P G  H  X S+     0   0    0  165    1        G     G  G       G G  G  G      G  G                    G       
   419   25 P V  H  X S+     0   0    0  165    0        V     V  V       V V  V  V      V  V                    V       
   420   26 P I  H  X S+     0   0    4  165   14        I     I  I       I I  I  I      I  I                    I       
   421   27 P N  H  X S+     0   0   48  165   42        N     H  N       N N  N  N      N  N                    N       
   422   28 P D  H  X S+     0   0   14  166    0        D     D  D       D D  D  D      D  D                    D       
   423   29 P W  H  X S+     0   0    6  166    0        W     W  W       W W  W  W      W  W                    W       
   424   30 P R  H  < S+     0   0   67  166   26        R     R  R       R R  R  R      R  R                    R       
   425   31 P K  H >X S+     0   0   67  166   36        R     R  R       K K  K  K      K  R                    R       
   426   32 P F  H >X>S+     0   0    1  166    1        F     Y  F       Y Y  Y  Y      Y  F                    Y       
   427   33 P K  H 3<5S+     0   0   30  166    7        k     k  k       k k  k  k      k  k                    k       
   428   34 P L  H <45S+     0   0  139  161    1        l     l  l       l l  l  l      l  l                    l       
   429   35 P E  H <<5S+     0   0   86  161    9        E     E  E       E E  E  E      E  E                    E       
   430   36 P S  T  <5       0   0   57  162   66        t     t  t       v v  v  v      v  t                    t       
   431   37 P E      <       0   0  118  167   66        k     k  k       k k  k  k      a  k                    k       
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  143   42        i     i  i       i i  i  i      l  l                    l       
   434   69 P S        +     0   0   52  144   64        S     S  S       Q K  Q  Q      K  N                    Q       
   435   70 P R        -     0   0  103  120   85        G     G  G       G G  G  G      G  .                    .       
   436   71 P K        +     0   0   22  123   12        K     K  K       K K  K  K      K  .                    G       
   437   72 P M  S    S-     0   0   12  124   13        I     M  I       M M  M  M      M  .                    K       
   438   73 P S     >  -     0   0   52  131   65        T     T  T       T T  T  T      T  .                    M       
   439   74 P V  H  > S+     0   0  107  130   53        L     L  L       M M  M  M      M  .                    T       
   440   75 P Q  H  > S+     0   0  133  130   52        K     K  K       Q Q  Q  Q      Q  .                    M       
   441   76 P E  H  > S+     0   0   38  134   26        E     D  E       E E  E  E      E  D                    Q       
   442   77 P Y  H  X S+     0   0   36  146   56        M     F  M       Y Y  Y  Y      Y  K                    E       
   443   78 P E  H  < S+     0   0  111  154   61        A     A  A       N N  N  N      N  L                    Y       
   444   79 P L  H >X S+     0   0   45  155   57        M     M  M       M M  M  M      M  A                    K       
   445   80 P I  H 3< S+     0   0   37  157   72        M     L  M       L L  L  L      L  L                    M       
   446   81 P H  T 3< S+     0   0  178  158   80        T     N  T       Q Q  Q  Q      Q  H                    M       
   447   82 P K  T <4 S+     0   0  140  157   65        G     E  G       E E  E  E      E  Q                    N       
   448   83 P D     <  -     0   0   58  169   39        D     D  D       D E  D  E      E  E                    D       
   449   84 P K        -     0   0  205  149   80        Q     Q  Q       E E  E  E      E  A                    G       
   450   85 P E        -     0   0   45  150   68        D     D  D       D D  D  D      D  D                    D       
   451   86 P D    >>  -     0   0   87  169   31        D     D  D       D D  D  D      D  D                    D       
   452   87 P E  H 3> S+     0   0  113  168   12        E     E  E       E E  E  E      E  E                    E       
   453   88 P N  H 3> S+     0   0   73  169   59        E     E  E       D D  D  E      A  E                    E       
   454   89 P C  H <> S+     0   0   32  170   72        F     F  F       F F  F  F      F  F                    F       
   455   90 P L  H  X S+     0   0    4  170    2        L     L  L       L L  L  L      L  L                    L       
   456   91 P R  H  X S+     0   0  131  170   63        Q     Q  Q       Q Q  Q  Q      Q  Q                    Q       
   457   92 P K  H  X S+     0   0  112  170   59        Q     Q  Q       H H  Q  H      H  Q                    Q       
   458   93 P Y  H  X S+     0   0    7  170    5        Y     Y  Y       Y Y  Y  Y      Y  Y                    Y       
   459   94 P R  H  X S+     0   0   31  170   31        R     R  R       R R  R  R      R  R                    R       
   460   95 P R  H  X S+     0   0  130  170   43        Q     K  Q       M M  M  M      M  K                    K       
   461   96 P Q  H  X S+     0   0   96  170   30        Q     Q  Q       Q Q  K  Q      Q  Q                    Q       
   462   97 P C  H  X S+     0   0   22  170   72        R     R  R       R R  R  R      R  R                    R       
   463   98 P M  H  X S+     0   0   33  170   11        M     M  M       I I  I  I      I  M                    I       
   464   99 P Q  H  X S+     0   0  115  170   54        E     E  E       E E  E  E      E  E                    E       
   465  100 P D  H  X S+     0   0   46  170   21        E     E  E       E E  E  E      E  E                    E       
   466  101 P M  H  X S+     0   0   23  170    2        M     M  M       M M  M  M      M  M                    M       
   467  102 P H  H  X S+     0   0   64  170   74        R     R  R       R R  R  R      R  R                    K       
   468  103 P Q  H  < S+     0   0  143  170   59        R     Q  R       R R  R  R      R  Q                    K       
   469  104 P K  H  < S+     0   0  140  170   55        R     Q  R       Q Q  Q  Q      Q  Q                    Q       
   470  105 P L  H  < S+     0   0   35  170   43        L     L  L       L L  F  L      L  L                    L       
   471  106 P S     <  -     0   0   75  170   79        H     H  H       C C  C  C      C  H                    S       
   472  107 P F        -     0   0   71  168   99        K     .  K       R S  R  R      R  P                    Q       
   473  108 P G        -     0   0   36  168   51        G     G  G       G G  G  G      G  G                    P       
   474  109 P P        +     0   0   92  160   41        P     P  P       K K  K  K      K  Q                    Q       
   475  110 P R        +     0   0  177  165   61        Q     Q  Q       R R  R  R      R  Q                    L       
   476  111 P Y        +     0   0   51  166    5        F     F  F       F F  F  F      F  F                    F       
   477  112 P G        +     0   0   12  170   61        R     K  R       A A  Q  E      A  K                    K       
   478  113 P F  S    S-     0   0  151  170  103        Q     Q  Q       Q Q  Q  Q      Q  Q                    K       
   479  114 P V  E     -v  532   0H  28  170   13        V     V  V       V V  V  V      V  V                    V       
   480  115 P Y  E     -v  533   0H  71  165   68        F     F  F       Y Y  Y  Y      Y  F                    F       
   481  116 P E  E     -v  534   0H 108  170   41        E     E  E       E E  E  E      E  E                    D       
   482  117 P L        -     0   0   12  170   32        I     I  I       L L  L  L      L  I                    I       
   483  118 P E        +     0   0  134  170   74        P     P  P       S A  N  N      S  Q                    A       
   484  119 P S  S >> S-     0   0   57  170   53        S     S  S       S S  S  S      G  S                    S       
   485  120 P G  H 3> S+     0   0   15  169   40        G     G  G       G G  G  G      G  G                    G       
   486  121 P E  H 3> S+     0   0  127  170   23        E     E  E       E E  E  E      E  E                    E       
   487  122 P Q  H <> S+     0   0   72  170   61        R     G  R       D D  D  E      D  A                    E       
   488  123 P F  H  X S+     0   0   26  170    1        F     F  F       F F  F  F      F  F                    F       
   489  124 P L  H  X S+     0   0   90  170    6        V     L  V       L L  L  L      L  L                    L       
   490  125 P E  H  X S+     0   0  103  170   41        D     D  D       E E  E  E      E  D                    D       
   491  126 P T  H  < S+     0   0   10  170   76        M     M  M       A A  A  A      A  T                    M       
   492  127 P I  H  < S+     0   0   17  170   12        I     I  I       L L  L  L      L  V                    V       
   493  128 P E  H  < S+     0   0  139  170   20        D     D  D       D D  D  D      D  D                    D       
   494  129 P K  S  < S+     0   0  172  170   35        Q     K  Q       K K  K  K      K  R                    K       
   495  130 P E  S    S-     0   0   38  166    5        E     E  E       E E  E  E      E  G                    E       
   496  131 P Q    >   -     0   0  116  170   66        R     P  R       D D  D  D      D  N                    H       
   497  132 P K  T 3  S+     0   0  156  170   34        K     K  K       K K  K  K      K  K                    M       
   498  133 P I  T 3  S+     0   0   68  170   87        S     G  S       S S  S  S      S  K                    K       
   499  134 P T    <   -     0   0   10  170   35        T     T  T       T T  T  T      T  T                    T       
   500  135 P T  E     -W  558   0H   7  169   62        L     L  L       L L  L  L      L  L                    R       
   501  136 P I  E     -Wx 557 531H   3  170   15        I     I  I       V V  I  V      V  V                    V       
   502  137 P V  E     -Wx 556 532H   0  170   35        I     M  I       M M  M  M      M  M                    L       
   503  138 P V  E     -Wx 555 533H   0  170   12        V     V  V       I I  I  I      I  I                    I       
   504  139 P H  E     -Wx 554 534H   0  170    6        H     H  H       H H  H  H      H  H                    L       
   505  140 P I  E     +Wx 553 535H   2  170    1        I     I  I       I I  I  I      I  I                    I       
   506  141 P Y  E     - x   0 536H   4  170    2        Y     Y  Y       Y Y  Y  Y      Y  Y                    Y       
   507  142 P E    >   -     0   0   45  170   26        E     E  E       E E  E  E      E  E                    E       
   508  143 P D  T 3  S+     0   0   95  170   51        D     D  D       S P  P  P      P  D                    D       
   509  144 P G  T 3  S+     0   0   66  170   48        G     G  G       D D  D  D      E  H                    D       
   510  145 P I  S X> S-     0   0   36  170   33        I     I  I       I I  A  V      V  L                    V       
   511  146 P K  T 34 S+     0   0  191  170   71        P     P  P       P P  P  P      P  P                    L       
   512  147 P G  T 3> S+     0   0   13  170   22        G     G  G       G G  G  G      G  G                    G       
   513  148 P C  H <> S+     0   0    0  170   35        T     T  T       C C  C  C      C  A                    C       
   514  149 P D  H  X S+     0   0   78  170   47        D     E  D       E E  E  E      E  E                    E       
   515  150 P A  H  > S+     0   0   44  170   50        A     A  A       S S  A  A      A  A                    A       
   516  151 P L  H  X S+     0   0    0  170   11        M     M  M       M M  M  M      M  L                    A       
   517  152 P N  H  X S+     0   0   19  170   16        H     N  H       S S  S  S      S  D                    N       
   518  153 P S  H  X S+     0   0   78  170   56        G     G  G       G G  G  G      G  G                    G       
   519  154 P S  H  X S+     0   0    6  170   35        C     C  C       S S  S  S      S  C                    S       
   520  155 P L  H  X S+     0   0    1  170   10        M     M  M       L L  L  L      L  M                    I       
   521  156 P I  H  X S+     0   0  105  170   85        V     I  V       M M  M  M      M  L                    I       
   522  157 P C  H  X S+     0   0   63  170   38        C     C  C       C C  C  C      C  C                    C       
   523  158 P L  H  X S+     0   0    0  170    4        L     L  L       L L  L  L      L  L                    L       
   524  159 P A  H  < S+     0   0    1  170    9        A     A  A       A A  A  A      A  A                    A       
   525  160 P A  H  < S+     0   0   61  170   67        S     A  S       Q Q  Q  Q      Q  A                    S       
   526  161 P E  H  < S+     0   0   72  170   23        E     E  E       E E  E  E      E  E                    E       
   527  162 P Y    ><  +     0   0    5  170    2        Y     Y  Y       Y Y  H  Y      Y  Y                    Y       
   528  163 P P  T 3  S+     0   0   28  170   29        P     P  P       P P  P  P      P  P                    P       
   529  164 P M  T 3  S+     0   0   26  170   86        A     A  A       L L  L  L      L  T                    G       
   530  165 P V  S <  S-     0   0    1  170    8        V     V  V       V V  V  V      V  V                    V       
   531  166 P K  E     - x   0 501H  37  170    2        K     K  K       K K  K  K      K  K                    K       
   532  167 P F  E     +vx 479 502H   0  170    1        F     F  F       F F  F  F      F  F                    F       
   533  168 P C  E     -vx 480 503H   0  170   18        C     C  C       C C  C  C      C  C                    C       
   534  169 P K  E     +vx 481 504H  51  170   37        R     R  R       S S  S  S      S  R                    R       
   535  170 P I  E     - x   0 505H   1  170   21        V     V  V       V V  V  V      V  V                    V       
   536  171 P K  E >>  - x   0 506H  52  170   72        K     K  K       R R  R  R      R  R                    K       
   537  172 P A  H >> S+     0   0   13  170   46        S     S  S       S S  S  S      S  S                    S       
   538  173 P S  H 34 S+     0   0   88  170   30        S     S  S       S S  S  S      S  S                    S       
   539  174 P N  H <4 S+     0   0   67  170   86        V     V  V       A A  A  A      A  L                    L       
   540  175 P T  H << S-     0   0   25  170   73        I     I  I       I I  I  I      I  I                    L       
   541  176 P G     <  +     0   0   66  169   22        G     X  G       S S  S  S      S  G                    G       
   542  177 P A    >   -     0   0   39  170   55        A     A  A       T T  I  T      T  T                    T       
   543  178 P G  T 3  S-     0   0   70  169   43        S     .  S       S S  S  S      S  S                    S       
   544  179 P D  T 3  S+     0   0  151  169   78        R     .  R       A A  D  A      A  S                    A       
   545  180 P R  S <  S+     0   0  167  169   58        R     .  R       L L  L  L      L  R                    K       
   546  181 P F  S    S+     0   0   35  169    0        F     .  F       F F  F  F      F  F                    F       
   547  182 P S    >>  -     0   0   34  169   70        T     .  T       R R  R  R      R  T                    T       
   548  183 P S  T 34 S+     0   0   86  169   84        R     .  R       D D  E  D      D  G                    T       
   549  184 P D  T 34 S+     0   0  126  169   66        N     .  N       S S  S  S      S  N                    Y       
   550  185 P V  T <4 S+     0   0   20  169   65        A     .  A       A A  A  A      A  A                    A       
   551  186 P L     <  +     0   0    8  170   13        L     L  L       L L  L  L      L  L                    L       
   552  187 P P  S    S+     0   0    1  170    0        P     P  P       P P  P  P      P  P                    P       
   553  188 P T  E     -W  505   0H   1  170   42        A     A  A       A A  A  A      A  A                    A       
   554  189 P L  E     -WY 504 566H   0  170    2        L     L  L       L L  L  L      L  L                    L       
   555  190 P L  E     -WY 503 565H   4  170    9        L     L  L       L L  L  L      L  L                    L       
   556  191 P V  E     +WY 502 564H   0  170   19        I     I  I       V V  V  V      V  V                    V       
   557  192 P Y  E     +WY 501 562H  31  170    0        Y     Y  Y       C Y  Y  Y      Y  Y                    Y       
   558  193 P K  E >  S-WY 500 561H  25  170   12        K     K  K       K K  K  K      K  K                    K       
   559  194 P G  T 3  S-     0   0   25  170   41        G     G  G       A G  G  A      G  G                    A       
   560  195 P G  T 3  S+     0   0   48  170   21        G     G  G       G G  G  G      G  G                    G       
   561  196 P E  E <   -Y  558   0H  38  170   36        D     E  D       D D  D  D      D  E                    E       
   562  197 P L  E     +Y  557   0H  34  170   12        L     L  L       L L  L  L      L  L                    L       
   563  198 P L  E     -     0   0H   2  170   20        V     I  V       I I  I  I      I  I                    I       
   564  199 P S  E     -Y  556   0H   4  170   30        G     G  G       G G  G  G      G  G                    G       
   565  200 P N  E     -Y  555   0H  41  170    0        N     N  N       N N  N  N      N  N                    N       
   566  201 P F  E >   -Y  554   0H   3  170    1        F     F  F       F F  F  F      F  F                    F       
   567  202 P I  T 3  S-     0   0   87  168   25        V     V  V       V V  V  V      V  V                    V       
   568  203 P S  T >  S-     0   0   11  168   71        R     R  R       R R  R  R      R  R                    R       
   569  204 P V  G X  S+     0   0    0  168   35        V     V  V       V V  L  L      L  I                    I       
   570  205 P T  G >  S+     0   0   17  168   36        T     T  T       T T  T  T      T  T                    T       
   571  206 P E  G <  S+     0   0  156  168   35        D     D  D       D D  D  D      D  D                    D       
   572  207 P Q  G <  S+     0   0   84  168   43        Q     Q  Q       Q Q  Q  Q      Q  Q                    Q       
   573  208 P L  S <  S-     0   0   31  168   11        L     L  L       L L  L  L      L  L                    L       
   574  209 P A    >   -     0   0   49  168   51        G     G  G       G G  G  G      G  G                    G       
   575  210 P E  T 3  S+     0   0  201  168   27        E     E  E       E E  E  E      D  E                    V       
   576  211 P E  T 3  S+     0   0  166  168   21        D     D  D       D D  D  D      D  D                    D       
   577  212 P F    <   -     0   0   17  168    0        F     F  F       F F  F  F      F  F                    F       
   578  213 P F    >>  -     0   0  146  168   24        F     F  F       L F  F  F      F  F                    F       
   579  214 P T  H 3> S+     0   0   24  167   24        A     .  A       A A  A  A      A  A                    A       
   580  215 P G  H 3> S+     0   0   32  167   71        V     .  V       V V  V  V      V  A                    V       
   581  216 P D  H <> S+     0   0   57  167    4        D     .  D       D D  D  D      D  D                    D       
   582  217 P V  H  X S+     0   0    0  167   23        L     .  L       V V  V  L      L  L                    L       
   583  218 P E  H  X S+     0   0   32  167    8        E     .  E       E E  E  E      E  E                    E       
   584  219 P S  H  X S+     0   0   58  167   52        A     .  A       A A  A  A      A  A                    A       
   585  220 P F  H  < S+     0   0    2  168    2        F     F  F       L L  L  L      L  F                    F       
   586  221 P L  H ><>S+     0   0    0  168    0        L     L  L       L L  L  L      L  L                    L       
   587  222 P N  H ><5S+     0   0   61  168   82        Q     Q  Q       Q Q  Q  Q      Q  Q                    H       
   588  223 P E  T 3<5S+     0   0   70  168   18        E     E  E       E E  E  E      E  E                    E       
   589  224 P Y  T < 5S-     0   0   20  165   47        C     F  C       Y Y  Y  Y      Y  F                    C       
   590  225 P G  T < 5S+     0   0    6  165    6        G     G  G       G G  G  G      G  S                    G       
   591  226 P L      < +     0   0    2  165   18        L     L  L       L M  L  L      L  L                    L       
   592  227 P L  S    S-     0   0   10  161    8        L     L  L       L L  L  L      L  L                    L       
   593  228 P P        -     0   0   40  161   31        P     P  P       P P  P  P      P  P                    P       
   594  229 P E              0   0   94  159   17        A     E  A       D D  E  E      D  E                    E       
   595  230 P K              0   0  161  158   24        K     K  K       K K  K  K      K  K                    K       
## ALIGNMENTS  631 -  700
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....4....:....5....:....6....:....7....:....8....:....9....:....0
     1    2 B S              0   0  117  267   60                                                                     D  
     2    3 B E     >  -     0   0  107  283   60                                                                     K  
     3    4 B L  H  > S+     0   0   52  299   33                                                                     I  
     4    5 B D  H  > S+     0   0  104  300   57                                                                     R  
     5    6 B Q  H  > S+     0   0  131  301   62                                                                     T  
     6    7 B L  H  X S+     0   0   27  302   65                                                                     A  
     7    8 B R  H  X S+     0   0  110  311   10                                                                     K  
     8    9 B Q  H  X S+     0   0  117  312   60                                                                     T  
     9   10 B E  H  X S+     0   0   78  313   13                                                                     E  
    10   11 B A  H  X S+     0   0    1  313   25                                                                     C  
    11   12 B E  H  X S+     0   0  121  315   21                                                                     K  
    12   13 B Q  H  X S+     0   0  111  323   73                                                                     Q  
    13   14 B L  H  X S+     0   0   14  348    5                                                                     L  
    14   15 B K  H  X S+     0   0   99  348   37                                                                     Y  
    15   16 B N  H  X S+     0   0   33  348   56                                                                     D  
    16   17 B Q  H  X S+     0   0   82  348   60                                                                     Q  
    17   18 B I  H  X S+     0   0    7  348   18                                                                     I  
    18   19 B R  H  X S+     0   0  135  348   59                                                                     N  
    19   20 B D  H  X S+     0   0   85  349   72                                                                     R  
    20   21 B A  H  X S+     0   0   36  249   44                                                                     .  
    21   22 B R  H >X S+     0   0   22  349   28                                                                     I  
    22   23 B K  H 3< S+     0   0  136  350   43                                                                     K  
    23   24 B A  H 3< S+     0   0   79  350   64                                                                     g  
    24   25 B C  H << S+     0   0   19  306   94                                                                     i  
    25   26 B A     <  +     0   0   46  309   60                                                                     Q  
    26   27 B D        +     0   0   88  312    3                                                                     D  
    27   28 B A        -     0   0   17  315   51                                                                     T  
    28   29 B T    >>  -     0   0   59  315   41                                                                     Q  
    29   30 B L  H 3> S+     0   0    0  317    9                                                                     L  
    30   31 B S  H 34 S+     0   0   38  323   90                                                                     M  
    31   32 B Q  H X4 S+     0   0  119  330   65                                                                     N  
    32   33 B I  H 3< S+     0   0   28  332   58                                                                     L  
    33   34 B T  T >< S+     0   0    0  343   62                                                                     S  
    34   35 B N  T <  S+     0   0  129  351   77                                                                     H  
    35   36 B N  T 3  S+     0   0  111  351   67                                                                     G  
    36   37 B I  S <  S-     0   0   21  338   72                                                                     V  
    37   38 B D        -     0   0  138  345   57                                                                     N  
    38   39 B P        -     0   0   89  348   62                                                                     S  
    39   40 B V        -     0   0   23  350   41                                                                     L  
    40   41 B G        -     0   0   54  353   52                                                                     H  
    41   42 B R        -     0   0  115  354   44                                                                     E  
    42   43 B I        +     0   0    8  354   63                                                                     L  
    43   44 B Q        -     0   0   54  340   61                                                                     N  
    44   45 B M        -     0   0   11  345   12                                                                     L  
    45   46 B R        -     0   0   49  346   51                                                                     Q  
    46   47 B T  E     +A  338   0A  12  350   67                                                                     P  
    47   48 B R  E     +     0   0A  56  355   56                                                                     V  
    48   49 B R  E     -A  337   0A  60  355   15                                                                     R  
    49   50 B T  E     -A  336   0A  30  355   27                                                                     T  
    50   51 B L  E     -A  335   0A   0  355    2                                                                     L  
    51   52 B R        +     0   0  159  355   41                                                                     K  
    52   53 B G        +     0   0   20  355    0                                                                     G  
    53   54 B H        -     0   0    4  355    0                                                                     H  
    54   55 B L  S    S+     0   0  116  355   50                                                                     N  
    55   56 B A  S    S-     0   0    0  355   30                                                                     N  
    56   57 B K        -     0   0   15  355    0                                                                     K  
    57   58 B I  E     -D   73   0B   0  355    9                                                                     I  
    58   59 B Y  E     -     0   0B   6  355   20                                                                     S  
    59   60 B A  E     -D   72   0B  13  355   32                                                                     D  
    60   61 B M  E     -D   71   0B  15  355   10                                                                     V  
    61   62 B H  E     -D   70   0B  44  355   33                                                                     K  
    62   63 B W  E     -D   69   0B  11  355    0                                                                     W  
    63   64 B G    >   -     0   0    3  355   54                                                                     S  
    64   65 B T  T 3  S+     0   0   75  355   66                                                                     Q  
    65   66 B D  T 3  S-     0   0   80  355   12                                                                     D  
    66   67 B S  S <  S+     0   0    3  355   57                                                                     S  
    67   68 B R  S    S+     0   0   94  355   47                                                                     A  
    68   69 B L  E     + E   0  82B  31  355   87                                                                     S  
    69   70 B L  E     -DE  62  81B   0  355   23                                                                     V  
    70   71 B L  E     -DE  61  80B   0  355    7                                                                     L  
    71   72 B S  E     -DE  60  79B   0  354    2                                                                     S  
    72   73 B A  E     -DE  59  78B   0  354    5                                                                     S  
    73   74 B S  E >>  -DE  57  77B   0  354    2                                                                     S  
    74   75 B Q  T 34 S+     0   0    1  355    1                                                                     Q  
    75   76 B D  T 34 S-     0   0    9  355    0                                                                     D  
    76   77 B G  T <4 S+     0   0    7  355    1                                                                     G  
    77   78 B K  E  <  -EF  73  93B  52  355   34                                                                     F  
    78   79 B L  E     -EF  72  92B   0  355    4                                                                     I  
    79   80 B I  E     -EF  71  91B   0  355    7                                                                     I  
    80   81 B I  E     -EF  70  90B   0  355   18                                                                     I  
    81   82 B W  E     -EF  69  88B   0  355    0                                                                     W  
    82   83 B D  E >>> -EF  68  87B  21  355   18                                                                     D  
    83   84 B S  T 345S+     0   0    0  355   52                                                                     P  
    84   85 B Y  T 345S+     0   0   57  354   48                                                                     F  
    85   86 B T  T <45S-     0   0   56  354    8                                                                     T  
    86   87 B T  T  <5 +     0   0   43  354   36                                                                     G  
    87   88 B N  E   < -F   82   0B  99  354   38                                                                     L  
    88   89 B K  E     +F   81   0B  95  354    0                                                                     K  
    89   90 B V  E    S+     0   0B  66  353   49                                                                     K  
    90   91 B H  E     -F   80   0B  57  353   18                                                                     S  
    91   92 B A  E     -F   79   0B  43  353    8                                                                     A  
    92   93 B I  E     -F   78   0B   0  353    3                                                                     I  
    93   94 B P  E     -F   77   0B  80  353   37                                                                     P  
    94   95 B L        -     0   0   26  354    2                                                                     L  
    95   96 B R  S    S+     0   0  190  354   40                                                                     L  
    96   97 B S        -     0   0   17  354   24                                                                     S  
    97   98 B S  S    S+     0   0    6  354   36                                                                     Q  
    98   99 B W        +     0   0    2  354    3                                                                     W  
    99  100 B V  E     -G  115   0C   4  354    1                                                                     V  
   100  101 B M  E     +     0   0C   5  353    4                                                                     L  
   101  102 B T  E     -G  114   0C   8  353   13                                                                     S  
   102  103 B C  E     -G  113   0C   0  353    9                                                                     S  
   103  104 B A  E     -G  112   0C   0  353    8                                                                     A  
   104  105 B Y  E     -G  111   0C   9  353   10                                                                     I  
   105  106 B A    >   -     0   0    0  353   33                                                                     S  
   106  107 B P  T 3  S+     0   0   64  353    8                                                                     P  
   107  108 B S  T 3  S-     0   0   47  353   31                                                                     S  
   108  109 B G  S <  S+     0   0    8  353   14                                                                     G  
   109  110 B N  S    S+     0   0   50  353   43                                                                     N  
   110  111 B Y  E     - H   0 124C  50  353   55                                                                     L  
   111  112 B V  E     -GH 104 123C   0  353    5                                                                     V  
   112  113 B A  E     +GH 103 122C   0  353    4                                                                     A  
   113  114 B C  E     +GH 102 121C   5  353   10                                                                     S  
   114  115 B G  E     +GH 101 120C   1  353    6                                                                     A  
   115  116 B G  E >  S-G   99   0C   0  353    0                                                                     G  
   116  117 B L  T 3  S+     0   0    1  353    1                                                                     L  
   117  118 B D  T 3  S-     0   0   50  353    3                                                                     D  
   118  119 B N  S <  S+     0   0   30  353   21                                                                     N  
   119  120 B I  E     - I   0 139C  39  353   43                                                                     H  
   120  121 B C  E     -HI 114 138C   0  353    7                                                                     C  
   121  122 B S  E     -HI 113 137C   9  353   14                                                                     S  
   122  123 B I  E     -HI 112 136C   0  353    6                                                                     V  
   123  124 B Y  E     -H  111   0C   3  353    4                                                                     Y  
   124  125 B N  E     +H  110   0C  24  353   45                                                                     R  
   125  126 B L        +     0   0   11  353   12                                                                     V  
   126  127 B K  S    S+     0   0  109  353   60                                                                     S  
   127  128 B T  S    S-     0   0   64  353   71                                                                     r  
   128  129 B R  S    S+     0   0  267  336   26                                                                     r  
   129  130 B E  S    S-     0   0  173  340   28                                                                     I  
   130  131 B G        -     0   0   50  351   25                                                                     q  
   131  132 B N        +     0   0   30  349   59                                                                     n  
   132  133 B V  S    S+     0   0   58  329   58                                                                     .  
   133  134 B R  S    S-     0   0  213  347   44                                                                     .  
   134  135 B V        -     0   0   29  352   27                                                                     V  
   135  136 B S  S    S-     0   0   43  352   59                                                                     I  
   136  137 B R  E     -I  122   0C 105  344   18                                                                     S  
   137  138 B E  E     -I  121   0C  75  346   40                                                                     I  
   138  139 B L  E     +I  120   0C   1  349    5                                                                     F  
   139  140 B A  E     +I  119   0C  61  351   61                                                                     K  
   140  141 B G        +     0   0   50  351   27                                                                     G  
   141  142 B H        -     0   0    9  352    8                                                                     H  
   142  143 B T  S    S+     0   0   64  352   62                                                                     T  
   143  144 B G  S    S-     0   0    0  352    8                                                                     C  
   144  145 B Y        -     0   0    0  352    1                                                                     Y  
   145  146 B L  E     +J  160   0D   0  352   18                                                                     I  
   146  147 B S  E     -     0   0D   3  352    1                                                                     S  
   147  148 B C  E     -J  159   0D   9  353   29                                                                     A  
   148  149 B C  E     -J  158   0D   0  353    6                                                                     T  
   149  150 B R  E     -J  157   0D  53  353   33                                                                     E  
   150  151 B F  E     -J  156   0D  10  353    2                                                                     F  
   151  152 B L  S    S-     0   0   26  353   35                                                                     L  
   152  153 B D  S    S-     0   0   60  353   56                                                                     D  
   153  154 B D  S    S+     0   0   60  353   13                                                                     E  
   154  155 B N  S    S+     0   0   44  353   76                                                                     R  
   155  156 B Q  E     + K   0 169D  60  353   66                                                                     T  
   156  157 B I  E     -JK 150 168D   0  354   13                                                                     I  
   157  158 B V  E     -JK 149 167D   0  354   27                                                                     L  
   158  159 B T  E     -JK 148 166D   0  353    0                                                                     T  
   159  160 B S  E     -JK 147 165D   0  352   19                                                                     A  
   160  161 B S  E >   -J  145   0D   0  352    0                                                                     S  
   161  162 B G  T 3  S+     0   0    0  352    0                                                                     G  
   162  163 B D  T 3  S-     0   0    5  352    0                                                                     D  
   163  164 B T  S <  S+     0   0    8  353   76                                                                     M  
   164  165 B T        -     0   0    2  353   17                                                                     T  
   165  166 B C  E     -KL 159 179D   0  352    1                                                                     C  
   166  167 B A  E     -KL 158 178D   0  353   70                                                                     A  
   167  168 B L  E     -KL 157 177D   6  353   29                                                                     M  
   168  169 B W  E     -KL 156 175D   2  353    0                                                                     W  
   169  170 B D  E >>> -KL 155 174D  37  353    1                                                                     D  
   170  171 B I  T 345S+     0   0    7  353   13                                                                     I  
   171  172 B E  T 345S+     0   0  144  353   32                                                                     P  
   172  173 B T  T <45S-     0   0   78  353   40                                                                     K  
   173  174 B G  T  <5 +     0   0   16  353   12                                                                     S  
   174  175 B Q  E   < -L  169   0D 135  353   74                                                                     K  
   175  176 B Q  E     -L  168   0D  30  353   58                                                                     R  
   176  177 B T  E     +     0   0D  64  353   70                                                                     V  
   177  178 B T  E     -L  167   0D  20  353   63                                                                     T  
   178  179 B T  E     -L  166   0D   5  354   78                                                                     E  
   179  180 B F  E     +L  165   0D   1  354    0                                                                     F  
   180  181 B T        +     0   0   34  354   73                                                                     I  
   181  182 B G        +     0   0   37  354   33                                                                     D  
   182  183 B H        -     0   0    7  354    0                                                                     H  
   183  184 B T  S    S+     0   0   99  354   69                                                                     L  
   184  185 B G  S    S-     0   0    0  354   17                                                                     G  
   185  186 B D        -     0   0    1  354    0                                                                     D  
   186  187 B V  E     -M  202   0E   0  354   18                                                                     V  
   187  188 B M  E     +     0   0E   3  354   11                                                                     L  
   188  189 B S  E     -M  201   0E  16  354   17                                                                     T  
   189  190 B L  E     -M  200   0E   3  354   28                                                                     M  
   190  191 B S  E     -M  199   0E  21  354   23                                                                     D  
   191  192 B L  E     -M  198   0E  29  354   32                                                                     L  
   192  193 B A    >   -     0   0    4  354   63                                                                     P  
   193  194 B P  T 3  S+     0   0   85  354   30                                                                     P  
   194  195 B D  T 3  S-     0   0   87  354   71                                                                     A  
   195  196 B T  S <  S+     0   0   62  354   89                                                                     N  
   196  197 B R  S    S+     0   0  142  355   76                                                                     T  
   197  198 B L  E     - N   0 211E  37  351   70                                                                     .  
   198  199 B F  E     -MN 191 210E   0  351    0                                                                     .  
   199  200 B V  E     -MN 190 209E   0  352   12                                                                     .  
   200  201 B S  E     -MN 189 208E   0  353    3                                                                     .  
   201  202 B G  E     +MN 188 207E   0  355    3                                                                     g  
   202  203 B A  E >   -M  186   0E   0  354   31                                                                     g  
   203  204 B C  T 3  S+     0   0    5  354    7                                                                     S  
   204  205 B D  T 3  S-     0   0   31  354    0                                                                     D  
   205  206 B A  S <  S+     0   0   20  354   39                                                                     G  
   206  207 B S  E     - O   0 222E   6  354   82                                                                     Y  
   207  208 B A  E     -NO 201 221E   0  354   28                                                                     A  
   208  209 B K  E     -NO 200 220E  18  354   20                                                                     Y  
   209  210 B L  E     -NO 199 219E   2  354   11                                                                     L  
   210  211 B W  E     -NO 198 217E   1  354    0                                                                     W  
   211  212 B D  E >>> -NO 197 216E  11  354    0                                                                     D  
   212  213 B V  T 345S+     0   0   12  354   39                                                                     V  
   213  214 B R  T 345S+     0   0  194  354    0                                                                     R  
   214  215 B E  T <45S-     0   0  111  353   69                                                                     Q  
   215  216 B G  T  <5 +     0   0    8  354   39                                                                     P  
   216  217 B M  E      -     0   0    1  353    5                                                                     F  
   235  236 B P  T 3  S+     0   0   45  353    4                                                                     N  
   236  237 B N  T 3  S-     0   0   42  353   42                                                                     N  
   237  238 B G  S <  S+     0   0   12  353    5                                                                     G  
   238  239 B N  S    S+     0   0   56  353   67                                                                     E  
   239  240 B A  E     - Q   0 253F   0  353   48                                                                     S  
   240  241 B F  E     -PQ 233 252F   0  353   14                                                                     F  
   241  242 B A  E     -PQ 232 251F   0  353   59                                                                     M  
   242  243 B T  E     -PQ 231 250F   0  353    6                                                                     A  
   243  244 B G  E     +PQ 230 249F   0  353    0                                                                     G  
   244  245 B S  E >   -P  228   0F   0  353    0                                                                     S  
   245  246 B D  T 3  S+     0   0   13  353    2                                                                     D  
   246  247 B D  T 3  S-     0   0   28  353    0                                                                     D  
   247  248 B A  S <  S+     0   0    6  353   38                                                                     G  
   248  249 B T        -     0   0   16  353   41                                                                     S  
   249  250 B C  E     -QR 243 263F   0  353   12                                                                     A  
   250  251 B R  E     -QR 242 262F  23  353    7                                                                     R  
   251  252 B L  E     -QR 241 261F   0  353    1                                                                     L  
   252  253 B F  E     -QR 240 259F   1  352    1                                                                     F  
   253  254 B D  E  >> -QR 239 258F   1  352    0                                                                     D  
   254  255 B L  T >45S+     0   0   15  352   28                                                                     L  
   255  256 B R  T 345S+     0   0   57  352    1                                                                     R  
   256  257 B A  T 345S-     0   0    0  352   29                                                                     S  
   257  258 B D  T <<5 +     0   0    0  352   23                                                                     D  
   258  259 B Q  E      -     0   0  119  354   72                                                                     e  
   266  267 B D  T 3  S+     0   0  161  354   42                                                                     S  
   267  268 B N  T 3  S+     0   0   66  354   66                                                                     C  
   268  269 B I    <   +     0   0   23  354   48                                                                     i  
   269  270 B I        +     0   0   97  354   54                                                                     d  
   270  271 B C  S    S-     0   0   10  354   48                                                                     Q  
   271  272 B G        -     0   0    1  355   28                                                                     G  
   272  273 B I  E     +S  288   0G   0  355   15                                                                     V  
   273  274 B T  E     +     0   0G  13  355   15                                                                     I  
   274  275 B S  E     +S  287   0G  18  355    1                                                                     S  
   275  276 B V  E     +S  286   0G  10  355   16                                                                     I  
   276  277 B S  E     -S  285   0G  15  354   25                                                                     D  
   277  278 B F  E     -S  284   0G  12  354   30                                                                     F  
   278  279 B S        -     0   0    3  354    4                                                                     S  
   279  280 B K  S    S+     0   0  104  354   81                                                                     S  
   280  281 B S  S    S-     0   0    2  354    3                                                                     S  
   281  282 B G  S    S+     0   0    0  354    1                                                                     G  
   282  283 B R        +     0   0    8  354    0                                                                     R  
   283  284 B L  E     - T   0 297G   0  354   11                                                                     L  
   284  285 B L  E     -ST 277 296G   0  354    5                                                                     M  
   285  286 B L  E     -ST 276 295G   0  354   15                                                                     Y  
   286  287 B A  E     -ST 275 294G   0  355   18                                                                     A  
   287  288 B G  E     -ST 274 293G   2  355   11                                                                     C  
   288  289 B Y  E >   -S  272   0G   4  355    1                                                                     Y  
   289  290 B D  T 3  S+     0   0    3  355   34                                                                     A  
   290  291 B D  T 3  S-     0   0   37  355   17                                                                     D  
   291  292 B F  S <  S+     0   0    3  355   44                                                                     Y  
   292  293 B N        -     0   0   15  355   49                                                                     G  
   293  294 B C  E     -TU 287 307G   0  355   10                                                                     C  
   294  295 B N  E     -TU 286 306G   5  355   74                                                                     A  
   295  296 B V  E     -TU 285 305G   0  355   16                                                                     V  
   296  297 B W  E     -TU 284 303G   6  355    0                                                                     W  
   297  298 B D  E  >  -T  283   0G   4  355    0                                                                     D  
   298  299 B A  T  4 S+     0   0    0  355   65                                                                     I  
   299  300 B L  T  4 S+     0   0    0  355   27                                                                     I  
   300  301 B K  T  4 S-     0   0   29  355   53                                                                     K  
   301  302 B A  S  < S+     0   0   17  355   52                                                                     G  
   302  303 B D  S    S-     0   0   95  355   52                                                                     E  
   303  304 B R  E     -U  296   0G  69  354   61                                                                     M  
   304  305 B A  E     -     0   0G  14  355   63                                                                     I  
   305  306 B G  E     -U  295   0G   4  355   27                                                                     G  
   306  307 B V  E >   -U  294   0G   7  355   69                                                                     K  
   307  308 B L  E >  S+U  293   0G   2  350   36                                                                     V  
   308  309 B A  G >  S-     0   0    4  351   70                                                                     D  
   309  310 B G  G <   -     0   0    4  353   21                                                                     G  
   310  311 B H  G <  S+     0   0    8  353    0                                                                     H  
   311  312 B D    <   -     0   0   26  353   32                                                                     R  
   312  313 B N  S    S+     0   0   31  353   16                                                                     N  
   313  314 B R        +     0   0   40  353    5                                                                     R  
   314  315 B V        +     0   0    2  353   10                                                                     I  
   315  316 B S  S    S-     0   0    2  353   10                                                                     N  
   316  317 B C  E     -B  329   0A  10  353   17                                                                     A  
   317  318 B L  E     -B  328   0A  15  353   13                                                                     V  
   318  319 B G  E     -B  327   0A  10  353   13                                                                     K  
   319  320 B V  E     -B  326   0A  25  353   19                                                                     T  
   320  321 B T    >   -     0   0    3  353   52                                                                     S  
   321  322 B D  T 3  S+     0   0   98  353   70                                                                     P  
   322  323 B D  T 3  S-     0   0   51  352    9                                                                     D  
   323  324 B G  S <  S+     0   0    0  352    4                                                                     G  
   324  325 B M  S    S+     0   0   36  350   62                                                                     M  
   325  326 B A        -     0   0    0  350   30                                                                     A  
   326  327 B V  E     -BC 319 338A   0  350   33                                                                     V  
   327  328 B A  E     -BC 318 337A   0  349   47                                                                     V  
   328  329 B T  E     -BC 317 336A   7  349    4                                                                     S  
   329  330 B G  E     -BC 316 335A   1  349    4                                                                     S  
   330  331 B S    >   -     0   0    6  349    0                                                                     S  
   331  332 B W  T 3  S+     0   0    6  349    0                                                                     W  
   332  333 B D  T 3  S-     0   0   17  349    0                                                                     D  
   333  334 B S  S <  S+     0   0   12  349   35                                                                     M  
   334  335 B F        -     0   0   78  349   71                                                                     T  
   335  336 B L  E     -AC  50 329A   1  349    8                                                                     L  
   336  337 B K  E     -AC  49 328A  60  346   23                                                                     K  
   337  338 B I  E     -AC  48 327A   0  344   13                                                                     V  
   338  339 B W  E      AC  46 326A   2  341    0                                                                     W  
   339  340 B N              0   0   10  297   57                                                                     T  
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   80    0                                                                        
   342    3 G V        +     0   0   96   82   63                                                                       V
   343    4 G I        -     0   0   38   84   34                                                                       M
   344    5 G N    >   -     0   0  109   84   59                                                                       S
   345    6 G I  G >  S+     0   0   25   84   30                                                                       N
   346    7 G E  G 3  S+     0   0  122  126   44       N        N     N                               N                N
   347    8 G D  G <  S+     0   0  133  137   21       N        N     N                               N                S
   348    9 G L    <   -     0   0   35  141   15       M M      M     M                               T                T
   349   10 G T     >  -     0   0   69  141   62       A P      A     A                               T                T
   350   11 G E  H  > S+     0   0  116  143   33       K E      K     K     D                         N                S
   351   12 G K  H >> S+     0   0   66  152   41       I V      I   R I     K             K           I       R R  M   I
   352   13 G D  H 3> S+     0   0   39  152   35       A D      A   D A     D             E           S       D D  E   S
   353   14 G K  H 3X S+     0   0   83  152   84       E R      E   A D     M             A           Q       A A  N   Q
   354   15 G L  H < S+     0   0    7  233    6  EEEEEE EEEEEEEEEEEQEEEEEEEQEEEEEEEQEEEEEQEEEEEEEEEEEEEEEEEQEQEQ  E   E
   365   26 G V  H 3< S+     0   0   43  233   53  AAAAAV LAAAATAVAAAAAVAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  A   A
   366   27 G T  T 3< S+     0   0  116  233   82  GGGGSN GSSGAGSNGGCSCNSGGGATGCGCGSCGGSSCCSCCCCCGCASACYCGCCCSCSCS  A   Y
   367   28 G L    <   -     0   0   49  233   61  VVVVVI IVVVVLVIVVMMMIVIIILMIMIMVVMVMIVMMMMMMMMVMVVIMMMIMMMMMMMM  I   L
   368   29 G E        -     0   0  191  233   49  EEEEED EEEEEEEDEEDEDEEDTDKEDDDDEEDEDEEDDEDDDDDEDEEEDDDDDDDEDEDE  Q   D
   369   30 G R        -     0   0   32  233    1  RRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRRRRRRRRRRRRRRRR  R   R
   370   31 G M        -     0   0   53  233   85  IIIIIM QIIIIIIMIIVWVMIVIVIWVVVVIIVIVIIVVWVVVVVIVIIMIIVVVVIWIWIW  K   I
   371   32 G L     >  -     0   0   75  232   81  KKKKKK KKMKKRKKKKKPKMKKKKTPKKKKKKKKKKKKKPKKKKKNKRKKKKKKKKKTKPKP  K   K
   372   33 G V  H  > S+     0   0    4  232   15  VVVVVV VVVVVVVVVVVLVVVVVVVLVVVVVVVVVVVVVLVVVVVVVVVVVVVVVVVLVLVL  V   V
   373   34 G S  H  > S+     0   0   14  232    1  SSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS  S   S
   374   35 G K  H  > S+     0   0   93  232   38  QQQQQK VQQQQQQKQQQKQKQKKKKKKQKQQQQQQKQQQKQQQQQQQQQQKKQKQQKKKKKK  E   K
   375   36 G C  H  X S+     0   0    0  233   62  AAAAAA VAAAAAAAAAASAAAAAAASAAAAAAAAAAAAASAAAAAEAAAAAAAAAAASASAS  V   A
   376   37 G C  H  X S+     0   0    0  233   63  AAAAAA AAAAAAAAAAAIAAAAAAVIAAAAAAAAASAAAIAAAAAAAAEAAAAAAAAIAIAI  S   A
   377   38 G E  H  X S+     0   0   75  233   68  AAAAAA NAAAAAAAAAAAAAAATTEAAATAAAAASSAAAAASAAAAAAAMAAATSAAAAAAA  K   A
   378   39 G E  H  X S+     0   0   60  233   26  EEEEED SEEEEEEDEEDADDEDDDDADDDDEEDEDDEDDVDDDDDEDEEGDDDDDDDADADA  E   D
   379   40 G F  H  X S+     0   0    3  233   36  LLLLLL LLLLLLLLLLLMLLLLLLIMLLLLLLLLLLLLLMLLLLLLLLLLLLLLLLLMLMLM  L   L
   380   41 G R  H  X S+     0   0   53  233   79  QQQQQL KQQQQQQLQQLRLMQLLLMRLLLLQQLQLMQLLRLLLLLQLQQQLLLLLLMRMRMR  L   L
   381   42 G D  H  X S+     0   0   67  233   65  QQQQQA EQQQQQQAQQAEAAQQQQKEQAQAQQAQARQAAEAAAAAQAQQQAAAQAAAEAEAE  E   A
   382   43 G Y  H  X S+     0   0   43  233    2  YYYYYY YYYYYYYYYYYYYFYFFFYYFYFYYYYYYYYYYYYYYYYYYYYYYYYFYYYYYYYY  Y   Y
   383   44 G V  H >X S+     0   0    0  233   58  CCCCCC CCCCCCCCCCCVCCCCCCIICCCCCCCCCCCCCVCCCCCCCCCCCCCCCCCVCVCV  C   C
   384   45 G E  H 3X S+     0   0   71  233   47  MMMILE ILMMMMLEIMEEEEMTTTTEMEMEMMEMEGLEEEEEEEEMEMMVDEETEEDEDEDE  E   D
   385   46 G E  H 3< S+     0   0  125  233   57  QQQQQT SQQQQQQAQQAEAAQEEEEEEAEAQQAQAEQAAEAAAAAQAQQQAAAEAAAEAEAE  K   A
   386   47 G R  H XX S+     0   0   94  233   69  NNNNNH ENNNNNNHNNHNHHNQQQHHQHQHNNHNHHNHHNHHHHHNHNNNHHHQHHHNHNHN  N   H
   387   48 G S  H >< S+     0   0   12  233   67  AAAAAG SAAAAAAAAAVEVAAAAAEEAVAVAAVAVAAVVEVVVVVAVAAAIIVAVVTEVEVE  K   M
   388   49 G G  T 3< S+     0   0   38  233   80  CCCCGK DGCCCCGKCCRKRKCKKKQKKRKRCCRCRKGRRKRRRRRCRCCCRGRKRRRKRKRK  G   G
   389   50 G E  T <4 S+     0   0  138  232   54  KKKKKE .KKKKKKEKKENEEKSSSETSESEKKEKESKEENEEEEEKEKKKEEESEEENENEN  G   E
   390   51 G D    XX> -     0   0    1  232    0  DDDDDD .DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDNDDDDDDDDDDDDD  D   D
   391   52 G P  H 3>5S+     0   0   17  233   25  AAAAAP PAAAAAAPAAPPPPAPPPCPPPPPAAPAPPAPPPPPPPPAPAAAPPPPPPPPPPPP  L   P
   392   53 G L  H 345S+     0   0    6  233    3  LLLLLL LLLLLLLLLLLLLLLFFFLLFLFLLLLLLLLLLLLLLLLLLLLLLLLFLLLLLLLL  L   L
   393   54 G V  H <45S+     0   0   24  233   29  LLLLLV VLLLLLLVLLIIIVLLLLLILILILLILILLIIIIIIIILILLLIIILIIIIIIII  V   I
   394   55 G K  H  <5S-     0   0  149  233   80  VIVLVT DVVVVVVTLVIHIVVVVMLHVIVIVVIVIMVIIHIIIIIVIVVVIIIVIIVHLHLH  S   M
   395   56 G G     << -     0   0   38  233   34  GGGGGP GGGGGDGPGGPAPPGGGGgAGPGPGSPGPGGPPAPPPPPGPGGGPPPGPPPAPAPA  g   P
   396   57 G I        -     0   0   21  224   20  VVVVVV VVVVVVVVVVV.VVMIIIs.IVIVVVVVVLVVV.VVVVVVVVVLVVVIVVVPV.V.  t   V
   397   58 G P    >>  -     0   0   80  233   11  PPPPPP PPPPPPPPPPPPPSPPPPSPPPPPPPPPPGPPPPPPPPPPPPPPPPPPPPPDPPPP  N   P
   398   59 G E  T 34 S+     0   0   75  233   58  AAAATS KTAAAATSAAADASAAAAQDAAAAAAAAAAAVADAAAAAAAAAAAAAAAAAKADAD  E   T
   399   60 G D  T 34 S+     0   0  151  233   61  GGGGGS RGGGGGGSGGSKSSGAAAKKASASGGSGSSGSSKSSSSSGSGGGSSSASSSKSKSK  S   S
   400   61 G K  T <4 S+     0   0  163  233   62  SSSSSE DSSSSSSESSEKEESTTTSKTETESSESEESEEKEEEEESESSSEEETEEENEKEK  H   E
   401   62 G N     <  -     0   0    1  233    0  NNNNNN NNNNNNNNNNNNNNNNNNNSNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  N   N
   402   63 G P  S    S+     0   0   36  224    0  PPPPPP PPPPPPPPPPP PPPPPPP PPPPPPPPPPPPP PPPPPPPPPPPPPPPPPPP P   P   P
   403   64 G F  S    S-     0   0    3  224    0  FFFFFF FFFFFFFFFFF FFFFFFF FFFFFFFFFFFFF FFFFFFFYFFFFFFFFFWF F   F   F
   404   65 G K              0   0  108  222   29  RRRRRR  RRRRRRRRRR RRRKKKR KRKRRLRRRKRRR RRRRRRRRRRRRRKRRRAR R   Q   R
   405   66 G E              0   0  201  217    3  EEEEEE  EEEEEEEEEE EEEEEEE EEEEEEEEEDEEE EEEEEEEEEEEEEEEEEEE E   E   E
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   62   10                                                                        
   408   14 P E        +     0   0  153  142   39        D                                                        QE D D 
   409   15 P G  S    S+     0   0   38  144   37        G                                                        GG G G 
   410   16 P Q  S    S-     0   0   94  148   90        S                                                        TT S T 
   411   17 P A        +     0   0    1  149   53        A                                                        AS S S 
   412   18 P S        +     0   0   28  149   71        V                                                        PS V S 
   413   19 P H  S    S+     0   0   42  151   57        N                                                        DN N N 
   414   20 P T  S  > S-     0   0    2  152   17        T                                                        qT T T 
   415   21 P G  H  > S-     0   0   10  164    2        G                                                        gG G G 
   416   22 P P  H  > S+     0   0   14  165    0        P                                                        PP P P 
   417   23 P K  H  > S+     0   0    6  165    0        K                                                        KK K K 
   418   24 P G  H  X S+     0   0    0  165    1        G                                                        GG G G 
   419   25 P V  H  X S+     0   0    0  165    0        V                                                        VV V V 
   420   26 P I  H  X S+     0   0    4  165   14        I                                                        LI I I 
   421   27 P N  H  X S+     0   0   48  165   42        H                                                        EK N K 
   422   28 P D  H  X S+     0   0   14  166    0        D                                                        DD D D 
   423   29 P W  H  X S+     0   0    6  166    0        W                                                        WW W W 
   424   30 P R  H  < S+     0   0   67  166   26        R                                                        RQ R Q 
   425   31 P K  H >X S+     0   0   67  166   36        R                                                        RR K R 
   426   32 P F  H >X>S+     0   0    1  166    1        F                                                        FY Y Y 
   427   33 P K  H 3<5S+     0   0   30  166    7        k                                                        kk k k 
   428   34 P L  H <45S+     0   0  139  161    1        l                                                        ll l l 
   429   35 P E  H <<5S+     0   0   86  161    9        E                                                        EE E E 
   430   36 P S  T  <5       0   0   57  162   66        t                                                        ta n a 
   431   37 P E      <       0   0  118  167   66        a                                                        et k t 
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  143   42        l                                                        .. l . 
   434   69 P S        +     0   0   52  144   64        g                                                        .. T . 
   435   70 P R        -     0   0  103  120   85        l                                                        .. G . 
   436   71 P K        +     0   0   22  123   12        Q                                                        .. K . 
   437   72 P M  S    S-     0   0   12  124   13        K                                                        .. L . 
   438   73 P S     >  -     0   0   52  131   65        R                                                        .. N . 
   439   74 P V  H  > S+     0   0  107  130   53        G                                                        .. L . 
   440   75 P Q  H  > S+     0   0  133  130   52        L                                                        .. R . 
   441   76 P E  H  > S+     0   0   38  134   26        E                                                        .. V . 
   442   77 P Y  H  X S+     0   0   36  146   56        E                                                        .. D . 
   443   78 P E  H  < S+     0   0  111  154   61        A                                                        .D E D 
   444   79 P L  H >X S+     0   0   45  155   57        E                                                        .P E P 
   445   80 P I  H 3< S+     0   0   37  157   72        D                                                        ED E E 
   446   81 P H  T 3< S+     0   0  178  158   80        D                                                        EL E L 
   447   82 P K  T <4 S+     0   0  140  157   65        D                                                        DA E A 
   448   83 P D     <  -     0   0   58  169   39        D                                                        VN D N 
   449   84 P K        -     0   0  205  149   80        D                                                        EL D L 
   450   85 P E        -     0   0   45  150   68        D                                                        LL D L 
   451   86 P D    >>  -     0   0   87  169   31        D                                                        DA D S 
   452   87 P E  H 3> S+     0   0  113  168   12        E                                                        ED E D 
   453   88 P N  H 3> S+     0   0   73  169   59        A                                                        DE A E 
   454   89 P C  H <> S+     0   0   32  170   72        F                                                        FF F F 
   455   90 P L  H  X S+     0   0    4  170    2        L                                                        LL L L 
   456   91 P R  H  X S+     0   0  131  170   63        Q                                                        RL Q L 
   457   92 P K  H  X S+     0   0  112  170   59        Q                                                        WE Q E 
   458   93 P Y  H  X S+     0   0    7  170    5        Y                                                        YY Y Y 
   459   94 P R  H  X S+     0   0   31  170   31        R                                                        RQ R Q 
   460   95 P R  H  X S+     0   0  130  170   43        Q                                                        ER L K 
   461   96 P Q  H  X S+     0   0   96  170   30        Q                                                        QQ Q Q 
   462   97 P C  H  X S+     0   0   22  170   72        R                                                        RR R R 
   463   98 P M  H  X S+     0   0   33  170   11        M                                                        LM M M 
   464   99 P Q  H  X S+     0   0  115  170   54        E                                                        RK E K 
   465  100 P D  H  X S+     0   0   46  170   21        E                                                        EE Q E 
   466  101 P M  H  X S+     0   0   23  170    2        M                                                        MM M M 
   467  102 P H  H  X S+     0   0   64  170   74        R                                                        QL R L 
   468  103 P Q  H  < S+     0   0  143  170   59        R                                                        QS R A 
   469  104 P K  H  < S+     0   0  140  170   55        Q                                                        KK Q K 
   470  105 P L  H  < S+     0   0   35  170   43        L                                                        AA L T 
   471  106 P S     <  -     0   0   75  170   79        Y                                                        AE C E 
   472  107 P F        -     0   0   71  168   99        g                                                        SK G K 
   473  108 P G        -     0   0   36  168   51        g                                                        LL G L 
   474  109 P P        +     0   0   92  160   41        q                                                        P. R . 
   475  110 P R        +     0   0  177  165   61        Q                                                        TQ R . 
   476  111 P Y        +     0   0   51  166    5        F                                                        FF F F 
   477  112 P G        +     0   0   12  170   61        R                                                        GG E G 
   478  113 P F  S    S-     0   0  151  170  103        R                                                        HK K R 
   479  114 P V  E     -v  532   0H  28  170   13        V                                                        VV V V 
   480  115 P Y  E     -v  533   0H  71  165   68        F                                                        FI M I 
   481  116 P E  E     -v  534   0H 108  170   41        E                                                        DN D D 
   482  117 P L        -     0   0   12  170   32        L                                                        LL I L 
   483  118 P E        +     0   0  134  170   74        T                                                        TE S E 
   484  119 P S  S >> S-     0   0   57  170   53        S                                                        RS S N 
   485  120 P G  H 3> S+     0   0   15  169   40        G                                                        .T G T 
   486  121 P E  H 3> S+     0   0  127  170   23        E                                                        SD E D 
   487  122 P Q  H <> S+     0   0   72  170   61        A                                                        QQ E Q 
   488  123 P F  H  X S+     0   0   26  170    1        F                                                        YF F F 
   489  124 P L  H  X S+     0   0   90  170    6        L                                                        VL L L 
   490  125 P E  H  X S+     0   0  103  170   41        E                                                        DQ R Q 
   491  126 P T  H  < S+     0   0   10  170   76        A                                                        AA A A 
   492  127 P I  H  < S+     0   0   17  170   12        V                                                        II V I 
   493  128 P E  H  < S+     0   0  139  170   20        D                                                        DD D D 
   494  129 P K  S  < S+     0   0  172  170   35        G                                                        KE E G 
   495  130 P E  S    S-     0   0   38  166    5        G                                                        EE E E 
   496  131 P Q    >   -     0   0  116  170   66        P                                                        ND G D 
   497  132 P K  T 3  S+     0   0  156  170   34        R                                                        KK K K 
   498  133 P I  T 3  S+     0   0   68  170   87        G                                                        HS S S 
   499  134 P T    <   -     0   0   10  170   35        A                                                        VV T I 
   500  135 P T  E     -W  558   0H   7  169   62        L                                                        LT L I 
   501  136 P I  E     -Wx 557 531H   3  170   15        V                                                        II V V 
   502  137 P V  E     -Wx 556 532H   0  170   35        L                                                        II L I 
   503  138 P V  E     -Wx 555 533H   0  170   12        V                                                        IV V V 
   504  139 P H  E     -Wx 554 534H   0  170    6        H                                                        HH H H 
   505  140 P I  E     +Wx 553 535H   2  170    1        L                                                        II I I 
   506  141 P Y  E     - x   0 536H   4  170    2        Y                                                        FY Y Y 
   507  142 P E    >   -     0   0   45  170   26        E                                                        EE E E 
   508  143 P D  T 3  S+     0   0   95  170   51        E                                                        QD P D 
   509  144 P G  T 3  S+     0   0   66  170   48        G                                                        FN E N 
   510  145 P I  S X> S-     0   0   36  170   33        V                                                        VI V V 
   511  146 P K  T 34 S+     0   0  191  170   71        P                                                        PP P S 
   512  147 P G  T 3> S+     0   0   13  170   22        G                                                        GG A G 
   513  148 P C  H <> S+     0   0    0  170   35        A                                                        CC C C 
   514  149 P D  H  X S+     0   0   78  170   47        E                                                        DE Q E 
   515  150 P A  H  > S+     0   0   44  170   50        A                                                        AA A A 
   516  151 P L  H  X S+     0   0    0  170   11        L                                                        VM M M 
   517  152 P N  H  X S+     0   0   19  170   16        D                                                        ND D N 
   518  153 P S  H  X S+     0   0   78  170   56        G                                                        GG G G 
   519  154 P S  H  X S+     0   0    6  170   35        C                                                        CC S C 
   520  155 P L  H  X S+     0   0    1  170   10        L                                                        FL L L 
   521  156 P I  H  X S+     0   0  105  170   85        A                                                        QI L I 
   522  157 P C  H  X S+     0   0   63  170   38        C                                                        CS C S 
   523  158 P L  H  X S+     0   0    0  170    4        L                                                        LL L L 
   524  159 P A  H  < S+     0   0    1  170    9        A                                                        AA A A 
   525  160 P A  H  < S+     0   0   61  170   67        G                                                        QE L E 
   526  161 P E  H  < S+     0   0   72  170   23        Q                                                        DE Q E 
   527  162 P Y    ><  +     0   0    5  170    2        Y                                                        HY Y Y 
   528  163 P P  T 3  S+     0   0   28  170   29        P                                                        PP P P 
   529  164 P M  T 3  S+     0   0   26  170   86        G                                                        RH M Y 
   530  165 P V  S <  S-     0   0    1  170    8        V                                                        VV V V 
   531  166 P K  E     - x   0 501H  37  170    2        K                                                        KK K K 
   532  167 P F  E     +vx 479 502H   0  170    1        F                                                        FF F F 
   533  168 P C  E     -vx 480 503H   0  170   18        C                                                        CC C C 
   534  169 P K  E     +vx 481 504H  51  170   37        R                                                        RR R K 
   535  170 P I  E     - x   0 505H   1  170   21        D                                                        II V I 
   536  171 P K  E >>  - x   0 506H  52  170   72        A                                                        QL R L 
   537  172 P A  H >> S+     0   0   13  170   46        A                                                        SG G G 
   538  173 P S  H 34 S+     0   0   88  170   30        P                                                        SL S S 
   539  174 P N  H <4 S+     0   0   67  170   86        W                                                        ET A I 
   540  175 P T  H << S-     0   0   25  170   73        W                                                        AA V A 
   541  176 P G     <  +     0   0   66  169   22        G                                                        DA G G 
   542  177 P A    >   -     0   0   39  170   55        P                                                        VL T L 
   543  178 P G  T 3  S-     0   0   70  169   43        A                                                        SS S S 
   544  179 P D  T 3  S+     0   0  151  169   78        P                                                        QT A K 
   545  180 P R  S <  S+     0   0  167  169   58        R                                                        TQ L Q 
   546  181 P F  S    S+     0   0   35  169    0        F                                                        FF F F 
   547  182 P S    >>  -     0   0   34  169   70        A                                                        TK R K 
   548  183 P S  T 34 S+     0   0   86  169   84        A                                                        SK S K 
   549  184 P D  T 34 S+     0   0  126  169   66        A                                                        KF S F 
   550  185 P V  T <4 S+     0   0   20  169   65        A                                                        GG A G 
   551  186 P L     <  +     0   0    8  170   13        L                                                        LT L V 
   552  187 P P  S    S+     0   0    1  170    0        P                                                        PP P P 
   553  188 P T  E     -W  505   0H   1  170   42        A                                                        AA A T 
   554  189 P L  E     -WY 504 566H   0  170    2        L                                                        IL L L 
   555  190 P L  E     -WY 503 565H   4  170    9        L                                                        LL L L 
   556  191 P V  E     +WY 502 564H   0  170   19        V                                                        AV L V 
   557  192 P Y  E     +WY 501 562H  31  170    0        Y                                                        YY Y Y 
   558  193 P K  E >  S-WY 500 561H  25  170   12        K                                                        RK R K 
   559  194 P G  T 3  S-     0   0   25  170   41        G                                                        GE G N 
   560  195 P G  T 3  S+     0   0   48  170   21        G                                                        GG G G 
   561  196 P E  E <   -Y  558   0H  38  170   36        E                                                        QQ D Q 
   562  197 P L  E     +Y  557   0H  34  170   12        L                                                        LL L V 
   563  198 P L  E     -     0   0H   2  170   20        V                                                        VI V I 
   564  199 P S  E     -Y  556   0H   4  170   30        G                                                        AG G G 
   565  200 P N  E     -Y  555   0H  41  170    0        N                                                        NN N N 
   566  201 P F  E >   -Y  554   0H   3  170    1        F                                                        FF L F 
   567  202 P I  T 3  S-     0   0   87  168   25        V                                                        LV   I 
   568  203 P S  T >  S-     0   0   11  168   71        R                                                        RH   H 
   569  204 P V  G X  S+     0   0    0  168   35        I                                                        IV   V 
   570  205 P T  G >  S+     0   0   17  168   36        T                                                        TT   T 
   571  206 P E  G <  S+     0   0  156  168   35        D                                                        DD   D 
   572  207 P Q  G <  S+     0   0   84  168   43        Q                                                        QH   H 
   573  208 P L  S <  S-     0   0   31  168   11        L                                                        LL   L 
   574  209 P A    >   -     0   0   49  168   51        G                                                        GG   G 
   575  210 P E  T 3  S+     0   0  201  168   27        L                                                        EI   V 
   576  211 P E  T 3  S+     0   0  166  168   21        D                                                        DD   D 
   577  212 P F    <   -     0   0   17  168    0        F                                                        FF   F 
   578  213 P F    >>  -     0   0  146  168   24        F                                                        FY   Y 
   579  214 P T  H 3> S+     0   0   24  167   24        A                                                        AS   S 
   580  215 P G  H 3> S+     0   0   32  167   71        D                                                        GS   S 
   581  216 P D  H <> S+     0   0   57  167    4        D                                                        DD   D 
   582  217 P V  H  X S+     0   0    0  167   23        L                                                        LV   V 
   583  218 P E  H  X S+     0   0   32  167    8        E                                                        EE   E 
   584  219 P S  H  X S+     0   0   58  167   52        S                                                        SA   A 
   585  220 P F  H  < S+     0   0    2  168    2        F                                                        FF   F 
   586  221 P L  H ><>S+     0   0    0  168    0        L                                                        LL   L 
   587  222 P N  H ><5S+     0   0   61  168   82        Q                                                        VI   I 
   588  223 P E  T 3<5S+     0   0   70  168   18        E                                                        EE   E 
   589  224 P Y  T < 5S-     0   0   20  165   47        C                                                         H   H 
   590  225 P G  T < 5S+     0   0    6  165    6        G                                                         G   G 
   591  226 P L      < +     0   0    2  165   18        L                                                         I   I 
   592  227 P L  S    S-     0   0   10  161    8        L                                                         L   L 
   593  228 P P        -     0   0   40  161   31        P                                                         T   A 
   594  229 P E              0   0   94  159   17        E                                                         D   D 
   595  230 P K              0   0  161  158   24        K                                                         K   K 
## ALIGNMENTS  701 -  755
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1    2 B S              0   0  117  267   60     N  DG    G                                          
     2    3 B E     >  -     0   0  107  283   60     R  KQ    QR                        Q Q              
     3    4 B L  H  > S+     0   0   52  299   33     I  II    II                        I I              
     4    5 B D  H  > S+     0   0  104  300   57     N  RD    DA                        E E              
     5    6 B Q  H  > S+     0   0  131  301   62  Q  K  TT    TS                        V K              
     6    7 B L  H  X S+     0   0   27  302   65  A  A  AA    AA L                      T E              
     7    8 B R  H  X S+     0   0  110  311   10  K  R  KR    RR K                      K R              
     8    9 B Q  H  X S+     0   0  117  312   60  Q  L  TN    NQ T                      E N              
     9   10 B E  H  X S+     0   0   78  313   13  E  E  EE    EE M                      K Q              
    10   11 B A  H  X S+     0   0    1  313   25  A  T  CA    AT A                      A G              
    11   12 B E  H  X S+     0   0  121  315   21  K  R  KK    KR D                      K K              
    12   13 B Q  H  X S+     0   0  111  323   73  A  Q  QV    VT S                      L V              
    13   14 B L  H  X S+     0   0   14  348    5  L  L  LL    LL I     L                L L              
    14   15 B K  H  X S+     0   0   99  348   37  F  Y  YY    YY E     A                Y Y              
    15   16 B N  H  X S+     0   0   33  348   56  G  S  DT    TY E     D                D N              
    16   17 B Q  H  X S+     0   0   82  348   60  E  Q  QE    EE K     Q                E E              
    17   18 B I  H  X S+     0   0    7  348   18  V  I  II    IV I     I                I V              
    18   19 B R  H  X S+     0   0  135  348   59  E  D  NL    LE K     K                I L              
    19   20 B D  H  X S+     0   0   85  349   72  d  K  Rs    sn k     a                S h              
    20   21 B A  H  X S+     0   0   36  249   44  l  .  .k    ks g     l                V q              
    21   22 B R  H >X S+     0   0   22  349   28  R  V  IR    RR K     R                K R              
    22   23 B K  H 3< S+     0   0  136  350   43  I  K  KR    RI C     L                K T              
    23   24 B A  H 3< S+     0   0   79  350   64  R  a  gT    TQ q     k                R Q              
    24   25 B C  H << S+     0   0   19  306   94  .  i  i.    .. v     t                T .              
    25   26 B A     <  +     0   0   46  309   60  .  Q  QQ    Q. R     Q                Q .              
    26   27 B D        +     0   0   88  312    3  D  D  DD    DD D     N                D D              
    27   28 B A        -     0   0   17  315   51  T  T  TA    AA G     I                T T              
    28   29 B T    >>  -     0   0   59  315   41  T  T  QT    TT D     T                N K              
    29   30 B L  H 3> S+     0   0    0  317    9  L  L  LI    IL L     M                L I              
    30   31 B S  H 34 S+     0   0   38  323   90  V  L  MQ    QF M     Q                Q Q              
    31   32 B Q  H X4 S+     0   0  119  330   65  K  E  NA    AK S     S                R Y              
    32   33 B I  H 3< S+     0   0   28  332   58  A  S  LI    IV V     A                A V              
    33   34 B T  T >< S+     0   0    0  343   62  A  S  SS    SA C     A                S S              
    34   35 B N  T <  S+     0   0  129  351   77  S  K  HQ    QS K     R                V Q              
    35   36 B N  T 3  S+     0   0  111  351   67  S  Q  GN    ND Q     V                N N              
    36   37 B I  S <  S-     0   0   21  338   72  I  I  VV    VV V     I                V V              
    37   38 B D        -     0   0  138  345   57  R  A  NN    SE S     A                A T              
    38   39 B P        -     0   0   89  348   62  P  P  SQ    QM R     P                T T              
    39   40 B V        -     0   0   23  350   41  L  L  LI    IL L     I                I I              
    40   41 B G        -     0   0   54  353   52  N  S  HP    PS Q     P                P P              
    41   42 B R        -     0   0  115  354   44  A  K  EK    KS P     R                R R              
    42   43 B I        +     0   0    8  354   63  g  n  Ln    nd s     n                n n              
    43   44 B Q        -     0   0   54  340   61  i  v  Nc    cl v     c                c c              
    44   45 B M        -     0   0   11  345   12  l  l  Ll    ll l     l                l l              
    45   46 B R        -     0   0   49  346   51  K  K  QT    TK R     K                R K              
    46   47 B T  E     +A  338   0A  12  350   67  L  L  PL    LL V     L                L L              
    47   48 B R  E     +     0   0A  56  355   56  Y  L  VY    YY Y     Y                Y Y              
    48   49 B R  E     -A  337   0A  60  355   15  H  Q  RN    NN N     N                N N              
    49   50 B T  E     -A  336   0A  30  355   27  T  K  TT    TT T     T                T T              
    50   51 B L  E     -A  335   0A   0  355    2  L  L  LL    LL L     L                L L              
    51   52 B R        +     0   0  159  355   41  R  Q  KR    RR S     K                C K              
    52   53 B G        +     0   0   20  355    0  G  G  GG    GG T     G                G G              
    53   54 B H        -     0   0    4  355    0  H  H  HH    HH H     H                H H              
    54   55 B L  S    S+     0   0  116  355   50  Q  N  NQ    QQ R     Q                Q Q              
    55   56 B A  S    S-     0   0    0  355   30  N  N  NN    NN D     N                N N              
    56   57 B K        -     0   0   15  355    0  K  K  KK    KK K     K                K K              
    57   58 B I  E     -D   73   0B   0  355    9  V  I  II    II I     V                V V              
    58   59 B Y  E     -     0   0B   6  355   20  A  A  SA    AA A     A                A A              
    59   60 B A  E     -D   72   0B  13  355   32  Q  D  DK    KQ S     K                K K              
    60   61 B M  E     -D   71   0B  15  355   10  V  I  VL    LI I     L                L V              
    61   62 B H  E     -D   70   0B  44  355   33  R  K  KC    CR Q     V                S C              
    62   63 B W  E     -D   69   0B  11  355    0  W  W  WW    WW W     W                W W              
    63   64 B G    >   -     0   0    3  355   54  S  A  SS    SN S     S                N S              
    64   65 B T  T 3  S+     0   0   75  355   66  S  H  QS    SS D     A                S K              
    65   66 B D  T 3  S-     0   0   80  355   12  N  D  DD    DN D     D                D D              
    66   67 B S  S <  S+     0   0    3  355   57  S  S  SS    SS S     S                S S              
    67   68 B R  S    S+     0   0   94  355   47  S  K  AS    SR K     S                T T              
    68   69 B L  E     + E   0  82B  31  355   87  Q  S  SK    KH S     K                K K              
    69   70 B L  E     -DE  62  81B   0  355   23  V  I  VI    II L     I                I V              
    70   71 B L  E     -DE  61  80B   0  355    7  L  L  LL    LL V     L                L L              
    71   72 B S  E     -DE  60  79B   0  354    2  S  S  SS    SS S     S                S S              
    72   73 B A  E     -DE  59  78B   0  354    5  A  A  SA    AA A     A                A A              
    73   74 B S  E >>  -DE  57  77B   0  354    2  S  S  SS    SS C     S                S S              
    74   75 B Q  T 34 S+     0   0    1  355    1  Q  Q  QQ    QQ Q     Q                Q Q              
    75   76 B D  T 34 S-     0   0    9  355    0  D  D  DD    DD D     D                D D              
    76   77 B G  T <4 S+     0   0    7  355    1  G  G  GG    GG G     G                G G              
    77   78 B K  E  <  -EF  73  93B  52  355   34  Y  F  FF    FY Y     Y                Y F              
    78   79 B L  E     -EF  72  92B   0  355    4  L  L  IM    MM M     M                M M              
    79   80 B I  E     -EF  71  91B   0  355    7  I  L  II    II F     F                I I              
    80   81 B I  E     -EF  70  90B   0  355   18  L  I  II    II V     I                L V              
    81   82 B W  E     -EF  69  88B   0  355    0  W  W  WW    WW W     W                W W              
    82   83 B D  E >>> -EF  68  87B  21  355   18  D  D  DD    DD D     D                D D              
    83   84 B S  T 345S+     0   0    0  355   52  I  P  PA    AT A     P                T A              
    84   85 B Y  T 345S+     0   0   57  354   48  V  V  FV    VV V     I                I V              
    85   86 B T  T <45S-     0   0   56  354    8  T  T  TT    TS T     T                T T              
    86   87 B T  T  <5 +     0   0   43  354   36  G  G  GG    GG G     G                G G              
    87   88 B N  E   < -F   82   0B  99  354   38  F  L  LF    FF Y     F                Y M              
    88   89 B K  E     +F   81   0B  95  354    0  K  K  KK    KK K     K                K K              
    89   90 B V  E    S+     0   0B  66  353   49  K  L  KK    KK T     K                K K              
    90   91 B H  E     -F   80   0B  57  353   18  K  N  SH    HH Q     H                Q H              
    91   92 B A  E     -F   79   0B  43  353    8  A  A  AA    AA A     V                A A              
    92   93 B I  E     -F   78   0B   0  353    3  I  V  II    II I     I                I I              
    93   94 B P  E     -F   77   0B  80  353   37  F  P  PQ    QS A     Q                Q Q              
    94   95 B L        -     0   0   26  354    2  L  L  LL    LL L     L                L L              
    95   96 B R  S    S+     0   0  190  354   40  E  D  LN    SE E     E                D E              
    96   97 B S        -     0   0   17  354   24  N  S  SN    NN N     N                N N              
    97   98 B S  S    S+     0   0    6  354   36  Q  Q  QP    PQ N     T                P P              
    98   99 B W        +     0   0    2  354    3  W  W  WW    WW W     W                W W              
    99  100 B V  E     -G  115   0C   4  354    1  V  V  VV    VV V     V                V V              
   100  101 B M  E     +     0   0C   5  353    4  L  L  LL    LL L     L                L L              
   101  102 B T  E     -G  114   0C   8  353   13  T  S  ST    TA T     T                T T              
   102  103 B C  E     -G  113   0C   0  353    9  C  C  SC    CC C     C                S C              
   103  104 B A  E     -G  112   0C   0  353    8  A  A  AS    SA A     S                S S              
   104  105 B Y  E     -G  111   0C   9  353   10  I  Y  IY    YI Y     Y                I Y              
   105  106 B A    >   -     0   0    0  353   33  A  S  SS    SA A     S                S S              
   106  107 B P  T 3  S+     0   0   64  353    8  P  P  PP    PP P     A                P A              
   107  108 B S  T 3  S-     0   0   47  353   31  N  N  SN    NN S     D                N N              
   108  109 B G  S <  S+     0   0    8  353   14  C  G  GE    EG G     E                E E              
   109  110 B N  S    S+     0   0   50  353   43  E  Q  NK    KE R     K                K K              
   110  111 B Y  E     - H   0 124C  50  353   55  N  L  LL    LS F     L                L L              
   111  112 B V  E     -GH 104 123C   0  353    5  V  V  VV    VV V     A                V L              
   112  113 B A  E     +GH 103 122C   0  353    4  V  A  AA    AA A     A                A A              
   113  114 B C  E     +GH 102 121C   5  353   10  S  S  SS    SS S     S                S S              
   114  115 B G  E     +GH 101 120C   1  353    6  G  A  AA    AG A     G                A G              
   115  116 B G  E >  S-G   99   0C   0  353    0  G  G  GG    GG G     G                G G              
   116  117 B L  T 3  S+     0   0    1  353    1  L  L  LL    LL L     L                L L              
   117  118 B D  T 3  S-     0   0   50  353    3  D  T  DD    DD D     D                D D              
   118  119 B N  S <  S+     0   0   30  353   21  N  N  NN    NN N     N                N N              
   119  120 B I  E     - I   0 139C  39  353   43  T  N  HN    NT A     V                N N              
   120  121 B C  E     -HI 114 138C   0  353    7  L  C  CC    CL C     C                C C              
   121  122 B S  E     -HI 113 137C   9  353   14  T  T  ST    TT T     T                T T              
   122  123 B I  E     -HI 112 136C   0  353    6  V  I  VI    IV V     I                I I              
   123  124 B Y  E     -H  111   0C   3  353    4  Y  Y  YY    YY Y     Y                Y Y              
   124  125 B N  E     +H  110   0C  24  353   45  N  R  RK    KN A     K                K K              
   125  126 B L        +     0   0   11  353   12  V  I  VI    II V     I                I V              
   126  127 B K  S    S+     0   0  109  353   60  S  G  SK    KK G     K                K K              
   127  128 B T  S    S-     0   0   64  353   71  S  s  rP    Pp n     P                s A              
   128  129 B R  S    S+     0   0  267  336   26  K  r  r.    .h s     .                v .              
   129  130 B E  S    S-     0   0  173  340   28  Q  D  ID    DD D     D                Q D              
   130  131 B G        -     0   0   50  351   25  P  d  qt    tq S     t                Q t              
   131  132 B N        +     0   0   30  349   59  G  f  nn    nt E     n                Q n              
   132  133 B V  S    S+     0   0   58  329   58  .  q  .F    Fi .     .                F Y              
   133  134 B R  S    S-     0   0  213  347   44  .  R  .P    PR .     P                R P              
   134  135 B V        -     0   0   29  352   27  .  I  VV    VS L     I                S V              
   135  136 B S  S    S-     0   0   43  352   59  .  V  IT    TL G     S                N A              
   136  137 B R  E     -I  122   0C 105  344   18  .  S  S.    .. H     .                . E              
   137  138 B E  E     -I  121   0C  75  346   40  .  I  I.    .. A     .                A E              
   138  139 B L  E     +I  120   0C   1  349    5  L  L  F.    .F M     .                F M              
   139  140 B A  E     +I  119   0C  61  351   61  S  K  KE    EK Y     .                P N              
   140  141 B G        +     0   0   50  351   27  E  G  GE    EG G     .                M G              
   141  142 B H        -     0   0    9  352    8  Y  H  HR    RH I     Y                Q R              
   142  143 B T  S    S+     0   0   64  352   62  E  T  TN    NK T     R                T Y              
   143  144 B G  S    S-     0   0    0  352    8  q  C  Cg    gA s     g                g p              
   144  145 B Y        -     0   0    0  352    1  y  G  Yy    yY y     y                y y              
   145  146 B L  E     +J  160   0D   0  352   18  I  I  II    II I     I                I I              
   146  147 B S  E     -     0   0D   3  352    1  S  T  SS    SS S     S                S S              
   147  148 B C  E     -J  159   0D   9  353   29  D  A  AE    ED G     E                E E              
   148  149 B C  E     -J  158   0D   0  353    6  C  C  TC    CC C     C                C C              
   149  150 B R  E     -J  157   0D  53  353   33  D  D  EE    ED Q     E                E E              
   150  151 B F  E     -J  156   0D  10  353    2  F  F  FF    FY F     F                F F              
   151  152 B L  S    S-     0   0   26  353   35  T  V  LI    II L     I                I I              
   152  153 B D  S    S-     0   0   60  353   56  S  D  DG    GS A     D                G G              
   153  154 B D  S    S+     0   0   60  353   13  N  N  EN    SN D     N                N N              
   154  155 B N  S    S+     0   0   44  353   76  H  E  RN    NE S     S                N D              
   155  156 B Q  E     + K   0 169D  60  353   66  H  E  TS    SK K     S                S S              
   156  157 B I  E     -JK 150 168D   0  354   13  L  I  II    IL I     I                I I              
   157  158 B V  E     -JK 149 167D   0  354   27  V  L  LV    VI V     V                V V              
   158  159 B T  E     -JK 148 166D   0  353    0  T  T  TT    TT T     T                T T              
   159  160 B S  E     -JK 147 165D   0  352   19  S  A  AA    AA S     A                G G              
   160  161 B S  E >   -J  145   0D   0  352    0  S  S  SS    SS S     S                S S              
   161  162 B G  T 3  S+     0   0    0  352    0  G  G  GG    GG G     G                G G              
   162  163 B D  T 3  S-     0   0    5  352    0  D  D  DD    DD D     D                D D              
   163  164 B T  S <  S+     0   0    8  353   76  M  M  MM    MM M     M                M M              
   164  165 B T        -     0   0    2  353   17  T  T  TT    TT T     T                T T              
   165  166 B C  E     -KL 159 179D   0  352    1  C  C  CC    CC C     C                C C              
   166  167 B A  E     -KL 158 178D   0  353   70  A  A  AA    AI A     I                M A              
   167  168 B L  E     -KL 157 177D   6  353   29  M  S  ML    LM T     L                L L              
   168  169 B W  E     -KL 156 175D   2  353    0  W  W  WW    WW W     W                W W              
   169  170 B D  E >>> -KL 155 174D  37  353    1  D  D  DD    DD D     D                D D              
   170  171 B I  T 345S+     0   0    7  353   13  M  L  IL    LI V     V                I L              
   171  172 B E  T 345S+     0   0  144  353   32  A  N  PT    TN E     T                T T              
   172  173 B T  T <45S-     0   0   78  353   40  K  K  KK    KK R     K                K K              
   173  174 B G  T  <5 +     0   0   16  353   12  G  G  SG    GG G     G                G G              
   174  175 B Q  E   < -L  169   0D 135  353   74  S  N  KT    TG Q     R                S S              
   175  176 B Q  E     -L  168   0D  30  353   58  K  K  RK    KK R     K                K K              
   176  177 B T  E     +     0   0D  64  353   70  V  K  VS    SV T     V                S S              
   177  178 B T  E     -L  167   0D  20  353   63  R  D  TR    RR C     R                R R              
   178  179 B T  E     -L  166   0D   5  354   78  D  E  ED    DD E     D                D D              
   179  180 B F  E     +L  165   0D   1  354    0  F  Y  FF    FF Y     F                F F              
   180  181 B T        +     0   0   34  354   73  V  L  IV    VV V     I                I I              
   181  182 B G        +     0   0   37  354   33  E  D  DE    ED D     D                D E              
   182  183 B H        -     0   0    7  354    0  H  H  HH    HH H     H                H H              
   183  184 B T  S    S+     0   0   99  354   69  L  L  LS    SI L     V                V S              
   184  185 B G  S    S-     0   0    0  354   17  G  G  GG    GG G     S                G G              
   185  186 B D        -     0   0    1  354    0  D  D  DD    DD D     D                D D              
   186  187 B V  E     -M  202   0E   0  354   18  V  V  VV    VV V     I                V V              
   187  188 B M  E     +     0   0E   3  354   11  L  L  LL    LL L     L                L L              
   188  189 B S  E     -M  201   0E  16  354   17  C  C  TC    CV C     S                C C              
   189  190 B L  E     -M  200   0E   3  354   28  L  M  ML    LL V     L                L L              
   190  191 B S  E     -M  199   0E  21  354   23  s  D  Ds    sa a     a                t t              
   191  192 B L  E     -M  198   0E  29  354   32  i  I  Lp    pt f     p                p p              
   192  193 B A    >   -     0   0    4  354   63  S  D  PQ    QQ R     Q                A Q              
   193  194 B P  T 3  S+     0   0   85  354   30  S  R  PN    NG S     S                N N              
   194  195 B D  T 3  S-     0   0   87  354   71  Q  S  AI    IN S     I                I I              
   195  196 B T  S <  S+     0   0   62  354   89  S  K  NL    LH F     F                L L              
   196  197 B R  S    S+     0   0  142  355   76  d  g  Ts    se e     n                s s              
   197  198 B L  E     - N   0 211E  37  351   70  l  n  .l    li q     v                l l              
   198  199 B F  E     -MN 191 210E   0  351    0  F  F  .F    FF F     F                F F              
   199  200 B V  E     -MN 190 209E   0  352   12  V  V  .V    VV V     I                I I              
   200  201 B S  E     -MN 189 208E   0  353    3  S  S  .S    SS T     S                S S              
   201  202 B G  E     +MN 188 207E   0  355    3  G  G  gG    GG G     G                G G              
   202  203 B A  E >   -M  186   0E   0  354   31  S  A  gS    SS S     S                S S              
   203  204 B C  T 3  S+     0   0    5  354    7  A  S  SS    SS C     A                S S              
   204  205 B D  T 3  S-     0   0   31  354    0  D  D  DD    DD D     D                D D              
   205  206 B A  S <  S+     0   0   20  354   39  G  G  GG    GG G     G                G G              
   206  207 B S  E     - O   0 222E   6  354   82  Y  Y  YS    SY T     Y                Y Y              
   207  208 B A  E     -NO 201 221E   0  354   28  A  A  AA    AA V     A                A A              
   208  209 B K  E     -NO 200 220E  18  354   20  K  R  YK    KK R     K                K K              
   209  210 B L  E     -NO 199 219E   2  354   11  V  I  LI    II V     I                V I              
   210  211 B W  E     -NO 198 217E   1  354    0  W  W  WW    WW W     W                W W              
   211  212 B D  E >>> -NO 197 216E  11  354    0  D  D  DD    DD D     D                D D              
   212  213 B V  T 345S+     0   0   12  354   39  P  R  VL    LL P     L                L L              
   213  214 B R  T 345S+     0   0  194  354    0  R  R  RR    RR R     R                R R              
   214  215 B E  T <45S-     0   0  111  353   69  C  G  QS    SC .     S                S S              
   215  216 B G  T  <5 +     0   0    8  354   39  Q  A  PP    PQ V     P                P P              
   216  217 B M  E      -     0   0    1  353    5  F  F  FF    FF F     F                F F              
   235  236 B P  T 3  S+     0   0   45  353    4  P  K  NP    PP P     P                P P              
   236  237 B N  T 3  S-     0   0   42  353   42  E  D  ND    DD D     G                D D              
   237  238 B G  S <  S+     0   0   12  353    5  N  G  GG    GN G     G                G G              
   238  239 B N  S    S+     0   0   56  353   67  H  N  EN    NH N     G                N N              
   239  240 B A  E     - Q   0 253F   0  353   48  S  S  SA    AS A     A                A A              
   240  241 B F  E     -PQ 233 252F   0  353   14  F  I  FF    FF V     F                F F              
   241  242 B A  E     -PQ 232 251F   0  353   59  V  V  MA    AM V     I                A A              
   242  243 B T  E     -PQ 231 250F   0  353    6  T  T  AT    TT S     T                V T              
   243  244 B G  E     +PQ 230 249F   0  353    0  G  G  GG    GG G     G                G G              
   244  245 B S  E >   -P  228   0F   0  353    0  S  S  SS    SS S     S                S S              
   245  246 B D  T 3  S+     0   0   13  353    2  D  D  DD    DD D     D                D D              
   246  247 B D  T 3  S-     0   0   28  353    0  D  D  DD    DD D     D                D D              
   247  248 B A  S <  S+     0   0    6  353   38  G  G  GG    GG G     G                G G              
   248  249 B T        -     0   0   16  353   41  I  I  SS    SI V     L                Q V              
   249  250 B C  E     -QR 243 263F   0  353   12  I  I  AI    II V     V                I I              
   250  251 B R  E     -QR 242 262F  23  353    7  R  R  RR    RR R     R                R R              
   251  252 B L  E     -QR 241 261F   0  353    1  L  L  LL    LL L     L                L L              
   252  253 B F  E     -QR 240 259F   1  352    1  F  F  FF    FF F     F                I F              
   253  254 B D  E  >> -QR 239 258F   1  352    0  D  D  DD    DD D     D                D D              
   254  255 B L  T >45S+     0   0   15  352   28  M  L  LL    LM R     M                L L              
   255  256 B R  T 345S+     0   0   57  352    1  R  R  RR    RR R     R                R R              
   256  257 B A  T 345S-     0   0    0  352   29  S  A  SS    SS A     S                S S              
   257  258 B D  T <<5 +     0   0    0  352   23  D  D  DD    DD D     D                D D              
   258  259 B Q  E      -     0   0  119  354   72  a  s  ev    vy n     n                s n              
   266  267 B D  T 3  S+     0   0  161  354   42  E  N  SN    ND D     S                S T              
   267  268 B N  T 3  S+     0   0   66  354   66  S  S  CS    ST T     A                R N              
   268  269 B I    <   +     0   0   23  354   48  i  l  il    lP l     i                n s              
   269  270 B I        +     0   0   97  354   54  i  s  dn    n. s     n                s n              
   270  271 B C  S    S-     0   0   10  354   48  P  S  QQ    Q. P     Q                S Q              
   271  272 B G        -     0   0    1  355   28  G  G  GG    GG G     G                G G              
   272  273 B I  E     +S  288   0G   0  355   15  I  V  VV    VV V     I                V I              
   273  274 B T  E     +     0   0G  13  355   15  V  T  IF    FV T     Y                L F              
   274  275 B S  E     +S  287   0G  18  355    1  S  S  SS    SS S     S                S S              
   275  276 B V  E     +S  286   0G  10  355   16  L  L  IL    LL V     L                L L              
   276  277 B S  E     -S  285   0G  15  354   25  D  D  DD    DD A     D                D D              
   277  278 B F  E     -S  284   0G  12  354   30  L  F  FF    FF F     F                F F              
   278  279 B S        -     0   0    3  354    4  S  S  SG    GS S     G                G G              
   279  280 B K  S    S+     0   0  104  354   81  K  S  SK    KR R     K                K K              
   280  281 B S  S    S-     0   0    2  354    3  S  S  SS    SS S     S                S S              
   281  282 B G  S    S+     0   0    0  354    1  G  G  GG    GG G     G                G G              
   282  283 B R        +     0   0    8  354    0  R  R  RR    RR R     R                R R              
   283  284 B L  E     - T   0 297G   0  354   11  L  L  LF    FL V     F                L F              
   284  285 B L  E     -ST 277 296G   0  354    5  I  M  ML    LL L     I                L L              
   285  286 B L  E     -ST 276 295G   0  354   15  Y  Y  YY    YY Y     Y                Y Y              
   286  287 B A  E     -ST 275 294G   0  355   18  G  S  AS    SS S     A                S S              
   287  288 B G  E     -ST 274 293G   2  355   11  C  C  CC    CC C     C                C C              
   288  289 B Y  E >   -S  272   0G   4  355    1  Y  Y  YY    YY Y     Y                Y Y              
   289  290 B D  T 3  S+     0   0    3  355   34  A  T  AS    SS A     S                S S              
   290  291 B D  T 3  S-     0   0   37  355   17  D  D  DE    ED E     E                D E              
   291  292 B F  S <  S+     0   0    3  355   44  Y  H  YY    YY Y     Q                H Y              
   292  293 B N        -     0   0   15  355   49  G  G  GG    GG G     G                G G              
   293  294 B C  E     -TU 287 307G   0  355   10  C  C  CC    CC G     C                C C              
   294  295 B N  E     -TU 286 306G   5  355   74  I  M  AV    VI V     I                V V              
   295  296 B V  E     -TU 285 305G   0  355   16  I  I  VV    VI V     V                V V              
   296  297 B W  E     -TU 284 303G   6  355    0  W  W  WW    WW W     W                W W              
   297  298 B D  E  >  -T  283   0G   4  355    0  D  D  DD    DD D     D                D D              
   298  299 B A  T  4 S+     0   0    0  355   65  T  L  IT    TT T     T                T I              
   299  300 B L  T  4 S+     0   0    0  355   27  L  L  IL    LL L     L                L L              
   300  301 B K  T  4 S-     0   0   29  355   53  k  K  KK    KK G     k                K K              
   301  302 B A  S  < S+     0   0   17  355   52  v  A  GS    SG G     e                N G              
   302  303 B D  S    S-     0   0   95  355   52  v  E  EE    En Q     i                E E              
   303  304 B R  E     -U  296   0G  69  354   61  k  I  MI    Iv V     s                I T              
   304  305 B A  E     -     0   0G  14  355   63  L  V  IV    VG I     V                I V              
   305  306 B G  E     -U  295   0G   4  355   27  G  G  GG    GA G     G                G G              
   306  307 B V  E >   -U  294   0G   7  355   69  F  K  Ki    il v     N                t t              
   307  308 B L  E >  S+U  293   0G   2  350   36  .  L  Vg    gm t     .                g g              
   308  309 B A  G >  S-     0   0    4  351   70  A  E  DS    SA G     .                S S              
   309  310 B G  G <   -     0   0    4  353   21  G  G  GE    EG G     D                E E              
   310  311 B H  G <  S+     0   0    8  353    0  H  H  HH    HH H     H                H H              
   311  312 B D    <   -     0   0   26  353   32  S  S  RL    LL S     N                L G              
   312  313 B N  S    S+     0   0   31  353   16  N  N  NN    NN D     N                N N              
   313  314 B R        +     0   0   40  353    5  K  R  RK    KK R     K                K K              
   314  315 B V        +     0   0    2  353   10  V  T  II    IV I     I                I I              
   315  316 B S  S    S-     0   0    2  353   10  N  S  NN    NN T     N                N S              
   316  317 B C  E     -B  329   0A  10  353   17  Q  H  AQ    QQ G     Q                R R              
   317  318 B L  E     -B  328   0A  15  353   13  V  V  VV    VV V     V                V V              
   318  319 B G  E     -B  327   0A  10  353   13  R  T  KS    SS A     S                A A              
   319  320 B V  E     -B  326   0A  25  353   19  V  A  TV    VS A     V                V V              
   320  321 B T    >   -     0   0    3  353   52  S  S  SS    SS S     S                S S              
   321  322 B D  T 3  S+     0   0   98  353   70  P  P  PP    PP R     P                P S              
   322  323 B D  T 3  S-     0   0   51  352    9  D  N  DD    DD D     D                D D              
   323  324 B G  S <  S+     0   0    0  352    4  G  G  GG    GG G     G                G G              
   324  325 B M  S    S+     0   0   36  350   62  I  L  MV    VL V     V                V I              
   325  326 B A        -     0   0    0  350   30  A  A  AA    AI A     A                A G              
   326  327 B V  E     -BC 319 338A   0  350   33  L  V  VL    LI L     L                L L              
   327  328 B A  E     -BC 318 337A   0  349   47  C  A  VA    AC A     A                V A              
   328  329 B T  E     -BC 317 336A   7  349    4  T  T  ST    TT T     T                T T              
   329  330 B G  E     -BC 316 335A   1  349    4  A  A  SG    GA S     G                G C              
   330  331 B S    >   -     0   0    6  349    0  S  S  SS    SS S     S                S S              
   331  332 B W  T 3  S+     0   0    6  349    0  W  W  WW    WW W     W                W W              
   332  333 B D  T 3  S-     0   0   17  349    0  D  D  DD    DD D     D                D D              
   333  334 B S  S <  S+     0   0   12  349   35  Q  T  MA    AQ H     T                S S              
   334  335 B F        -     0   0   78  349   71  T  T  TT    TT T     T                T T              
   335  336 B L  E     -AC  50 329A   1  349    8  I  M  LI    II V     I                I I              
   336  337 B K  E     -AC  49 328A  60  346   23  K  R  KK    KK K     K                K K              
   337  338 B I  E     -AC  48 327A   0  344   13  V  V  VV    VV I     V                V I              
   338  339 B W  E      AC  46 326A   2  341    0  W  Y  WW    WW W     W                W W              
   339  340 B N              0   0   10  297   57  A  T  TS    SS S     S                S S              
   340      ! !              0   0    0   0     0  
   341    2 G P              0   0  101   80    0                                                         
   342    3 G V        +     0   0   96   82   63                                                         
   343    4 G I        -     0   0   38   84   34                                      M  M               
   344    5 G N    >   -     0   0  109   84   59                                      A  A               
   345    6 G I  G >  S+     0   0   25   84   30                                      S  S               
   346    7 G E  G 3  S+     0   0  122  126   44           N                          N  N               
   347    8 G D  G <  S+     0   0  133  137   21   N       N                          N  N               
   348    9 G L    <   -     0   0   35  141   15   M       M                          T  T               
   349   10 G T     >  -     0   0   69  141   62   A       A                          A  T               
   350   11 G E  H  > S+     0   0  116  143   33   K       K                          S  S               
   351   12 G K  H >> S+     0   0   66  152   41   I       I                          I  I               
   352   13 G D  H 3> S+     0   0   39  152   35   A       A                          A  A               
   353   14 G K  H 3X S+     0   0   83  152   84   E       E                          Q  Q               
   354   15 G L  H < S+     0   0    7  233    6   E       E                          E  E               
   365   26 G V  H 3< S+     0   0   43  233   53   V       V                          A  A               
   366   27 G T  T 3< S+     0   0  116  233   82   N       N                          N  N               
   367   28 G L    <   -     0   0   49  233   61   I       L                          I  I               
   368   29 G E        -     0   0  191  233   49   E       D                          D  D               
   369   30 G R        -     0   0   32  233    1   R       R                          R  R               
   370   31 G M        -     0   0   53  233   85   M       M                          I  I               
   371   32 G L     >  -     0   0   75  232   81   K       K                          K  K               
   372   33 G V  H  > S+     0   0    4  232   15   V       V                          V  V               
   373   34 G S  H  > S+     0   0   14  232    1   S       S                          S  S               
   374   35 G K  H  > S+     0   0   93  232   38   Q       Q                          K  K               
   375   36 G C  H  X S+     0   0    0  233   62   A       A                          A  A               
   376   37 G C  H  X S+     0   0    0  233   63   A       A                          A  A               
   377   38 G E  H  X S+     0   0   75  233   68   A       A                          A  A               
   378   39 G E  H  X S+     0   0   60  233   26   E       E                          E  D               
   379   40 G F  H  X S+     0   0    3  233   36   L       L                          L  L               
   380   41 G R  H  X S+     0   0   53  233   79   L       L                          M  M               
   381   42 G D  H  X S+     0   0   67  233   65   A       A                          S  A               
   382   43 G Y  H  X S+     0   0   43  233    2   F       F                          Y  Y               
   383   44 G V  H >X S+     0   0    0  233   58   C       C                          C  C               
   384   45 G E  H 3X S+     0   0   71  233   47   E       E                          E  E               
   385   46 G E  H 3< S+     0   0  125  233   57   T       T                          A  A               
   386   47 G R  H XX S+     0   0   94  233   69   H       H                          H  H               
   387   48 G S  H >< S+     0   0   12  233   67   A       A                          A  A               
   388   49 G G  T 3< S+     0   0   38  233   80   K       K                          K  K               
   389   50 G E  T <4 S+     0   0  138  232   54   D       D                          E  E               
   390   51 G D    XX> -     0   0    1  232    0   D       D                          D  D               
   391   52 G P  H 3>5S+     0   0   17  233   25   P       P                          P  P               
   392   53 G L  H 345S+     0   0    6  233    3   L       L                          L  L               
   393   54 G V  H <45S+     0   0   24  233   29   V       V                          L  L               
   394   55 G K  H  <5S-     0   0  149  233   80   T       T                          S  T               
   395   56 G G     << -     0   0   38  233   34   P       P                          P  P               
   396   57 G I        -     0   0   21  224   20   V       V                          V  V               
   397   58 G P    >>  -     0   0   80  233   11   P       P                          P  P               
   398   59 G E  T 34 S+     0   0   75  233   58   A       A                          A  A               
   399   60 G D  T 34 S+     0   0  151  233   61   A       A                          S  S               
   400   61 G K  T <4 S+     0   0  163  233   62   E       E                          E  E               
   401   62 G N     <  -     0   0    1  233    0   N       N                          N  N               
   402   63 G P  S    S+     0   0   36  224    0   P       P                          P  P               
   403   64 G F  S    S-     0   0    3  224    0   F       F                          F  F               
   404   65 G K              0   0  108  222   29   R       R                          R  R               
   405   66 G E              0   0  201  217    3   D       D                          E  E               
   406      ! !              0   0    0   0     0  
   407   13 P F              0   0  122   62   10                Y F       YYFF Y             FFFFFFF     
   408   14 P E        +     0   0  153  142   39    N DD  D EE  P RESE  S NRRTDQ G         E KRRRRRRA   S
   409   15 P G  S    S+     0   0   38  144   37    G GG  G SG  G QGGGG G KQQSGG G         GGQQQQQQQG   G
   410   16 P Q  S    S-     0   0   94  148   90    S TS  T CC  Y QCSTT S FQQRTS S         STRQQQQQQC   S
   411   17 P A        +     0   0    1  149   53    A SS  S SS  S GSSSA A SQCQST S         SAGSSSSSGS   T
   412   18 P S        +     0   0   28  149   71    T SV  S VV  T SVTSG T TGSQSN I         TGSSSSSSST   T
   413   19 P H  S    S+     0   0   42  151   57    N NN  N NN  N TNNNN N NSTGNT N         NNTTTTTTTNH  N
   414   20 P T  S  > S-     0   0    2  152   17    T TT  T TT  T nTTTT T TtnsTG T         TTnnnnnnnTT  T
   415   21 P G  H  > S-     0   0   10  164    2    G GG  G GG  G gGGGG GGGgggG. GGGGG G   GGgggggggGGGGG
   416   22 P P  H  > S+     0   0   14  165    0    P PP  P PP  P PPPPP PPPPPPPP PPPPP P   PPPPPPPPPPPPPP
   417   23 P K  H  > S+     0   0    6  165    0    K KK  K KK  K KKKKK KKKKKKKK KKKKK K   KKKKKKKKKKKKKK
   418   24 P G  H  X S+     0   0    0  165    1    G GG  G GG  G GGGGG GGGGGGGG GGGGG G   GGGGGGGGGGGGGG
   419   25 P V  H  X S+     0   0    0  165    0    V VV  V VV  V VVVVV VVVVVVVV VVVVV V   VVVVVVVVVVVVVV
   420   26 P I  H  X S+     0   0    4  165   14    I II  I LL  L VLIII LIIVVVLV LLLLL L   IIVVVVVVVLIVLI
   421   27 P N  H  X S+     0   0   48  165   42    E RN  K KK  Q QKKKQ EENQQKNE EEEEE A   EQKKKKKKKKEASK
   422   28 P D  H  X S+     0   0   14  166    0    D DD  D DD  D DDDDD DDDDDDDDDDDDDD D   DDDDDDDDDDDDDD
   423   29 P W  H  X S+     0   0    6  166    0    W WW  W WW  W WWWWW WWWWWWWWWWWWWW W   WWWWWWWWWWWYYW
   424   30 P R  H  < S+     0   0   67  166   26    R QR  Q QQ  R QQQQQ RRRQQQEQQRRRRR R   RQQQQQQQQQRKKQ
   425   31 P K  H >X S+     0   0   67  166   36    R RK  R RR  R RRRRR RNERRRQRRLSSSS R   KRRRRRRRRQTRQR
   426   32 P F  H >X>S+     0   0    1  166    1    F FY  Y YY  F FFFYF FYFFFFYFYYFFFF F   FFFFFFFFFYYFYF
   427   33 P K  H 3<5S+     0   0   30  166    7    k kk  k qr  k kkkkk kkkkkkkkkkhhhH k   kkkkkkkkkkkkkk
   428   34 P L  H <45S+     0   0  139  161    1    l il  l ll  l lllll llllll.llm.... l   lllllllllillll
   429   35 P E  H <<5S+     0   0   86  161    9    E EE  E QQ  E EEEEE EEEEEE.QEK.... E   EEEEEEEEEQEEEE
   430   36 P S  T  <5       0   0   57  162   66    a nn  a ns  t asina aftaan.aac...n t   saaaaaaaasysrt
   431   37 P E      <       0   0  118  167   66    e tk  t qe  q eeeee ekdeeeketakkkk e   eeeeeeeeelkhtq
   432      ! !              0   0    0    0    0  
   433   68 P F              0   0  211  143   42    . .l  . ..  . fl... ll..ffi..liiii .   ...lllll....tl
   434   69 P S        +     0   0   52  144   64    . .T  . ..  . AD... Dq..AAN.DcAAAA .   ...DDDDD....hA
   435   70 P R        -     0   0  103  120   85    . .G  . ..  . ..... .s.......q.... .   ............f.
   436   71 P K        +     0   0   22  123   12    . .K  . ..  . ..... .L.......Q.... .   ............D.
   437   72 P M  S    S-     0   0   12  124   13    . .L  . ..  . ..... .T.......P.... .   ............I.
   438   73 P S     >  -     0   0   52  131   65    . .N  . ..  Q ..... .C....D..VEEEE .   ............V.
   439   74 P V  H  > S+     0   0  107  130   53    . .L  . ..  F ..... .D....M..EAAAA .   ............S.
   440   75 P Q  H  > S+     0   0  133  130   52    . .R  . ..  M ..... .P....A..DKKKK .   ............S.
   441   76 P E  H  > S+     0   0   38  134   26    . .V  . ..  E ..L.. .N....L..ERRRR L   ............E.
   442   77 P Y  H  X S+     0   0   36  146   56    I .D  . ..  Q ..D.L .AKL..TI.EGGGG D   .LL.....L..SF.
   443   78 P E  H  < S+     0   0  111  154   61    E DE  D E.  I ..ADD .KLD..CD.KMMMM Q   DDD.....D..TE.
   444   79 P L  H >X S+     0   0   45  155   57    D PE  P V.  Q ..EPA .GLA..KNPVLLLL L   PAA.....D..LV.
   445   80 P I  H 3< S+     0   0   37  157   72    E EE  E AE  L ..MDE .YQE..SEDFSSSS Q   EEE.....E..NL.
   446   81 P H  T 3< S+     0   0  178  158   80    F FE  L IT  E .EALF .DEF..ELLAGGGG L   LFM.....L..AE.
   447   82 P K  T <4 S+     0   0  140  157   65    N AE  A AP  M .LEAE .SLA..AAEENNNN E   AQD.....S..SS.
   448   83 P D     <  -     0   0   58  169   39    E ED  N QQ  G EQLEE EDEEEEEENLEEEE S   EEEEEEEEEE.DLE
   449   84 P K        -     0   0  205  149   80    L LD  L EE  E LEMLL LDSLLLELLEEEEE M   LLLLLLLLLQ.DDL
   450   85 P E        -     0   0   45  150   68    I MD  L EE  F MENLM IEFMMMLMLNGGGG L   LMMMMMMMMF.SDM
   451   86 P D    >>  -     0   0   87  169   31    D AD  N DD  E SDDNE DDESSSDSTDVVVV E   DDSSSSSSSL.DDS
   452   87 P E  H 3> S+     0   0  113  168   12    E DE  D DD  D EDDDE EKDEEEDEDNDDDD D   DEEEEEEEED.DDD
   453   88 P N  H 3> S+     0   0   73  169   59    E EA  E DD  E DDTDG GEEDDDQDDEEEEE E   DDDDDDDDDPEEED
   454   89 P C  H <> S+     0   0   32  170   72    F FF  F FF  F FFVFF FFFFFFFFFLEEEE F   FFFFFFFFFYFFFF
   455   90 P L  H  X S+     0   0    4  170    2    L LL  L LL  L LLLLL LMLLLLLLLLLLLL M   LLLLLLLLLVMLIL
   456   91 P R  H  X S+     0   0  131  170   63    Q LQ  L RR  K QQLLL MDKQHQAQLKQQQQ R   LLQQQQQQQLDTAL
   457   92 P K  H  X S+     0   0  112  170   59    Q AQ  E EE  E QEQNE KWEQQQEQEQRRRR R   HEQQQQQQQEWQMQ
   458   93 P Y  H  X S+     0   0    7  170    5    Y YY  Y YY  Y YYFYY YYYYYYYYYFIIII Y   YYYYYYYYYYYYYY
   459   94 P R  H  X S+     0   0   31  170   31    Q QR  Q MM  R QMQQQ QNRQQQRQQARRRR R   QQQQQQQQQSNRRQ
   460   95 P R  H  X S+     0   0  130  170   43    K KL  R RR  N KLQKR QKQKKKKKKQEEEE E   KRKKKKKKKVKQQK
   461   96 P Q  H  X S+     0   0   96  170   30    Q QQ  Q RK  K QKQQK QKKQQQKQQKEEEE E   QKQQQQQQQKKNNK
   462   97 P C  H  X S+     0   0   22  170   72    R RR  R RR  R RRRRR RRRRRRRRRRRRRR R   RRRRRRRRRKRRRR
   463   98 P M  H  X S+     0   0   33  170   11    L MM  M MM  I MMMMM MIIMMMMMMMLLLL M   IMMMMMMMMMIIMM
   464   99 P Q  H  X S+     0   0  115  170   54    Q RE  K EE  E AERQA QVEAAAKAKKQQQQ N   EAAAAAAAAQMNRA
   465  100 P D  H  X S+     0   0   46  170   21    E EQ  E EE  E EEEEE EEEEEEEEEEQQQQ Q   EEEEEEEEEEEEEE
   466  101 P M  H  X S+     0   0   23  170    2    L MM  M MM  M MMMMM LLMMMMMMMLLLLL M   MMMMMMMMMMLLLM
   467  102 P H  H  X S+     0   0   64  170   74    M IR  L MM  R LMLLL MQRLLLMLLGKKKK I   ILLLLLLLLLKRKL
   468  103 P Q  H  < S+     0   0  143  170   59    A AR  A AA  R RSELA ASIRRRARAQDDDD L   QARRRRRRRANKMA
   469  104 P K  H  < S+     0   0  140  170   55    Q KQ  K QE  A QQHQM QKAQQQKQKKRRRR N   QMQQQQQQQKKASL
   470  105 P L  H  < S+     0   0   35  170   43    L AL  T II  V TICTM LFLTTTTCTYVVVV I   TMTTTTTTTSFNLA
   471  106 P S     <  -     0   0   75  170   79    E EC  E NN  Q GNGNE QAQGGGQGEGAAAA Q   NDGGGGGGGTAEEG
   472  107 P F        -     0   0   71  168   99    K KG  K AS  N HARHr KSNHHHEH.HSSSS K   LkHHHHHHHLSsrK
   473  108 P G        -     0   0   36  168   51    V LG  F RR  I HRqNg AkVHHNANKqKKKK n   SgNHHHHHNNk..L
   474  109 P P        +     0   0   92  160   41    P .R  . PP  P QPkI. PaPQQQPVLa.... p   K.QQQQQQQKvppP
   475  110 P R        +     0   0  177  165   61    K RR  C HK  Q QKRKR KGKQQQEQYS.... R   KCQQQQQQQQGTVT
   476  111 P Y        +     0   0   51  166    5    F FF  F FF  F FFFFY FIFFFFFFFY.... F   FFFFFFFFFFIFFF
   477  112 P G        +     0   0   12  170   61    G GE  G GG  G GGGGG GTGGGGGGGGGGGG G   GGGGGGGGGGANGG
   478  113 P F  S    S-     0   0  151  170  103    K SK  K QH  K KHTEE KFRKKKKKKHKKKK K   DEKQQQQQKEFKTT
   479  114 P V  E     -v  532   0H  28  170   13    V VV  V LL  V VLVVL LgVVVVVVVVVVVV L   LLVVVVVVVVgIVL
   480  115 P Y  E     -v  533   0H  71  165   68    V IM  I VS  . LIIII Qv.VLQFLIFTIII .   MIQQQQQQQYv..T
   481  116 P E  E     -v  534   0H 108  170   41    T ND  D QR  Y QCSVD TTVQQQDHDEEEEE L   FHQQQQQQQTTYCD
   482  117 P L        -     0   0   12  170   32    L LI  L LL  N LLLLL LTELLLLLLLMMMM R   LLLLLLLLLLNDTI
   483  118 P E        +     0   0  134  170   74    N ES  D EE  L AENKK KLLGSTLTENEEEE L   RKTTTTTTSSLLLQ
   484  119 P S  S >> S-     0   0   57  170   53    S ES  N DD  S TDNST NTSTTSTSSHTTTT N   NDTSSSSSTNTVTN
   485  120 P G  H 3> S+     0   0   15  169   40    R AG  T GG  K HGGSG QHSHHHGHARKKKK K   SGHHHHHHHGGASG
   486  121 P E  H 3> S+     0   0  127  170   23    V EE  D QQ  P EQDGD DTSEEEDKDEEEEE N   KGEEEEEEGQEDSD
   487  122 P Q  H <> S+     0   0   72  170   61    E QE  Q AA  E EAEED DNNEEEDEQDQQQQ N   DEEEEEEEEENTNE
   488  123 P F  H  X S+     0   0   26  170    1    F YF  F FF  F FFFLF FYFFFFFFFMFFFF F   FFFFFFFFFFYFFF
   489  124 P L  H  X S+     0   0   90  170    6    L LL  L LL  V LLLLL LVVLLLLLLLLLLL V   LLLLLLLLLLVIVL
   490  125 P E  H  X S+     0   0  103  170   41    D KR  Q DD  E SDNDQ SEDASEVDQNSSSS D   EQAAAAAASDEEQK
   491  126 P T  H  < S+     0   0   10  170   76    A AA  A AA  C CAAAA AEECCCACAAAAAA A   AACCCCCCCAEEES
   492  127 P I  H  < S+     0   0   17  170   12    I IV  I VV  I VVIII IIIVVIVVIVIIII I   IVVVVVVVVIIIIV
   493  128 P E  H  < S+     0   0  139  170   20    D DD  D DD  D EDDDD DEDEEEEEDDEEEE D   DDEEEEEEEDEDDD
   494  129 P K  S  < S+     0   0  172  170   35    K EE  G KR  R QKNKK KNKQEQNNEVKKKK S   KKQQQQQQQKSNSE
   495  130 P E  S    S-     0   0   38  166    5    E EE  E EE  E EEEEE EEEEEEEEED.... E   EEEEEEEEEEETTE
   496  131 P Q    >   -     0   0  116  170   66    D DG  D KK  K NKDHN DEKNNNNNDSCCCC R   DDNNNNNNNNKNDQ
   497  132 P K  T 3  S+     0   0  156  170   34    K KK  K SS  A KTKKK VKPKKKPKKARRRR K   KKKKKKKKKKKKPK
   498  133 P I  T 3  S+     0   0   68  170   87    K SS  S GG  S HGTSN KVQHHHYHSVNNNN E   TNHHHHHHHNFDST
   499  134 P T    <   -     0   0   10  170   35    V VT  V VV  V TVIVT VVVTTTVTVTAAAA V   VATTTTTTTVVTVV
   500  135 P T  E     -W  558   0H   7  169   62    T TL  I TT  T TTTTT TTTTTTTTTTLLLL T   TTTTTTTTTTTTTT
   501  136 P I  E     -Wx 557 531H   3  170   15    V IV  V VV  I IVIIV VIIIIIVIVILLLL V   VVVIIIIIIVIVVV
   502  137 P V  E     -Wx 556 532H   0  170   35    I IL  I II  V IVIVV VIIIIIIIIFLLLL I   IVIIIIIIIIIIVI
   503  138 P V  E     -Wx 555 533H   0  170   12    I IV  V VV  I IIVVV IIIIIIVIVVIIII I   IIIIIIIIIIIVVI
   504  139 P H  E     -Wx 554 534H   0  170    6    H HH  H HH  H HHHHH HHHHHHHHHHHHHH H   HHHHHHHHHHHFHH
   505  140 P I  E     +Wx 553 535H   2  170    1    I II  I II  V IIIII IILIIIVIIIIIII I   IIIIIIIIIIIIII
   506  141 P Y  E     - x   0 536H   4  170    2    Y YY  Y YY  Y YYYYY YYYYYYYYYYYYYY E   YYYYYYYYYYYYYY
   507  142 P E    >   -     0   0   45  170   26    N QE  E AA  E ESEER GEEEEEEEEEEEEE D   EREEEEEEEEDEED
   508  143 P D  T 3  S+     0   0   95  170   51    N KP  D QQ  D RENDE HDNRRRHRNDEEEE Q   EERRRRRRKEDNPR
   509  144 P G  T 3  S+     0   0   66  170   48    V DE  N GG  G TGKNK NNNSSNNGNEAAAA S   HKNQQQQQSKNGDY
   510  145 P I  S X> S-     0   0   36  170   33    T VV  V IM  V QILVY VIVQQLVLVAVVVV L   VYLLLLLLLVVNND
   511  146 P K  T 34 S+     0   0  191  170   71    I PP  S PP  K SQLEG KPETSSPSPQDDDD Q   HDSAAAAASSPKST
   512  147 P G  T 3> S+     0   0   13  170   22    A GA  G GG  A AGAAP AAAAAATAGGGGGG A   PPAAAAAAADASAA
   513  148 P C  H <> S+     0   0    0  170   35    C CC  C CC  C CCCCC CCCCCCCCCCCCCC C   CCCCCCCCCCCCCC
   514  149 P D  H  X S+     0   0   78  170   47    E TQ  E EE  N SQKRT EDEAASSSEAVVVV E   RITAAAAASKEARK
   515  150 P A  H  > S+     0   0   44  170   50    T AA  A AA  A TTTTK SAATTTITAATTTT S   LKTTTTTTTNAKKN
   516  151 P L  H  X S+     0   0    0  170   11    M MM  M MM  M LMMMM MMMLLLMLMMMMMM M   MMLLLLLLLMMVVM
   517  152 P N  H  X S+     0   0   19  170   16    D ND  N NN  N NNNNN DNNNNNNNNDNNNN N   NNNNNNNNNNNNNN
   518  153 P S  H  X S+     0   0   78  170   56    G GG  G GG  G NGRVD GGGKSKSKGESSSS G   QENKKKKKKHGTDK
   519  154 P S  H  X S+     0   0    6  170   35    C CS  C CC  C CCCCA CCCCCCCCCCVVVV C   CACCCCCCCCCCYS
   520  155 P L  H  X S+     0   0    1  170   10    L LL  L LL  L LLLLL LILLLLLLLFLLLL L   LLLLLLLLLLILLL
   521  156 P I  H  X S+     0   0  105  170   85    N IL  I QQ  Q DRDKK SQSDDDKEIQCCCC H   ISDDDDDDEDQEEE
   522  157 P C  H  X S+     0   0   63  170   38    I TC  S CC  C TCEQQ IVCTTSVASASSSS C   QKSSSSSSSVVKTE
   523  158 P L  H  X S+     0   0    0  170    4    L LL  L LL  L LLLLL LLLLLLLLLLVVVV L   LLLLLLLLLILILL
   524  159 P A  H  < S+     0   0    1  170    9    A AA  A AA  A AAACA ASAAAACAAAAAAA A   SAAAAAAAACAFCA
   525  160 P A  H  < S+     0   0   61  170   67    S QL  E GE  K SERKK SQQTNQRGEEAAAA Q   KKGSSTSSSKQQTQ
   526  161 P E  H  < S+     0   0   72  170   23    D EQ  E EE  E EENTE DKEEDDEQESKKKK E   IEDDDDDDDNKSEE
   527  162 P Y    ><  +     0   0    5  170    2    Y YY  Y YY  Y YCYYY YYYYYYFYYYYYYY Y   YYYYYYYYYYYYYY
   528  163 P P  T 3  S+     0   0   28  170   29    P PP  S PP  P PPLEL PRPPPPQAPPPPPP P   NTPPPPPPPPRPPK
   529  164 P M  T 3  S+     0   0   26  170   86    A FM  Y QQ  T SQNNN ANTSSSKMRQQQQQ F   TNSSSSSSSDTHHN
   530  165 P V  S <  S-     0   0    1  170    8    V VV  V VV  V IVVVV VVVIIITVVFVVVV V   VVIIIIIIIVVVVV
   531  166 P K  E     - x   0 501H  37  170    2    K KK  K KK  K KKKKK KKKKKKKKKKKKKK K   KKKKKKKKKKKKRK
   532  167 P F  E     +vx 479 502H   0  170    1    F FF  F FF  F FFFFF FFFFFFFFFFLLLL F   FFFFFFFFFFFFFF
   533  168 P C  E     -vx 480 503H   0  170   18    C CC  C CC  C ACCCC CCCAAACACCAAAA C   ACAAAAAAACCCCC
   534  169 P K  E     +vx 481 504H  51  170   37    R RR  R IA  R KIKSK RKKKKKKKRRRRRR A   AKKKKKKKKKKRRR
   535  170 P I  E     - x   0 505H   1  170   21    I IV  I VV  M IVIIF IVIIIILIILVVVV A   IFIIIIIIIVVIIF
   536  171 P K  E >>  - x   0 506H  52  170   72    S LR  L EE  R CEIVI AKRCCCICLRKKKK N   LICCCCCCCLKRQM
   537  172 P A  H >> S+     0   0   13  170   46    A AG  G AA  A SAGGC VAASSSGSGASSSS A   ASSSSSSSSGAAAS
   538  173 P S  H 34 S+     0   0   88  170   30    D SS  S SS  S SSSST DSSSSSSSSSSSSS A   PSSSSSSSSSSSSS
   539  174 P N  H <4 S+     0   0   67  170   86    I AA  V AA  D VAVRD VEDVVVSVIAVVVV D   LDVVVVVVVKEENV
   540  175 P T  H << S-     0   0   25  170   73    T VV  A AA  A AAAAA AATAAAAAAVLLLL I   AAAAAAAAAAAAAA
   541  176 P G     <  +     0   0   66  169   22    G GG  G GG  Q GGGGG GQSGGGGGGGKKKK Q   SGGGGGGGGGRHHG
   542  177 P A    >   -     0   0   39  170   55    L VT  L MM  L MMMML LVLMMMMMLMTTTT T   VLMMMMMMMVVLLL
   543  178 P G  T 3  S-     0   0   70  169   43    S SS  S SS  S SSSSS SSSSSSSSSSSSSS S   SSSSSSSSSSSSSS
   544  179 P D  T 3  S+     0   0  151  169   78    R KA  K RR  G RRKMN RRHRRRLRKRAAAA Q   RNRRRRRRRKSHYS
   545  180 P R  S <  S+     0   0  167  169   58    H HL  Q HH  N DHTRM HNKDDDNEQETTTT L   ELDDDDDDDSNRQF
   546  181 P F  S    S+     0   0   35  169    0    F FF  F FF  F FFFFF FFFFFFFFFFFFFF F   FFFFFFFFFFFFFF
   547  182 P S    >>  -     0   0   34  169   70    R KR  K EE  S REKKK SVSRRRKRKCSSSS T   RKRRRRRRRKVSSK
   548  183 P S  T 34 S+     0   0   86  169   84    V KS  E RR  S TRITA VETTTTMNKKSSSS E   ATTTTTTTTLERRS
   549  184 P D  T 34 S+     0   0  126  169   66    D ES  F KK  R KKSDS ENSKKKCKFANNNN K   GSKKKKKKKKNCSN
   550  185 P V  T <4 S+     0   0   20  169   65    G GA  G GG  G GGGGG GGGGGGGGGGAAAA G   GGGGGGGGGGGGGG
   551  186 P L     <  +     0   0    8  170   13    V VL  V VV  V LVIVV VLVLLLVLVLLLLL L   LVLLLLLLLVLVVV
   552  187 P P  S    S+     0   0    1  170    0    P PP  P PP  P PPPPP PPPPPPPPPPPPPP P   PPPPPPPPPPPPPP
   553  188 P T  E     -W  505   0H   1  170   42    A AA  T AA  A AAAAA AAAAAAAAATTTTT A   AAAAAAAAAAAAAA
   554  189 P L  E     -WY 504 566H   0  170    2    L LL  L LL  L LLLLL LLLLLLLLLLLLLL L   LLLLLLLLLLLIIL
   555  190 P L  E     -WY 503 565H   4  170    9    L LL  L LL  L LLLLL LLLLLLLLLQQQQQ L   LLLLLLLLLLLVVL
   556  191 P V  E     +WY 502 564H   0  170   19    V VL  V VV  V VVVII VAIVVVAVVAVVVV V   VIVVVVVVVVAVVV
   557  192 P Y  E     +WY 501 562H  31  170    0    Y YY  Y YY  Y YYYYY YYYYYYYYYYYYYY Y   YYYYYYYYYYYYYY
   558  193 P K  E >  S-WY 500 561H  25  170   12    K KR  K KK  K KKKKK KKKKKKRKKKYYYY K   KKKKKKKKKKKKKK
   559  194 P G  T 3  S-     0   0   25  170   41    E GG  N NN  N ANGGG GNGAAAAAKNNNNN A   SGAAAAAAASNNRG
   560  195 P G  T 3  S+     0   0   48  170   21    G GG  G GG  K QGGGG GNGQQQGQGKDDDD G   GGQQQQQQQGNGGG
   561  196 P E  E <   -Y  558   0H  38  170   36    Q QD  Q SN  E ANNQQ QEEAAAQAQDAAAA Q   NQAAAAAAATVEEQ
   562  197 P L  E     +Y  557   0H  34  170   12    I IL  V LL  M LLLLM IILLLVLVVLLLLL L   IMLVVVVVVLILVM
   563  198 P L  E     -     0   0H   2  170   20    I IV  I II  V IIIVI IIIIIIVIIVVVVV I   IIIIIIIIVVIIII
   564  199 P S  E     -Y  556   0H   4  170   30    G GG  G GG  G GGGGG GGGGGGGGGLGGGG G   GGGGGGGGGGGGGG
   565  200 P N  E     -Y  555   0H  41  170    0    N NN  N NN  N NNNNN NNNNNNNNNNNNNN N   NNNNNNNNNNNNNN
   566  201 P F  E >   -Y  554   0H   3  170    1    F FL  F FF  F FFFFF FFFFFFFFFFFFFF F   FFFFFFFFFFFLMF
   567  202 P I  T 3  S-     0   0   87  168   25    V V   V VV  I VVVIV VVVVVVVVVVVVVV I   VVVVVVVVVVVLLV
   568  203 P S  T >  S-     0   0   11  168   71    K H   H RR  A RRRRK QARRRRRRHRRRRR R   KKRRRRRRRKASRR
   569  204 P V  G X  S+     0   0    0  168   35    M I   V LL  L LLLLL LLLLLLIIMIIIII V   LLLLLLLLLILIIV
   570  205 P T  G >  S+     0   0   17  168   36    S T   T TT  S TTSSV AASTTTTTTITTTT S   TVTTTTTTTTSTDT
   571  206 P E  G <  S+     0   0  156  168   35    N N   D DD  D DDDDD TDDDDDDDDDDDDD D   NDDDDDDDDEEKRD
   572  207 P Q  G <  S+     0   0   84  168   43    E T   H EE  D DEDDD ETEDDDEDHYHHHH V   DDDDDDDDDETDDD
   573  208 P L  S <  S-     0   0   31  168   11    L L   L FF  L LFLLL LLLLLLLLLLLLLL F   LLLLLLLLLLLLLL
   574  209 P A    >   -     0   0   49  168   51    G G   G GG  G SGgGS GGGSSSGSGGGGGG G   GSSSSSSSSGGDGS
   575  210 P E  T 3  S+     0   0  201  168   27    N D   T DD  D DDdTD NEEDDDDDMDEEEE E   DDDDDDDDDNELND
   576  211 P E  T 3  S+     0   0  166  168   21    D D   D DD  D DDEDE DDDDDDDDDEDDDD D   NEDDDDDDDDDEEQ
   577  212 P F    <   -     0   0   17  168    0    F F   F FF  F FFFFF FFFFFFFFFFFFFF F   FFFFFFFFFFFFFF
   578  213 P F    >>  -     0   0  146  168   24    F Y   Y FF  F FFFED FYYFFFYFYETTTT F   QDFFFFFFFSYCYN
   579  214 P T  H 3> S+     0   0   24  167   24    A A   S AA  A AAAPY AAVAAAAESTTTTT A   AFAAAAAAAYAPAS
   580  215 P G  H 3> S+     0   0   32  167   71    S S   S LV  G SVSES SATSSSGSSESSSS T   EASSSSSSSGTNSS
   581  216 P D  H <> S+     0   0   57  167    4    D D   D DD  D DDDDD NDDDDDDDDDQQQQ E   DDDDDDDDDDDDDD
   582  217 P V  H  X S+     0   0    0  167   23    V V   V VV  V VVVIV VLIVVVVVVVVVVV V   VVVVVVVVVVVLLV
   583  218 P E  H  X S+     0   0   32  167    8    E E   E EE  E EEEQE EEEEEEEEEEVVVV E   QEEEEEEEEEEEEE
   584  219 P S  H  X S+     0   0   58  167   52    R S   A SS  G SASSS KAGSSSNSMRAAAA S   SSSSSSSSSNSNNG
   585  220 P F  H  < S+     0   0    2  168    2    Y F   F FF  Y FFFFF FFFFFFFFFFFFFF F   FFFFFFFFFFFYFF
   586  221 P L  H ><>S+     0   0    0  168    0    L L   L LL  L LLLLL LLLLLLLLLLLLLL L   LLLLLLLLLLLLLL
   587  222 P N  H ><5S+     0   0   61  168   82    I I   I VV  V IVIVV IHHIIIIIIIYYYY Q   VVIIIIIIIIHIVI
   588  223 P E  T 3<5S+     0   0   70  168   18    E E   E EE  E EEEEE ESEEEEEEEEEEEE E   EEEEEEEEEESEEE
   589  224 P Y  T < 5S-     0   0   20  165   47    Y H   H HH  H HHHHN YY HHHHNH HHHH H   HNHHHHHHHNYYRA
   590  225 P G  T < 5S+     0   0    6  165    6    G G   G GG  G GGAGG GS GGGGGG DDDD G   GGGGGGGGGGGGGG
   591  226 P L      < +     0   0    2  165   18    M L   I FF  M IFMMI ML IIIVIM IIII L   LIIIIIIIIITFFM
   592  227 P L  S    S-     0   0   10  161    8    L L   L LL  L ILILI LL IILLLL      L   LIIIIIIIILLLLL
   593  228 P P        -     0   0   40  161   31    P R   V PP  P VPPEN PP VVVSII      P   ENVVVVVVVLPPPP
   594  229 P E              0   0   94  159   17    E D   D DD  E DDDDD E  DDDDDD      N   DDDDDDDDDD DDD
   595  230 P K              0   0  161  158   24    K K   K QQ  R KRKKK N  KRRKKK      K   KKRRRRRRRK KKK
## SEQUENCE PROFILE AND ENTROPY
 SeqNo PDBNo   V   L   I   M   F   W   Y   G   A   P   S   T   C   H   R   K   Q   E   N   D  NOCC NDEL NINS ENTROPY RELENT WEIGHT
    1    2 B   0   0   0   0   0   0   0  13  23   0  45   1   0   0   0   0   0   4  11   2   267    0    0   1.471     49  0.40
    2    3 B   0   0   0   0   0   0   0   1   0   0   0   2   0   0  14  18   1  61   0   2   283    0    0   1.158     38  0.39
    3    4 B   2  48  37  12   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   299    0    0   1.100     36  0.66
    4    5 B   0   0   2   0   0   0   0   0   8   0   0   8   0   0   1   0  16  36   1  27   300    0    0   1.624     54  0.42
    5    6 B   1   2   2   0   0   0   0   0  19   0   9   2   0   0   0   1  60   2   2   0   301    0    0   1.307     43  0.38
    6    7 B   0  62   0   1   0   0   0   0  34   0   0   2   0   0   0   0   0   0   0   0   302    0    0   0.814     27  0.34
    7    8 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  92   8   0   0   0   0   311    0    0   0.293      9  0.90
    8    9 B   0   1   0   0   0   0   0   0   1   0   2   2   0   0  32   6  53   1   1   1   312    0    0   1.281     42  0.39
    9   10 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   2   1  92   0   4   313    0    0   0.410     13  0.87
   10   11 B   1   1   2   0   0   0   0   0  88   0   1   3   4   0   0   0   0   0   0   0   313    0    0   0.584     19  0.74
   11   12 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   3   1  87   0   8   315    0    0   0.568     18  0.79
   12   13 B   2   1   0   0   0   0   0  11   7   0  10  15   0   1   0   1  48   1   2   1   323    0    0   1.723     57  0.26
   13   14 B   0  96   3   1   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   348    0    0   0.190      6  0.95
   14   15 B   0   0   0   0   0   0   3   0   0   0   0   0   0   0  27  68   0   0   0   0   348    0    0   0.819     27  0.62
   15   16 B   0   1   0   0   0   0   0   1   1   0   3   2   0   1   0   8   1  18  39  25   348    0    0   1.666     55  0.43
   16   17 B   0   0   0   0   0   0   0   0   7   0   0   2   0   1  23  15  46   5   0   0   348    0    0   1.504     50  0.39
   17   18 B   1  11  86   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   348    0    0   0.506     16  0.81
   18   19 B   0   2   0   0   0   0   0   0   7   0   0   1   0   0  49  26   6   5   1   1   348    0    0   1.497     49  0.41
   19   20 B   1   1   1   0   0   0   0   0  13   0   1   1   0   0  20   3   9   7   1  43   349    0    0   1.723     57  0.28
   20   21 B   1   2   0   0   0   0   1   1  80   0   4   2   0   0   0   2   1   2   2   1   249    0    0   0.981     32  0.56
   21   22 B   0   0   1   0   0   0   0   0   1   0   1   0   0   0  71  24   0   0   0   0   349    0    0   0.806     26  0.71
   22   23 B   0   0   1   0   0   0   1   0   3   0   5   2   0   0   5  78   0   2   1   1   350    0    0   0.975     32  0.56
   23   24 B   2   1   0   0   0   0   0   2  51   1   2   1   0   0   1   2   8   7   1  21   350    0    0   1.604     53  0.36
   24   25 B   4  28   1   2   0   0   0   0  16   0   3   2  41   0   0   2   0   0   0   0   306    0    0   1.580     52  0.05
   25   26 B   0   1   0   0   0   0   0   8  56   0   5   0   9   2   2   0   5   1  12   0   309    0    0   1.560     52  0.40
   26   27 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  98   312    0    0   0.103      3  0.97
   27   28 B   4   0   3   0   0   0   0   3  23   0  10  55   1   0   0   0   0   0   0   0   315    0    0   1.314     43  0.48
   28   29 B   0   0   0   0   0   0   0   1   0   1  19  74   0   0   0   0   1   1   1   2   315    0    0   0.874     29  0.59
   29   30 B   1  90   2   6   1   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   317    0    0   0.457     15  0.91
   30   31 B  10   4   1   2   1   0   2   2  17   0  16   7   0   1  28   3   6   0   0   0   323    0    0   2.162     72  0.10
   31   32 B   1   0   0   1   0   0   0   1  17   1   4   4   0   0   2   3  48  13   2   5   330    0    0   1.739     58  0.35
   32   33 B  27   9  33   9   2   0   0   1  17   0   0   2   0   1   0   0   0   0   0   0   332    0    0   1.729     57  0.41
   33   34 B   7   0   1   0   0   0   0   3  39   2   3  41   1   0   1   0   1   0   1   0   343    0    0   1.472     49  0.38
   34   35 B   3   0   1   1   0   0   0   5  32   0  19   3   0   1   7   2  15   2  10   0   351    0    0   2.037     68  0.22
   35   36 B   0   1   0   0   0   0   0  21   3   1  10   1   0   1   2   3  13   6  34   6   351    0    0   1.960     65  0.33
   36   37 B  17  25  20  10   1   0   0   0   1   5   0   9   0  10   1   0   1   0   0   0   338    0    0   1.990     66  0.28
   37   38 B   7   0   1   0   0   0   0   1   5   2   1   1   0   0   0   0   0  40   2  40   345    0    0   1.419     47  0.43
   38   39 B   8   1   0   0   0   0   0   2   9  52  16   6   0   0   0   1   2   1   1   1   348    0    0   1.627     54  0.38
   39   40 B  43  25  21   1   8   0   0   0   1   0   0   1   0   0   0   0   0   0   0   0   350    0    0   1.392     46  0.59
   40   41 B   0   0   0   0   0   0   0  60   0  31   3   0   0   1   0   1   0   0   2   1   353    0    0   1.030     34  0.47
   41   42 B   0   1   0   0   0   0   0   0   2   6   1   0   0   0  75  12   1   1   1   0   354    0    0   0.972     32  0.56
   42   43 B  14   6  55   0   2   0   0   1   0   0   2   8   0   0   0   0   0   0  11   1   354    0    0   1.490     49  0.36
   43   44 B   6   1   1   0   0   0   0   7   2   2   1   2   1   1   0   0  64   0   3   8   340    0    0   1.467     48  0.38
   44   45 B   1  16   3  80   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   345    0    0   0.657     21  0.87
   45   46 B   7   1   0   0   0   0   0   0   0   0   0   1   0   0  62  28   1   0   0   0   346    0    0   0.987     32  0.48
   46   47 B   1   4   0   0   1   0   0   0   7  14   1  60  11   0   0   0   0   0   0   0   350    0    0   1.359     45  0.32
   47   48 B   1   0   0   0   0   0   3   0   0   0   0   0   9   0  73  14   0   0   0   0   355    0    0   0.902     30  0.43
   48   49 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  91   6   0   0   2   0   355    0    0   0.388     12  0.85
   49   50 B   2   1   2   0   0   0   0   1   3   0   1  85   0   0   0   0   0   0   4   0   355    0    0   0.691     23  0.72
   50   51 B   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.058      1  0.98
   51   52 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  57  32   9   0   0   0   355    0    0   0.954     31  0.58
   52   53 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.019      0  0.99
   53   54 B   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   355    0    0   0.000      0  1.00
   54   55 B   0  82   1   0   2   0   0   1   0   0   3   6   0   0   0   0   2   0   1   0   355    0    0   0.821     27  0.50
   55   56 B   0   0   0   0   0   0   0  12  82   0   1   0   0   0   0   0   0   0   4   0   355    0    0   0.623     20  0.69
   56   57 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   355    0    0   0.019      0  1.00
   57   58 B  12   0  88   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.375     12  0.91
   58   59 B   0   1   0   0   0   0  94   0   3   0   1   0   0   0   0   0   0   0   0   0   355    0    0   0.296      9  0.79
   59   60 B   0   0   0   0   0   0   0   0  86   0  10   0   1   0   0   2   1   0   0   1   355    0    0   0.560     18  0.68
   60   61 B   1  12   1  85   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.521     17  0.90
   61   62 B   0   0   0   0   0   0   0   0   0   0   0   0   1  85   1   1   2   0   0  10   355    0    0   0.622     20  0.67
   62   63 B   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.000      0  1.00
   63   64 B   0   0   0   0   0   0   0  39  20   0  31   9   1   0   0   0   0   0   1   0   355    0    0   1.352     45  0.45
   64   65 B   0   0   0   0   0   0   6   3   6   6  19  51   1   0   1   1   2   1   3   1   355    0    0   1.670     55  0.33
   65   66 B   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0  10   1  88   355    0    0   0.448     14  0.88
   66   67 B   0   0   0   0   0   0   0   1   0   0  61   1   0   0  25  10   1   0   1   0   355    0    0   1.058     35  0.42
   67   68 B   0   0   0   0   0   0   0   0   1   0   3   2   0   0  74  10   1   0   9   0   355    0    0   0.997     33  0.53
   68   69 B   0  37   0   0   0   2   1   0   0   0   3   1   0  30   8   2   2   0  13   1   355    0    0   1.636     54  0.13
   69   70 B   2  81  13   2   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   355    0    0   0.647     21  0.77
   70   71 B  95   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.227      7  0.93
   71   72 B   0   0   0   0   0   0   0   0   0   0  99   1   0   0   0   0   0   0   0   0   354    0    0   0.057      1  0.98
   72   73 B   0   0   0   0   0   0   0   0  98   0   2   0   0   0   0   0   0   0   0   0   354    0    0   0.125      4  0.95
   73   74 B   0   0   0   0   0   0   0   1   0   0  99   0   0   0   0   0   0   0   0   0   354    0    0   0.074      2  0.98
   74   75 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   355    0    0   0.058      1  0.99
   75   76 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   355    0    0   0.039      1  0.99
   76   77 B   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.058      1  0.98
   77   78 B   0   1   0   0   2   0   2   0   0   0   0   0   0   0   9  85   0   0   0   0   355    0    0   0.618     20  0.65
   78   79 B   1  94   1   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.273      9  0.95
   79   80 B   0   5  94   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.265      8  0.93
   80   81 B  44   2  53   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   355    0    0   0.833     27  0.81
   81   82 B   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.041      1  0.99
   82   83 B   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  12  87   355    0    0   0.436     14  0.81
   83   84 B   0   0   0   0   0   0   0   5  41   1  45   8   0   0   0   0   0   0   0   0   355    0    0   1.167     38  0.47
   84   85 B   3  10   2   0   4   0  73   0   0   0   0   0   0   5   0   0   2   0   0   0   354    0    0   1.031     34  0.51
   85   86 B   0   0   0   0   0   0   0   0   0   0   3  96   0   0   0   0   0   0   1   0   354    0    0   0.211      7  0.92
   86   87 B   0   0   0   1   0   0   0   6   1   0   9  82   0   0   1   0   0   0   0   0   354    0    0   0.674     22  0.63
   87   88 B   0   1   0   1   2   0   1   0   0   0   0   0   0   0   0   0   9   0  85   0   354    0    0   0.607     20  0.62
   88   89 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   354    0    0   0.019      0  0.99
   89   90 B  69   3   4  10   0   0   0   0   1   0   0   9   0   0   0   3   0   1   0   0   353    0    0   1.125     37  0.51
   90   91 B   1   0   0   0   0   0   1   0   0   0   1   0   0  91   0   0   3   0   2   0   353    0    0   0.459     15  0.81
   91   92 B   1   0   0   0   0   0   0   0  96   0   1   0   2   0   0   0   0   0   0   0   353    0    0   0.214      7  0.91
   92   93 B   3   0  96   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.177      5  0.97
   93   94 B   0   0   0   0   0   0   0   0   0  85   1   1   0   0   1   9   1   0   0   0   353    0    0   0.634     21  0.63
   94   95 B   0  97   1   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.149      4  0.97
   95   96 B   0   1   0   0   0   0   0   0   0   7   0   0   0   3  81   4   1   2   0   1   354    0    0   0.838     27  0.60
   96   97 B   0   0   0   0   0   0   0   0   0   0  86   1  10   0   0   0   0   0   3   0   354    0    0   0.529     17  0.76
   97   98 B   0   0   0   0   0   0   0   0   9   4  83   1   0   0   1   0   2   0   0   0   354    0    0   0.689     22  0.63
   98   99 B   0   0   0   0   0  99   0   1   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.093      3  0.96
   99  100 B  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.078      2  0.98
  100  101 B   0   4   0  95   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.235      7  0.95
  101  102 B   0   0   0   0   0   0   0   0   3   0   3  94   0   0   0   0   0   0   0   0   353    0    0   0.314     10  0.86
  102  103 B   2   0   0   0   0   0   0   0   1   0   1   1  95   0   0   0   0   0   0   0   353    0    0   0.249      8  0.90
  103  104 B   0   0   0   0   0   0   0   1  96   0   3   0   0   0   0   0   0   0   0   1   353    0    0   0.202      6  0.92
  104  105 B   0   0   2   0  13   0  84   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.525     17  0.90
  105  106 B   0   0   0   0   0   0   0   0  79   0  19   0   0   0   0   0   0   2   0   0   353    0    0   0.604     20  0.66
  106  107 B   0   0   0   0   0   0   0   0   1  96   0   0   0   0   0   0   2   0   0   0   353    0    0   0.212      7  0.92
  107  108 B   0   0   0   0   0   0   0   1   0   0  86   4   0   0   1   0   1   0   6   1   353    0    0   0.628     20  0.69
  108  109 B   0   0   0   1   0   0   0  93   1   0   0   0   0   0   1   0   0   1   1   0   353    0    0   0.364     12  0.85
  109  110 B   0   0   0   0   0   0   0   1   0   0   9   0   1   0   1   3  10   1  74   0   353    0    0   0.968     32  0.56
  110  111 B   0   8   0   2  29   1  48   0   1   0  10   1   0   0   0   0   0   0   0   0   353    0    0   1.370     45  0.45
  111  112 B  96   1   2   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.211      7  0.94
  112  113 B   1   0   0   0   0   0   0   0  98   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.107      3  0.96
  113  114 B   0   0   0   0   0   0   0   0   1   0   6   0  93   0   0   0   0   0   0   0   353    0    0   0.272      9  0.89
  114  115 B   0   0   0   0   0   0   0  97   3   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.157      5  0.94
  115  116 B   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.039      1  0.99
  116  117 B   0  99   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.054      1  0.99
  117  118 B   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0  98   353    0    0   0.113      3  0.96
  118  119 B   0   0   0   0   0   0   0   0   0   0   9   0   0   0   0   0   0   0  90   0   353    0    0   0.355     11  0.78
  119  120 B   7   3  71  11   0   0   0   0   4   0   0   1   0   1   0   1   0   0   2   0   353    0    0   1.119     37  0.57
  120  121 B   1   1   0   0   0   0   0   0   0   0   0   0  98   0   0   0   0   0   0   0   353    0    0   0.136      4  0.93
  121  122 B   0   0   0   0   0   0   0   0   0   0  94   6   0   0   0   0   0   0   0   0   353    0    0   0.256      8  0.85
  122  123 B   6   1  93   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.299      9  0.94
  123  124 B   0   0   0   0  11   0  88   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.405     13  0.95
  124  125 B   0   0   0   0   0   0   0   0   0   1  26   1   1   1   1   2   0   1  65   0   353    0    0   1.020     34  0.54
  125  126 B   3  92   5   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.378     12  0.87
  126  127 B   0   0   0   0   0   0   0   1   2   0  14   1   0   1   4  55   1   0  20   0   353    0    0   1.327     44  0.39
  127  128 B   0   0   0   0   1   0   0   3   8   3  28  43   0   0   1   0  11   0   2   0   353    0    0   1.538     51  0.29
  128  129 B   0   0   0   0   0   0   0   0   0   1   2   0   0   0  82  13   1   0   0   0   336    0    0   0.698     23  0.74
  129  130 B   1   0   1   0   0   0   0   1   0   1   0   0   0   0   0   0   1  68   2  26   340    0    0   0.904     30  0.71
  130  131 B   1   1   0   0   0   0   0  86   4   3   1   1   0   0   0   0   2   1   0   1   351    0    0   0.693     23  0.74
  131  132 B   1   0   0   0   0   0   0   2   0  24   1   5   0   2   0   0   2   0  62   0   349    0    0   1.163     38  0.40
  132  133 B  60   4   5   4   1   0   1   1   0   0   0  22   0   0   0   0   0   0   2   0   329    0    0   1.278     42  0.42
  133  134 B   0   0   0   0   0   0   0   0   2   8   0   0   0   0  69  17   0   0   2   0   347    0    0   0.984     32  0.55
  134  135 B  86   0   1   0   0   0   0   3   3   1   1   3   0   0   1   0   0   0   0   0   352    0    0   0.671     22  0.73
  135  136 B   1   2   1   1   0   0   1   3  24   0  58   5   1   0   0   1   1   0   1   0   352    0    0   1.362     45  0.41
  136  137 B   0   0   0   0   0   0   0   0   1   0   2   0   0   0  92   3   0   1   0   0   344    0    0   0.417     13  0.81
  137  138 B   1   0   4   6   0   0   0   0   1   0   1   1   0   0   0   0   1  86   0   0   346    0    0   0.607     20  0.59
  138  139 B   1  96   0   1   2   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   349    0    0   0.240      8  0.95
  139  140 B   0   0   0   0   0   0   1   0  19  30  40   4   0   0   0   2   0   1   1   2   351    0    0   1.485     49  0.39
  140  141 B   0   0   0   1   1   0   0  77  19   0   1   0   0   0   0   0   0   1   0   0   351    0    0   0.724     24  0.73
  141  142 B   0   0   0   0   0   0   1   0   0   0   1   0   0  97   1   0   0   0   0   0   352    0    0   0.191      6  0.92
  142  143 B   2   1   1   0   0   0   0   2  10   0  13  59   0   0   1   8   0   0   1   2   352    0    0   1.415     47  0.38
  143  144 B   0   0   0   0   0   0   0  97   1   0   0   0   1   0   0   0   0   0   1   0   352    0    0   0.211      7  0.91
  144  145 B   0   0   0   0   1   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   352    0    0   0.055      1  0.98
  145  146 B   9  86   5   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   352    0    0   0.506     16  0.81
  146  147 B   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   352    0    0   0.039      1  0.98
  147  148 B   0   0   0   0   0   0   0   0   2   0   8   0  87   0   0   0   0   1   0   1   353    0    0   0.548     18  0.71
  148  149 B   0   0   0   1   0   0   0   0   0   0   0   1  98   0   0   0   0   0   0   0   353    0    0   0.111      3  0.93
  149  150 B   0   0   0   0   0   0   0   0   0   0   1   0   0   0  86   1   8   2   0   1   353    0    0   0.593     19  0.67
  150  151 B   0   0   0   0  89   0  10   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.355     11  0.98
  151  152 B  15  51  31   0   0   0   1   0   0   0   0   2   0   0   0   0   0   0   0   0   353    0    0   1.133     37  0.65
  152  153 B   0   0   0   0   0   0   0   1   0   9   7   1   0   0   0   0   0   0  27  55   353    0    0   1.212     40  0.44
  153  154 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   7   3  90   353    0    0   0.431     14  0.87
  154  155 B   0   0   0   1   0   0   0   2   3   0  10  10   0   1  26   2   2   1  43   1   353    0    0   1.661     55  0.24
  155  156 B   0   0   0   0   0   0   0   0   0   0  12   2   0   8  14   2  50   5   7   0   353    0    0   1.591     53  0.34
  156  157 B   1   9  89   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.402     13  0.86
  157  158 B  46  25  29   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   1.079     36  0.73
  158  159 B   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   353    0    0   0.019      0  0.99
  159  160 B   0   0   0   0   0   0   0   3   6   0  90   1   0   0   0   0   0   0   0   0   352    0    0   0.431     14  0.80
  160  161 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   352    0    0   0.000      0  1.00
  161  162 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   352    0    0   0.000      0  1.00
  162  163 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   352    0    0   0.000      0  1.00
  163  164 B   0   0   0  45   0   0   0   1   0   0   4  38   1   1   0   0   9   0   0   0   353    0    0   1.239     41  0.24
  164  165 B   0   0   0   1   0   0   0   0   0   0   8  89   0   0   0   0   0   0   2   0   353    0    0   0.448     14  0.83
  165  166 B   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   352    0    0   0.039      1  0.99
  166  167 B  12   0   6  23   1   0   0   4  50   0   0   0   3   0   0   0   0   0   0   0   353    0    0   1.433     47  0.29
  167  168 B   0  86   0   1   1   0   0   0   0   0   0   0   0   0   1  10   1   0   0   0   353    0    0   0.589     19  0.71
  168  169 B   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.039      1  0.99
  169  170 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  99   353    0    0   0.081      2  0.98
  170  171 B  10   5  85   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.551     18  0.87
  171  172 B   0   0   0   0   0   0   0   0   0   1   0  10   0   0   0   0   0  85   1   2   353    0    0   0.575     19  0.68
  172  173 B   0   0   0   1   0   0   0   0   5   0  10  78   0   0   1   3   1   0   1   0   353    0    0   0.870     29  0.60
  173  174 B   0   0   0   0   0   0   0  91   4   0   3   1   0   0   0   0   0   0   0   0   353    0    0   0.416     13  0.88
  174  175 B   5   7   0   0   0   0   0   0   2   0   8  11   0   0   0   3  58   2   1   0   353    0    0   1.538     51  0.26
  175  176 B   1   1   0   0   0   0   0   0   0   1   0   1   0   0  15  26  54   0   1   0   353    0    0   1.214     40  0.42
  176  177 B  27   1  11   0   0   0   0   0   1   0   2  38   7   0   0  12   0   0   0   0   353    0    0   1.634     54  0.29
  177  178 B  12   0   3   3   0   0   0   0   2   0  10  62   0   3   3   0   2   0   0   0   353    0    0   1.377     45  0.36
  178  179 B  17   0   4   0   0   0   0   5   4   0  11  23   0   1   0   0   1  29   0   4   354    0    0   1.911     63  0.21
  179  180 B   0   0   0   0  98   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.097      3  1.00
  180  181 B   9   5   3   0   0   0   0  10  32   0   6  25   0   1   1   1   1   0   3   0   354    0    0   1.958     65  0.27
  181  182 B   0   0   0   0   0   0   0  62   0   0   0   0   0   0   0   0   0   3   2  32   354    0    0   0.845     28  0.67
  182  183 B   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   354    0    0   0.000      0  1.00
  183  184 B   1  22   2   0   0   0   0   1   1   0  14  54   0   0   0   0   3   0   1   0   354    0    0   1.324     44  0.30
  184  185 B   0   0   0   0   0   0   0  88  11   0   1   0   0   0   0   0   0   0   0   0   354    0    0   0.381     12  0.83
  185  186 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   354    0    0   0.039      1  0.99
  186  187 B  88   0   0   0   0   0   0   0   1   0   0   0  11   0   0   0   0   0   0   0   354    0    0   0.394     13  0.81
  187  188 B   0  12   0  86   0   0   0   0   0   0   0   1   0   0   0   0   1   0   0   0   354    0    0   0.503     16  0.89
  188  189 B   0   0   0   0   0   0   0   0   4   0  89   1   5   0   0   0   0   0   0   0   354    0    0   0.487     16  0.82
  189  190 B  11  66  21   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.931     31  0.72
  190  191 B   0   0   0   0   0   0   0   0  13   0  85   1   0   0   0   0   0   0   0   2   354    0    0   0.517     17  0.76
  191  192 B  12  64  23   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0   0   0   354    0    0   0.976     32  0.67
  192  193 B   0   0   0   0   0   0   0   4  27   1  37   1   0   0   1   0   1   0  27   1   354    0    0   1.467     48  0.37
  193  194 B   0   0   0   0   0   0   0   4   1  86   6   0   0   0   0   0   0   1   2   0   354    0    0   0.631     21  0.70
  194  195 B   0   4   2   0   0   0   0   0   1   0  12  18   0   2   0   0   4   0   7  52   354    0    0   1.541     51  0.28
  195  196 B   0   5   1  13  10   0   2   6   1   2   5  11   2   1   1   1   5   1  28   4   354    0    0   2.370     79  0.11
  196  197 B   0   0   0   0   1   0   0   1   1   5   7   3   0   2  36  11  14   1  18   1   355    0    0   1.902     63  0.24
  197  198 B  11  23   5   8   1   1   1   0   0   0   2  43   2   0   1   0   3   0   0   0   351    0    0   1.740     58  0.30
  198  199 B   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   351    0    0   0.000      0  1.00
  199  200 B  73   0  26   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   352    0    0   0.633     21  0.87
  200  201 B   0   0   0   0   0   0   0   0   0   0  99   1   0   0   0   0   0   0   0   0   353    0    0   0.088      2  0.97
  201  202 B   0   0   0   0   0   0   0  99   0   0   0   0   1   0   0   0   0   0   0   0   355    0    0   0.093      3  0.97
  202  203 B   0   0   0   0   0   0   0   3  83   0  14   0   0   0   0   0   0   0   0   0   354    0    0   0.550     18  0.69
  203  204 B   0   0   0   0   0   0   0   0   1   0   3   0  96   0   0   0   0   0   0   0   354    0    0   0.183      6  0.92
  204  205 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   354    0    0   0.000      0  1.00
  205  206 B   0   0   0   0   1   0   0   4  78   0  12   3   0   0   0   1   0   0   0   0   354    0    0   0.837     27  0.61
  206  207 B   1   2   0   2  20   0   3   0   1   0  48  21   0   0   0   1   0   0   0   0   354    0    0   1.427     47  0.18
  207  208 B   4   0   6   0   0   0   0   0  80   0  10   0   0   0   0   0   0   0   0   0   354    0    0   0.724     24  0.71
  208  209 B   0   0   0   1   0   0   1   0   0   0   0   0   0   0   9  89   0   0   0   0   354    0    0   0.443     14  0.80
  209  210 B   7  90   3   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.410     13  0.88
  210  211 B   0   0   0   0   1  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.062      2  1.00
  211  212 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   354    0    0   0.000      0  1.00
  212  213 B  28   5  56   2   0   0   0   0   0   1   1   8   0   0   0   0   0   0   0   0   354    0    0   1.183     39  0.61
  213  214 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   354    0    0   0.019      0  0.99
  214  215 B   1   1   0   1   0   0   0   1  21   1   7  10   1   0   0   0   4  30   0  23   353    0    0   1.803     60  0.31
  215  216 B   0   0   0   0   0   0   0  73   1   3  16   1   0   0   0   1   4   1   0   1   354    0    0   0.983     32  0.61
  216  217 B   2   1   1  33   0   0   0   1   2   0   2  10   0   1  13  28   4   0   2   0   354    0    0   1.862     62  0.22
  217  218 B   1   0   0   0   0   0   0   0  30   2   3   1  62   0   0   0   0   0   0   0   354    0    0   0.985     32  0.48
  218  219 B  34   0   2   1   0   0   0   0   2   0   1   6   0   0  38  14   2   0   0   0   354    0    0   1.488     49  0.17
  219  220 B   0   0   0   1   0   0   0   1   2   0   0   0   0   1   8   0  87   0   0   0   354    0    0   0.549     18  0.72
  220  221 B   0   0   0   0   0   0   0   0   1   0  13  86   0   0   0   0   0   0   0   0   354    0    0   0.472     15  0.77
  221  222 B   0   0   0   0  97   0   3   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.138      4  0.98
  222  223 B   1   1   5   0   2   0   1   2  19  10   6  41   0   8   0   0   2   1   0   0   354    0    0   1.878     62  0.21
  223  224 B   1   0   2   0   0   0   0  92   3   0   0   1   0   0   0   0   0   0   0   0   355    0    0   0.377     12  0.82
  224  225 B   0   0   0   0   0   0   0   0   0   0   3   0   0  96   0   0   0   0   0   0   355    0    0   0.167      5  0.86
  225  226 B   7   0   2   0   0   0   0   0   0   0   0   2   0   0   0   1   1  78   3   6   355    0    0   0.920     30  0.66
  226  227 B   0   0   0   0   0   0   0   8   2   0  89   0   0   0   0   0   0   0   0   0   354    0    0   0.424     14  0.81
  227  228 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   354    0    0   0.000      0  1.00
  228  229 B  11   0  89   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.353     11  0.92
  229  230 B   0   0   0   0   0   0   0   0   0   0   1   1   0   0   0   0   0   0  98   0   354    0    0   0.111      3  0.94
  230  231 B   0   0   0   0   0   0   0   0  85   0   8   6   1   0   0   0   0   0   0   0   354    0    0   0.587     19  0.69
  231  232 B  52   0  48   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.727     24  0.85
  232  233 B   0   0   1   0   0   0   0   1  12   0  10  10  25   0   1  11  26   1   1   1   353    0    0   1.954     65  0.10
  233  234 B   2   0   0   1  92   0   5   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.398     13  0.90
  234  235 B   0   1   0   0  97   0   1   0   0   0   0   0   0   1   0   0   0   0   0   0   353    0    0   0.179      5  0.95
  235  236 B   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   1   0   0   1   0   353    0    0   0.089      2  0.96
  236  237 B   0   0   0   0   0   0   0   0   0   0  11   0   0   0   0   0   0   1  58  29   353    0    0   1.009     33  0.57
  237  238 B   0   0   0   0   0   0   1  97   0   0   0   0   0   0   0   0   0   0   1   0   353    0    0   0.156      5  0.94
  238  239 B   0   1   0   1   3   0  14   0   0   0   1   1   0  17   0   0   6   8  39   7   353    0    0   1.885     62  0.33
  239  240 B   0   0   0   0   0   0   0   0  76   0  14   0   0   0   9   0   0   0   0   0   353    0    0   0.752     25  0.51
  240  241 B   3   1   8   0  88   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.478     15  0.86
  241  242 B  11   0   5   1   0   0   0  26  44   0   0   6   7   0   0   0   0   0   0   0   353    0    0   1.514     50  0.41
  242  243 B   0   0   0   0   0   0   0   0   1   0   2  97   0   0   0   0   0   0   0   0   353    0    0   0.140      4  0.93
  243  244 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.019      0  0.99
  244  245 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   353    0    0   0.000      0  1.00
  245  246 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   2   0  98   353    0    0   0.097      3  0.98
  246  247 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   353    0    0   0.000      0  1.00
  247  248 B   0   0   0   0   1   0   0  13  75   0   2   6   2   0   0   0   0   0   0   0   353    0    0   0.888     29  0.62
  248  249 B   1   1   1   0   0   0   0   0   0   0  27  70   0   0   0   0   1   0   0   0   353    0    0   0.744     24  0.58
  249  250 B   1   0   3   0   0   0   0   0   1   0   0   0  95   0   0   0   0   0   0   0   353    0    0   0.225      7  0.87
  250  251 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  94   5   1   0   0   0   353    0    0   0.244      8  0.93
  251  252 B   0  96   0   3   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.207      6  0.98
  252  253 B   0   0   0   0  93   0   7   0   0   0   0   0   0   0   0   0   0   0   0   0   352    0    0   0.280      9  0.98
  253  254 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   352    0    0   0.000      0  1.00
  254  255 B   1  48  47   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   352    0    0   0.914     30  0.71
  255  256 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   352    0    0   0.019      0  0.99
  256  257 B   0   0   0   0   0   0   0   0  85   0   5   9   1   0   0   0   0   0   0   0   352    0    0   0.557     18  0.70
  257  258 B   0   1   0   0   0   0   2   9   0   0   1   0   0   0   0   0   0   0   0  88   352    0    0   0.458     15  0.77
  258  259 B   0   0   0   1   0   0   0   1   0   0   0   0   3   9  31   0  54   0   0   0   352    0    0   1.170     39  0.38
  259  260 B   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   9  89   0   0   353    0    0   0.402     13  0.82
  260  261 B   4  91   3   1   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.401     13  0.89
  261  262 B   0  12   6  20   0   0   0   4  14   0   3   4   0   0   0   0  10   0  26   0   353    0    0   1.987     66  0.13
  262  263 B  17  11   6  21   1   0   0   1   4   0   5  19   4   1   0   1   3   0   3   1   354    0    0   2.256     75  0.20
  263  264 B   0   0   0   0   8   0  92   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.277      9  0.99
  264  265 B   0   0   0   0   0   0   3   9   2   0  58   9   1   1   1   1  12   1   2   0   354    0    0   1.512     50  0.34
  265  266 B   1   0   3   0   0   0   1   0   0   2  19   0   0  56   3   1   5   1   3   5   354    0    0   1.516     50  0.28
  266  267 B   0   0   1   0   0   0   0   1   0   4   3   1   0   1   0   0   4  25   1  58   354    0    0   1.292     43  0.57
  267  268 B   0   0   0   0   0   0   0   2   1   2  23   1   1   5   0   2   7   3  50   1   354    0    0   1.629     54  0.34
  268  269 B   6   4  75   1   0   0   0   3   0   3   2   0   0   0   0   0   0   1   1   4   354    0    0   1.075     35  0.51
  269  270 B   5  30  52   2   0   0   0   0   1   0   1   0   0   0   0   0   1   0   5   1   354    0    0   1.347     44  0.45
  270  271 B   1   1   0   0   1   0   0   1   3   7   1   0  82   2   0   0   2   0   0   1   354    0    0   0.834     27  0.51
  271  272 B   0   0   1   0   0   0   0  90   0   2   0   2   0   4   0   0   0   0   0   0   355    0    0   0.474     15  0.72
  272  273 B  18   0  81   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.562     18  0.85
  273  274 B   1   0   1   0   1   0   0   0   0   0   1  95   0   0   0   0   0   0   0   0   355    0    0   0.301     10  0.84
  274  275 B   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   355    0    0   0.058      1  0.98
  275  276 B  84   5   9   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.616     20  0.83
  276  277 B   0   0   0   0   0   0   0   3  83   0   8   0   0   0   0   0   0   0   0   5   354    0    0   0.648     21  0.75
  277  278 B   0   3   1   0  84   0   0   0   0   1   0  10   1   0   0   0   0   0   0   0   354    0    0   0.637     21  0.69
  278  279 B   0   0   0   0   0   0   0   2   0   0  98   0   0   0   0   0   0   0   0   0   354    0    0   0.125      4  0.96
  279  280 B  23   8  10   0   0   0   1   1   2   0   2   0   0   0  10  40   0   0   2   0   354    0    0   1.733     57  0.18
  280  281 B   0   0   0   0   0   0   0   0   0   0  99   1   0   0   0   0   0   0   0   0   354    0    0   0.081      2  0.96
  281  282 B   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.019      0  0.99
  282  283 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   354    0    0   0.000      0  1.00
  283  284 B   1  88   6   0   3   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.495     16  0.89
  284  285 B   1  94   4   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.285      9  0.94
  285  286 B   0  43   1   0  53   0   4   0   0   0   0   0   0   0   0   0   0   0   0   0   354    0    0   0.868     28  0.84
  286  287 B   1   0   0   0   0   0   0   7  88   0   2   0   1   0   0   0   0   0   0   0   355    0    0   0.513     17  0.81
  287  288 B   0   0   0   0   0   0   0  96   0   0   0   0   4   0   0   0   0   0   0   0   355    0    0   0.176      5  0.89
  288  289 B   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.039      1  0.98
  289  290 B   0   0   0   0   0   0   0   0   3   0   8   3   0   0   0   0   0   1   1  85   355    0    0   0.605     20  0.66
  290  291 B   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   2   8  89   355    0    0   0.439     14  0.83
  291  292 B   0   1   0   0  75   4  10   8   0   0   0   0   0   1   0   0   0   0   1   0   355    0    0   0.953     31  0.55
  292  293 B   0   0   0   0   0   0   0   5   0   0   1   6   0   0   0   0   0  20  60   7   355    0    0   1.242     41  0.50
  293  294 B   2   0   1   0   0   0   0   0   1   0   0   1  95   0   0   0   0   0   0   0   355    0    0   0.253      8  0.90
  294  295 B   2   1   1   0   0   0  11   0   1   0   2   0   0   2   0  20   0   0  59   0   355    0    0   1.286     42  0.25
  295  296 B  82   0  14   0   0   1   0   0   0   0   0   0   2   0   0   0   0   0   0   0   355    0    0   0.603     20  0.83
  296  297 B   0   0   0   0   1  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   355    0    0   0.035      1  1.00
  297  298 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   355    0    0   0.000      0  1.00
  298  299 B  19   1   6   0   0   0   0   0  16   0  17  40   0   0   0   0   0   0   0   0   355    0    0   1.509     50  0.35
  299  300 B   1  66   2  21   0   0   0   0   0   0   0  10   0   0   0   0   0   0   0   0   355    0    0   0.964     32  0.72
  300  301 B   0   9   0   0   0   0   0   0   0   0   1   1   0   0  23  64   0   0   0   0   355    0    0   1.013     33  0.47
  301  302 B   7   0   0   0   0   0   0  54  21   0   4   3   2   0   1   0   4   3   1   0   355    0    0   1.495     49  0.47
  302  303 B   9   0   1   1   0   0   0   2   1   0   1   0   0   0   0   0   1  51   1  32   355    0    0   1.270     42  0.48
  303  304 B   1   6   1   1   0   0   1   0   0   0   1   0   0   1  64  19   1   0   2   1   354    0    0   1.233     41  0.38
  304  305 B  41   3   5   0   0   0   0   6  39   0   3   0   0   0   0   0   0   0   0   0   355    0    0   1.380     46  0.37
  305  306 B   0   1   0   0   0   1   1  88   1   0   4   2   0   0   0   0   0   0   1   0   355    0    0   0.579     19  0.73
  306  307 B  50   5  14   0   0   0   0   0   1   0  18   6   0   0   0   2   2   1   1   0   355    0    0   1.579     52  0.31
  307  308 B   1  88   0   0   0   0   0   1   0   0   0   0   0   0   0   0   9   0   0   0   350    0    0   0.472     15  0.64
  308  309 B  11   0   0   0   1   0   0   1  50   0  19   6   0   0   0   0   3   1   7   3   351    0    0   1.582     52  0.30
  309  310 B   0   0   0   0   0   0   0  87   2   0   8   1   0   0   0   0   0   1   0   1   353    0    0   0.526     17  0.79
  310  311 B   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   353    0    0   0.000      0  1.00
  311  312 B   0   1   0   0   0   0   0   1   0   0   1   0   0   0   1   1   0  32   0  62   353    0    0   0.946     31  0.67
  312  313 B   0   0   0   0   0   0   0   6   0   0   0   0   0   0   0   0   0   0  92   1   353    0    0   0.339     11  0.83
  313  314 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0  97   2   0   0   0   0   353    0    0   0.147      4  0.94
  314  315 B  88   0  12   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   353    0    0   0.403     13  0.89
  315  316 B   0   0   0   0   0   0   0   0   0   0  96   1   0   0   0   0   0   0   3   0   353    0    0   0.200      6  0.90
  316  317 B   0   0   0   0   0   0   0   1   1   0   0   1  95   1   1   0   1   0   0   0   353    0    0   0.276      9  0.83
  317  318 B   4  92   2   0   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0   353    0    0   0.370     12  0.87
  318  319 B   0   0   0   0   0   0   0  95   1   0   1   0   0   0   1   1   0   0   0   0   353    0    0   0.278      9  0.86
  319  320 B  87   8   1   2   0   0   0   0   1   0   0   1   0   0   0   0   0   0   0   0   353    0    0   0.540     18  0.81
  320  321 B   0   0   0   0   0   0   0   0   1   3  46  49   1   0   0   0   0   0   1   0   353    0    0   0.927     30  0.48
  321  322 B   2   0   0   0   0   0   0   1  16   8   5   3   0   0   0   1   0  13  21  29   353    0    0   1.888     63  0.30
  322  323 B   0   0   0   0   0   0   0   0   1   0   0   1   0   0   0   1   0   0   5  93   352    0    0   0.336     11  0.90
  323  324 B   0   0   0   0   0   0   0  96   4   0   0   0   0   0   0   0   0   0   0   0   352    0    0   0.177      5  0.95
  324  325 B   2   3  14  63   0   0   1   0   0   0   9   4   0   0   0   0   1   1   0   1   350    0    0   1.296     43  0.37
  325  326 B   0   0   0   0   0   0   0   2  77   0  21   0   0   0   0   0   0   0   0   0   350    0    0   0.643     21  0.70
  326  327 B  52  44   1   0   1   0   0   0   1   0   0   0   1   0   0   0   0   0   0   0   350    0    0   0.894     29  0.67
  327  328 B   1   0   0   0   0   0   0   1  46   0   1   0  51   0   0   0   0   0   0   0   349    0    0   0.831     27  0.52
  328  329 B   0   0   0   0   0   0   0   0   0   0   1  98   0   0   0   0   0   0   0   0   349    0    0   0.114      3  0.96
  329  330 B   0   0   0   0   0   0   0  98   1   0   1   0   0   0   0   0   0   0   0   0   349    0    0   0.132      4  0.95
  330  331 B   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   349    0    0   0.000      0  1.00
  331  332 B   0   0   0   0   0  99   1   0   0   0   0   0   0   0   0   0   0   0   0   0   349    0    0   0.035      1  1.00
  332  333 B   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   349    0    0   0.000      0  1.00
  333  334 B   0   0   0   1   0   0   0   0   2   0  85   8   0   1   0   3   1   0   0   0   349    0    0   0.637     21  0.64
  334  335 B   1  19   0   4  54   0   0   0   0   0   0  11   0   0   1   0   0   0   9   0   349    0    0   1.380     46  0.29
  335  336 B   3  93   3   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   349    0    0   0.337     11  0.91
  336  337 B   0   1   0   0   0   0   0   0   0   0   1   0   0   0  27  70   0   0   0   0   346    0    0   0.722     24  0.77
  337  338 B  23   3  74   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   344    0    0   0.685     22  0.87
  338  339 B   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   341    0    0   0.040      1  1.00
  339  340 B   0   0   0   0   0   0   0   0  32   0   5   1   0   0   0   0   0   0  62   0   297    0    0   0.861     28  0.42
  340          0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     0    0    0   0.000      0  1.00
  341    2 G   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0    80    0    0   0.000      0  1.00
  342    3 G  51   0   2   0   0   0   0   0  46   0   0   0   0   0   0   0   0   0   0   0    82    0    0   0.790     26  0.36
  343    4 G   1  40  55   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    84    0    0   0.868     28  0.66
  344    5 G   0   0   0   0   0   0   0   0   2   0   1   0   0  42   0   0   0   0  52   2    84    0    0   0.934     31  0.41
  345    6 G  10   0  87   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   1   0    84    0    0   0.488     16  0.70
  346    7 G   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0  26  62   9   2   126    0    0   0.988     32  0.56
  347    8 G   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   6   9  84   137    0    0   0.572     19  0.78
  348    9 G   0  79   0  18   0   0   0   0   0   0   0   3   0   0   0   0   0   0   0   0   141    0    0   0.601     20  0.84
  349   10 G   0   0   0   0   0   0   0   0   8  24  30  38   0   0   0   0   0   0   0   0   141    0    0   1.272     42  0.38
  350   11 G   0   0   0   0   0   0   0   0   0   0   2   0   0   0   0   8   0  78   1  12   143    0    0   0.763     25  0.66
  351   12 G   1   2   9   1   0   0   0   0   0   0   0   0   0   0   3  85   0   0   0   0   152    0    0   0.598     19  0.59
  352   13 G   0   0   0   0   0   0   0   0   8   0   1   0   0   0   0   0   0  43   0  47   152    0    0   0.974     32  0.64
  353   14 G   1  22   7   1   0   0   0   0   5   0   0   0   0   0   1  53   3   4   1   3   152    0    0   1.467     48  0.16
  354   15 G   0  81   1   5   0   0   0   0  13   0   0   1   0   0   0   0   0   0   0   0   183    0    0   0.633     21  0.69
  355   16 G   1   1   0   0   0   0   0   0   0   0   0   0   0   0  33  53  11   0   0   0   230    0    0   1.045     34  0.57
  356   17 G   0   2   0  54   0   0   0   0   0   0   0   0   0   0  18  25   0   0   0   0   232    0    0   1.119     37  0.39
  357   18 G   1  13   0   1   0   0   0   0  16   0   0   7   0   0   0   0   5  54   1   0   232    0    0   1.403     46  0.26
  358   19 G  88   5   6   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   233    0    0   0.491     16  0.88
  359   20 G   0   0   0   0   0   0   0   0   1   0   0   2   0   0   0   0   3  75   2  18   233    0    0   0.814     27  0.80
  360   21 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  95   0   4   0   233    0    0   0.205      6  0.91
  361   22 G   0  96   0   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   233    0    0   0.177      5  0.98
  362   23 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0  27  72   1   0   0   0   233    0    0   0.634     21  0.79
  363   24 G   1  19   4  17   1   0   4   0   0   0   0   2   0   0   2  49   0   0   0   0   233    0    0   1.523     50  0.21
  364   25 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   5  95   0   0   233    0    0   0.190      6  0.93
  365   26 G  57   2   0   0   0   0   0   0  40   0   0   1   0   0   0   0   0   0   0   0   233    0    0   0.822     27  0.47
  366   27 G   0   0   0   0   0   0   3  12   3   0  11  14   9   0   0  37   0   0   9   0   233    0    0   1.845     61  0.17
  367   28 G  12  37  15  16   0   0   0   0   0   0   0   5   0   0   0   0   0   0  15   0   233    0    0   1.648     55  0.39
  368   29 G   0   0   0   0   0   0   0   0   0   9   0   8   0   0   0   1  16  47   0  18   233    0    0   1.478     49  0.51
  369   30 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   233    0    0   0.028      0  0.99
  370   31 G  12   0  26  20   0   6   0   0   5   0   1   3   0   0   0   0  21   2   0   2   233    1    0   1.943     64  0.14
  371   32 G   0  19   0   7   0   0   0   0   3  16   0   1   0   0   1  37  15   0   0   0   232    0    0   1.695     56  0.19
  372   33 G  80   5  13   0   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0   232    0    0   0.669     22  0.85
  373   34 G   0   0   0   0   0   0   0   0   1   0  99   0   0   0   0   0   0   0   0   0   232    0    0   0.050      1  0.98
  374   35 G   1   0   0   0   0   0   0   0   2   0   0   1   0   0   1  73  22   0   0   0   232    0    0   0.804     26  0.62
  375   36 G   1   0   0   1   0   0   0   0  45   0   6  12  32   0   0   0   0   0   2   0   233    0    0   1.368     45  0.38
  376   37 G   0   0   5   0   0   0   0  14  39   0  20   0  20   0   0   0   0   0   0   0   233    0    0   1.534     51  0.37
  377   38 G   0   0   0   0   0   0   0   0  38   1   3   3   0   0   0  17   0  36   0   0   233    0    0   1.397     46  0.32
  378   39 G   0   0   0   0   0   0   0   0   4   0   0   0   0   0   0   0   0  68   0  26   233    0    1   0.865     28  0.73
  379   40 G  12  42  38   5   1   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0   233    0    0   1.297     43  0.63
  380   41 G   0  18   3   9   0   0   0   0   0   0   0   1   1   0  17  37  12   0   0   0   233    0    0   1.687     56  0.20
  381   42 G   0   0   0   0   0   0   0   1  20   0   2   3   0   1   1   1  17  16  16  22   233    0    0   1.911     63  0.35
  382   43 G   0   0   0   0  11   1  88   0   0   0   0   0   0   0   0   0   0   0   0   0   233    0    0   0.408     13  0.98
  383   44 G  33   0  26   0   0   0   0   0   0   0   0   0  40   0   0   0   0   0   0   0   233    0    0   1.106     36  0.42
  384   45 G   1   2   1  11   0   0   0   0   0   0   1   3   0   0   0   0   3  73   0   4   233    0    0   1.096     36  0.52
  385   46 G   0   0   0   0   0   0   0   3  31   0   5   2   0   0   0   0  14  42   1   2   233    0    0   1.471     49  0.43
  386   47 G   0   2   0   2   0   0   0   3   0   0   0   0   0  25  31   1  15   3  17   0   233    0    0   1.740     58  0.31
  387   48 G  11   1   3   2   0   0   0   0  42   0  34   1   0   0   0   0   0   5   0   0   233    0    0   1.483     49  0.32
  388   49 G   0   0   0   0   0   0   0  47   3   2   0   1  11   0  12  17   0   3   0   2   233    1    0   1.654     55  0.20
  389   50 G   0   0   0   0   0   0   1   1   0   0   5   3   0   0   1  13   0  57  16   3   232    0    0   1.400     46  0.46
  390   51 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   232    0    0   0.028      0  0.99
  391   52 G   0   0   1   0   0   0   0   0  12  83   0   1   0   0   0   0   0   0   0   0   233    0    0   0.626     20  0.74
  392   53 G   0  91   0   0   9   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   233    0    0   0.303     10  0.97
  393   54 G  44  36  20   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   233    0    0   1.052     35  0.70
  394   55 G  18   2  11   2   0   0   0   0   0   0   1   7   0   4   1  53   0   0   0   0   233    0    0   1.517     50  0.19
  395   56 G   0   0   0   0   0   0   0  76   4  19   0   0   0   0   0   0   0   0   0   0   233    9    3   0.706     23  0.65
  396   57 G  44   1  53   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   224    0    0   0.878     29  0.79
  397   58 G   0   0   0   0   0   0   0   0   0  94   5   0   0   0   0   0   0   0   0   0   233    0    0   0.300     10  0.89
  398   59 G   0   0   0   0   0   0   0   0  30   0   4   4   0   0   0   1   0  52   0   7   233    0    0   1.257     41  0.42
  399   60 G   0   0   0   0   0   0   0  12   6   0  21   0   0   0   0   5   0   4   0  50   233    0    0   1.416     47  0.39
  400   61 G   0   0   0   0   0   0   0   0   0   0  13   4   0   0   3  55   0  23   0   0   233    0    0   1.274     42  0.38
  401   62 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   233    0    0   0.028      0  0.99
  402   63 G   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   224    0    0   0.000      0  1.00
  403   64 G   0   0   0   0  96   0   3   0   0   0   0   0   0   0   0   0   0   0   0   0   224    0    0   0.168      5  0.99
  404   65 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0  34  65   0   0   0   0   222    0    0   0.720     24  0.70
  405   66 G   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  96   0   4   217    0    0   0.173      5  0.97
  406          0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     0    0    0   0.000      0  1.00
  407   13 P   0  16   0   0  77   0   6   0   0   0   0   0   0   0   0   0   0   0   0   0    62    0    0   0.669     22  0.90
  408   14 P   0   0   0   0   0   0   0   1   1   2   2   1   0   0   6   1   1  66   1  18   142    0    0   1.176     39  0.60
  409   15 P   1   3   0   0   0   0   0  77   0   0   1   0   0   0   0   1   7   7   0   3   144    0    0   0.916     30  0.63
  410   16 P   0   1  23   0   1   0   1   0   0   9  18  11   3   0   1   0  31   1   1   0   148    0    0   1.834     61  0.09
  411   17 P   5   0   0   0   0   0   0   2  49   1  36   4   1   0   0   0   1   0   0   0   149    0    0   1.232     41  0.46
  412   18 P  33   0   6   1   0   0   0   2   0   1  13  40   0   0   0   0   1   0   5   0   149    0    0   1.488     49  0.29
  413   19 P   3   0   0   0   0   0   0   1   0   0   1   7   0  36   0   0   3   0  49   1   151    0    0   1.206     40  0.43
  414   20 P   0   0   0   0   0   0   0   1   0   0   1  91   0   0   0   0   1   0   6   0   152    1   18   0.372     12  0.83
  415   21 P   0   0   0   0   0   1   0  99   0   0   0   0   0   0   0   0   0   0   0   0   164    0    0   0.037      1  0.98
  416   22 P   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   165    0    0   0.000      0  1.00
  417   23 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   1   0   165    0    0   0.037      1  0.99
  418   24 P   0   0   0   0   0   0   0  99   0   0   0   0   1   0   0   0   0   0   0   0   165    0    0   0.037      1  0.99
  419   25 P 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   165    0    0   0.000      0  1.00
  420   26 P   8  10  82   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   165    0    0   0.586     19  0.86
  421   27 P   0   0   0   0   0   0   0   0   1   0   1   0   0   6   1  11   4   7  70   0   165    0    0   1.090     36  0.58
  422   28 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   166    0    0   0.000      0  1.00
  423   29 P   0   0   0   0   0  99   1   0   0   0   0   0   0   0   0   0   0   0   0   0   166    0    0   0.065      2  0.99
  424   30 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0  83   1  16   1   0   0   166    0    0   0.533     17  0.73
  425   31 P   0   1   0   0   0   0   0   0   0   0   2   1   0   0  56  37   2   1   1   0   166    0    0   0.978     32  0.63
  426   32 P   0   0   0   0  84   0  16   0   0   0   0   0   0   0   0   0   0   0   0   0   166    0    0   0.434     14  0.98
  427   33 P   0   0   0   0   0   0   0   0   0   0   0   0   0   2   1  96   1   0   0   0   166    5   91   0.187      6  0.93
  428   34 P   0  98   1   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.105      3  0.98
  429   35 P   0   0   1   0   0   0   0   0   0   0   0   0   0   0   1   1   3  91   0   4   161    0    0   0.408     13  0.90
  430   36 P   4   0   1   0   1   0   1   0  12   0  46  31   1   0   1   0   0   0   4   0   162    0  161   1.394     46  0.34
  431   37 P   0   1   1   2   0   0   0   0   2   0   2   4   1   1  29  37   2  15   5   1   167   24   72   1.747     58  0.33
  432          0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     0    0    0   0.000      0  1.00
  433   68 P  14  22  38   2  20   0   0   0   0   0   2   1   0   0   1   0   1   0   0   0   143    0    0   1.560     52  0.58
  434   69 P   0   0   0   0   0   0   0   3   8   0  48   1   3   1   1   3   4   0  22   6   144   24    5   1.659     55  0.36
  435   70 P   0   1   0   1   1   0   0  38   1   0   3   0   0   0  55   0   1   1   0   0   120    0    0   1.028     34  0.15
  436   71 P   0   1   0   0   0   0   0   1   0   0   1   0   0   0   0  95   2   0   0   1   123    0    0   0.271      9  0.88
  437   72 P   1   2   2  92   0   0   0   0   0   1   0   1   0   0   0   2   0   0   0   0   124    0    0   0.417     13  0.86
  438   73 P   2   0   0   1   0   0   0   1   0   0  53  36   1   0   1   0   2   3   2   1   131    1    0   1.190     39  0.34
  439   74 P  21  33  24  12   1   0   0   1   5   0   1   1   0   0   0   1   0   1   0   1   130    0    0   1.696     56  0.46
  440   75 P   0   1   0   2   0   0   0   0   1   2   1   0   0   0   2  30  61   0   0   1   130    0    0   1.052     35  0.47
  441   76 P   1   2   0   0   0   0   0   0   0   0   0   1   0   0   3   0   1  87   1   4   134    0    0   0.626     20  0.74
  442   77 P   0   5   1   2  19   0  58   3   1   0   1   1   1   0   0   1   3   2   0   3   146    0    0   1.487     49  0.43
  443   78 P   0   1   1   3   0   0   1   5  18   0   1   2   1   0   0   1   1  50   8   9   154    0    0   1.681     56  0.38
  444   79 P   5  42   3  29   0   0   3   1   3   5   0   3   0   0   1   1   1   3   1   1   155    0    0   1.763     58  0.42
  445   80 P   1  14  41  18   1   0   1   0   1   0   3   1   0   0   1   2   1  12   1   3   157    0    0   1.815     60  0.27
  446   81 P   0   8   1   2   3   0   0   3   2   0   0   2   0  30   0   8  11   5  22   4   158    1    0   2.083     69  0.20
  447   82 P   0   1   3   1   0   0   0   2   7   1   3   0   0   0   3  14  13  36   6  11   157    0    0   2.024     67  0.34
  448   83 P   1   2   0   0   1   0   0   4   1   0   1   0   0   0   0   3   2  41   5  40   169   20    0   1.392     46  0.61
  449   84 P   0  19   0   1   0   0   0   1   1   0   1   0   0   0   1  31  21  19   0   5   149    0    0   1.686     56  0.19
  450   85 P   0   6   1  11   2   0   0   3   0   0   1   0   0   0   0   0   0  39   1  36   150    0    0   1.466     48  0.32
  451   86 P   2   1   0   0   0   0   0   0   1   0   8   1   0   0   0   0   1   2   1  83   169    1    0   0.736     24  0.69
  452   87 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0  85   1  14   168    0    0   0.470     15  0.88
  453   88 P   0   0   0   0   0   0   0   8   4   1   5   2   0   1   4   3   2  35  20  15   169    0    0   1.916     63  0.40
  454   89 P   1   1   0   0  52   0   1   0   0   0   4   0  40   0   0   0   0   2   0   0   170    0    0   1.002     33  0.28
  455   90 P   1  97   1   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.161      5  0.98
  456   91 P   0   7   0   1   0   0   0   0   1   0   0   1   0   1  33  12  44   0   0   1   170    0    0   1.368     45  0.36
  457   92 P   0   0   0   1   0   2   0   0   1   0   1   0   0   4   9  38  36   8   1   0   170    0    0   1.492     49  0.40
  458   93 P   0   0   2   0   1   0  96   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.175      5  0.94
  459   94 P   0   0   0   2   0   0   0   0   1   0   1   0   0   0  81   0  15   0   1   0   170    0    0   0.645     21  0.68
  460   95 P   1   2   0   4   0   0   0   0   0   0   0   0   0   0  28  56   5   4   1   0   170    0    0   1.203     40  0.56
  461   96 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0  11   8  78   3   1   0   170    0    0   0.787     26  0.69
  462   97 P   0   0   0   0   0   0   0   0   0   0   1   0  43   0  56   1   0   0   0   0   170    0    0   0.749     24  0.27
  463   98 P   0   4   8  88   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.434     14  0.89
  464   99 P   1   1   0   1   0   0   0   0   9   0   0   0   0   1   2   4  45  34   1   2   170    0    0   1.431     47  0.46
  465  100 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   4  64   1  31   170    0    0   0.810     27  0.79
  466  101 P   0   6   0  94   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.240      8  0.98
  467  102 P   0  13   2   4   0   0   0   1   0   0   0   0   0  44  31   4   2   0   0   0   170    0    0   1.429     47  0.26
  468  103 P   0   1   1   1   0   0   0   0   8   0   2   0   0   0  15   2  54  11   2   5   170    0    0   1.536     51  0.41
  469  104 P   0   1   0   1   0   0   0   0   2   0   1   0   0   1  16  37  41   1   1   0   170    0    0   1.305     43  0.44
  470  105 P   3  74   2   1   4   0   1   0   2   0   1  10   1   0   0   0   0   0   1   0   170    0    0   1.059     35  0.56
  471  106 P   0   0   0   0   0   0   5   9   4   0  44   1   5  21   0   0   4   5   3   1   170    2    0   1.757     58  0.21
  472  107 P   0   1   0   0  44   0   0   2   1   1  11   1   0   8   7  21   2   1   1   0   168    2    3   1.714     57  0.00
  473  108 P   1   3   1   0   1   0   0  76   1   1   1   0   0   5   2   4   1   0   4   0   168   10    8   1.074     35  0.48
  474  109 P   1   1   1   0   0   0   0   0   1  75   0   0   0   1   1   6  13   0   0   0   160    0    0   0.932     31  0.58
  475  110 P   1   1   0   0   0   0   1   1   0   0   2   2   1   1  38  18  36   1   0   0   165    0    0   1.449     48  0.38
  476  111 P   0   0   1   0  69   0  30   0   0   0   0   0   0   0   0   0   0   0   0   0   166    0    0   0.673     22  0.95
  477  112 P   0   0   0   0   0   0   0  52   2   0   1   1   0   0   4  22   1  15   1   3   170    0    0   1.383     46  0.39
  478  113 P   1   0   0   0  26   0   4   8   0   0   5   2   2   2   2  15  31   2   0   1   170    0    0   1.930     64 -0.03
  479  114 P  87  11   1   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   170    5    2   0.448     14  0.87
  480  115 P   4   2   8   2  30   0  32   0   0   0   2   1   4   9   1   0   6   0   0   0   165    0    0   1.883     62  0.32
  481  116 P   1   1   0   0   1   0   1   0   0   0   1   3   1   1   1   0   7  66   1  15   170    0    0   1.232     41  0.59
  482  117 P   0  66  27   2   0   0   0   0   0   0   0   1   0   0   1   0   0   1   1   1   170    0    0   0.909     30  0.68
  483  118 P   0   5   0   0   0   0   0   1   2  15   9  10   0   0   1   3   5  36   3   9   170    0    0   1.991     66  0.25
  484  119 P   1   0   0   0   0   0   0   1   0   0  57  27   0   1   1   0   0   1  10   2   170    1    0   1.165     38  0.47
  485  120 P   0   0   0   0   0   0   0  81   2   0   2   2   0   8   1   4   1   0   0   0   169    0    0   0.801     26  0.60
  486  121 P   1   0   0   0   0   0   0   2   0   1   2   1   0   0   0   3   2  81   1   8   170    0    0   0.821     27  0.77
  487  122 P   0   0   0   0   0   0   0  19  21   0   0   1   0   0   1   0  35  16   3   5   170    0    0   1.641     54  0.38
  488  123 P   0   1   0   1  96   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.183      6  0.98
  489  124 P   5  94   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.243      8  0.94
  490  125 P   1   0   0   0   0   0   0   0   4   0   5   0   0   0   1   1   4  51   1  32   170    0    0   1.303     43  0.58
  491  126 P  16   0   0  19   0   0   0   0  25   0   1  28   8   0   0   0   0   3   0   0   170    0    0   1.646     54  0.24
  492  127 P  20   4  76   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.645     21  0.87
  493  128 P   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0  55   0  45   170    0    0   0.720     24  0.80
  494  129 P   1   0   0   0   0   0   0   2   0   0   2   0   0   0   2  78   7   4   5   0   170    4    0   0.920     30  0.65
  495  130 P   0   0   0   0   0   0   0   1   0   0   0   1   0   0   0   0   0  97   0   1   166    0    0   0.167      5  0.95
  496  131 P   0   4   0   0   0   0   0   1   0   2   1   0   2  20   6   5  37   1  11  10   170    0    0   1.911     63  0.34
  497  132 P   1   0   0   1   0   0   1   0   1   2   1   1   0   5  12  76   0   0   0   0   170    0    0   0.935     31  0.66
  498  133 P   3   8  21   0   1   0   1   4   0   0  37   7   0   8   0   2   1   1   8   1   170    0    0   1.935     64  0.12
  499  134 P  14   0   5   0   0   0   0   0   4   0   0  78   0   0   0   0   0   0   0   0   170    1    0   0.741     24  0.64
  500  135 P  13  34   1   1   0   0   0   0   0   1   0  50   0   0   1   0   0   0   0   0   169    0    0   1.123     37  0.38
  501  136 P  38   2  60   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.762     25  0.84
  502  137 P  41   5  27  26   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   1.245     41  0.64
  503  138 P  72   0  28   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.595     19  0.87
  504  139 P   0   1   0   0   1   0   0   0   0   0   0   0   0  96   0   0   0   0   3   0   170    0    0   0.204      6  0.93
  505  140 P   1   1  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.128      4  0.98
  506  141 P   0   0   0   0   1   0  98   0   0   0   0   0   0   0   0   0   0   1   0   0   170    0    0   0.100      3  0.98
  507  142 P   0   0   0   0   0   0   0   1   2   0   1   0   0   0   1   9   4  81   1   2   170    0    0   0.805     26  0.73
  508  143 P   4   0   1   0   0   0   0   0   0   5   1   0   0   4   7   1   4   7   5  63   170    0    0   1.442     48  0.49
  509  144 P   1   0   0   0   1   0   1  62   2   0   3   1   0   1   0   2   3   3   7  14   170    0    0   1.413     47  0.52
  510  145 P  32   7  54   1   0   0   1   0   1   0   0   1   0   0   0   0   2   0   1   1   170    0    0   1.205     40  0.66
  511  146 P   0   1   1   0   0   0   0   1   3  38   6   1   0   1   3  39   2   2   0   3   170    0    0   1.550     51  0.28
  512  147 P   0   0   0   0   0   0   0  81  15   2   1   1   0   0   0   0   0   0   0   1   170    0    0   0.635     21  0.77
  513  148 P   0   0   0   0   0   0   0   0   4   0   2  19  75   0   0   0   0   0   1   0   170    0    0   0.765     25  0.64
  514  149 P   2   0   1   0   0   0   0   0   5   0   3   2   0   0   2   2   2  51   1  29   170    0    0   1.418     47  0.53
  515  150 P   1   1   1   0   0   0   0   0  65   1   6  12   0   0   0   2   5   4   1   0   170    0    0   1.294     43  0.49
  516  151 P   3  52   0  44   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.834     27  0.88
  517  152 P   0   0   0   0   0   0   0   0   0   0   4   0   0   5   0   0   0   0  87   5   170    0    0   0.526     17  0.84
  518  153 P   1   0   0   0   0   0   0  41   0   0  38   1   0   1   1   6   1   1   9   2   170    0    0   1.406     46  0.43
  519  154 P   2   0   0   0   0   0   1   1   1   0  36   0  59   0   0   0   0   0   0   0   170    0    0   0.878     29  0.65
  520  155 P   0  69   2  25   5   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.818     27  0.90
  521  156 P   2   4  27   4   0   0   0   0   4   0   2  25   2   1   1   2   4   4   2  19   170    0    0   2.054     68  0.14
  522  157 P   2   0   1   0   0   0   1   0   1   0   9   3  78   0   0   1   2   1   0   0   170    0    0   0.917     30  0.61
  523  158 P   2  96   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.175      5  0.96
  524  159 P   0   0   0   0   1   0   0   0  95   0   2   0   2   0   0   0   0   0   0   0   170    0    0   0.236      7  0.90
  525  160 P   3   2   2   0   0   0   0   4  48   0   8  15   0   1   1   4   8   4   1   0   170    0    0   1.788     59  0.33
  526  161 P   0   0   1   0   0   0   0   0   0   0   1   1   0   0   0   4   5  81   1   7   170    0    0   0.783     26  0.76
  527  162 P   0   0   0   0   1   0  98   0   0   0   0   0   1   1   0   0   0   0   0   0   170    0    0   0.136      4  0.97
  528  163 P   0   1   0   0   0   0   0   0   4  81   8   3   0   0   1   1   1   1   1   0   170    0    0   0.813     27  0.71
  529  164 P   1   4   7  18   1   0   1   2  20   0  11  23   0   2   1   1   5   0   4   1   170    0    0   2.191     73  0.14
  530  165 P  89   1   8   1   1   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   170    0    0   0.440     14  0.91
  531  166 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   3  97   0   0   0   0   170    0    0   0.133      4  0.97
  532  167 P   0   2   0   0  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.111      3  0.99
  533  168 P   0   0   0   0   0   0   0   0  10   0   0   0  90   0   0   0   0   0   0   0   170    0    0   0.325     10  0.82
  534  169 P   0   0   1   0   0   0   0   0   2   0   4   0   1   0  48  45   0   0   0   0   170    0    0   0.983     32  0.62
  535  170 P  36   1  59   1   2   0   0   0   1   0   0   0   0   0   0   0   0   0   0   1   170    0    0   0.891     29  0.79
  536  171 P   1   4   2   1   0   0   0   0   1   0   1   0   9   0  15  53   1   2   1  10   170    0    0   1.587     52  0.27
  537  172 P   1   0   0   0   0   0   0   6  52   0  41   0   1   0   0   0   0   0   0   0   170    0    0   0.932     31  0.53
  538  173 P   9   1   0   0   0   0   0   0   1   1  83   1   2   0   0   0   0   1   0   1   170    0    0   0.727     24  0.70
  539  174 P  31   7   2   0   0   1   0   0  16   0   6   1   0   1   1   2   0   2  25   7   170    0    0   1.895     63  0.14
  540  175 P   2   3  29   0   0   1   0   0  20   0   6  38   0   0   0   0   0   0   0   0   170    0    0   1.449     48  0.27
  541  176 P   0   0   0   0   0   0   0  88   1   0   5   0   0   1   1   2   2   0   0   1   169    0    0   0.559     18  0.78
  542  177 P   4   8   1  11   0   0   0   0  68   1   0   8   0   0   0   0   0   0   0   0   170    1    0   1.099     36  0.44
  543  178 P   0   1   0   0   0   0   0  31   7   0  58   0   0   0   1   0   1   1   0   0   169    0    0   1.054     35  0.57
  544  179 P   0   1   0   1   0   0   1   1   8   1  20   4   0   1  13   4   1  13   1  31   169    0    0   1.992     66  0.22
  545  180 P   0   6   0   1   1   0   0   0   0   0   1   4   0   4  70   1   4   2   2   7   169    0    0   1.255     41  0.42
  546  181 P   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   169    0    0   0.000      0  1.00
  547  182 P   1   0   0   0   0   0   0   0   1   1  46  27   3   0  13   7   0   2   0   0   169    0    0   1.451     48  0.30
  548  183 P   1   8   1   1   0   0   0   1   3   2  24  11   0   0  21   3   0   7   6  13   169    0    1   2.153     71  0.15
  549  184 P   0   0   0   0   2   0   1   1   1   0   8   0   1   0   1  12   0  14  28  30   169    0    0   1.762     58  0.33
  550  185 P  41   0   0   0   0   0   3  23  33   0   0   0   0   0   0   0   0   0   0   0   169    0    0   1.174     39  0.34
  551  186 P  11  88   1   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   170    0    0   0.421     14  0.87
  552  187 P   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   170    0    0   0.000      0  1.00
  553  188 P   0   0   0   0   0   0   0   0  57   0   1  42   0   0   0   0   0   0   0   0   170    0    0   0.714     23  0.57
  554  189 P   0  98   2   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.125      4  0.98
  555  190 P   1  96   0   0   0   0   0   0   0   0   0   0   0   0   0   0   3   0   0   0   170    0    0   0.196      6  0.90
  556  191 P  64   2  31   1   0   0   0   0   3   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.852     28  0.80
  557  192 P   0   0   0   0   0   0  99   0   0   0   0   0   1   0   0   0   0   0   0   0   170    0    0   0.036      1  1.00
  558  193 P   0   0   0   0   0   0   2   0   0   0   0   0   0   0   4  94   0   0   0   0   170    0    0   0.282      9  0.87
  559  194 P   0   0   0   0   0   0   0  55  32   0   2   0   0   0   1   1   0   1   8   0   170    0    0   1.098     36  0.58
  560  195 P   0   0   0   0   0   0   0  88   0   0   0   0   0   0   0   1   7   0   1   2   170    0    0   0.490     16  0.78
  561  196 P   1   0   0   0   0   0   0   0   9   0   1   1   0   0   0   0   8  72   2   6   170    0    0   1.022     34  0.64
  562  197 P   7  85   4   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.572     19  0.88
  563  198 P  12  20  68   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.834     27  0.79
  564  199 P   0   1   0   0   0   0   0  71   1   0  28   0   0   0   0   0   0   0   0   0   170    0    0   0.663     22  0.70
  565  200 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   170    0    0   0.000      0  1.00
  566  201 P   0   2   0   1  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   170    0    0   0.125      4  0.98
  567  202 P  52  18  30   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   168    0    0   1.010     33  0.75
  568  203 P   0   0   0   0   0   0   0   0  10   0  32   0   2   3  47   3   1   0   2   0   168    0    0   1.352     45  0.28
  569  204 P  58  17  17   1   1   0   0   0   0   0   0   0   7   0   0   0   0   0   0   0   168    0    0   1.181     39  0.65
  570  205 P   1   0   1   0   0   0   0   0  17   0   8  73   0   0   0   0   0   0   0   1   168    0    0   0.852     28  0.64
  571  206 P   0   0   0   0   0   0   0   0   0   0   0   1   0   0   1   6  10  28   2  54   168    0    0   1.215     40  0.65
  572  207 P   1   0   0   0   0   0   1   0   0   0   0   2   0  20   1   0  58   5   1  13   168    0    0   1.255     41  0.56
  573  208 P   0  64   0   2  34   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   168    0    0   0.743     24  0.89
  574  209 P   0   0   0   0   0   0   0  47  21   0  15   3   0   0   1   0   0   0  13   1   168    0    1   1.394     46  0.49
  575  210 P   1   1   1   1   0   0   0   0   0   0   0   1   0   0   0   0   0  72   2  20   168    0    0   0.890     29  0.72
  576  211 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  45   2  53   168    0    0   0.799     26  0.78
  577  212 P   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   168    0    0   0.000      0  1.00
  578  213 P   0   1   0   0  86   0   7   0   0   0   1   2   1   0   0   0   1   1   1   1   168    1    0   0.658     21  0.75
  579  214 P   1   0   0   0   1   0   1   0  86   1   4   7   0   0   0   0   0   1   0   0   167    0    0   0.629     21  0.76
  580  215 P  38   1   0   0   0   0   0  24   2   0  16  16   0   0   0   0   0   2   1   1   167    0    0   1.553     51  0.28
  581  216 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   2   1   1  96   167    0    0   0.186      6  0.95
  582  217 P  68  31   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   167    0    0   0.699     23  0.77
  583  218 P   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  96   0   0   167    0    0   0.178      5  0.91
  584  219 P   0   0   0   1   0   0   0   5  45   0  42   1   1   0   1   1   0   0   4   0   167    0    0   1.200     40  0.48
  585  220 P   0   4   0   0  94   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   168    0    0   0.262      8  0.98
  586  221 P   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   168    0    0   0.000      0  1.00
  587  222 P   6   0  15   0   0   0   2   0   0   0   0   0   1   4   1   1  30   0  42   0   168    0    0   1.476     49  0.18
  588  223 P   0   0   0   0   0   0   0   0   2   0   8   0   0   0   0   0   1  89   0   0   168    0    0   0.446     14  0.82
  589  224 P   0   0   0   0  19   0  52   0   1   0   0   0   8  18   1   0   0   0   2   0   165    0    0   1.323     44  0.52
  590  225 P   0   0   0   0   0   0   0  95   1   0   2   0   0   0   0   0   0   0   0   2   165    0    0   0.241      8  0.93
  591  226 P   1  78  13   5   3   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   165    0    0   0.780     26  0.81
  592  227 P   0  92   8   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.281      9  0.91
  593  228 P   7   1   1   0   0   0   0   0   1  86   1   1   0   0   1   0   0   1   1   0   161    0    0   0.647     21  0.69
  594  229 P   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   1  75   1  22   159    0    0   0.664     22  0.82
  595  230 P   0   0   0   0   0   0   0   0   0   0   0   0   0   0  31  67   1   0   1   0   158    0    0   0.718     23  0.75
## INSERTION LIST
 AliNo  IPOS  JPOS   Len Sequence
    53    64    65     1 gTd
    72   202   203    27 gACDASAKLWDVREGMCRQTXXRLFVSGa
   135    64    65     4 gSDSNs
   141   431    37    30 sEDSDSVAPSKKEILRQMSSPQSRDDKDSKEr
   148   431    37    30 sEDSDSVAHSKKEILRQMSSPQSRDDKDSKEr
   161   431    40    30 sEDSDSVAPSKKEILRQMSSPQSRDDKDSKEr
   179   431    38    30 sEDSDSFPPSKKDILRKMSSPQSRDDKDSKEr
   189   431    32    30 sEDSDSFPPSKKDILRKMSSPQSRDDKDSKEr
   199    20    21    13 nLRKKFFIVMSNDNl
   203   431    42    30 sEDSDSIPPCKKEILKQMSSPQSRDDKDSKEr
   206   431    37    30 sEDSDSIPPSKKEILRQMSSPQSRDDKESNEr
   209   431    37    30 sEDSDSVPSSKKEILRQMSSPQSRDDKDSKEk
   210   431    37    30 sEDSDSIPPCKKEILKQMSSPQSRDDKDSKEr
   211   423    17    30 sEDGDSVPPSKKEILRQMSSPQNRDDKDAKEr
   215   431    39    30 sEDGDSVPPSKKEILRQMSSPQNRDDKDAKEr
   216   431    37    30 sEDSNSIPPNKKEILRQMSSPQSRDDKDSKEr
   219   423    17    30 sEDRDSIPPSKKEILRQMSSPHDRNNKDLKEr
   220   431    37    30 sEDSDSVPPSKKEILRQMSSPQNRDDKDSKEr
   221   431    37    30 sEDSDSVPPSKKEILRQMSSPQSRDNKDSKEr
   223   431    37    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   224   431    45    30 sEDSDSTPPSKKEILRQMSSPQSRNSKDSKEr
   225   431    45    30 sEDTDSVPPSKKEILRQMSSPQTRDDRDPKEr
   226   431    37    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   227   415    29     1 tAg
   227   431    46    30 sEDSDSVPPSKKEILRQMSSPQSKDDKDAKDr
   228    64    65     1 gYd
   228    84    86    23 gLMASFPELLPVCSSLCLVSSSACl
   229   423    17    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   230   431    45    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   231   431    37    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   232   431    37    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   233   431    37    28 sEESESIPPSKKEILRQMSSPQSRNDSKEr
   235   431    44    29 sEYSESIPPSKKEILRQMSSQSKDDKDSKEr
   236   431    37    30 sEDSESVPPSKKEILRQMSSPQSRDDKDSKDr
   238   431    37    30 sEDNDSVPPSKKEILRQMSSPQSRDDRDSKEr
   239   431    37    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   240   431    37    28 sEDGDSIPPSKKEILRQMSSPQSRDDSKEr
   241    20    21    13 aRRQESVWRLNPDTv
   241    24    38     2 gTLl
   241   144   160    23 gEPSSLVPGDPSPEGGLTGFWVSGy
   242   431    74    30 sQDSDSIPPSKKEILRQMSSPQSRNGKDSKEr
   245   431    37    30 sEDGDSIPPSKKEILRQMSSPQSRDDKDSKEr
   246   144   145    19 gRHRFRGAEEDQRTDTGAKGy
   247   431    44    30 sEDNDSVPPNKKEILRQMSSPQCRDDKDTKEr
   248   431    45    29 sEDSDSIPSSKKEILRQMSSPQYRDDNTKQk
   251    64    65     4 gCDSNg
   289    20    21     6 vSPDPPAa
   290    17    32     1 eSs
   291    17    33     1 eSs
   291   125   142     1 nNv
   292    17    32     1 eSs
   292   125   141     1 nSv
   293    23    29     1 dQl
   294    23    29     1 dQl
   296    22    32     1 eQt
   297    20    22     3 aDRDs
   297   194   199     2 nPNt
   298    17    32     1 dQm
   298   125   141     1 hNi
   299    17    32     1 dQm
   299   125   141     1 nNi
   300    17    32     1 dQm
   300   125   141     1 nNi
   301    17    32     1 eSs
   301   125   141     1 tNl
   302    17    32     1 dQm
   302   125   141     1 hNi
   303    23    33     1 dEl
   303    35    46     1 nQt
   303   196   208     1 qNv
   305    21    31     1 dAa
   305   129   140     1 gGn
   307    23    34     1 dEl
   307    35    47     1 nNt
   307   196   209     1 qNv
   307   336   350     2 rCYi
   308    23    25     1 dEl
   308    35    38     1 nNt
   308   196   200     1 nNv
   309    23    34     1 dEl
   309    35    47     1 nNt
   309   196   209     1 nNv
   310    23    34     1 dEl
   310    35    47     1 nQt
   310   196   209     1 qNi
   311    21    28     1 eEl
   311    33    41     1 eTl
   311   194   203     1 qNi
   312   431    37    33 sEDKDSLPLSKKEILRQMSSPHRSFSKDDKDTREr
   313    21    32     1 dQm
   313   129   141     1 nNi
   314    23    30     1 dEl
   314    35    43     1 nNt
   314   196   205     1 nNi
   315   130   141     1 nGv
   316   130   141     1 nGv
   319    23    33     1 dEl
   319    35    46     1 nQt
   319   196   208     1 qNv
   321    23    34     1 dEl
   321    35    47     1 qHt
   321   196   209     1 aNv
   322    23    30     1 dEl
   322    35    43     1 nNt
   322   196   205     1 nNi
   323    21    38     1 eTs
   323   129   147     1 gTn
   323   133   152     1 gAr
   323   194   214     1 nNv
   324    21    38     1 eTs
   324   129   147     1 gTn
   324   133   152     1 gAr
   324   194   214     1 nNv
   325    23    34     1 eEl
   325    35    47     1 sQt
   325   196   209     1 qNv
   326    23    33     1 eSs
   326   131   142     1 nNv
   327    23    33     1 dDl
   327    35    46     1 nQt
   327   196   208     1 qNi
   328    23    34     1 dEl
   328    35    47     1 nNt
   328   196   209     1 qNv
   329    23    34     1 dEl
   329    35    47     1 nQt
   329   196   209     1 qNi
   330    23    34     1 dEl
   330    35    47     1 nNt
   330   196   209     1 nNv
   331    23    34     1 dEl
   331    35    47     1 nQt
   331   196   209     1 qNi
   331   336   350     1 sAl
   332    21    32     1 dEl
   332    33    45     1 qRt
   332   194   207     1 nNq
   333    23    34     1 dEl
   333    35    47     1 nNt
   333   196   209     1 nNv
   334    23    34     1 dEl
   334    35    47     1 nNt
   334   196   209     1 nNv
   335    23    30     1 dEl
   335    35    43     1 nNt
   335   196   205     1 nNi
   336    23    34     1 dEl
   336    35    47     1 nNt
   336   196   209     1 nNv
   337    23    34     1 dEl
   337    35    47     1 nNt
   337   196   209     1 nNv
   338   431    40    29 sEDSDSVPSKKEILRQLSSPHRRDNKDSREr
   339   423    17    33 sEDKDSLPLSKKEILRQMSSPHRSFSKDDKDTREr
   340    21    29     1 dEl
   340    33    42     1 eQv
   340   194   204     1 sNi
   342    21    32     1 eSt
   342   129   141     1 tGn
   343    23    33     1 dEl
   343    35    46     1 nQt
   343   196   208     1 qNi
   344    23    33     1 dEl
   344    35    46     1 nQt
   344   196   208     1 qNi
   345    22    33     1 dEl
   345    34    46     1 qRt
   345   195   208     1 nNq
   348    21    32     1 eQt
   348   129   141     1 tNg
   348   133   146     1 nVk
   349   431    37    33 sEDRDSLPLSKKEILRQMSSPHRSLSKDDKDTREr
   350    23    34     1 dEl
   350    35    47     1 nQt
   350   196   209     1 qNi
   350   336   350     1 sAl
   351   424    18    33 sEDRDSLPLSKKEILRQMSSPHRSFSKDDKDTRDr
   352    23    38     1 dEl
   352    35    51     1 qAh
   352    43    60     1 qLm
   352   127   145     1 qQr
   352   196   215     1 sNt
   354    23    37     1 dDl
   354    35    50     1 aQq
   354    43    59     1 qMm
   354   127   144     1 sNr
   354   196   214     1 qNt
   355    21    30     1 eAt
   355   128   138     2 gGIg
   355   129   141     1 gSv
   356    23    38     1 dEl
   356    35    51     1 qAh
   356    43    60     1 qLm
   356   127   145     1 qQr
   356   196   215     1 sNt
   357    23    38     1 dEl
   357    35    51     1 qAh
   357    43    60     1 qLm
   357   127   145     1 qQr
   357   196   215     1 sNt
   358   431    37    33 sEDRDSLPLSKKEILRQMSSPHRSFSKEDKDTREr
   360    22    33     1 dEl
   360    34    46     1 qRt
   360   195   208     1 nNq
   361    23    32     1 dEl
   361    35    45     1 rQt
   361   196   207     1 nNq
   362    23    37     1 dDl
   362    35    50     1 aQq
   362    43    59     1 qMm
   362   127   144     1 sNr
   362   196   214     1 qNt
   364    23    38     1 eEl
   364    35    51     1 qAh
   364    43    60     1 qLm
   364   127   145     1 qSr
   364   196   215     1 qNt
   365    23    38     1 dEl
   365    35    51     1 qAh
   365    43    60     1 qLm
   365   127   145     1 qQr
   365   196   215     1 qNt
   366    23    38     1 dDl
   366    35    51     1 qAh
   366    43    60     1 qLm
   366   127   145     1 qQr
   366   196   215     1 qNt
   367    23    38     1 dEl
   367    35    51     1 qAh
   367    43    60     1 qLm
   367   127   145     1 qQr
   367   196   215     1 qNt
   368    23    38     1 dEl
   368    35    51     1 qAh
   368    43    60     1 qLm
   368   127   145     1 qQr
   368   196   215     1 qNt
   369    22    30     1 dEl
   369    34    43     1 dRv
   369   195   205     1 hNq
   370    22    33     1 dEl
   370    34    46     1 dRv
   370   195   208     1 nNq
   371    43    49     1 lEn
   371    44    51     1 nKi
   372    23    38     1 dDl
   372    35    51     1 qAh
   372    43    60     1 qLm
   372   127   145     1 qQr
   372   196   215     1 qNt
   373    23    37     1 dEl
   373    35    50     1 qAh
   373    43    59     1 qLm
   373   127   144     1 qQr
   373   196   214     1 qNt
   374    43    49     1 mEg
   374    44    51     1 gKi
   375   428    38    34 aKDRDALPLSKKEILIRQMSSPHRAHSKDDKDTREr
   376    23    38     1 dDl
   376    35    51     1 qAh
   376    43    60     1 qLm
   376   127   145     1 qQr
   376   196   215     1 qNt
   377    22    33     1 dEl
   377    34    46     1 dRv
   377   195   208     1 hNq
   378    23    38     1 dEl
   378    35    51     1 qAh
   378    43    60     1 qLm
   378   127   145     1 qNr
   378   196   215     1 qNt
   379    23    38     1 dEl
   379    35    51     1 qAh
   379    43    60     1 qLm
   379   127   145     1 qQr
   379   196   215     1 qNt
   380    23    38     1 dDl
   380    35    51     1 qAh
   380    43    60     1 qLm
   380   127   145     1 qQr
   380   196   215     1 qNt
   381    23    38     1 dDl
   381    35    51     1 qAh
   381    43    60     1 qLm
   381   127   145     1 qQr
   381   196   215     1 qNt
   382    23    38     1 dEl
   382    35    51     1 qAh
   382    43    60     1 qLm
   382   127   145     1 qNr
   382   196   215     1 qNt
   384    22    33     1 dEl
   384    34    46     1 dRv
   384   195   208     1 hNq
   385    23    83     1 dEl
   385    35    96     1 qAh
   385    43   105     1 qLm
   385   127   190     1 qNr
   385   196   260     1 qNt
   386    23    38     1 dEl
   386    35    51     1 hSh
   386    43    60     1 qLm
   386   127   145     1 qNr
   386   196   215     1 qNt
   387    23    34     1 dEl
   387    35    47     1 aQq
   387    43    56     1 qMm
   387   127   141     1 sNr
   387   196   211     1 qNt
   387   336   352     2 sQNm
   388    23    38     1 dEl
   388    35    51     1 qAh
   388    43    60     1 qLm
   388   127   145     1 qQr
   388   196   215     1 sNt
   389    22    33     1 dEl
   389    34    46     1 dRv
   389   195   208     1 hNq
   390   128   133     8 gAGPGAPGAp
   391    23    38     1 dDl
   391    35    51     1 qAh
   391    43    60     1 qLm
   391   127   145     1 qQr
   391   196   215     1 qNt
   392    23    38     1 dDl
   392    35    51     1 qAh
   392    43    60     1 qLm
   392   127   145     1 qQr
   392   196   215     1 qNt
   393    22    33     1 dEl
   393    34    46     1 dRv
   393   195   208     1 hNq
   394    23    38     1 dEl
   394    35    51     1 qAh
   394    43    60     1 qLm
   394   127   145     1 qNr
   394   196   215     1 qNt
   395    23    38     1 dEl
   395    35    51     1 qAh
   395    43    60     1 qMm
   395   127   145     1 qNr
   395   196   215     1 qNt
   396    23    38     1 dDl
   396    35    51     1 qAh
   396    43    60     1 qLm
   396   127   145     1 qQr
   396   196   215     1 qNt
   397    22    33     1 dEl
   397    34    46     1 dRv
   397   195   208     1 hNq
   399    23    41     1 dEl
   399    35    54     1 qAh
   399    43    63     1 qLm
   399   127   148     1 qNr
   399   196   218     1 qNt
   402    23    37     1 eGl
   402    35    50     1 qAh
   402    43    59     1 nMm
   402   127   144     1 sNr
   402   196   214     1 qNt
   405    23    37     1 eGl
   405    35    50     1 qAh
   405    43    59     1 nMm
   405   127   144     1 sNr
   405   196   214     1 qNt
   406    23    37     1 eGl
   406    35    50     1 qAh
   406    43    59     1 nMm
   406   127   144     1 sNr
   406   196   214     1 qNt
   407    23    38     1 eEl
   407    35    51     1 qAh
   407    43    60     1 qLm
   407   127   145     1 qNr
   407   196   215     1 qNt
   409    23    38     1 eEl
   409    35    51     1 qAh
   409    43    60     1 qLm
   409   127   145     1 qSr
   409   196   215     1 qNt
   410    23    25     1 dEl
   410    35    38     1 qAh
   410    42    46     1 nQl
   410   127   132     1 qNr
   410   196   202     1 qNt
   416    23    25     1 eEl
   416    35    38     1 qAh
   416    43    47     1 qLm
   416   127   132     1 qSr
   416   196   202     1 qNt
   418    23    37     1 eGl
   418    35    50     1 qAh
   418    43    59     1 nMm
   418   127   144     1 sNr
   418   196   214     1 qNt
   419   415    21     5 tGKETNw
   419   431    42    33 sEDSDSLPLSKKEMLRQMSSPHRSFSRDDKDTREr
   422   425    19    33 sEDQESIPPNKKEILRQMSSPYKPPIKDEKDTKEk
   431    22    24     1 lAl
   431    82    85     1 sYt
   431    83    87     1 tTn
   432   431    46    33 sEDHETVPSGKRELLRQMSSPYRSQSRDEKDTREr
   434   129   130     1 pVi
   438    23    31     1 eAl
   438    42    51     1 lLm
   438   195   205     1 pNi
   439   129   134     1 aSp
   440   428    38    34 sEDRNTLPVSKKEILIRQMSSPHRSNSKCSTRDRLi
   441    23    31     1 eAl
   441    42    51     1 lVm
   441   195   205     1 pNl
   442   428    41    28 sEDHESIPSNKRELLRQMSNPKSSDDPREk
   443   427    32    28 sEDHESIPSNKRELLRQMSNPKSSDDPREk
   445   129   134     1 aSp
   446   129   134     1 aSp
   447   129   134     1 aSp
   448    16    22     1 qAl
   448    54    61     4 aPTTEg
   448    57    68     1 rRr
   448   118   130     2 aTSk
   448   187   201     1 aRl
   450   125   130     1 aSp
   451   430    39    25 sVDQTVPQNKRELLRQMSSPRDDDKEr
   457    18    18     3 sNRAa
   457   123   126     3 qQDEn
   460    64    69     7 sADSRSMVs
   460   129   141     1 aSp
   461   431    38    29 sMDRENLPSAKKELLRQMSSPNKSKDDSRAn
   463   431    32    29 sMDRENLPSAKKELLRQMSSPNKSKDDSRAn
   465   430    57    25 sVDQNVPQRKRELLRQMSNPRDDDKEr
   466   431    32    29 sMDQENLNPAKRELLRQMSSPSRAKDTSRAn
   467   431    56    29 sMDQENLNPAKRELLRQMSSPSRAKDTSRAn
   468   430    32    25 sVDQTVPQKKRELLRQMSNPRDDDKEr
   469   414    15     2 tHTg
   469   430    33    26 sMDQEALPPNKREPLRQMSSPQKPKDSc
   469   433    62     3 gGLNr
   470   430    33    25 sVDQNVPQRKRELLRQMSNPRDDDKEr
   471   431    32    29 sMDQESLPAAKRELLRQMSSPSRPKDDARAn
   472   431    50    29 sMDQESLPAAKRELLRQMSSPSRPKDDARAn
   473   423    38    29 sMDQENLPTAKKELLRQMSSPNKSKDDSRGn
   474   431    36    29 sMDQENLPSAKKELLRQMSSPNKSKDDSRGs
   475   431    32    29 sMDRENLPPAKKELLRQMSSPNKSKDDSRAn
   476   431    32    29 sMDQENLPSAKKELLRQMSSPNKSKDDSRGs
   477   430    37    25 sMDQTVPQSKRELLRQMSSPREDDKEr
   478   430    39    25 sMDQTVPQSKRELLRQMSSPREDDKEr
   479    42    43     1 iPa
   479    43    45     1 aPp
   479   106   109     1 qKq
   479   129   133     1 qVm
   479   194   199     1 pSm
   479   298   304     2 sTTg
   480   431    55    29 sMDQENLPTAKKELLRQMSSPNKSKDDSRGn
   481    10    21    10 tTRAAKANGGFk
   481    88   109     1 pTr
   481   111   133     1 qVv
   481   176   199     1 lNm
   481   280   304     2 sTTg
   482   428    42    34 sEDHESIPSNKRELLRQMSNPKSSDDPREKVNRKMs
   483    43    44     1 lAp
   483   107   109     1 qKq
   483   130   133     1 qVm
   483   195   199     1 pSm
   483   299   304     2 sTSg
   484    43    49     1 sDh
   484   128   135     4 pKSSSs
   484   131   142     1 pLn
   485    20    25     3 kAQNd
   485    39    47     1 lGp
   485    40    49     1 pGl
   485   103   113     1 pTq
   485   125   136     1 sTv
   485   191   203     2 dKNv
   485   295   309     2 nSTg
   486    23    29     1 dQl
   486   127   134     6 pRRDPSEw
   487    43    49     1 sDh
   487   128   135     4 pKSSSs
   487   131   142     1 pLn
   488    43    49     1 sDh
   488   128   135     4 pKSSSs
   488   131   142     1 pLn
   489    43    49     1 sDh
   489   128   135     4 pKSSSs
   489   131   142     1 pLn
   490    20    21    10 qTREEKLDGGFe
   490    98   109     1 qNq
   490   121   133     1 qVm
   490   186   199     1 pNm
   490   290   304     2 sTSg
   495   414    38     2 tHTg
   495   430    56    34 sMDQEALPPNKRELLRQMSSPQKPKDSCVGGLNRKm
   496   414    15     2 tHTg
   496   430    33    34 sMDQEALPPNKRELLRQMSSPQKPKDSCVGGLNRKm
   497   414    39     2 tHTg
   497   430    57    34 sMDQEALPPNKRELLRQMSSPQKPKDSCVGGLNRKm
   498    43    52     1 fVm
   498   127   137     1 fDk
   498   135   146     1 kKk
   498   152   164     1 nSd
   498   196   209     2 tGNt
   500    43    94     1 fVm
   500   127   179     1 fDk
   500   135   188     1 kKk
   500   152   206     2 nSDm
   500   196   252     2 tGNt
   501   124   133     5 aVTQQLq
   501   127   141     1 sSn
   501   128   143     1 nEy
   501   193   209     1 qNv
   501   297   314     2 kGTi
   501   299   318     2 lQTl
   502    20    24    12 vEKVRIDNSKDFAt
   502    94   110     1 qTr
   502   183   200     1 pKl
   502   200   218     1 rVp
   502   287   306     2 rDGm
   502   289   310     2 nFQq
   503    19    24    12 kEKMRIDDSRSFTm
   503    93   110     1 qTr
   503   182   200     1 pKv
   503   199   218     1 rIp
   503   288   308     2 nFPq
   506   427    71     1 kQl
   506   430    75    34 tEQREEQCQEMERLVKKLSMTCRSHLDEEEDQHRQk
   506   431   110     5 kDLQEKi
   507   427    71     1 kQl
   507   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   507   431   110     5 kDLQEKi
   508   427    71     1 kQl
   508   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQRQQk
   508   431   110     5 kELQEKi
   510   427    32     1 kQl
   510   430    36    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   510   431    71     5 kDLQEKi
   511   427    71     1 kQl
   511   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   511   431   110     5 kDLQEKi
   512   427    71     1 kQl
   512   430    75    34 tEQKEEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   512   431   110     5 kDLQEKi
   513   427    71     1 kQl
   513   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   513   431   110     5 kDLQEKi
   514   427    71     1 kQl
   514   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQq
   514   431   110     5 qDLQEKi
   517   427    71     1 kQl
   517   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   517   431   110     5 kDLQEKi
   518   427    71     1 kQl
   518   430    75    34 tEQREEQCREMERLVKKLSMTCRSHLDEEEERHKQe
   518   431   110     5 eALQEKl
   519   427    71     1 kQl
   519   430    75    34 tEQREEQCREMERLVRKLSMTCRSHLDEEEGQRKQk
   519   431   110     5 kDLQEKi
   520   427    70     1 kQl
   520   430    74    34 tEQRQEQRREMERLIKKLSMTCRSHLDEETDKQKQk
   520   431   109     5 kELQEKi
   521   427    71     1 kQl
   521   430    75    34 tEQKEEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   521   431   110     5 kDLQEKi
   522   427    70     1 kQl
   522   430    74    34 tEQRQEQRREMERLIKKLSMTCRSHLDEETDKQKQk
   522   431   109     5 kELQEKi
   523   427    71     1 kQl
   523   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   523   431   110     5 kDLQEKi
   524   427    71     1 kQl
   524   430    75    34 tEQREEQCREMERLIKKLSMTCRSNLDEEEEQKKQk
   524   431   110     5 kDLQEKi
   525   427    71     1 kQl
   525   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   525   431   110     5 kDLQEKi
   526   427    71     1 kQl
   526   430    75    34 tEQKEEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   526   431   110     5 kDLQEKi
   527   427    71     1 kQl
   527   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   527   431   110     5 kDLQEKi
   528   427    70     1 kQl
   528   430    74    34 tEQRQEQRREMERLIKKLSMTCRSHLDDEADQQKQk
   528   431   109     5 kELQEKi
   529   427    71     1 kQl
   529   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   529   431   110     5 kDLQEKi
   530   427    71     1 kQl
   530   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   530   431   110     5 kDLQEKi
   531   427    71     1 kQl
   531   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   531   431   110     5 kDLQEKi
   532   427    71     1 kQl
   532   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   532   431   110     5 kDLQEKi
   533   427    71     1 kQl
   533   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEEQQKQk
   533   431   110     5 kDIQEKi
   534   427    70     1 kQl
   534   430    74    34 tEQRQEQRREMERLIKKLSMTCRSHLDEESEKQKQk
   534   431   109     5 kEIQEKi
   535   427    71     1 kQl
   535   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   535   431   110     5 kDLQEKi
   536   427  1193     1 kQl
   536   430  1197    34 tEQREEQCREMERLIKKLSVTCRSHLDEEDDKQKQk
   536   431  1232     5 kELQDKi
   536   472  1278     1 gHh
   537   427    71     1 kQl
   537   430    75    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEERQREk
   537   431   110     5 kDLQEKm
   538   427    69     1 kQl
   538   430    73    34 tEQREEQCREMERLIKKLSMTCRSHLDEEDDKQKQk
   538   431   108     5 kELQDKi
   538   472   154     1 gHh
   539   427    69     1 kQl
   539   430    73    34 tEQRDEQCREMERLIKKLSMTCRSHLDEEKDKQKQk
   539   431   108     5 kELQEKi
   540   362    39     1 dLc
   541   427    71     1 kQl
   541   430    75    34 tEQREEQCREMERLIKKLSLSCRSHLDEEEEQRKQk
   541   431   110     5 kDLQEKi
   541   547   231     1 rKn
   542   427    69     1 kQl
   542   430    73    34 tEQREEQCREMERLIKKLSMTCRSHLDEEEDKQKQk
   542   431   108     5 kELQEKi
   543   427    71     1 kQl
   543   430    75    34 tEQREEQCREMERLIKKLSLSCRSHLDEEEEQRKQk
   543   431   110     5 kDLQEKi
   544   427    71     1 kQl
   544   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   544   431   110     5 kDLQEKi
   545   427    71     1 kQl
   545   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   545   431   110     5 kDLQEKi
   546   427    71     1 kQl
   546   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   546   431   110     5 kDLQEKi
   547     8    27    13 qKRLLLLDTDMARYa
   547   107   139     3 sPTDk
   547   132   167     2 pDEd
   547   160   197     5 gGEFQSg
   547   176   218     1 sRm
   547   193   236     1 rVa
   547   248   292     3 gDTEi
   547   280   327     2 lAEa
   547   282   331     2 vLNl
   548     8    27    13 qKRLLLLDTDIAGHa
   548   107   139     3 sPTDk
   548   132   167     2 pDEd
   548   160   197     5 gGEFQSg
   548   176   218     1 sRm
   548   193   236     1 rVa
   548   248   292     3 gDNEi
   548   280   327     2 lAEv
   548   282   331     2 vLNl
   549     8    27    10 qRRLQLLDTDVa
   549    17    46     1 rTr
   549   109   139     3 sTADk
   549   134   167     2 pNEd
   549   162   197     5 gGEFQSg
   549   178   218     1 pNw
   549   195   236     1 rAa
   549   250   292     2 dGEn
   549   274   318     1 nTc
   549   282   327     2 lGEv
   549   284   331     2 vLDl
   550     8    27    13 qKRLLLLDTDVAGYa
   550   107   139     3 sPTDk
   550   132   167     2 pDEd
   550   160   197     5 gGEFQSg
   550   176   218     1 sRm
   550   193   236     1 rAa
   550   248   292     3 gDNEa
   550   280   327     2 lAKv
   550   282   331     2 vLNl
   552   427    69     1 kQl
   552   430    73    34 tEQREEQCREMERLIKKLSMTCRSHFDEEDDKQKQk
   552   431   108     5 kELQEKi
   553    43    94     1 fVm
   553   127   179     1 fDk
   553   135   188     1 kKr
   553   152   206     1 nSd
   553   196   251     2 tGNt
   553   264   321    46 sKESIIFGASSVDFSLSALRKHTHTTHARTWALKAWLLQDAHDSFPPp
   553   268   371     5 lATPGVl
   554     8    27    10 qRRLQLLDTDVa
   554    17    46     1 rTr
   554   109   139     3 sTADk
   554   134   167     2 pNEd
   554   162   197     5 gGEFQSg
   554   178   218     1 pNw
   554   195   236     1 rAa
   554   250   292     2 dGEn
   554   274   318     1 nTc
   554   282   327     2 lGEv
   554   284   331     2 vLDl
   555   128   138     1 sSs
   555   131   142     1 sSt
   555   136   148     1 sNk
   555   144   157    21 gPADTGAGTIMQQRKVVAMHTSy
   555   153   187     1 hSd
   555   197   232     2 tGNl
   556   427    69     1 kQl
   556   430    73    34 tENREEQRREMERLIKKLSMTCKSSLDEEKDKQKQk
   556   431   108     5 kDLQEKi
   557     8    27    13 qKRLSLLDTDISGYa
   557   107   139     3 sPTDk
   557   132   167     2 pDEd
   557   160   197     5 gGEFQSg
   557   176   218     1 sRm
   557   193   236     1 rVa
   557   248   292     3 sDNEi
   557   280   327     2 lAKv
   557   282   331     2 vLNi
   558     8    28    12 qRREMLLDTDVARy
   558   108   140     3 sQADr
   558   133   168     2 pDQe
   558   161   198     5 gGEFPSg
   558   177   219     1 tNm
   558   194   237     1 rIa
   558   249   293     5 nRDDNEl
   558   281   330     1 lAe
   558   283   333     2 vVLn
   558   287   339     1 nLq
   559   427    72     1 kQl
   559   430    76    34 vEQKQEQKKEMERLIKKLSMTCRSDLDLKKDKEEEk
   559   431   111     5 kKLQDKi
   560     8    27    10 qRRLQLLDTDVa
   560    17    46     1 rTr
   560   109   139     3 sTADk
   560   134   167     2 pNEd
   560   162   197     5 gGEFQSg
   560   178   218     1 pNw
   560   195   236     1 rAa
   560   250   292     2 dGEn
   560   274   318     1 nTc
   560   282   327     2 lGEv
   560   284   331     2 vLDl
   561    17    31     1 aSl
   561    29    44     1 aDf
   561    37    53     1 vFm
   561    57    74     1 aYr
   561   121   139     3 sVPDk
   561   146   167     2 pTQe
   561   174   197     5 gGDILTg
   561   190   218     1 pHv
   561   207   236     1 rTp
   561   262   292     4 aLARGp
   561   294   328     2 lAKv
   561   296   332     2 vANl
   561   300   338     1 gRd
   562     8    28    13 qRRQMLLDTDVERYs
   562   107   140     3 sQADr
   562   132   168     2 pDQe
   562   160   198     5 gGEFPSg
   562   176   219     1 sNm
   562   193   237     1 rIa
   562   248   293     5 dRNDNEl
   562   280   330     2 lAEv
   562   282   334     2 vLNl
   563     8    27    13 qKRLLLLDTDVAGYa
   563    14    46     1 kTp
   563   106   139     3 sPTEk
   563   131   167     2 pDEd
   563   159   197     5 gGEFQSg
   563   175   218     1 sRm
   563   192   236     1 rVa
   563   247   292     3 nDNEv
   563   279   327     2 lAQv
   563   281   331     1 vLd
   563   285   336     1 sLq
   564    10    31     9 qLLDTDVSGYa
   564    16    46     1 kTp
   564   108   139     3 sPIDk
   564   111   145     1 gNh
   564   132   167     2 pDEd
   564   160   197     5 gGEFQSg
   564   176   218     1 pRl
   564   193   236     1 rVa
   564   248   292     3 gDGDi
   564   280   327     2 lAKv
   564   282   331     2 vLNl
   565     8    27    13 eRRLSLLDTDIAGYa
   565   107   139     3 sPTDr
   565   132   167     2 pDEd
   565   160   197     5 gGEFQSg
   565   176   218     1 sRm
   565   193   236     1 rVa
   565   248   292     3 gDNEa
   565   280   327     2 lAKv
   565   282   331     2 vLNl
   566     8    28    13 qRRQMLLDTDVERYs
   566   107   140     3 sQADr
   566   132   168     2 pDQe
   566   160   198     5 gGEFPSg
   566   176   219     1 sNm
   566   193   237     1 rIa
   566   248   293     5 dRNDNEl
   566   280   330     1 lAe
   566   282   333     2 vVLn
   566   286   339     1 nLq
   567   427    68     1 kQl
   567   430    72    34 tEQREEQCREVEKLIKKLSMTCRSHLDEEKEQQKQk
   567   431   107     5 kDLQEKi
   568     8    27    13 qRRLSLLDTDIAGYa
   568   107   139     3 sPTDr
   568   132   167     2 pGEd
   568   160   197     5 gGEFQSg
   568   176   218     1 sKm
   568   193   236     1 rVa
   568   248   292     4 sGDNEm
   568   280   328     2 lAKv
   568   282   332     2 vLNl
   569     9    27    13 qKRLQLLDTDVSGYa
   569    15    46     1 kTp
   569   107   139     3 sPIDk
   569   110   145     1 gNh
   569   131   167     2 pDEd
   569   159   197     5 gGEFQSg
   569   175   218     1 pRl
   569   192   236     1 rVa
   569   247   292     3 gDGDi
   569   279   327     2 lAKv
   569   281   331     2 vLNl
   571     8    28    12 qRRQLLLDTDVERy
   571   108   140     3 sQVDr
   571   133   168     2 pDQe
   571   161   198     5 gGEFPSg
   571   177   219     1 tNm
   571   194   237     1 rIa
   571   249   293     5 dRNDNEl
   571   281   330     2 lAEv
   571   283   334     2 vLNl
   572     8    28    13 qRRQMLLDTDVERYs
   572   107   140     3 sQADr
   572   132   168     2 pDQe
   572   160   198     5 gGEFPSg
   572   176   219     1 tNm
   572   193   237     1 rIa
   572   248   293     5 dRNDNEl
   572   280   330     2 lAEv
   572   282   334     2 vLNl
   573   427    71     1 kQl
   573   430    75    34 tEQREEQCREMERLIKKLSMSCRSHLDEEEEQQKQk
   573   431   110     5 kDLQEKi
   574     8    27    13 qKRLSLLDTDISGYa
   574   107   139     3 sSTDr
   574   132   167     2 pDEd
   574   160   197     5 gGEFQSg
   574   176   218     1 sRm
   574   193   236     1 rVa
   574   248   292     3 sDNEi
   574   280   327     2 lAKv
   574   282   331     2 vLNl
   575     9    27    13 qKRLQLLDTDVSGYa
   575    15    46     1 kTp
   575   107   139     3 sPIDk
   575   110   145     1 gIh
   575   131   167     2 pDEd
   575   159   197     5 gGEFQSg
   575   175   218     1 pRl
   575   192   236     1 rVa
   575   247   292     3 gDGDi
   575   279   327     2 lAKv
   575   281   331     2 vLNl
   576   427  1188     1 kQl
   576   430  1192    34 tEQREEQCREVEKLIKKLSMTCRSHLDEEKEQQKQk
   576   431  1227     5 kDLQEKi
   577     8    27    13 eKRASLLDTDVAGYa
   577    14    46     1 kTp
   577   106   139     3 sLCDk
   577   131   167     2 pDEd
   577   159   197     5 gGEFQSg
   577   175   218     1 sRl
   577   192   236     1 rVa
   577   247   292     3 gDNDf
   577   279   327     2 lAKv
   577   281   331     1 vLn
   577   285   336     1 sLq
   579     8    28    13 qRRQMLLDTDVERYs
   579   107   140     3 sQADr
   579   132   168     2 pDQe
   579   160   198     5 gGEFPSg
   579   176   219     1 sNm
   579   193   237     1 rIa
   579   248   293     5 dRNDNEl
   579   280   330     2 lAEv
   579   282   334     2 vLNl
   580     8    28    12 qRRQTLLDTDVEKy
   580   108   140     3 sQADr
   580   133   168     2 pDQe
   580   161   198     5 gSEFPSg
   580   177   219     1 aNm
   580   194   237     1 rIt
   580   249   293     5 dRNDNEl
   580   281   330     1 lAe
   580   283   333     2 mVLn
   580   287   339     1 tLq
   581     9    27    13 qKRLQLLDTDVSGYa
   581    15    46     1 kTp
   581   107   139     3 sPIDk
   581   110   145     1 gIh
   581   131   167     2 pDEd
   581   159   197     5 gGEFQSg
   581   175   218     1 pKl
   581   192   236     1 rVa
   581   247   292     3 gDGDi
   581   279   327     2 lAKv
   581   281   331     2 vLNl
   582     9    27    13 qKRLQLLDTDVSGYa
   582    15    46     1 kTp
   582   107   139     3 sPIDk
   582   110   145     1 gNh
   582   131   167     2 pDEd
   582   159   197     5 gGEFQSg
   582   175   218     1 pRl
   582   192   236     1 rVa
   582   247   292     3 gDGDi
   582   279   327     2 lAKv
   582   281   331     2 vLNl
   583     8    27    13 rDRLSLLDTDIAGYa
   583   107   139     3 sPLDr
   583   132   167     2 pGEd
   583   160   197     5 lGEFQSg
   583   176   218     1 sKl
   583   193   236     1 rVa
   583   248   292     3 qDNEm
   583   280   327     2 lAKv
   583   282   331     2 vLNl
   584   427    72     1 kQl
   584   430    76    34 vEQKQEQKKEMERLIKKLSMSCRSDLDLEKDKQKQk
   584   431   111     5 kELQDKi
   585    20    34    10 dTDVAKYSAAQg
   585   115   139     3 sTADk
   585   140   167     2 pNEd
   585   168   197     5 gGEFQSg
   585   184   218     1 pTr
   585   201   236     1 rDa
   585   256   292     2 dGEn
   585   280   318     1 nTc
   585   288   327     1 lGe
   585   290   330     2 vVLd
   585   294   336     1 eLq
   586   427    72     1 kQl
   586   430    76    34 vEQKQEQKQEMERLIKKLSMTCRSDLDLEKDKDKQk
   586   431   111     5 kELKEKi
   587     8    27    13 qKRLLLLDTDVAGYa
   587    14    46     1 qTr
   587   106   139     3 sQTDk
   587   109   145     1 gNp
   587   130   167     2 pDEd
   587   158   197     5 gGEFQSg
   587   174   218     1 sRm
   587   191   236     1 rVa
   587   246   292     3 dDNEa
   587   278   327     2 lAEv
   587   280   331     2 vLDl
   588     8    28    13 qRRETLLDTDVARYs
   588   107   140     3 sQADr
   588   132   168     2 pDQe
   588   160   198     5 gGEFPSg
   588   176   219     1 tNm
   588   193   237     1 rIa
   588   248   293     5 dRNSNEl
   588   280   330     1 lAe
   588   282   333     2 vVLn
   588   286   339     1 nLq
   589   427    70     1 kQl
   589   430    74    34 vEQKQEQKREMERLIKKLSMTCRSDLDQEKDKEKQk
   589   431   109     5 kELQNKi
   590     8    27    13 eRRLSLLDTDIAGYa
   590   107   139     3 sPADr
   590   132   167     2 pDEd
   590   160   197     5 gGEFQSg
   590   176   218     1 sRm
   590   193   236     1 rVa
   590   248   292     3 gDNEa
   590   280   327     2 lAKv
   590   282   331     2 vLNl
   592   427    72     1 kQl
   592   430    76    34 vEQKQEQKKEMERLIKKLSMTCRSNLDQEKDQEKQk
   592   431   111     5 kALQEKi
   593     8    27    13 qRRQLLLDTDVAAFa
   593   107   139     3 sQVDr
   593   132   167     2 pDQe
   593   160   197     5 gGEFPSg
   593   176   218     1 sNm
   593   193   236     1 rIa
   593   248   292     5 eGDDNDv
   593   280   329     1 mAe
   593   282   332     2 vVLn
   593   286   338     1 tSq
   594    20    34    10 dTDVAKYTAAQg
   594   103   127     1 gLl
   594   115   140     3 sTADk
   594   140   168     2 pNEd
   594   168   198     5 gGEFQSg
   594   184   219     1 pTr
   594   201   237     1 rDa
   594   256   293     2 dGEn
   594   280   319     1 nTc
   594   288   328     1 lGe
   594   290   331     2 vVLd
   594   294   337     1 eLq
   599   427    72     1 kQl
   599   430    76    34 vEQKQEQKREMERLIKKLSMTCRSDLDLEKDKEQEa
   599   431   111     5 aQLQNKl
   602   427    70     1 kQl
   602   430    74    34 tEQREEQCREMERLIKKLSMTCQSHLDEEKDKQKQk
   602   431   109     5 kELQEKl
   605    43    55     1 nFn
   605    44    57     1 nNl
   605   128   142     4 qDGDFr
   605   200   218     6 dNLFVSGs
   605   263   287    31 sLLSQFQKQNHKIPKAKIPSRRHSTTDQVSTGs
   605   267   322     5 iYSSIDn
   605   299   359     1 kNe
   605   301   362     2 iVGs
   606    17    25     6 kVQKSKRe
   606    21    35     2 gSAa
   606    95   111     1 qTr
   606   181   198     1 rNv
   606   198   216     1 rAp
   606   224   243     1 nCf
   606   253   273     5 sLGESPs
   606   285   310     2 sERs
   606   287   314     2 gPAy
   607    19    61     2 kVKs
   607    40    84     1 dKi
   607    41    86     1 iNl
   607   125   171     4 rDSKVq
   607   185   235     1 sLp
   607   191   242     2 nSNl
   607   259   312    36 sLAKSMRKPKSQPTFTTGSSPTKPGYEGDISRKTSHKs
   607   263   352     5 sPSYLDn
   607   295   389     1 kAg
   609   381    53     1 gFa
   623   427    64     1 kQl
   623   430    68    34 tEQNEDQKREMEQLIKRLSMTCKSHLDEEKDKQKEk
   623   431   103     5 kELEERl
   637   427   110     1 kQl
   637   430   114    34 tERREDQAREMKRLVQRLSLSCRSHLDEEEDRRRQa
   637   431   149     5 aELREKl
   637   433   156     4 gSKLTl
   637   471   198     1 gAg
   637   472   200     2 gAPq
   656   382   136     1 gFs
   694   414    50     1 qTg
   694   427    64     1 kQl
   694   430    68    34 tERRAEQQAEKVALVKKLALTCRSELDDDDQTEGRe
   695   427    75     1 kQl
   695   430    79    34 aEKRELQEKERLQLIKKLSLTCRSALDEEKEKLNEt
   696   386    46     1 gPt
   697   427    72     1 kQl
   697   430    76    34 nEQRIEQQKEMEKLIKKLSMTCKSHLEEEADKQKQk
   697   431   111     5 kELQDKl
   698    23    55     1 gKi
   698   127   160     2 rDNr
   698   130   165     1 qQn
   698   195   231     9 gRYGHNFITGg
   698   258   303    54 sFSDGLLQQHQLQQQHHPHPHSHAYSRIQKNRYGSSSSSTSSYPIVKTPQSLNFKe
   698   262   361     1 iEd
   699   427    76     1 kQl
   699   430    80    34 aEKRESQEKERLQLINKLSLTCRSALDEEKEKLNEt
   701    16    32     2 dIHl
   701    37    55     1 gSi
   701    38    57     1 iSl
   701   132   152    14 qFYSSVSAVFKGHRAy
   701   179   213     4 sKFNHi
   701   185   223     2 dRPl
   701   253   293    29 sLASTLTSHDNQGFRSNGNISPTSVDRSSKa
   701   257   326     5 iDSNYNi
   701   289   363     2 kGQv
   701   291   367     1 vGk
   703   427    76     1 kQl
   703   430    80    34 aENRAELEKERIALSKKLTLSVKTEREEAQDKKIEe
   704    23    39     1 aKi
   704    42    59     1 nAv
   704    43    61     1 vNl
   704   127   146     2 sSVr
   704   130   151     2 dFQf
   704   131   154     1 fQq
   704   196   220     2 gSIn
   704   264   290    43 sLPRAIQESNKANQTFLTPNTPSPYGNYNLTQSPYSRHQSTASIs
   704   268   337     5 lNSAIDs
   705   427    76     1 kQi
   705   430    80    34 nEKRAEQEKERIELMKKLTLTCRSTLDDEREKMLEt
   706   427    72     1 kQl
   706   430    76    34 nEQRIEQQKEMEKLIKKLSMTCKSHLEEEADKQKQk
   706   431   111     5 kELQDKl
   707    23    55     1 gKi
   707   127   160     2 rDNr
   707   130   165     1 qQn
   707   195   231     9 gRYGHNFITGg
   707   258   303    54 sFSDGLLQQHQLQQQHHPHPHSHAYSRIQKNRYGSSSSSTSSYPIVKTPQSLNFKe
   707   262   361     1 iEd
   708    20    49     1 sVk
   708    42    72     1 nSc
   708    43    74     1 cNl
   708   129   161     1 tSn
   708   139   172    21 gTYQMQGNFYQSIQSIFKGHTAy
   708   186   240     2 sTFp
   708   192   248     2 sANl
   708   260   318    58 sLSSELRNKQNLLHLTIPSPVDERYMKRFGNTTSQTYDEQSTSLLHSNGSSSGNIDQYSv
   708   264   380     5 lQSVIEn
   708   302   423     1 iIg
   709   427    80     1 kQl
   709   430    84    34 aEKRESQEKERLQLINKLSLTCRSALDEEKEKLNEt
   711   427    67     1 qQl
   711   430    71    34 nEKREEQERERLQLIQKLSLTCKSELEQPQAGAAEq
   712   427    72     1 rQl
   712   430    76    34 sERREEQERERLQLIKKLSLTCRSELEAEKKSKEEe
   713    20    49     1 sVk
   713    42    72     1 nSc
   713    43    74     1 cNl
   713   129   161     1 tSn
   713   139   172    21 gTYQMQGNFYQSIQSIFKGHTAy
   713   186   240     2 sTFp
   713   192   248     2 sANl
   713   260   318    58 sLSSELRNKQNLLHLTIPSPADERYMKRFGNTTAQTYDEQSTSLLHSNGSSSGNIDQYSv
   713   264   380     5 lQSVIEn
   713   302   423     1 iIg
   714    19    34     2 nIRs
   714    40    57     1 dRl
   714    41    59     1 lNl
   714   125   144     7 pRNYQYGAh
   714   128   154     2 qYQt
   714   129   157     1 tSi
   714   186   215     4 aKFSDt
   714   192   225     2 eSPi
   714   260   295    38 sLSANLHKLDLNNLRPSVSRSYPESPTDQISRVQSTNSSy
   714   296   369     1 nIv
   714   300   374     1 lGm
   715   428    74     1 kQl
   715   431    78    34 tEKREEQEIERMELAKKLSVSCRSQSDEQREKDKDq
   716    15    21    12 kARGDARILYTELg
   716    19    37     2 qRRv
   716    38    58     1 sDv
   716    39    60     1 vNl
   716   123   145     4 nDTMEs
   716   137   163    11 sRVQSVFKGHTAy
   716   184   221     1 aAf
   716   190   228     1 eSq
   716   257   296    29 sLQSQSQVSAPVAARYRRRPVSTGSDNHSSn
   716   261   329     1 lDs
   716   299   368     1 vMt
   717   415    70     1 nTg
   717   428    84     1 kQl
   717   431    88    34 aERREETERQRLALAKKLSMTTATAAEDEERKRQEe
   717   432   123     4 eLDAEf
   718   427    76     1 kQl
   718   430    80    34 sEKREQQEKERLQLIKKLSLTCKSDLDTEKRQKEKe
   718   431   115     2 eAAl
   719   427    86     1 kQl
   719   430    90    34 iERDMGKENERLGLMKKLCITAKTVAEDRKQIEQDe
   719   464   158     1 qQk
   719   565   260     1 gGd
   720   427    70     1 kQl
   720   430    74    34 nEKRAEDESEKIALMKKLTLTVQSALDEEREKAALe
   721   426    97     1 kQl
   721   429   101    34 aERREQDDAEKLRLLKKLSITAQTKEEDEKAAAMSe
   721   461   167     1 rKg
   722     8    14    12 aAQYQARTLYNDIl
   722    12    30     2 kTHt
   722    31    51     1 nSc
   722    32    53     1 cTl
   722   118   140     2 tITn
   722   125   149    21 gGNQPNQGIYQKVESVFKGHTAy
   722   172   217     2 aIFp
   722   178   225     2 nANv
   722   246   295    32 nLLAQLQTPGGKISQTFLTRLDDSEWMNSNTSIn
   722   250   331     1 iEn
   722   282   364     1 kNe
   722   284   367     2 iVDs
   723   427    77     1 kEl
   723   430    81    34 aQNREELAKERIALAKKLTMTVKTVQEEDKEKEIDe
   723   431   116     4 eLEDEl
   724   420    62     1 kKl
   724   423    66    10 fEKKEEAETKRk
   724   424    77     2 kEIl
   724   426    81     2 qKHs
   724   465   122     1 kWa
   724   471   129     1 gKv
   725   428    71     1 kRl
   725   431    75    34 tERRAEQEKEKQALAKKLSMTCRSHLDDEREKENDd
   726   415    70     2 tNTg
   726   428    85     1 kQl
   726   431    89    34 aERREETERQRLDMAKKLTMTTTTSAEDEERKRQEe
   727   415    72     1 nTg
   727   428    86     1 kQl
   727   431    90    34 aERREETERQRLALAKKLSMTTTTSAEDEERKRQEe
   727   432   125     4 eLDAEf
   728   415    69     3 sTNTg
   728   428    85     1 kQl
   728   431    89    34 nERRDETERQRIALAKKLSMTTATAAEDEERKRQEe
   728   432   124     4 eLDAEf
   729   427    60    11 kRQQSAQRIQREk
   729   428    72     5 kDVLKQi
   730   427    85     1 kKl
   730   430    89    34 aEKREENERQRIELAKKLTMTTATAQEEEERKRQEe
   731   413     7     1 kQl
   731   416    11    34 aEKRELQEREKLQLIKKLSLTCRSALDEEKEKLNEt
   732   427    77     1 kQm
   732   430    81    13 cKEDLERDKKLVEAa
   732   431    95     2 aKRl
   732   433    99     2 cIIq
   732   472   140     2 qNSa
   733   420    75     9 hNEQKQQQKAk
   733   421    85     4 kFQEMi
   734   420    62     9 hNEQKQQQKAk
   734   421    72     4 kFQEMi
   735   420    74     9 hNEQKQQQKAk
   735   421    84     4 kFQEMi
   736   421    62     8 nEQKQQQKAk
   736   422    71     4 kFQEMi
   738   420    79     1 kQl
   738   423    83    34 tEKRGDQDREKRLLAEKLSMTCRSYLDDEKAKEDEe
   738   457   151     1 nSp
   739    42    85     1 nSc
   739    43    87     1 cKl
   739   127   172     8 sDTSNNPVSv
   739   142   195    14 gFFQSVQSIFKGHTAy
   739   189   256     2 tVFp
   739   195   264     2 sDNl
   739   263   334    58 sLNSEIRNMQALHEKGMGQISPTMPLDRKTYTFGNSYSMLTPSSAPVNASLASSDGLSIs
   739   267   396     4 nSTLEs
   739   305   438     1 tLg
   741    19    41     2 hLKq
   741    40    64     1 nSc
   741    41    66     1 cNl
   741   127   153     1 tSn
   741   140   167    19 pMQGINFYQSIQSIFKGHTAy
   741   187   233     2 tTFp
   741   193   241     2 sNNl
   741   261   311    58 sLSQELKNGQSLPELAVQDESESRSHKLFHQKSPLLHRRNNSSGNWNGNASYDQYSIISn
   741   265   373     3 sVLEn
   741   303   414     1 tIg
   742   427    72     1 kQl
   742   430    76    34 sAKRTESGKEMVELAKKLTMTVRTTLEDEREQAALe
   743   426    91     1 kQl
   743   429    95    34 aERREQDEMEKVRLLKKLSITARTKEEDKAAEAMNe
   743   461   161     1 kKg
   744   415    65     1 nTg
   744   428    79     1 kQl
   744   431    83    34 aERRDETERQRLALAKKLSMTTSTAAEDEERKRQEe
   745   415    66     1 nTg
   745   428    80     1 kQl
   745   431    84    34 aERRDETERQRLALAKKLTITTTTSAEDEERKRQEe
   745   432   119     4 eLDAEl
   746   415    66     1 nTg
   746   428    80     1 kQl
   746   431    84    34 aERRDETERQRLALAKKLTITTTTSAEDEERKRQEe
   746   432   119     4 eLDAEl
   747   415    66     1 nTg
   747   428    80     1 kQl
   747   431    84    34 aERRDETERQRLALAKKLTITTATSAEDEERKRQEe
   747   432   119     4 eLDAEl
   748   415    66     1 nTg
   748   428    80     1 kQl
   748   431    84    34 aERRDETERQRLALAKKLTITATTSAEDEERKRQEe
   748   432   119     4 eLDAEl
   749   415    66     1 nTg
   749   428    80     1 kQl
   749   431    84    34 aERRDETERQRLALAKKLTITATTSAEDEERKRQEe
   749   432   119     4 eLDAEl
   750   415    66     1 nTg
   750   428    80     1 kQl
   750   431    84    34 aERRDETERQRLALAKKLSMTTATTAEDEERKRQEe
   751   427    72     1 kQi
   751   430    76    34 sEQRMEREREKLELIERLAFTCRSDLDQEKEEDPEl
   752   422    67     1 kRl
   752   425    71    34 yEKREEEEKKRDEILKKLSLTCDPNAGEDGVDNEDk
   752   447   127     1 kWv
   752   453   134     1 gKv
   753   420    68     1 kKl
   753   423    72    34 sRRNAEKERKVVEYAKQHSLSCRPYSEDVKEDEHTh
   753   455   138     1 sLp
   754   420    72     1 kAl
   754   423    76    17 rLKEAQKEQELIEAAKKNt
   754   424    94     4 tLTSQt
   754   426   100     2 hVCf
   754   464   140     1 rLp
   755   427    79     1 kQl
   755   430    83    34 tEKKESQEREKLDLIKKLSITSRTVAEDEKAKEQEq
   755   431   118     4 qLDEEl
//